COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..3651348 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(32..1571) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA complement(1862..1972) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA complement(2065..4968) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 tRNA complement(5162..5237) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 rRNA complement(5322..6859) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 rRNA complement(7150..7260) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA complement(7354..10257) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 tRNA complement(10450..10525) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 rRNA complement(10610..12147) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 CDS 12656..13213 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174588.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(13186..13455) product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070570.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(13452..14267) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451217.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene aroE CDS complement(14271..14843) product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361937.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene tsaC CDS complement(14848..15408) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369441.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(15446..15916) product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene smg CDS complement(15888..17000) product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209022.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene dprA CDS 17124..17639 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209021.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene def CDS 17658..18605 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004443.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene fmt CDS 18747..20039 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817317.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene rsmB CDS 20092..21468 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209018.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene trkA CDS 21477..22922 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421530.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 22988..23404 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174607.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene mscL CDS complement(23450..23914) product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369432.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene zntR CDS complement(23917..24291) product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(24410..24796) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216372.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene rplQ CDS complement(24837..25826) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209013.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene rpoA CDS complement(25852..26472) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene rpsD CDS complement(26503..26892) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029684.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene rpsK CDS complement(26909..27265) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004702348.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene rpsM CDS complement(27562..28893) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118861.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene secY CDS complement(28901..29335) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391411.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene rplO CDS complement(29339..29518) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140433.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene rpmD CDS complement(29525..30025) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703641.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene rpsE CDS complement(30040..30393) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358956.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene rplR CDS complement(30403..30936) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091939.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene rplF CDS complement(30949..31341) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174622.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene rpsH CDS complement(31375..31680) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118932.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene rpsN CDS complement(31694..32233) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096200.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene rplE CDS complement(32248..32562) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729185.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene rplX CDS complement(32574..32945) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613955.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene rplN CDS complement(33111..33365) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130100.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene rpsQ CDS complement(33365..33556) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644741.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene rpmC CDS complement(33556..33966) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941212.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene rplP CDS complement(33979..34680) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene rpsC CDS complement(34698..35030) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447529.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene rplV CDS complement(35045..35323) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138117.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene rpsS CDS complement(35338..36162) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213425.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene rplB CDS complement(36182..36484) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617544.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene rplW CDS complement(36481..37086) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174626.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene rplD CDS complement(37097..37726) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863274.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene rplC CDS complement(37759..38070) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene rpsJ CDS complement(38362..39546) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368828.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene tuf CDS complement(39616..41724) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124703.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene fusA CDS complement(41820..42290) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138043.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene rpsG CDS complement(42387..42761) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene rpsL CDS complement(42928..43218) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903373.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene tusB CDS complement(43236..43595) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820731.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene tusC CDS complement(43613..43987) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209706.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene tusD CDS complement(43991..44707) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091471.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(44918..45745) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369412.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene fkpA CDS 46033..46266 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703644.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(46330..46983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(47091..47279) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007729.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(47276..49099) product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212314.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene kefB CDS complement(49089..49649) product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081510.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene kefG CDS 49810..51735 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634756.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(51750..52928) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174672.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 53151..53726 product aminodeoxychorismate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174674.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(53788..54354) product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817336.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene ppiA CDS 54774..55958 product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817338.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene tsgA CDS complement(56031..57314) product cytosine/isoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295686.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene codA CDS complement(57304..58554) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076253.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene codB CDS 58829..60226 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208890.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene cysG CDS complement(60279..61283) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165543.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene trpS CDS complement(61308..61994) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208892.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(61987..62664) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174695.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene rpe CDS complement(62704..63522) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208895.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene dam CDS complement(63614..64651) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817345.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(64712..65797) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439848.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene aroB CDS complement(65838..66356) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391482.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene aroK CDS complement(66681..67820) product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene hofQ CDS complement(68191..68661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(68654..69169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(69157..69984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 70103..72667 product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817350.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene mrcA CDS complement(72779..73432) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519362.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene nudE CDS 73885..75903 product intracellular growth attenuator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208908.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 75980..76681 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520508.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene yrfG CDS 76678..77094 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159667.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene hslR CDS 77118..77999 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135575.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene hslO CDS 78231..78869 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309532.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 78879..79667 product thiosulfate reductase cytochrome B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092553.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 79756..81777 product dissimilatory sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070829.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene sirA CDS 81867..82307 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070830.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 82498..84117 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361659.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene pckA CDS complement(84218..85603) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174760.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene envZ CDS complement(85600..86319) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene ompR CDS 86668..87144 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856744.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene greB CDS 87256..89583 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980764.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(89722..89910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 90202..90483 product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene feoA CDS 90588..92903 product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208919.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene feoB CDS 92925..93170 product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099093.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene feoC CDS complement(93217..93996) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998145.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene bioH CDS 94002..94229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 94325..94720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 94779..95354 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099096.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene nfuA CDS complement(95507..97579) product YccS/YhfK family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012135464.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(97638..98270) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242755.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene crp CDS complement(98621..98845) product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369405.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(98842..99825) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212302.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 99925..100539 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174663.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(100547..103261) product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817355.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene malT CDS 103727..106132 product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817356.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene malP CDS 106142..108235 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817357.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene malQ CDS 108710..110026 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene glgC CDS 110255..112465 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene glgB CDS 112449..114428 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174773.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene glgX CDS 114483..115763 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817364.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene glgC CDS 115804..117234 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817363.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene glgA CDS 117388..119838 product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817362.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene glgP CDS complement(119892..121379) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174768.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene glpD CDS complement(121764..122522) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(122585..123415) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174723.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene glpG CDS complement(123455..123784) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694416.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene glpE CDS 124057..124353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(124404..125153) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211524.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene ugpQ CDS complement(125150..126244) product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211523.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(126269..127114) product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211522.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene ugpE CDS complement(127114..127998) product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211521.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene ugpA CDS complement(128066..129385) product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624747.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene ugpB CDS 129659..130051 product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211507.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene panM CDS complement(130048..131184) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209537.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(131200..132465) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209536.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(132616..133740) product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209535.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(133834..134688) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211506.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene rpoH CDS complement(134994..135956) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084329.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene ftsX CDS complement(135946..136617) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene ftsE CDS complement(136623..138260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 138606..139220 product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883606.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene rsmD CDS 139207..139482 product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(139496..139849) product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(139846..140166) product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211499.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 140432..141058 product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176373.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(141096..141770) product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817439.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene yiiM CDS complement(141837..142661) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848310.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene fdhD CDS 143100..146084 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830448.1 transl_table 11 codon_start 1 transl_except (pos:143619..143621,aa:Sec) note codon on position 174 is selenocysteine opal codon. locus_tag LOCUS_01380 gene fdnG CDS 146103..147053 product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817434.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene fdxH CDS 147040..147690 product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705520.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene fdnI CDS 147780..148706 product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161934.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene fdhE CDS complement(148785..149591) product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176120.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene yigL CDS complement(149608..150642) product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211487.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene pldB CDS 150916..152019 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038629675.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene asd CDS complement(152016..153755) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174778.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(154042..154227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 154552..157263 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050122726.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene mgtA CDS 157585..159039 product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157393.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene pitA CDS complement(159159..160508) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707340.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(160744..161079) product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703743.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene uspB CDS 161693..162130 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004145166.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene uspA CDS 162392..163867 product dipeptide/tripeptide permease DtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098647.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene dtpB CDS 164045..165391 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097043.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene gdhA CDS complement(165420..166883) product histidine kinase dimerization/phospho-acceptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419005.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(166880..167593) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704857.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 168114..169106 product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210043.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 169232..170728 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210044.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 170721..171710 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210045.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 171712..172665 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210046.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 172682..174319 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210047.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 174316..174933 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210048.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(174915..175664) product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene rsmJ CDS complement(175664..177712) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157382.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene prlC CDS complement(177909..178307) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128238.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 178542..179384 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954235.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 179577..180929 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209534.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene gorA CDS complement(181015..182586) product methyl-accepting chemotaxis citrate transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789682.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(182867..183253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 183494..184600 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413693.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene ddlA CDS complement(184656..185243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(185790..186683) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027274180.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 186967..187740 product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050163392.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(187737..188510) product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209547.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene pdeH CDS 188797..189690 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209549.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(189753..191270) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209550.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(191496..192776) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099213.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(192996..194972) product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209560.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene hmsP CDS complement(195256..198777) product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817392.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene bcsC CDS complement(198759..199883) product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817393.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene bcsZ CDS complement(199888..202035) product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018077.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene bcsB CDS 201959..202300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(202297..204867) product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275344.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene bcsA CDS complement(204864..205613) product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174891.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene bcsQ CDS complement(205619..205810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 205991..207547 product cellulose biosynthesis c-di-GMP-binding protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099221.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene bcsE CDS 207761..209416 product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174899.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene bcsG CDS complement(209459..210469) product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107027.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene dppF CDS complement(210466..211446) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196486.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene dppD CDS complement(211458..212381) product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174904.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene dppC CDS complement(212393..213412) product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228714.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene dppB CDS complement(213562..215190) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817398.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 215756..216253 product YbaK/prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989016.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 tRNA complement(216344..216420) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(216560..216636) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(216831..218177) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174929.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(218283..219815) product signal transduction histidine-protein kinase/phosphatase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817402.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene uhpB CDS complement(219815..220405) product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209570.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene uhpA CDS complement(220489..222045) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815441.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(222249..223058) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095814.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene proC CDS complement(223362..223892) product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890634.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene idi CDS complement(224213..224926) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217076.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(225834..226262) product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082296.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene uspF CDS 226907..227053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(227434..227778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(227974..228282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(228566..228913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(230237..231982) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064619.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(232020..233642) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225752.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(234173..234343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 note possible pseudo, frameshifted tRNA complement(234464..234558) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(234641..237079) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815295.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(237083..238243) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815294.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene metB CDS 238537..238857 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852811.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene metJ CDS complement(239033..239188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 239869..240132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(240469..240681) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715284.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene rpmE CDS 240883..243078 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208938.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene priA CDS 243357..244376 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815292.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene cytR CDS 244548..245399 product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815291.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene ftsN CDS 245487..246017 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368930.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene hslV CDS 246030..247361 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175854.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene hslU CDS 247543..248460 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 248568..249053 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872908.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene rraA CDS complement(249117..249359) product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392238.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene zapB CDS 249847..250689 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208954.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 250765..252273 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175870.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene glpK CDS 252434..253444 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815289.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene glpX CDS complement(253520..254704) product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815288.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene emrD CDS 255011..255631 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859357.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 255639..256385 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796322.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene fpr CDS complement(256423..256854) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208957.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 257015..257665 product DUF1454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046049972.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 257781..258548 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216325.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene tpiA CDS complement(258711..259673) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099327.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene pfkA CDS complement(259968..260870) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815283.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene fieF CDS complement(261201..262070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(262582..262833) product ogr/Delta-like zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488099.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(262879..264003) product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132828.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 264156..265355 product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005414.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 265356..265871 product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290456.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 265920..266336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 266442..269459 product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390260.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 269472..269963 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979955.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(270331..270912) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904922.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 270962..271876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 271876..272403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(272435..272785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(272782..274551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(274541..275155) product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071739.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(275148..276044) product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111965.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(276054..276398) product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213447.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(276395..276976) product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077826354.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(276973..277617) product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356347.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(277610..278077) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921128.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(278192..278632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(278629..279174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(279158..279451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(279442..279642) product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864897.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(279642..280136) product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063103.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(280237..281028) product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632318.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene gpM CDS complement(281080..282132) product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055094.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(282157..282990) product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262665.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 283150..284880 product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613796.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 284886..285929 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087812.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(285996..286499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 287018..287428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 287499..287816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(287933..288112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(288173..290623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(290627..291088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(291163..291423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(291737..292564) product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104152.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(292561..292773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(292760..293062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(293059..293583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(293568..293810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(293889..294062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(294220..294486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(294600..294881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(294991..295398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 295336..295746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(295761..295997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 296110..296430 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167470777.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 296500..297480 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815648.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(297672..298151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 298302..299000 product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862004.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene cpxR CDS 298997..300385 product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175902.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene cpxA CDS 300428..300901 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094923.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene trmL CDS complement(300959..301780) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815280.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene cysE CDS complement(302072..303088) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208975.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene gpsA CDS complement(303088..303549) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003370.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene secB CDS complement(303605..303853) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208977.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene grxC CDS complement(303878..304315) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815278.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 304688..306232 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208979.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene gpmM CDS 306242..307594 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815277.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene envC CDS 307633..308565 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815276.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 308779..309399 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176012.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 309520..310143 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046966.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene gmk CDS 310198..310473 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene rpoZ CDS 310493..312586 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176016.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene spoT CDS 312592..313284 product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369142.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene trmH CDS 313286..315367 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176019.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene recG CDS complement(315382..316596) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209005.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene gltS CDS 316797..318233 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815268.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 318477..320147 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602586.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(320222..320797) product phage sensitivity protein DcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245296.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene dcrB CDS complement(320874..321326) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908388.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(321439..322095) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211495.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 322319..322567 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215973.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene tusA CDS complement(322601..323260) product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369222.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(323418..323942) product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458690.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(324139..324645) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209627.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(324605..325195) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209626.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 325408..326316 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene glyQ CDS 326326..328395 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703776.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene glyS CDS 328530..329249 product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175086.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(329348..330616) product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175114.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(330811..331275) product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209635.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene ibpB CDS complement(331381..331794) product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209636.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene ibpA CDS 332075..332425 product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175118.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(332433..333731) product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817455.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(333812..334630) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209641.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene yidA CDS complement(334720..337134) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209642.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene gyrB CDS complement(337178..338275) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209643.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene recF CDS complement(338337..339437) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500170.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene dnaN CDS complement(339462..340784) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161100.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene dnaA CDS complement(341198..341440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 341772..342098 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228153.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene rnpA CDS 342318..343943 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817459.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene yidC CDS 344053..345420 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282349.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene mnmE CDS 345582..346721 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107182.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(346880..347680) product replication protein C, IncQ-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240536.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene repC CDS complement(347706..348410) product helicase RepA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880559.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(348565..348900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 349253..349483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(349665..350222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 note possible pseudo, internal stop codon, frameshifted CDS complement(350348..350743) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636379.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 350780..351193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 note possible pseudo, internal stop codon CDS complement(351404..354127) product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117924.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(354131..356977) product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459048.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(356977..357564) product DUF3780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117920.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(357561..360629) product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117919.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 361327..361482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(361600..361773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(362224..362817) product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704977.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene smrA CDS complement(362814..363470) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300395.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 363709..364446 product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190678.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(364523..365860) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215577.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 366071..367846 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065684.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene adeD CDS 367910..368581 product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175148.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene yieH CDS complement(368652..369374) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817472.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene phoU CDS complement(369392..370171) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215562.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene pstB CDS complement(370217..371104) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212190.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene pstA CDS complement(371106..372077) product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215558.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene pstC CDS complement(372138..373178) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369012.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene pstS CDS 373528..374364 product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816143.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(374433..376262) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215552.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene glmS CDS complement(376476..377846) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175168.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene glmU CDS complement(378127..378546) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024912932.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(378566..379948) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190499.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene atpD CDS complement(379983..380846) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817476.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene atpG CDS complement(380909..382450) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161175.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene atpA CDS complement(382463..382996) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288957.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene atpH CDS complement(383011..383481) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004107293.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene atpF CDS complement(383539..383778) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene atpE CDS complement(383830..384648) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135632.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene atpB CDS complement(384689..385066) product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161181.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene atpI CDS complement(385717..386337) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212261.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene rsmG CDS complement(386435..388324) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499788.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene mnmG CDS 388576..388731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(388721..389164) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212258.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene mioC CDS complement(389267..389728) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161192.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene asnC CDS 389883..390875 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212256.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene asnA CDS complement(390887..392341) product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212255.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene viaA CDS complement(392343..393857) product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212254.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene ravA CDS 394118..395986 product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175182.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene kup CDS 396183..396602 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715950.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene rbsD CDS 396610..398115 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099396.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene rbsA CDS 398122..399102 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368991.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene rbsC CDS 399126..400013 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene rbsB CDS 400087..401016 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815255.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene rbsK CDS 401023..402030 product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175187.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene rbsR CDS complement(402021..403442) product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815256.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene mdtD CDS complement(403461..404153) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175190.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 rRNA 404646..406185 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 tRNA 406260..406336 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 406391..406466 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 rRNA 406631..409534 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 rRNA 409627..409737 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 tRNA 409755..409830 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 rRNA 409867..409977 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 CDS complement(410101..410628) product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175770.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene mobB CDS complement(410625..411209) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213171.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene mobA CDS 411380..411649 product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175764.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 411654..412640 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213169.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 412671..413294 product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213168.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene dsbA CDS complement(413350..414060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 414717..417509 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175760.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene polA CDS complement(417964..418620) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213160.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene yihA CDS 419272..419796 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350037.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene yihI CDS 419983..421356 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003520.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene hemN CDS complement(421439..423097) product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209634.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(423572..424993) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175753.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene glnG CDS complement(425024..426091) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213151.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene glnL CDS complement(426320..427729) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392048.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene glnA CDS 428100..429920 product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene typA CDS 430126..430722 product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175743.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene yihX CDS 430831..431709 product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209010.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 431725..432162 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560978.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene dtd CDS complement(432214..433344) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097422.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(433613..434170) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 434339..434926 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261712.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 435145..436035 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007523.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene metF CDS complement(436238..438871) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209491.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene ppc CDS complement(439106..440257) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099301.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene argE CDS 440462..441484 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209489.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene argC CDS 441515..442288 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001575262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene argB CDS 442334..443548 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049171.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 443627..445000 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230102.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene argH CDS complement(445079..446527) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815311.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(446622..447101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 447489..448412 product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176059.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene oxyR CDS complement(448395..449795) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176056.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene sthA CDS 450046..450723 product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209476.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene fabR CDS 450732..451127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(451179..452279) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368905.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene trmA CDS complement(452780..453859) product porin OmpS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096462.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 454268..454876 product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703386.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene aphA CDS 454904..455728 product lipoprotein e(P4) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061724415.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene hel CDS 456180..457892 product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815316.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene btuB CDS 457918..458700 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228171.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene murI rRNA 459088..460627 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 tRNA 460712..460787 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 rRNA 460980..463883 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00130 rRNA 463977..464087 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00140 tRNA 464138..464214 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 464223..464298 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(464484..465320) product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212020.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene hdfR CDS 465440..465778 product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene maoP CDS complement(465981..466844) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094887.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 466977..467690 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175960.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene rph CDS 467776..468417 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844529.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene pyrE CDS complement(468456..469052) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004714376.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene slmA CDS complement(469165..469623) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077682.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene dut CDS complement(469601..470818) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175628128.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene coaBC CDS 471004..471687 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175951.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene radC CDS 471927..472163 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164747.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene rpmB CDS 472175..472342 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051798.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene rpmG CDS 472441..473250 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208989.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene mutM CDS complement(473247..473732) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703808.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene coaD CDS complement(473729..474505) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094896.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(474509..475783) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094897.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene waaA CDS complement(475958..477052) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703805.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(477053..478180) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703804.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(478177..479253) product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703803.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene rfaQ CDS 479384..480355 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703802.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(480417..481679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(481823..482929) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(484160..485098) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094904.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(485106..486068) product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264548.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene rfaC CDS complement(486056..487132) product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208984.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene rfaF CDS complement(487156..488085) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208983.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene rfaD CDS 488392..489588 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175931.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene kbl CDS 489598..490623 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208981.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene tdh CDS complement(490689..492209) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212018.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 492498..493712 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705367.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 494101..495750 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212017.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene ilvG CDS 495747..496037 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212016.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene ilvM CDS 496087..497016 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807980.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 497134..498987 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene ilvD CDS 498987..500531 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176085.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene ilvA CDS complement(500563..501462) product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176081.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene ilvY CDS 501658..503136 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176079.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene ilvC CDS complement(503165..503446) product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004704164.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene ppiC CDS 503645..505666 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099281.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene rep CDS complement(505705..507207) product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077605.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene gppA CDS complement(507213..508502) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047525.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene rhlB CDS 508649..508975 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene trxA CDS 509407..510666 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054532.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene rho CDS 510947..512035 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176219.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene wecA CDS 512066..513106 product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene wzzE CDS 513187..514317 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176215.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene wecB CDS 514314..515576 product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211985.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene wecC CDS 515567..516637 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848110.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene rffG CDS 516906..517787 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211983.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene rfbA CDS 517765..518460 product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848112.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene rffC CDS 518480..519610 product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099273.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene rffA CDS 519610..520860 product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211980.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene wzxE CDS 520857..521936 product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211979.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 521933..523312 product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815334.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene wzyE CDS 523302..524042 product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176198.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene wecG tRNA 524205..524281 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 524339..524414 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 524429..524515 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 524540..524616 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(525239..526438) product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815337.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene hemY CDS complement(526441..527622) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176188.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene hemX CDS complement(527625..528371) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026069.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene hemD CDS complement(528378..529331) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene hemC CDS 529633..532182 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281718.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene cyaA CDS complement(532191..532517) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815340.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene cyaY CDS 532595..532804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 532862..533686 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176172.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene dapF CDS 533700..534404 product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211472.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 534401..535312 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211473.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene xerC CDS 535312..536028 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211474.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene yigB CDS 536106..538268 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383407.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene uvrD CDS 538600..539550 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166238.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene corA CDS 539663..540718 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122050.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(540707..541597) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339103.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene rarD CDS 541840..542739 product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815346.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene pldA CDS 542835..544634 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815347.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene recQ CDS 544846..545454 product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176129.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene rhtC CDS complement(545622..545849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(546037..546219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167337863.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(546273..547610) product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369340.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene gntU CDS complement(547622..548152) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420757.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene gntK CDS complement(548357..549337) product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730239.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene gntR CDS 549582..551894 product zinc/cadmium/mercury/lead-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815354.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 552024..553079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703898.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 553079..554212 product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703897.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 554212..555345 product DUF4056 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259271.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 555418..556353 product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215597.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 557350..559635 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176312.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene metE CDS complement(559683..560450) product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045169.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene udp CDS 560819..562627 product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211530.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 562741..563268 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211531.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 563377..564903 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084315.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene rmuC CDS 564917..565672 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165601.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene ubiE CDS 565688..566293 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368846.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 566290..567921 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815371.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene ubiB CDS 568032..568301 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165598.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene tatA CDS 568305..568841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 568831..569625 product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815373.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene tatC CDS 569715..570497 product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815374.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene tatD CDS 570513..571535 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815375.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene hemB CDS complement(571589..572080) product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192407.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene rfaH CDS 572330..573055 product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707065.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene pepE CDS 573137..574675 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215917.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene ubiD CDS 574713..575414 product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215918.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene fre CDS 575615..576946 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444546.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene pepQ CDS 576946..577563 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295262.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 577613..579064 product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211550.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene trkH CDS 579082..579630 product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene hemG rRNA 580009..581548 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00150 tRNA 581623..581699 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 581754..581829 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 rRNA 581993..584896 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00160 rRNA 584990..585100 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00170 CDS 585299..586336 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099225.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene murB CDS 586333..587292 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655746.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene birA CDS complement(587352..588299) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212290.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene coaA tRNA 588729..588804 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 588826..588910 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 589035..589109 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 589117..589192 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 589320..590504 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368828.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene tuf CDS 590800..591183 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094999.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene secE CDS 591185..591730 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287521.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene nusG CDS 591894..592322 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085926.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene rplK CDS 592326..593030 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096676.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene rplA CDS 593351..593848 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207203.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene rplJ CDS 593915..594283 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095002.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene rplL CDS 594614..598642 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263098.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene rpoB CDS 598722..602942 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653953.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene rpoC CDS complement(603060..604988) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298956.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene thiC CDS 605363..606142 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166081.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene nudC CDS 606190..607254 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137653.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene hemE CDS 607271..607954 product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704015.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene nfi CDS 608054..608644 product DUF416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166074.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 608834..609106 product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166072.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene hupA CDS 609147..609812 product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175673.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(609859..611142) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175672.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene purD CDS complement(611188..612777) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210692.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene purH rRNA 613342..614881 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00180 tRNA 614966..615041 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 rRNA 615234..618137 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00190 rRNA 618231..618341 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00200 CDS complement(618422..618991) product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815537.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene satP CDS complement(619070..621025) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209031.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene acs CDS 621506..622825 product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175646.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene gltP CDS complement(622904..624328) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735278.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene tolC CDS 624544..625176 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212184.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene nudF CDS 625555..626382 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817215.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene cpdA CDS 626382..626966 product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105725.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene yqiA CDS 627071..628966 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817213.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene parE CDS 629152..631428 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212178.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene parC CDS 631518..632261 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369660.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene plsC CDS 632307..633728 product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817210.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene ftsP CDS 633999..637682 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095026.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene metH CDS complement(637728..639089) product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212084.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene lysC CDS 639918..641567 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212085.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene pgi CDS complement(641638..642885) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948301.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 643129..643536 product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705335.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene psiE CDS complement(643608..644498) product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212087.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene malG CDS complement(644513..646084) product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212088.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene malF CDS complement(646224..647417) product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695381.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene malE CDS 647910..649019 product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212091.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene malK CDS 649154..650425 product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212092.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 650535..651461 product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212093.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene malM CDS 651951..652457 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817301.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene ubiC CDS 652495..653346 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817300.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene ubiA CDS 653641..655317 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105432.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(655369..657825) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174551.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene plsB CDS 657951..658319 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368764.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(658406..659863) product citrate/succinate antiporter CitT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050328.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene citT CDS complement(659893..660807) product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982670.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene citG CDS complement(660782..661333) product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236063.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene citX CDS complement(661337..662857) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192347.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene citF CDS complement(662868..663764) product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309339.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene citE CDS complement(663761..664060) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700679.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene citD CDS complement(664057..665133) product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467705.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene citC CDS 665529..667163 product sensor histidine kinase DpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121811.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene dpiB CDS 667156..667842 product two-component response regulator DpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138786.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene dpiA CDS 667973..668581 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004704739.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene lexA CDS 668721..670055 product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704041.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene dinF CDS complement(670077..670553) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214647.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene zur CDS 671020..671730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(671796..672008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 671892..672929 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182236.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene dusA CDS 673149..673367 product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165239.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene pspG CDS 673724..674110 product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172296.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 674290..675702 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209095.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene dnaB CDS 675842..676933 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174405.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene alr CDS complement(676996..678153) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene yqhD CDS 678363..679274 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707745.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 679330..680619 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072953.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(680695..681327) product adhesin/invasin protein PagN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787614.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene pagN CDS 682231..683154 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475254.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 683266..683793 product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167260.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(683837..684517) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096512.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene narI CDS complement(684528..685175) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571699.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene narJ CDS complement(685179..686699) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702660.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene narH CDS complement(686726..690397) product nitrate reductase Z subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602346.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene narZ CDS complement(690416..691798) product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096516.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 692972..694426 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366800.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 694658..695560 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817228.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene murQ tRNA complement(696112..696187) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 697109..699271 product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817119.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene speF CDS 699366..700685 product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173672.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene potE CDS 700813..701262 product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083525.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene nikR CDS complement(701273..702364) product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098675.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene mltC CDS complement(702400..702672) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817051.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(702675..703763) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847823.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene mutY CDS 704017..704745 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173629.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene trmB CDS 704745..705071 product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209990.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 705270..706196 product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209989.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene glsB CDS 706207..706935 product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817048.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 707062..708690 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097243.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(708740..709870) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene hemW CDS complement(709863..710456) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174735.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(710542..710832) product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173614.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene yggU CDS complement(710829..711383) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157142.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(711481..712191) product pyridoxal phosphate homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997795.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene yggS CDS complement(712385..712807) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157116.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene ruvX CDS complement(712807..713331) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817044.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(713582..714532) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173586.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene gshB CDS complement(714565..715296) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene rsmE CDS complement(715402..716121) product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173574.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene endA CDS complement(716242..716769) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173572.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 717157..718476 product cadaverine/lysine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367859.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene cadB CDS 718550..720700 product lysine decarboxylase CadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100652.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene cadA CDS 720826..721314 product IS200/IS605-like element IS1004 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503164.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene tnpA CDS complement(721466..722626) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160795.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(722630..723301) product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357252.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(723521..724258) product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001308912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene fucR CDS complement(724313..724735) product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920848.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene fucU CDS complement(724729..726192) product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808376.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene fucK CDS complement(726240..728021) product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724159.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene fucI CDS complement(728105..729409) product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039140.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene fucP CDS 730426..731073 product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440772.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene fucA CDS 731084..732232 product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene fucO CDS complement(732298..732867) product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210400.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 733381..734298 product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366502.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(734506..735165) product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595416.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene torD CDS complement(735162..737708) product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790669.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene torA CDS complement(737721..738878) product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230247.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene torC CDS 739016..739705 product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120117.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene torR CDS complement(739716..740762) product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264948.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene torT CDS 740842..743640 product TMAO reductase system sensor histidine kinase/response regulator TorS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300633.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene torS CDS complement(744017..745660) product alpha-keto acid decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 tRNA complement(746206..746281) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 746780..747421 product YfdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825597.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(747490..748065) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175574.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(748077..749834) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209121.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(749810..750178) product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849537.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene cutA CDS complement(750306..751607) product anaerobic C4-dicarboxylate transporter DcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961957.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene dcuA CDS complement(751721..753157) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175569.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene aspA CDS 753522..753995 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267291.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene fxsA CDS 754253..754546 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209127.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 754606..756249 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729117.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene groL CDS 756505..756852 product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209129.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(756971..757669) product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069255.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 note possible pseudo, frameshifted CDS complement(757666..759087) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023919.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(759098..759817) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102123.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(759866..761419) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948686.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(761701..762729) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228125.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene epmB CDS 762772..763338 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257282.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene efp CDS 763528..763845 product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156471.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene sugE CDS complement(763900..764256) product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209134.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene frdD CDS complement(764272..764670) product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175556.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene frdC CDS complement(764687..765421) product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175554.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(765414..767213) product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815417.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene frdA CDS 767635..768612 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004789.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene epmA CDS complement(768676..771993) product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080723.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene mscM CDS complement(772052..772945) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209141.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene asd CDS complement(773084..774043) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041976.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene rsgA CDS 774279..774824 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095280.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene orn tRNA 774997..775072 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 775120..775195 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 775247..775322 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 775374..775449 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(775743..776885) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815421.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene queG CDS 776884..778380 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418520.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene nnr CDS 778411..778875 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209146.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene tsaE CDS 778899..780557 product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene amiB CDS 780574..782523 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209148.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene mutL CDS 782520..783473 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175510.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene miaA CDS 783638..783949 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368633.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene hfq CDS 784048..785328 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704170.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene hflX CDS 785387..786643 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209154.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene hflK CDS 786643..787644 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156425.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene hflC CDS complement(788118..789230) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389356.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 789421..789621 product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095291.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 789721..791019 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527972.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene purA CDS 791358..791780 product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177639.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene nsrR CDS 791819..794269 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815426.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene rnr CDS 794365..795108 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704174.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene rlmB CDS complement(795161..795436) product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441025.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene yjfN CDS complement(795608..795919) product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368621.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene bsmA CDS 796090..796839 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815429.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene yjfP CDS complement(796885..797160) product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156389.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 797461..797856 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216676.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene rpsF CDS 797865..798182 product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210154.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene priB CDS 798187..798414 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene rpsR CDS 798457..798906 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175476.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene rplI CDS 799029..799397 product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164450.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(799381..800016) product OapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210158.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 800266..800886 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156348.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(800947..801612) product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331469.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene ytfE CDS 801852..802592 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175628026.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene cysQ CDS 802947..803153 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689229.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(803211..804560) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210164.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(804835..805467) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830428.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene msrA CDS 805742..807478 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046695507.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 807475..811251 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154295113.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 811254..811604 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210168.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(811655..812185) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055075.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene ppa CDS complement(812290..813294) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216946.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene fbp CDS 813462..814832 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368582.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene mpl CDS complement(815130..815408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(815784..816254) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098972.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene argR CDS 816710..817648 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene mdh CDS complement(817708..817992) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175413.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(818194..819165) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047354.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene ispB CDS 819425..819736 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210178.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene rplU CDS 819755..820012 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434222.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene rpmA CDS 820100..821035 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210180.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 821084..822259 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156290.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene cgtA CDS complement(822381..823451) product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene pmrB CDS complement(823448..824110) product two-component system response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210183.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene pmrA CDS complement(824120..825517) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene dacB CDS 825802..826278 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098923.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene greA CDS complement(826424..826717) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210185.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene yhbY CDS 826848..827474 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145975.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene rlmE CDS 827522..829504 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107481.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene ftsH CDS 829600..830433 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene folP CDS 830440..831777 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071169.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene glmM CDS 831973..832308 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389230.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene secG tRNA 832362..832448 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 832505..832581 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 832827..833249 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300397.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene rimP CDS 833271..834758 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369524.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene nusA CDS 834783..837488 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133040.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene infB CDS 837588..837986 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209255.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene rbfA CDS 837986..838948 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089682.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene truB CDS 839096..839365 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369527.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene rpsO CDS 839622..841745 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209259.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene pnp CDS 841993..842751 product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209260.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene nlpI CDS 842930..844846 product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305131.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene deaD CDS 845504..846772 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175361.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 846813..848126 product cysteine desulfidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460499.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene cyuA CDS complement(848189..849067) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175357.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(849079..850074) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 850360..850881 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 850875..851378 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209273.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 851708..853192 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816239.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene putP CDS complement(853113..853496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 853521..854036 product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209282.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 854056..854700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815461.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(854708..855172) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704204.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene nrdG CDS complement(855226..857364) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187820.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene nrdD CDS complement(857787..858074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(858071..858475) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174200.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(858475..858780) product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164648.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(859055..859468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(859470..860150) product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369576.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene yqjA CDS complement(860252..860716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(860908..861297) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465059.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene crcB CDS 861296..861469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(861577..862344) product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174195.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene exuR CDS complement(862526..863821) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002353699.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 864340..865749 product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210410.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene uxaC CDS 865849..867327 product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174192.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 867340..868836 product altronate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199370.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene uxaA CDS 868898..869422 product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128143.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(869470..870711) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174187.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene sstT CDS complement(871060..872028) product TerC family membrane protein Alx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098806.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene alx CDS 872434..873351 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368920.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(873365..874345) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098856.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(874401..874904) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817239.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 874981..876138 product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817237.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene rlmG CDS 876300..877460 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849007.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(877471..878835) product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779337.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene qseC CDS complement(878835..879494) product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098725.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene qseB CDS 879708..880106 product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731552.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(880164..882596) product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192654.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(882601..883503) product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097441.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 883645..884307 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420897.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene fsa tRNA complement(884505..884580) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 884716..885210 product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703525.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene mug CDS complement(885299..887140) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437371.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene rpoD CDS complement(887376..889124) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210358.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene dnaG CDS complement(889315..889530) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene rpsU CDS 889744..890769 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264383.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene tsaD CDS complement(890792..891475) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160822.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene plsY CDS 891652..892017 product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212199.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene folB CDS 892054..892872 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174137.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene bacA CDS complement(892898..894145) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817222.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(894266..894718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 894632..894904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(895091..896356) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262659.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(896379..897059) product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421000.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 897210..898514 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817221.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 898584..901421 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212194.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene glnE CDS complement(901447..902376) product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816068.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 902482..903915 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869178.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene hldE CDS 903947..905194 product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212192.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene yjeH CDS complement(905205..905471) product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098757.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene ubiK CDS 905959..906618 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076993.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene ribB CDS complement(906710..907477) product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098748.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene zupT CDS 907668..908453 product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212189.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene ygiD tRNA complement(908595..908681) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(908714..908800) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(908836..908922) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(909098..910141) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene rsmC CDS 910315..910725 product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209207.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 910685..911131 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095481.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene rimI CDS 911328..912917 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095483.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene prfC CDS 913142..914158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 914155..914946 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119010.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 915240..916517 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209214.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 916642..917130 product IS200/IS605-like element IS1004 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503164.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene tnpA CDS complement(917192..918055) product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418645.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(918027..919577) product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143203.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 919985..920764 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095489.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene deoC CDS 920871..922193 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477811.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene deoA CDS 922292..923515 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815520.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene deoB CDS 923583..924308 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224864.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene deoD CDS 924522..924908 product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368578.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene cybC CDS 924914..925429 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118400.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(925460..925870) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367745.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene rnk CDS complement(926047..926319) product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210112.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene npr CDS complement(926327..927178) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243741.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene rapZ CDS complement(927286..927732) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162484.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene ptsN CDS complement(927868..928158) product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162480.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene hpf CDS complement(928177..929646) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098942.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene rpoN CDS complement(929773..930498) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206203.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene lptB CDS complement(930505..931062) product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669785.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene lptA CDS complement(931037..931609) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174254.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene lptC CDS complement(931606..932172) product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174251.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene kdsC CDS complement(932188..933174) product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210119.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene kdsD CDS complement(933227..934216) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162457.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 934493..935323 product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032898349.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene mlaF CDS 935313..936095 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174247.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene mlaE CDS 936100..936636 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369501.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene mlaD CDS 936657..937307 product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210124.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene mlaC CDS 937307..937609 product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004488.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene mlaB CDS 937762..938016 product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene ibaG CDS 938080..939336 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369505.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene murA CDS complement(939443..940504) product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703614.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene degS CDS complement(940602..941918) product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218066.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene degQ CDS 941815..942033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(942064..942456) product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene zapG CDS 942780..943814 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210131.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene zapE CDS 944076..944504 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918559.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene rplM CDS 944519..944911 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene rpsI CDS 945247..945888 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162411.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene sspA CDS 945888..946376 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369484.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene sspB CDS 946461..946700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(946800..947675) product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(947656..948363) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703466.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(948531..949232) product protein-disulfide oxidoreductase DsbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345576.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene dsbI CDS complement(949249..949920) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040020.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(949984..951780) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459855.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 952160..953149 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465075.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(953185..954603) product glutamate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210138.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(954619..959076) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077010.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene gltB CDS complement(959383..959643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 959765..960667 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703610.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 960749..963085 product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210142.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene arcB CDS 963471..964124 product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300411.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene elbB CDS 964202..964852 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162387.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene mtgA CDS complement(964894..965484) product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098899.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene dolP CDS complement(965495..966085) product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004710884.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene diaA CDS complement(966133..966519) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098898.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(966477..968576) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228200.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 968638..969513 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210149.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene rsmI CDS complement(969493..969903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(969955..970662) product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209218.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 970770..971747 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166929.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene serB CDS 971893..973278 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815522.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene radA CDS complement(973336..975003) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005180723.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene ettA CDS 975396..977324 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209227.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene sltY CDS 977429..977761 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368371.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene trpR CDS complement(977731..978300) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209229.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene yjjX CDS 978465..979112 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704328.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene gpmB CDS complement(979115..979999) product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166950.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene robA CDS 980200..980688 product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095506.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene creA CDS complement(980756..982474) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260716.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene proS CDS complement(982559..983263) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212157.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene tsaA CDS complement(983260..983541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 983525..983806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(983793..984608) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene metQ CDS complement(984681..985310) product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(985327..986358) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173141.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene metN CDS 986549..987112 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173139.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene gmhB rRNA 987498..989035 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00210 tRNA 989120..989195 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 rRNA 989388..992291 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00220 rRNA 992385..992495 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00230 CDS complement(992581..994242) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446174.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(994352..995710) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018051.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene pssA CDS complement(995841..998513) product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208750.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(998585..999277) product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001356055.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene tapT CDS complement(999374..999805) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216643.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene trxC CDS 1000012..1001103 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167464.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(1001184..1001672) product IS200/IS605-like element IS1004 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503164.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene tnpA CDS complement(1001801..1002517) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194358.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene arcA CDS 1003166..1003882 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704332.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 1004241..1006700 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264697.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene thrA CDS 1006702..1007631 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005282415.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene thrB CDS 1007635..1008921 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781103.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene thrC CDS complement(1008969..1009745) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209240.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene yaaA CDS complement(1009861..1011294) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459389.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 1011711..1012679 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095515.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene tal CDS 1012805..1014256 product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772868.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene gabD CDS 1014418..1015074 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707009.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 1015071..1015658 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094685.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene mog CDS 1015779..1017089 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815535.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(1017166..1017741) product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815537.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene satP CDS 1018197..1018508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 1018541..1018987 product DUF1311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483218.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(1019171..1019776) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172412315.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 1020295..1021107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 1021107..1023221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(1023332..1023607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 1024657..1026009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(1026106..1027878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 1028259..1030166 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815538.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene dnaK CDS 1030277..1031410 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119009.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene dnaJ CDS 1031628..1032806 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704351.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene nhaA CDS 1033011..1033913 product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157029.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene nhaR CDS complement(1033985..1034248) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157027.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene rpsT CDS 1034640..1035602 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210510.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene ribF CDS 1035627..1038473 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210509.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene ileS CDS 1038470..1038970 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368327.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene lspA CDS 1038970..1039431 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095528.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene fkpB CDS 1039412..1040365 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210506.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene ispH CDS complement(1040503..1041057) product Raf kinase inhibitor-like protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306955.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene ybcL CDS complement(1041222..1041716) product xanthine dehydrogenase iron sulfur-binding subunit XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016606.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene xdhC CDS complement(1041713..1042591) product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706035.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene xdhB CDS complement(1042598..1044889) product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706034.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene xdhA CDS 1045340..1046158 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543605.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene dapB CDS 1046703..1047782 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298633.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene carA CDS 1047802..1051023 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166990.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene carB CDS 1051253..1052023 product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368403.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 1052023..1052487 product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005180751.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 1052615..1053097 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080544.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene folA CDS complement(1053157..1053996) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257192.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene apaH CDS complement(1054000..1054377) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156966.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene apaG CDS complement(1054402..1055217) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065373.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene rsmA CDS complement(1055210..1056202) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210489.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene pdxA CDS complement(1056207..1057511) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167006.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene surA CDS complement(1057632..1060019) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815546.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene lptD CDS 1060180..1061019 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167009.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene djlA CDS complement(1061099..1061806) product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525195.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene rluA CDS complement(1061806..1064712) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167013.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene rapA CDS complement(1064977..1067328) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210466.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(1067424..1068128) product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704381.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene thiQ CDS complement(1068125..1069732) product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051607.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene thiP CDS complement(1069708..1070703) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005053588.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene thiB CDS complement(1070886..1072565) product HTH-type transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210461.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene sgrR CDS 1072912..1074393 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218844.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(1074467..1075069) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025800380.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene leuD CDS complement(1075062..1076477) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167044.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene leuC CDS complement(1076480..1077571) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210454.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene leuB CDS complement(1077574..1079160) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210453.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene leuA CDS 1079812..1080777 product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216434.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene leuO CDS 1081041..1082843 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815561.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 1083140..1084858 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815562.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene ilvI CDS 1084861..1085352 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388986.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene ilvN CDS 1085508..1086554 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095565.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene cra CDS 1087511..1087969 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167064.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene mraZ CDS 1087972..1088916 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210442.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene rsmH CDS 1088913..1089233 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029684613.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene ftsL CDS 1089272..1091029 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156878.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 1091016..1092503 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848752.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene murE CDS 1092500..1093876 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815567.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene murF CDS 1093870..1094952 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210437.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene mraY CDS 1094954..1096270 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796460.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene murD CDS 1096270..1097514 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156865.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene ftsW CDS 1097511..1098590 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016582.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene murG CDS 1098645..1100120 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene murC CDS 1100124..1101047 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210432.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 1101049..1101912 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228100.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene ftsQ CDS 1101909..1103165 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210431.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene ftsA CDS 1103235..1104395 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389003.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene ftsZ CDS 1104501..1105418 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095578.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene lpxC CDS complement(1105429..1105974) product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705424.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 1106090..1106512 product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014320.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene secM CDS 1106588..1109296 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905763.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene secA CDS 1109389..1109799 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210424.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene mutT CDS complement(1109847..1110047) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167089.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene yacG CDS complement(1110072..1110824) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557441.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene zapD CDS complement(1110821..1111447) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704406.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene coaE CDS 1111772..1112818 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167093.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(1112871..1114070) product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032713360.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene hofC CDS complement(1114067..1115386) product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704408.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene gspE CDS complement(1115383..1115832) product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095588.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene ppdD CDS 1116081..1116668 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051592.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene ampD CDS 1116693..1117547 product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815577.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene ampE CDS complement(1117623..1119002) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815579.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 1119586..1120350 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389026.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene pdhR CDS 1120498..1123161 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156812.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene aceE CDS 1123175..1125058 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095598.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene aceF CDS 1125330..1126754 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519338.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene lpdA CDS complement(1126817..1127074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 1127358..1129955 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209333.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene acnB CDS 1130099..1130767 product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024735.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 1130920..1131282 product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167120.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene yacL CDS complement(1131266..1132162) product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167123.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene yddG CDS complement(1132483..1132842) product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167131.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 1133119..1133655 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368206.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene hpt CDS complement(1133817..1134479) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651604.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene can CDS complement(1134570..1135253) product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368366.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene creB CDS 1135466..1136392 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150638.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 1136389..1137159 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368203.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 1137346..1137780 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901966.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 1138325..1139098 product transcriptional repressor AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209875.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene agaR CDS 1139227..1140408 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704759.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 1140412..1140894 product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369555.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene agaV CDS 1140911..1141699 product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406214.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene agaW CDS 1141689..1142582 product PTS N-acetylgalactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369553.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene agaE CDS 1142592..1143029 product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098891.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene agaF CDS 1143144..1143998 product tagatose bisphosphate family class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704754.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 1144104..1145435 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216851.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(1145419..1146912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(1147055..1147435) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156780.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene panD CDS complement(1147567..1148427) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815587.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene panC CDS complement(1148486..1149280) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167163.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene panB CDS 1149307..1149528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(1149558..1150070) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704426.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene folK CDS complement(1150067..1151440) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene pcnB CDS complement(1151613..1152554) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763945.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene gluQRS CDS complement(1152662..1153117) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007373199.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene dksA CDS complement(1153301..1154005) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228221.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene sfsA CDS complement(1154021..1154560) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095634.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene thpR CDS 1154680..1157127 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298481.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene hrpB CDS 1157212..1159698 product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209358.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene mrcB CDS complement(1159761..1160933) product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705623.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene ompC CDS complement(1161651..1162442) product DUF2076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114320.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(1162588..1163601) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815606.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 1163982..1164308 product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209389.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 1164528..1165397 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816984.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene lgt CDS 1165425..1166219 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816983.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene thyA CDS 1166355..1166837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 1166852..1167385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 1167418..1167864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 1167842..1168123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1168197..1171580 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816979.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene recC CDS 1171669..1174533 product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816978.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene ptrA CDS 1174533..1178093 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816977.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene recB CDS 1178083..1179936 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098543.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene recD CDS complement(1179942..1181267) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173274.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene argA CDS 1181504..1182766 product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173271.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene amiC tRNA complement(1182892..1182968) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(1183010..1183086) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(1183128..1183204) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 1183428..1184579 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228046.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene mltA CDS 1184678..1185499 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212114.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene tcdA CDS complement(1185469..1185924) product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816974.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene csdE CDS complement(1185921..1187129) product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212116.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene csdA CDS 1187659..1188606 product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044409.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene gcvA CDS 1188618..1189013 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 1189006..1190124 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene rlmM CDS complement(1190174..1190938) product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215970.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene xni CDS complement(1190993..1192357) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098530.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene ppnN tRNA 1191218..1191312 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(1192538..1193383) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100463.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene queF CDS 1193502..1194056 product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173239.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene syd CDS 1194726..1195055 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 1195196..1195990 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703313.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene truC CDS 1196006..1196458 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212126.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(1196530..1196916) product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212127.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(1197144..1197968) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186650.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene dapD CDS complement(1198044..1200698) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173232.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene glnD CDS complement(1200789..1201595) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266399.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene map CDS 1201933..1202658 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246882.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene rpsB CDS 1202821..1203678 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173227.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene tsf CDS 1203819..1204544 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164053.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene pyrH CDS 1204679..1205236 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212134.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene frr CDS 1205478..1206677 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212135.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene ispC CDS 1207024..1207719 product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212136.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene ispU CDS 1207729..1208586 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173216.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene cdsA CDS 1208605..1209960 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816967.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene rseP CDS 1209995..1212382 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173202.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene bamA CDS 1212522..1213082 product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816966.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene skp CDS 1213086..1214108 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173181.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene lpxD CDS 1214218..1214673 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212142.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene fabZ CDS 1214677..1215465 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173176.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene lpxA CDS 1215469..1216653 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741216.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene lpxB CDS 1216646..1217239 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173174.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene rnhB CDS 1217296..1220784 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294828.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene dnaE CDS 1220797..1221756 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391685.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene accA CDS 1221908..1222294 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704453.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 1222409..1224052 product lysine decarboxylation/transport transcriptional activator CadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704648.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene cadC CDS 1224469..1225800 product cadaverine/lysine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367859.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene cadB CDS 1225939..1228083 product lysine decarboxylase CadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295383.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene cadA CDS 1228166..1229647 product dipeptide permease DtpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704759.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene dtpD CDS 1229791..1231110 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816961.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene tilS CDS 1231148..1231477 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816960.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(1231525..1231785) product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218374.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene rof CDS complement(1231772..1231972) product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212152.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 1232198..1232746 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173162.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 1232748..1233164 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene arfB CDS 1233264..1233941 product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228043.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene nlpE CDS complement(1233970..1234230) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370294.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(1234361..1235212) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172731.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 1235346..1235990 product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211564.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene yfhb CDS complement(1236032..1237183) product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369197.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene yiaY CDS complement(1237442..1237780) product thiosulfate sulfurtransferase PspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473115.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene pspE CDS 1237988..1238506 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene tadA CDS complement(1238514..1239980) product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172712.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene mltF CDS 1240263..1244150 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970100.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene purL CDS 1244620..1246035 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216114.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 1246044..1246754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 1246758..1248098 product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene glrR CDS 1248262..1249884 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 1249898..1250236 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231018.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene glnB CDS 1250486..1251064 product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167499.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene lpcA CDS 1251115..1251882 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333380.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(1251853..1252575) product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208718.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene dpaA CDS 1252881..1253927 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227821.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(1253999..1255453) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(1255504..1256955) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(1257291..1259003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 1259719..1260777 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704475.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene dinB CDS 1260979..1262232 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261693.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene pepT CDS 1262229..1263590 product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418812.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene dcuC CDS 1263727..1264275 product outer membrane lipoprotein Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704785.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene blc CDS complement(1264357..1265817) product beta-Ala-His dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167527.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene pepD CDS 1266177..1266635 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863205.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene gpt CDS 1266831..1268093 product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816927.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene frsA CDS 1268155..1268556 product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174704.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene crl CDS 1268744..1269850 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167536.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene proB CDS 1269860..1271113 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095746.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene proA CDS complement(1271185..1272216) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816621.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 tRNA 1272433..1272508 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(1272537..1273685) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051894.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(1273912..1274730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(1274723..1275007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(1275007..1275612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(1275605..1276012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(1276016..1276306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1276308..1276823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(1276827..1277210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(1277203..1278228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(1278225..1279136) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160563.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene rdgC CDS complement(1279900..1280664) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133087235.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 1280746..1280973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 1281021..1281554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 1281752..1281925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 1281922..1282863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 1282860..1283597 product replication protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070133977.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 1283594..1283836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 1283833..1284402 product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103677717.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 1284399..1284791 product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767110.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 1284957..1285643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 1285640..1285858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1285858..1286901 product DUF968 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001533276.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 1286918..1287454 product DUF1133 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640035.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(1288284..1288562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 1288751..1289020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 1289025..1289558 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274722.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 1289661..1290542 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871021.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 1290595..1290876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 1291263..1292078 product antA/AntB antirepressor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776709.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 1292182..1292583 product DUF2570 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309362.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 1292546..1292725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(1292734..1293147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 1293510..1293854 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072872.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 1293942..1294409 product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938796.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 1294450..1296105 product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 1296480..1297433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 1297441..1298298 product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337208.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 1298311..1299534 product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072867.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 1299583..1299858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 1299868..1300197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 1300194..1300538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 1300519..1300899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 1300903..1301313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1301359..1301814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 1301824..1302162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 1302162..1302401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 1302394..1305318 product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072857.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 1305372..1305725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083691.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 1305771..1306106 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447253.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 1306116..1306814 product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152612.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(1306821..1307234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 1307360..1307533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 1307523..1308143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 1308216..1308998 product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705864.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 1309067..1309804 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001337536.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 1309699..1310346 product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309913.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 1310406..1313747 product host specificity protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515612.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 1313780..1315354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 1315351..1315644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(1316120..1316797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 note possible pseudo, frameshifted CDS complement(1316986..1317285) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076942383.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 1317332..1317631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 1317948..1318220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 1318775..1319344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 1319347..1320687 product reverse transcriptase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038198469.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 1320743..1320898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 1321103..1321375 product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179111.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 1321402..1321797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 note possible pseudo, frameshifted CDS complement(1321837..1322097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1322632..1323054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 1323628..1327770 product vacuolating autotransporter toxin Vat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene vat CDS complement(1328197..1328817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1329129..1329284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(1329300..1330049) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706011.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 1329930..1330166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 1330321..1330893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706010.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 1331708..1333204 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760238.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(1333268..1334533) product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858692.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(1334869..1335288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(1335501..1336358) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989022.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 1336887..1337486 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059235208.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 1337496..1338284 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526525.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 1338332..1338646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(1339073..1341178) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400805.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene katG CDS 1342195..1343142 product transcriptional regulator TdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094904.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene tdcA CDS 1343232..1344221 product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366079.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene tdcB CDS 1344243..1345574 product threonine/serine transporter TdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098878.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene tdcC CDS 1345607..1346815 product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298325.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene tdcD CDS 1346848..1349136 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098876.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene pflB CDS complement(1349214..1349846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762776.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 1350797..1351432 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284602.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene thiE CDS complement(1351574..1352674) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815496.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1352661..1352810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 1353478..1354218 product conjugal transfer complement resistance protein TraT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782438.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene traT CDS complement(1354297..1354698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 1356428..1356853 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833187.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene hiuH CDS 1357502..1359121 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228189.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 1359164..1363993 product hemagglutinin repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212081.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(1364135..1365151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 1365704..1366867 product serine-type D-Ala-D-Ala carboxypeptidase DacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365831.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene dacD CDS 1367051..1367704 product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097682.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene nfsB CDS 1368005..1368499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 1368621..1369565 product hypochlorite stress DNA-binding transcriptional regulator HypT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383509.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene hypT CDS complement(1369618..1370919) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262203.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(1371002..1371952) product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677245.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1372181..1372432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 1372407..1372595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 1372734..1373480 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693547.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene modA CDS 1373487..1374275 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005568139.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 1374262..1374882 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005645090.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(1374896..1375942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 1376110..1376748 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224231.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(1376753..1377643) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736956.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(1377800..1378684) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433673.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1378828..1380309) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261398.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1380403..1381098) product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700857.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(1381225..1382379) product N-acetylneuraminate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211169.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 1382789..1383019 product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816374.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 1383026..1383883 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816375.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 1383894..1385912 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169471.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(1385916..1386230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 1386835..1387509 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169692.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene yjjG CDS complement(1387694..1387897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 1388109..1388393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 1388489..1388917 product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301062.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(1388988..1390355) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168386.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1390964..1392316) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815808.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene yegD CDS complement(1392350..1395358) product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042960.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1395524..1396966) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098001.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene mgtE CDS complement(1397098..1397283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 1397590..1399824 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703158.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 1400136..1400312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 1400499..1401818 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167571.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene brnQ CDS 1401962..1403353 product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167572.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene proY CDS complement(1403427..1403693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(1403825..1405102) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 1405353..1407143 product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816914.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene malZ CDS complement(1407212..1407814) product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004707520.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(1408071..1408652) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167576.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 1408816..1409889 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208673.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene queA CDS 1410034..1411170 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095832.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene tgt CDS 1411309..1411641 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166605.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene yajC CDS 1411669..1413525 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208670.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene secD CDS 1413536..1414504 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167586.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene secF CDS 1414786..1415235 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208668.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene nrdR CDS 1415262..1416377 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167588.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene ribD CDS 1416465..1416935 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166502.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene ribE CDS 1416957..1417376 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367993.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene nusB CDS 1417487..1418458 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816909.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene thiL CDS 1418451..1418960 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704563.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene pgpA CDS complement(1419043..1420908) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367989.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene dxs CDS complement(1420981..1421886) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816905.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene ispA CDS complement(1421890..1422132) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124935.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene xseB CDS 1422344..1423792 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095844.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene thiI CDS complement(1423789..1424544) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140293.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(1424522..1425292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(1425292..1425897) product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene cbiM CDS complement(1425884..1426372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938247.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(1426441..1427226) product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938248.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(1427532..1428122) product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367984.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene yajL CDS complement(1428082..1428999) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167606.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene panE CDS 1429200..1429691 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167608.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(1429717..1431114) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706740.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(1431138..1432655) product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167629.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene ampG CDS complement(1432661..1433239) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208646.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 1433657..1433983 product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367954.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene bolA CDS 1434453..1435754 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198386.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene tig CDS 1435985..1436605 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167636.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene clpP CDS 1436789..1438060 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208641.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene clpX CDS 1438285..1440639 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387645.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene lon CDS 1440855..1441127 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002444653.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene hupB CDS 1441410..1443290 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167642.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene ppiD CDS 1443433..1443774 product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104586.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(1443813..1444502) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704596.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene queC CDS complement(1444551..1446263) product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816894.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 1446365..1447183 product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367942.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene cof CDS 1447366..1447827 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095868.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 1448092..1448445 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503304.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene glnK CDS 1448442..1449749 product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167660.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene amtB CDS complement(1449774..1450640) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208625.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene tesB CDS complement(1450721..1451044) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208623.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 1451579..1451764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(1451709..1451912) product expression modulating protein YmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208622.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene ymoA CDS complement(1451933..1452301) product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218472.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene tomB CDS complement(1452675..1455830) product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167694.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene acrB CDS complement(1455875..1457059) product efflux RND transporter adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene acrA CDS 1457200..1457895 product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167699.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene acrR CDS 1457920..1458273 product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096245.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 1458472..1461831 product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208612.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene mscK CDS complement(1461877..1462035) product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051143.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene rsmS CDS complement(1462044..1462295) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210786.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(1462365..1462937) product primosomal replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208610.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 1462986..1463354 product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704615.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 1463524..1464075 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367908.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene apt CDS 1464324..1466297 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208605.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene dnaX CDS 1466343..1466672 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 1466672..1467277 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene recR CDS 1467453..1469324 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167717.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene htpG CDS 1469532..1470176 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809841.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene adk CDS 1470322..1471299 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816874.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene hemH CDS 1471328..1472674 product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208586.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 1473411..1473944 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368070.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 1473992..1474678 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041165625.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 1474696..1477284 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704501.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 1477294..1478364 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 1478604..1480262 product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816863.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene ushA CDS complement(1480351..1480836) product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704619.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene ybaK CDS complement(1481115..1482458) product gluconate permease GntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558251.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene gntP CDS 1482824..1483015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1483098..1483910) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208580.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1484045..1486789) product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816861.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene copA CDS 1486911..1487324 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367894.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene cueR CDS complement(1487278..1487760) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095908.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(1487757..1488674) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158246.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(1488721..1489320) product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114466.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 1489552..1490223 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199961.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene queE CDS complement(1490267..1490443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 1490718..1491848 product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815773.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(1491849..1492211) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165931770.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene queD CDS 1492391..1494115 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095234.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene dld CDS complement(1494112..1494408) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095213.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 1494562..1496217 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095214.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 1496619..1497422 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694556.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene thiM CDS 1497422..1498249 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172521.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene thiD CDS complement(1498416..1499300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175627960.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 1499469..1499927 product inhibitor of vertebrate lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209800.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 1500056..1500694 product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213168.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene dsbA CDS 1500986..1501930 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704725.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(1502466..1503827) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209798.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene yegQ CDS complement(1503963..1504301) product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209797.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(1504454..1505185) product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137875.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene baeR CDS complement(1505267..1506640) product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162191.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene baeS CDS complement(1506637..1509729) product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209794.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene mdtC CDS complement(1509726..1512857) product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815801.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(1512854..1514086) product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097899.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 1514418..1514708 product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208692.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene ppnP CDS complement(1514711..1515184) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119006.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(1515204..1516115) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208691.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene rdgC CDS 1516238..1517143 product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704548.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene mak CDS 1517210..1517680 product DNA gyrase inhibitor SbmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706021.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene sbmC CDS 1517790..1518137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(1518191..1521892) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816917.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(1521889..1523118) product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704550.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene sbcD CDS 1523117..1523260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 1523356..1523997 product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113933.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene phoB CDS 1524024..1525322 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816915.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene phoR CDS complement(1525458..1526987) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072076535.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene ppx CDS complement(1527003..1529108) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162157.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene ppk1 CDS complement(1529235..1529786) product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene speG CDS complement(1529878..1530516) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209778.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene purN CDS complement(1530527..1531570) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172388.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene purM CDS 1531839..1532465 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860560.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene upp CDS 1532570..1533847 product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815817.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene uraA CDS 1533995..1534711 product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815818.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene hda CDS complement(1534810..1535163) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene arsC CDS complement(1535231..1536712) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217569.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 1536955..1538034 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172372.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(1538076..1538546) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172369.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene bcp CDS complement(1538567..1539124) product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098228.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 1539272..1540153 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172368.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene dapA CDS 1540170..1541210 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208557.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene bamC CDS 1541368..1542081 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208555.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 1542396..1544366 product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208552.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 1544523..1544801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 note possible pseudo, frameshifted CDS 1544744..1545196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 note possible pseudo, frameshifted CDS complement(1545209..1545415) product YpfN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208551.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(1545412..1546092) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172351.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(1546089..1547222) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277791.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene dapE CDS complement(1547219..1547635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(1548027..1551143) product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815827.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene acrD CDS 1551429..1551716 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208538.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(1551751..1552398) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165685.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(1552453..1554153) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300881.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene narQ CDS 1554547..1555056 product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208536.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene napF CDS 1555056..1555322 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557378.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene napD CDS 1555319..1557808 product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815828.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene napA CDS 1557821..1558573 product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694328.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene napG CDS 1558573..1559439 product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene napH CDS 1559436..1559882 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835177.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene napB CDS 1559892..1560512 product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815830.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene napC CDS complement(1560652..1561605) product protein YdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587570.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene ydhT CDS complement(1561671..1562327) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309532.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(1562386..1563069) product YdhW family putative oxidoreductase system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517579.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(1563080..1565182) product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273527.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(1565290..1565916) product ferredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070227.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 1566532..1567104 product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138361092.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene nudK CDS 1567320..1569599 product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172316.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene maeB CDS 1569694..1570512 product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(1570498..1570950) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815835.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(1570947..1571867) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801336.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene hemF CDS complement(1571956..1572825) product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365483.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene amiA CDS 1573199..1573624 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172297.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 1573780..1574361 product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815850.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 1574526..1575425 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208519.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(1575538..1576047) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522247.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene crr CDS complement(1576096..1577823) product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208490.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene ptsI CDS complement(1577877..1578134) product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene ptsH CDS complement(1578517..1579476) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098198.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene cysK CDS complement(1579629..1580408) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019083653.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene cysZ CDS 1580677..1581624 product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139343690.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene zipA CDS 1581694..1583721 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213368.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene ligA CDS 1583718..1583939 product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114688.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 1584002..1584670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 tRNA complement(1584831..1584906) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(1585038..1585113) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(1585118..1585193) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(1585229..1585304) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(1585340..1585415) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(1585447..1585522) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(1585554..1585629) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(1585668..1585743) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 1586253..1587668 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695634.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene gltX CDS complement(1587751..1588095) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210176.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 tRNA 1588346..1588421 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 1588477..1588552 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA 1588600..1588675 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA 1588722..1588797 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS 1588817..1589029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 1589026..1589196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1589139..1590323) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172189.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 1590727..1591965 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815865.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(1591962..1592297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 1592664..1593677 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815870.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene glk CDS complement(1593713..1594078) product MysB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097161.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 1594356..1594697 product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761890.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 1595217..1596716 product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816064.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 1596709..1599264 product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298322.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene mdoH CDS complement(1599541..1600308) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene moeB CDS complement(1600310..1601548) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816750.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene moeA CDS 1601933..1602595 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211960.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene folE CDS 1602672..1603841 product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706109.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene yeiB CDS 1604418..1604585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 1604572..1606662 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878157.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(1606709..1607506) product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816726.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene sanA CDS complement(1607654..1609351) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211968.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(1609582..1610469) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816724.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene cdd CDS complement(1610666..1611355) product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162334.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(1611352..1611768) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816723.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(1611930..1612877) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343890.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene rarD CDS complement(1613046..1614467) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816708.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene sbcB CDS 1614660..1615715 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168394.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 1615805..1617976 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210810.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene dinG CDS 1618349..1619377 product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208587.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene wzz(fepE) CDS complement(1619507..1620355) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873880.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene nfo CDS complement(1620484..1621554) product YeiH family putative sulfate export transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024911344.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1621696..1621953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 1622162..1622602 product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366316.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene uspF CDS 1622817..1623683 product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171339.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene yieE CDS 1623894..1625375 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208786.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 1625436..1625627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(1625716..1627110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(1627888..1629936) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816718.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene metG CDS 1630158..1631270 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816717.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene apbC CDS complement(1631352..1631516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 1631455..1632096 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365789.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene udk CDS complement(1632133..1633068) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369087.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 1633279..1633860 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365790.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene dcd CDS 1633918..1635702 product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene asmA CDS 1635974..1637332 product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162366.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene dcuC CDS 1637902..1638990 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699404.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene rfbB CDS 1638990..1639880 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706708.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene rfbD CDS 1639921..1640802 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706707.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene rfbA CDS 1640848..1641390 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100804.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene rfbC CDS 1641418..1642656 product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 1642653..1643579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 1644404..1644880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 1644870..1645427 product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525449.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 1645439..1646383 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261976.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(1647429..1647707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 1647643..1648185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 1648182..1648922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 1649002..1650048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 1650049..1651161 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 1651272..1652174 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168326.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene galU CDS 1652190..1653206 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694325.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene galE CDS 1653234..1654400 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704802.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene ugd CDS 1654566..1655573 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074276.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 1655784..1657199 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043528.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene gndA CDS 1657448..1657780 product PTS system regulator TmaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217522.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene tmaR tRNA complement(1657906..1657981) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(1658212..1658287) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(1658521..1658596) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(1658804..1658879) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS complement(1659159..1660340) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215044.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene metC CDS complement(1660352..1661632) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209057.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 1661890..1662804 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209056.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 tRNA complement(1662910..1662985) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS complement(1663083..1663871) product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211042.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene mtfA CDS complement(1664091..1665716) product MCR-3-related phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706485.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 1666177..1667343 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367336.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene flhB CDS 1667336..1669417 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816614.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene flhA CDS 1669421..1669828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(1669853..1670059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(1670213..1670635) product flagellar export chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211107.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene flgN CDS complement(1670641..1670937) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211108.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene flgM CDS complement(1671117..1671800) product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849222.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene flgA CDS 1672029..1672442 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367330.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene flgB CDS 1672446..1672850 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211111.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene flgC CDS 1672862..1673560 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020450.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene flgD CDS 1673611..1674846 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160443.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene flgE CDS 1674897..1675652 product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011192165.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 1675669..1676451 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367325.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene flgG CDS 1676542..1677228 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367324.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene flgH CDS 1677242..1678381 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367323.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 tRNA 1678231..1678319 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 CDS 1678381..1679343 product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704936.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene flgJ CDS 1679524..1681182 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704937.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene flgK CDS 1681197..1682162 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223025.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene flgL CDS 1682379..1682966 product reactive chlorine resistance membrane protein RclC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707216.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene rclC CDS 1683028..1683876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(1683961..1685154) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211303.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(1685390..1686526) product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705623.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene ompC CDS complement(1686849..1688249) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367451.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene asnS CDS complement(1688458..1689663) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816044.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene pncB CDS 1690067..1692685 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220013.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene pepN CDS 1692797..1693180 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261873.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 1693733..1694743 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097269.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene pyrD CDS 1694918..1695472 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211295.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 1695665..1696042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 1696060..1696389 product YmgD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295611.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(1696534..1697301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 1697607..1699724 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816048.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene rlmKL CDS 1699728..1701638 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816049.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 1701725..1702984 product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211291.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene pqiA CDS 1702988..1704625 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050078426.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene pqiB CDS 1704625..1705191 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367436.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene pqiC CDS 1705455..1705628 product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228015.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene rmf CDS complement(1705755..1706273) product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220006.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene fabA CDS complement(1706342..1708150) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032900735.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 1708294..1708752 product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877153.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene matP CDS complement(1709205..1710257) product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213066.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene ompA CDS complement(1710624..1711121) product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213065.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene sulA CDS 1711343..1711966 product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170872.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(1711992..1714130) product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816054.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene yccS CDS complement(1714144..1714590) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170867.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 1714792..1716846 product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816055.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene helD CDS complement(1716922..1717380) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816056.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(1717491..1717982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 1718175..1718597 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170853.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(1718634..1718954) product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367415.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene hspQ CDS complement(1719064..1720254) product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097247.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene rlmI CDS 1720443..1720721 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170844.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene yccX CDS complement(1720759..1721088) product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079836.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene tusE CDS complement(1721211..1721873) product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097244.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene yccA tRNA 1722191..1722278 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS complement(1722438..1723079) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433130.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1723249..1724538) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174929.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 1727647..1728792 product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001379974.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene arnB CDS 1728808..1729788 product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369284.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene arnC CDS 1729791..1731770 product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703731.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene arnA CDS 1731767..1732666 product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703730.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene arnD CDS 1732663..1734321 product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099173.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene arnT CDS 1734318..1734653 product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638018.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene arnE CDS 1734650..1735033 product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819455.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene arnF note possible pseudo, internal stop codon tRNA 1735805..1735880 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 CDS complement(1736474..1736689) product cold shock protein CspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163087.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene cspG CDS complement(1737090..1737293) product putative selenium delivery protein YdfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860613.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene ydfZ CDS 1737984..1738199 product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860775.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene cspA CDS complement(1738581..1743548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 1744265..1744471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(1744554..1744841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 tRNA 1745476..1745551 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA 1745591..1745664 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 CDS 1745903..1746136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 1746418..1747455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 1747527..1747673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 1747645..1747797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(1747864..1748049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(1748136..1748735) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020423.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 1749140..1750471 product bifunctional acid phosphatase/4-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297112.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene appA CDS complement(1750560..1751798) product two-component system response regulator PgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930841.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene pgtA CDS complement(1751785..1753812) product two-component system sensor histidine kinase PgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678500.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene pgtB CDS complement(1753809..1755041) product phosphoglycerate transport regulator PgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467983.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene pgtC CDS 1755436..1756821 product phosphoglycerate transporter PgtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene pgtP CDS 1756859..1757050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(1757116..1757967) product reactive chlorine-specific transcriptional regulator RclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339591.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene rclR CDS 1758089..1759414 product reactive chlorine resistance oxidoreductase RclA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046306.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene rclA CDS 1759542..1760123 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891610.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(1760196..1761848) product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097459.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(1761941..1762105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(1762142..1763890) product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816161.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene ftsI CDS 1764348..1765010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(1764954..1765373) product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122416.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene uspC CDS complement(1765594..1766748) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198074.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 1767655..1767999 product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164498.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene flhD CDS 1768001..1768582 product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164496.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene flhC CDS 1768739..1769629 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210888.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene motA CDS 1769626..1770624 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168761.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene motB CDS 1770628..1772724 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704929.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene cheA CDS 1772793..1773287 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210885.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene cheW CDS 1773474..1775150 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095457.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene tsr CDS 1775297..1776874 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816617.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 1776928..1777806 product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367340.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene cheR CDS 1777803..1778855 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210874.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 1778950..1779339 product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164479.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene cheY CDS 1779349..1779984 product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367337.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene cheZ CDS complement(1780176..1781285) product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169008.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene chaA CDS 1781495..1782067 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706097.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 1782166..1782471 product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097162.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(1782526..1783794) product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694556.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(1783813..1785090) product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467000.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene dcuC CDS 1785228..1786142 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095771.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(1786488..1787207) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704112.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(1787324..1788166) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098684.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(1788198..1789556) product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098685.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(1789860..1791326) product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262088.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene dcuC CDS complement(1791331..1792479) product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128783587.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene iadA CDS 1792478..1792708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 1792745..1793644 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262090.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(1793879..1794418) product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367123.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 1794695..1796068 product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene dbpA CDS complement(1796216..1797370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 1797290..1797499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 1797642..1797782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(1798068..1798814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(1798815..1799996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(1800761..1801477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(1801477..1802592) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 1803078..1803452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 note possible pseudo, frameshifted CDS 1803695..1805014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(1805432..1806175) product IS5-like element IS903B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012579081.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 note possible pseudo, internal stop codon CDS complement(1806763..1807854) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505850.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene ychF CDS complement(1808002..1808592) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218168.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene pth CDS 1808960..1809238 product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823874.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene ychH CDS complement(1809289..1810425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(1810653..1811600) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367113.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene prs CDS complement(1811786..1812667) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211239.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene ispE CDS complement(1812664..1813284) product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816542.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene lolB CDS 1813504..1814766 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169107.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene hemA CDS 1814808..1815890 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804703.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene prfA CDS 1815890..1816723 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211235.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene prmC CDS 1816816..1817616 product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816540.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene sirB1 CDS 1817768..1818622 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811065.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene kdsA CDS complement(1818676..1818813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(1818916..1820589) product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816539.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene dauA CDS complement(1820858..1821343) product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815953.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 tRNA complement(1821498..1821587) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 CDS 1822096..1822680 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096479.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 tRNA complement(1822972..1823061) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 CDS complement(1823224..1824402) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738534.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 1824754..1826253 product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444487.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 1826384..1827325 product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046457733.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene ghrA CDS complement(1827319..1828524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 1829044..1829781 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211221.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 1829834..1830409 product molecular chaperone YcdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001909.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene ycdY CDS complement(1830488..1831051) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211218.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(1831223..1832431) product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816537.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene mdtH CDS 1832758..1833342 product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468201.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene rimJ CDS 1833382..1834038 product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097145.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 1834163..1835761 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816533.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene murJ CDS complement(1836108..1837841) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705961.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene argS CDS 1838107..1838670 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304291.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(1838672..1839814) product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 1840062..1840859 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169161.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene cutC CDS complement(1840946..1841917) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211208.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene cmoB CDS complement(1841914..1842684) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019588.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene cmoA CDS complement(1842677..1842973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 1842956..1844317 product phenylalanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786319.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene pheP CDS complement(1844351..1844746) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211206.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(1844877..1845698) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816527.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 1846162..1847937 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169176.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene aspS CDS 1847937..1848368 product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211203.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene nudB CDS 1848468..1849214 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211202.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 1849211..1849732 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022509.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene ruvC CDS 1849831..1850439 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365989.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene ruvA CDS 1850458..1851462 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163065.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene ruvB CDS complement(1851525..1852310) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571465.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene znuB CDS complement(1852303..1853055) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169189.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene znuC CDS 1853155..1854162 product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227944.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene znuA CDS 1854175..1855494 product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169193.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene mepM CDS 1855703..1856665 product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene lpxM CDS 1856744..1857544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(1857611..1859053) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091149.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene pyk CDS complement(1859250..1860119) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169198.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 1860472..1861944 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163030.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene zwf CDS 1861995..1862690 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene pgl CDS 1862698..1864518 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050129919.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene edd CDS 1864645..1865286 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800512.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene kdgA CDS 1865888..1866274 product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene mdtJ CDS 1866261..1866590 product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183821.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene mdtI CDS complement(1866676..1867020) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169202.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 1867200..1869134 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849399.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 1869208..1869909 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816515.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene tsaB CDS 1870008..1870619 product Slp family lipoprotein YeaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290564.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene yeaY CDS 1870928..1872607 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169210.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene fadD CDS 1872594..1872734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 1872746..1873864 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169218.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene rnd CDS complement(1874079..1874348) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211180.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene minE CDS complement(1874352..1875164) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101055.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene minD CDS complement(1875190..1875675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 1876002..1876280 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295992.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 1876426..1877082 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211740.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 1877177..1877638 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306825.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 1877782..1878213 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088599.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(1878303..1878833) product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816443.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene dsbB CDS complement(1878931..1880505) product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406377.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene nhaB CDS complement(1880953..1881234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 1881490..1882209 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162963.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene fadR CDS complement(1882266..1883801) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240763.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(1884029..1884244) product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367252.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(1884437..1884694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 1885341..1886759 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391671.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 1886756..1888213 product dipeptide/tripeptide permease DtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098284.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene dtpB CDS complement(1888289..1890064) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527892.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(1890220..1891491) product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169266.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1891553..1893487) product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097060.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene yeaG CDS 1893875..1894618 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169267.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(1894718..1896979) product TonB-dependent hemoglobin receptor HmbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene hmbR CDS 1897157..1897357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(1897479..1898375) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816432.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 1898580..1899242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 1899958..1900599 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062036.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 1900648..1901319 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176232.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 1901346..1902065 product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484311.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 1902085..1905102 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210844.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 1905216..1906250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 1906467..1906889 product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065769.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene arsC CDS complement(1907139..1908134) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224141.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene gapA CDS 1908431..1908904 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211677.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene msrB CDS 1908974..1909252 product DUF1315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461780.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(1909355..1909990) product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366151.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene pncA CDS complement(1910046..1911062) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166135.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene ansA CDS complement(1911367..1913220) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816426.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene sppA CDS 1913432..1913980 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211673.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1913905..1914114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 1914175..1915221 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169286.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene selD CDS 1915218..1916330 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154074.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene mnmH CDS 1916339..1918267 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079527.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 1918264..1918602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(1918632..1919060) product pyrimidine (deoxy)nucleoside triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366162.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(1919057..1919866) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211667.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene xthA CDS complement(1919956..1920525) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 tRNA complement(1921190..1921274) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 tRNA complement(1921353..1921437) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 CDS complement(1921590..1922438) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166151.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene purU CDS complement(1922544..1923026) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816423.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 1923244..1924302 product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193451.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene rssB CDS 1924584..1925432 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718995.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene galU CDS complement(1925710..1926120) product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169306.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene hns CDS 1926628..1927218 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096267.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene tdk CDS complement(1927616..1927972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(1928001..1930670) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210657.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene adhE CDS 1931163..1931807 product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210656.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 1932564..1934201 product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218177.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene oppA CDS 1934277..1935197 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367069.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene oppB CDS 1935210..1936118 product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979661.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene oppC CDS 1936132..1937103 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058853.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 1937100..1938104 product murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164170.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene oppF CDS complement(1938188..1938520) product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069343.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(1938566..1939942) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210648.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene cls CDS complement(1940448..1940942) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(1941568..1941864) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967602.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 1942148..1943029 product TonB system transport protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989146.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene tonB CDS complement(1943077..1943505) product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210641.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene yciA CDS complement(1943580..1944119) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210640.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 1944365..1946125 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816413.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 1946278..1946472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 1946487..1947260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096723.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(1947327..1948076) product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169326.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(1948183..1948587) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705754.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 1948870..1949508 product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164191.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene ompW CDS complement(1949599..1949913) product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370060.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(1950053..1950859) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443067.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene trpA CDS complement(1950856..1952049) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076940213.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene trpB CDS complement(1952094..1953470) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210632.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene trpCF CDS complement(1953491..1954507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 note possible pseudo, frameshifted CDS complement(1954498..1955130) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215981.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(1955133..1956704) product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816407.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 1957051..1957962 product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285675.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene rnm CDS 1957959..1958579 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816405.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 1958633..1958884 product DUF2766 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365964.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(1959068..1959766) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812020.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(1959829..1960602) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926540.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(1960783..1961898) product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046516.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(1961911..1962306) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211048.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(1962355..1962582) product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856224.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(1962694..1962990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 1963340..1964215 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366215.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene rluB CDS 1964447..1965184 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168496.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene cobS CDS 1965194..1965790 product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351014.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(1965796..1966386) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278854.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene cobO CDS complement(1966452..1967234) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816402.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 1967440..1968507 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816401.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene sohB CDS complement(1968551..1968802) product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165861.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 1969202..1971802 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309471.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene topA CDS 1972012..1972986 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776231.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene cysB CDS 1973909..1974118 product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221949.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene cspE CDS 1974327..1975190 product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170523.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene rlmA CDS complement(1975546..1976007) product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211066.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(1976071..1976934) product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211067.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(1976952..1977752) product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211068.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(1977809..1978774) product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150543.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene manX CDS 1979216..1979407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 1979413..1980975 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170491.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(1980972..1982561) product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096134.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 1983314..1983691 product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172296.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 tRNA complement(1983893..1983969) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 tRNA complement(1983991..1984067) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 tRNA complement(1984089..1984165) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 tRNA complement(1984187..1984263) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 CDS complement(1984433..1985806) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816381.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 1986066..1986701 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366888.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(1986710..1988098) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816208.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 1988302..1989090 product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262203.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene kdgR CDS complement(1989161..1990549) product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050999.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(1990969..1991517) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170172.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(1991678..1992337) product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816215.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene hxpB CDS 1992523..1993068 product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170142.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(1993114..1993986) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211846.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(1994074..1994403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 1994568..1995224 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816222.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 1995626..1996909 product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819223.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(1997021..1997641) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947464.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(1997635..1998429) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950217.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(1998423..1999235) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966645.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(1999225..2000199) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520270.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(2000199..2001785) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946075.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 2002123..2002491 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369567.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 2002707..2004740 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446482.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene mrdA CDS complement(2004681..2004863) product GhoT/OrtT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096478.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(2005073..2005507) product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082296.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene uspF CDS 2005768..2005968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(2006028..2006378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 2006607..2007299 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265932.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(2007340..2007858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(2008609..2009778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(2010390..2010641) product DUF1883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705086.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 2010814..2010966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(2010971..2011732) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098575.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene kduD CDS complement(2011798..2012634) product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098576.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene kduI CDS 2013057..2013560 product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208969.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene cpxP CDS complement(2014327..2014599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 2014492..2014869 product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208969.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene cpxP CDS 2015260..2015610 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261764.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene hinT CDS 2015641..2016033 product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225291.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 2016055..2016645 product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213089.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene lpoB CDS 2016635..2017489 product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517652.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene thiK CDS 2017529..2018563 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816133.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene nagZ CDS 2018682..2019224 product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587943.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene ycfP CDS complement(2019270..2020328) product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759329.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene potD CDS complement(2020517..2021788) product cadaverine/lysine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene cadB CDS complement(2022279..2023055) product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097091.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene potC CDS complement(2023224..2024090) product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799406.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene potB CDS complement(2024074..2025207) product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531604.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene potA CDS 2025091..2025333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 2025446..2025616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 2025898..2027133 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210920.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene pepT CDS complement(2027205..2027795) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817212.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 2028428..2029732 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401586.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(2029812..2031755) product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169906.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(2031891..2033351) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097832.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 2033549..2034742 product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706445.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 2035015..2035530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 2035544..2035882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(2035914..2036885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(2036965..2037780) product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169510.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene sapF CDS complement(2037780..2038772) product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene sapD CDS complement(2038772..2039662) product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169515.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene sapC CDS complement(2039649..2040614) product putrescine ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169521.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene sapB CDS complement(2040611..2042305) product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816365.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene sapA CDS complement(2042321..2042500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(2042681..2043721) product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210974.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene pspF CDS 2043930..2044595 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169534.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene pspA CDS 2044643..2044870 product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366273.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene pspB CDS 2044870..2045223 product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050078551.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene pspC CDS 2045251..2045535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 2045516..2046913 product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169547.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 2046910..2047977 product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169550.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(2048039..2048884) product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098288.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene sseA CDS 2049278..2050870 product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210983.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene tyrR CDS complement(2050928..2051431) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816360.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene tpx CDS 2051667..2053289 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210987.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 2053867..2054880 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165628.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(2055036..2055272) product major outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002908860.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(2055573..2056985) product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816382.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene pykF CDS complement(2057411..2058484) product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene cobD CDS 2058908..2060452 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168494.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 2060440..2060991 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168495.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene cobU CDS 2061004..2062068 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168498.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene cobT CDS complement(2062118..2063506) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948912.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 2065119..2067398 product thiosulfate reductase PhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028230.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene phsA CDS 2067412..2067984 product thiosulfate reductase electron transport protein PhsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016236.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene phsB CDS 2067981..2068754 product thiosulfate reductase cytochrome B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092553.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(2068829..2070196) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170488.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(2070708..2071280) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174851158.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(2071271..2072656) product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene pabB CDS 2072796..2072999 product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457328.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(2073030..2074208) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419918.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene purT CDS 2074633..2075787 product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816380.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene cfa CDS 2076282..2076491 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159934.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 2076790..2077098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 2077233..2077562 product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115608390.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene yqfB CDS 2078107..2078961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 2079072..2081129 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211088.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 2081153..2081962 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037034.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(2082060..2083205) product porin OmpS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824321.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene ompS2 CDS complement(2084495..2084737) product DUF4060 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211054.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 2084967..2085920 product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097008.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene pfkB CDS complement(2085978..2086487) product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100805.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene dps CDS complement(2086670..2086909) product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216493.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 2087939..2088433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 2089129..2091123 product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130624425.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene betT CDS 2091370..2093298 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211836.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene thrS CDS 2093377..2093844 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023616141.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene infC CDS 2093941..2094138 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211834.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene rpmI CDS 2094182..2094538 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211833.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene rplT CDS 2094939..2095922 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211832.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene pheS CDS 2095937..2098324 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672332.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene pheT CDS 2098329..2098625 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211830.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene ihfA CDS 2098715..2098918 product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365898.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene dsrB CDS 2098905..2099930 product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816398.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene btuC CDS 2099923..2100690 product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050983.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene btuD CDS 2100965..2101333 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169395.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(2101566..2102507) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(2102504..2103898) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400819.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(2104099..2104884) product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815405.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(2104874..2105875) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175607.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(2105872..2106705) product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156544.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(2106702..2107748) product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209061.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(2107822..2109810) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096983.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(2109922..2110104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(2110183..2110815) product anaerobilin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189349.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene chuY CDS complement(2110812..2111342) product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209065.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene hutX CDS complement(2111332..2112708) product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209066.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene hutW CDS complement(2112889..2113935) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169413.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(2114130..2114951) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211814.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 2115357..2117732 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816386.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene ppsA CDS complement(2118177..2119274) product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169418.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene ydiK CDS 2119596..2122685 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367023.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 2122648..2123070 product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169420.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 2123107..2124099 product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227906.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene zntB CDS complement(2124393..2125328) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081419.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene ttcA CDS 2125619..2125987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(2126054..2128093) product formate-dependent uric acid utilization protein AegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078843.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene aegA CDS complement(2128436..2131969) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816353.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene nifJ CDS 2132163..2132495 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160972.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(2132553..2133206) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210995.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 2133384..2133638 product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705621.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(2133656..2134078) product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352339.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 2134448..2134654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(2134724..2135719) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210998.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 2135927..2138524 product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981411.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 2138517..2138711 product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688201.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 2138721..2139053 product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366327.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 2139399..2143238 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072088404.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene hrpA CDS complement(2143284..2144096) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816345.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(2144433..2144885) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012669197.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(2145560..2146798) product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097203.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene agp CDS complement(2147083..2147520) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702452.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(2147950..2149464) product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705288.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(2149516..2150826) product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011192505.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene rstB CDS complement(2150831..2151550) product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169653.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene rstA CDS complement(2151566..2152288) product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096872.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene folM CDS 2152882..2153283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816341.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(2153391..2154794) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211017.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(2155024..2155974) product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211018.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene ydgH CDS 2156507..2158033 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816338.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene pntA CDS 2158046..2159437 product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169667.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene pntB CDS complement(2159524..2160486) product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096866.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene uspE CDS complement(2160678..2161433) product FNR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160911.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 2161975..2163939 product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303492.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene rlhA CDS 2164201..2165253 product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985218.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene asrA CDS 2165253..2166071 product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706396.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene asrB CDS 2166083..2167090 product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706397.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene asrC CDS 2167247..2167543 product DUF406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655986.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 2167562..2167921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 2168114..2169907 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815979.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 2170119..2170697 product outer membrane lipoprotein Slp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057453.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene slp CDS complement(2171339..2172088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(2173992..2175482) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760238.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 2175732..2176157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 2176243..2179185 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704874.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 2179656..2180405 product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050078046.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene ydfG CDS 2180518..2180886 product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169788.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 2180916..2181209 product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165762.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(2181237..2182658) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(2182899..2184437) product carbohydrate-specific porin BglH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489881.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene bglH CDS 2185508..2186290 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704527.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 2186989..2188515 product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784837.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene ccp CDS complement(2188917..2189531) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366772.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene bioD CDS complement(2189818..2191044) product ROK family transcriptional regulator Mlc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169799.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene mlc CDS complement(2191196..2192098) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816301.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 2192290..2193525 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091834.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 2193633..2193830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 2194119..2195057 product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816298.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene tus CDS 2195916..2197094 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816296.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene manA CDS 2197223..2198701 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816295.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 2199105..2200106 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816291.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene add CDS complement(2200181..2201188) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169841.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 2201414..2201629 product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217950.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene ydgT CDS 2202104..2203834 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661416.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 2203918..2204349 product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210594.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 2204501..2205085 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210595.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene rsxA CDS 2205085..2205660 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169885.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene rsxB CDS 2205653..2208163 product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816279.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene rsxC CDS 2208164..2209201 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050901.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene rsxD CDS 2209211..2209840 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210600.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene rsxG CDS 2209837..2210553 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210601.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 2210553..2211194 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096904.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene nth CDS 2211790..2213253 product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050958.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene dtpA CDS 2213419..2214024 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816371.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene gstA CDS complement(2214101..2214967) product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165910.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene pdxY CDS complement(2215037..2216311) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366861.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene tyrS CDS complement(2216450..2217103) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210959.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene pdxH CDS complement(2217337..2217657) product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218323.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(2217661..2218797) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096911.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene anmK CDS 2219183..2219650 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165921.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(2219724..2220155) product virulence master transcriptional regulator RovA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210955.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene rovA CDS 2220915..2221322 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165939.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene gloA CDS 2221452..2222117 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169454.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene rnt CDS 2222339..2223631 product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880817.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(2223712..2224062) product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003832760.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene grxD CDS complement(2224110..2224256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 2224510..2225364 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169450.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 2225631..2226209 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169447.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene sodB CDS 2226740..2227765 product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165644.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene purR CDS 2227768..2229387 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478911.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 2229374..2229997 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705773.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(2229978..2230892) product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210942.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene punR CDS 2231053..2232249 product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816379.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene punC CDS 2232543..2233694 product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816380.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene cfa CDS complement(2233753..2236911) product Cu(+)/Ag(+) efflux RND transporter permease subunit SilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574029.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene silA CDS complement(2236904..2238208) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096582.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(2238315..2238662) product cation efflux system protein CusF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096581.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene cusF CDS complement(2238694..2240046) product Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074212.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene cusC CDS 2240269..2240952 product copper response regulator transcription factor CusR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770953.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene cusR CDS 2240942..2242393 product Cu(+)/Ag(+) sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704248.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 2242842..2243144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(2243221..2244717) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018494.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene putP CDS 2245264..2249220 product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367239.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene putA CDS complement(2249143..2249367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(2249589..2250476) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170215.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene htpX CDS complement(2250702..2251847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 note possible pseudo, frameshifted CDS complement(2251732..2252682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 note possible pseudo, frameshifted CDS complement(2253033..2253182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(2253195..2255237) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170217.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene prc CDS complement(2255257..2255961) product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170218.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene proQ CDS complement(2256063..2256554) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210850.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 2256793..2258049 product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367629.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene yebS CDS 2258009..2260648 product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816203.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(2260683..2263769) product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457967.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(2263771..2264814) product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481686.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene nrfD CDS complement(2264811..2265578) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481653.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 2265770..2267542 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481667.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 2267539..2268165 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263004.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 2268234..2268512 product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137910.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 2268525..2268989 product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262025.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 2269178..2269903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(2270011..2270457) product YcgJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521787.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(2270585..2272099) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707234.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(2273007..2273624) product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074530037.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(2273626..2276718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(2276746..2280087) product host specificity protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515612.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(2280105..2280743) product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309913.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(2280644..2281378) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194798.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(2281387..2282079) product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152490.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(2282076..2282405) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447256.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(2282405..2285221) product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371994.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(2285199..2285522) product phage tail assembly protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161004.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(2285531..2285917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(2285929..2286411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(2286408..2286839) product phage minor tail U family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079422.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(2286836..2287381) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096336.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(2287378..2287659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(2287652..2287975) product DUF2190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097065.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(2288028..2290028) product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077780990.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(2289973..2291487) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974564.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(2291484..2291699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309515.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(2291696..2293792) product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000507029.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(2293761..2294297) product DUF1441 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348565.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 2294650..2295156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(2295427..2295825) product DUF2570 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309362.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(2295843..2296433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(2296608..2296823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(2296856..2297098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(2297256..2297807) product putative peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166765.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(2297810..2298148) product phage holin, lambda family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120501.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(2298271..2298441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 2298927..2299940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(2299946..2300332) product antiterminator Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170273.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(2300349..2300747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(2300737..2300985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(2300982..2301716) product replication protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070133977.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(2301713..2302747) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095671.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(2302740..2303456) product Rha family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034165349.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 2303613..2303885 product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064047.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 2303845..2304129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(2304176..2304541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(2304547..2305062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(2305107..2305286) product Cro/CI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276886.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 2305378..2306049 product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055009277.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 2306519..2306716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(2306685..2307134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(2307230..2308255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 note possible pseudo, frameshifted CDS complement(2308273..2308785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 note possible pseudo, frameshifted CDS 2309259..2309582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(2309611..2309871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 2310103..2310390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 2310636..2312219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 2313043..2313666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 2313864..2314145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 2314221..2314466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 2314453..2315568 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050116311.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 2315636..2315842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(2316293..2317291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 2317503..2317670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(2317902..2318387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 2318713..2318889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 2319843..2320778 product virulence transcriptional regulator RovM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210280.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene rovM CDS 2320772..2321656 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090007.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(2321727..2323112) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(2323222..2324586) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857989.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene purB CDS 2325082..2326260 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064230.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene metC CDS 2326297..2327661 product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705380.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene dcuC CDS 2328029..2329441 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096878.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene fumC CDS 2329883..2330239 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096735.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 note possible pseudo, internal stop codon CDS complement(2330423..2330704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 2330963..2331301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 note possible pseudo, internal stop codon, frameshifted CDS 2331458..2331700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(2332834..2335095) product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593905.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(2335181..2336614) product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036475.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(2336693..2337631) product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723652.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 2337933..2338859 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350493.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(2339089..2339553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 2340144..2340368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 2340580..2340975 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706384.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 2341017..2341313 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261830.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2341542..2342987) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891132.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(2343055..2344263) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682078.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 2345607..2345987 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049049137.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 2345992..2346471 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095198.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 2346484..2346669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 2346951..2347178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 2347178..2348254 product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272375.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene arsB CDS 2348254..2348817 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087169.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(2349023..2349454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 2350206..2350505 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705611.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 2350646..2351635 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933388.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 2351661..2351900 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095205.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 tRNA complement(2352515..2352602) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 CDS complement(2353010..2353498) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589833.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(2353521..2354747) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084010.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(2354752..2355300) product YfiR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166944.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 2355772..2356116 product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015480.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(2356159..2356590) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366755.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(2356717..2357130) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092635.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(2357364..2357573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(2357702..2357821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 2358535..2363100 product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113014.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 2363084..2364031 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268102.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 2364135..2364272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(2364342..2364878) product beta/gamma crystallin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706731.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(2365048..2366400) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986601.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene melA CDS 2366651..2367580 product transcriptional regulator MelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106992.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene melR CDS 2367899..2369203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 2369218..2370456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(2370747..2371832) product nickel/cobalt efflux protein RcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703366.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 2371954..2372226 product Ni(II)/Co(II)-binding transcriptional repressor RcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369853.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene rcnR CDS complement(2372338..2372721) product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528057.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 2372932..2373897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 2373915..2375057 product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705357.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 2375224..2376276 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705139.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 2376266..2377285 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705138.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(2377414..2377635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(2377946..2378743) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705136.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(2378894..2380117) product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942611.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene opgC CDS 2380337..2382175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 2382177..2383532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 2383550..2385124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 2385109..2386497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 2386512..2388701 product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229242.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(2388896..2389801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 2390042..2390398 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915845.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 2390395..2391321 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703607.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 2391318..2392826 product glucosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097704.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 2393327..2393782 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705626.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(2393850..2394647) product 2-aminoethylphosphonate ABC transport system, membrane component PhnV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909802.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene phnV CDS complement(2394641..2395510) product 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703872.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene phnU CDS complement(2395510..2396622) product 2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928794.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene phnT CDS complement(2396629..2397642) product 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778002.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene phnS CDS complement(2397970..2398689) product phosphonate utilization transcriptional regulator PhnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836268.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene phnR CDS 2398829..2399932 product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203965.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene phnW CDS 2399942..2400751 product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079741.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(2400831..2401733) product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095448.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene hpaA CDS complement(2401785..2403161) product 4-hydroxyphenylacetate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285769.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene hpaX CDS complement(2403211..2404014) product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431692.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene hpaI CDS complement(2404024..2404827) product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884795.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene hpaH CDS complement(2404827..2406284) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387895.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(2406289..2407533) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159295.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(2407536..2407931) product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368431.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(2407948..2408808) product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095453.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene hpaD CDS complement(2408970..2410436) product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723530.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene hpaE CDS complement(2410433..2411200) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009485356.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(2411197..2411835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 2412215..2412688 product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene hpaR CDS 2413056..2414228 product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338972.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 2414246..2415202 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206906.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 2415395..2416300 product ABC transporter six-transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052123623.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 2416369..2417733 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 2417817..2418395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(2418444..2418911) product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979870.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene nanQ CDS complement(2418911..2419783) product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153624.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene nanK CDS complement(2419902..2421392) product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108454.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene nanT CDS complement(2421512..2422384) product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029662.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene nanA CDS complement(2422544..2423326) product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523843.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene nanR CDS complement(2423542..2423778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 2423893..2425461 product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953353.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene nikA CDS 2425461..2426405 product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947084.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene nikB CDS 2426402..2427235 product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008954.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene nikC CDS 2427235..2427999 product nickel import ATP-binding protein NikD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136229.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene nikD CDS 2427996..2428808 product nickel import ATP-binding protein NikE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173690.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene nikE CDS complement(2428880..2430280) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099094.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene fumC CDS 2430650..2431318 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194414.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 2431324..2432181 product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314263.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 2432282..2433844 product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865648.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene fdrA CDS 2433841..2435262 product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093933.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 2435259..2436218 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240546.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene arcC CDS 2436237..2436629 product glutamyl-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214035.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 2436654..2437877 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227356.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 2437953..2438444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 note possible pseudo, internal stop codon CDS 2438451..2438861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 note possible pseudo, internal stop codon CDS complement(2438858..2439289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 note possible pseudo, internal stop codon CDS complement(2439293..2439817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 note possible pseudo, internal stop codon CDS 2440091..2440855 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703823.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(2440839..2442218) product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703822.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(2442231..2443796) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703821.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(2444229..2445704) product multidrug efflux MFS transporter AmvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207042.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene amvA CDS complement(2445750..2446202) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089408.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(2446345..2447472) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(2447515..2448123) product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190363.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(2448154..2448798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(2449743..2450006) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634187.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 2450293..2451432 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171333.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 2451432..2452211 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208783.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(2452505..2452690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 2452638..2453435 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038164.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 2453450..2454619 product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054234.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 2454616..2456328 product siderophore biosynthesis protein PsvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477461.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 2456330..2457514 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038168.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 2457489..2459249 product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038169.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 2459246..2460418 product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460650.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 2460468..2461607 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166886.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 2461694..2463775 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038165.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(2463878..2464891) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213216.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(2464891..2466219) product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998359.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene fucP CDS complement(2466248..2467168) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350272.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene rbsK CDS 2467508..2468311 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448638.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(2468669..2470012) product invasin domain 3-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097364336.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(2470199..2470894) product ZirU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223931156.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(2471049..2472527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 2473867..2474097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(2474753..2475721) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164038.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(2475825..2476172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 2477040..2477978 product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419670.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 2478154..2478558 product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695223.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(2478487..2478828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(2478858..2479589) product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013551.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(2479586..2480380) product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168485.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(2480391..2481176) product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816684.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(2481173..2481901) product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953643.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(2481898..2482953) product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098913.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene cbiG CDS complement(2482934..2483707) product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004870.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(2483700..2484269) product decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650991.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(2484259..2484864) product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958833.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(2484858..2485433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 note possible pseudo, frameshifted CDS complement(2485342..2485998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 note possible pseudo, frameshifted CDS complement(2485995..2486633) product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816687.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(2486644..2487603) product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153666.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene cbiB CDS complement(2487600..2488979) product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741259.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 2489928..2490794 product L-threonine kinase PduX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201312.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 2491745..2492257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078137.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(2492606..2492803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 2492973..2493836 product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060149.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 2493833..2494825 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223651.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 2494822..2495589 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173324.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 2495589..2496395 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903995.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 2496465..2498432 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302893.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(2498790..2500118) product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426437.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene dsdA CDS complement(2500136..2501473) product D-serine transporter DsdX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556035.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene dsdX CDS 2501608..2502630 product DNA-binding transcriptional regulator DsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989264.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene dsdC CDS complement(2502596..2502895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(2503094..2503789) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209426.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 2504219..2505028 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209424.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 2505372..2506271 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216011.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 2506339..2507841 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209422.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 2507834..2508820 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209421.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 2508834..2509886 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216010.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 2509879..2510769 product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209420.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 2510766..2512253 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209419.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(2512343..2512558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(2512658..2513917) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704895.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(2513943..2514770) product xanthosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704894.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene xapA CDS complement(2514953..2515135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 2515118..2516047 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704893.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 2516415..2518187 product two-component system sensor histidine kinase AtoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559125.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene atoS CDS 2518184..2519566 product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125282.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene atoC CDS 2519857..2520519 product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850540.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene atoD CDS 2520519..2521169 product acetate CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339055.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene atoA CDS 2521166..2522488 product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580275.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 2522522..2523706 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786547.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene atoB CDS 2523840..2524169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 2524494..2525354 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274601.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(2525341..2525697) product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323849.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(2525699..2526577) product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204153.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(2526543..2528882) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184828.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(2528954..2529274) product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(2529289..2530368) product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004462.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 2530679..2533180 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174088.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene ptsP CDS 2533191..2533853 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424865.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene fsa CDS 2534316..2534951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 2535323..2535613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296612.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 2535689..2536006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(2536025..2536825) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114208.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 tRNA complement(2536995..2537081) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 tRNA complement(2537096..2537169) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 tRNA complement(2537210..2537285) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 CDS complement(2537423..2537971) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170287.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene pgsA CDS complement(2538027..2539859) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289473.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene uvrC CDS complement(2539852..2540508) product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211176.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene uvrY CDS 2541064..2541288 product DUF2594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160184.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 2541401..2541730 product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170280.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(2541883..2543136) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210910.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene icd CDS 2543472..2544008 product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097078.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene rluE CDS 2544068..2544514 product phosphatase NudJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476093.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene nudJ CDS 2544604..2545707 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170633.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene mnmA CDS 2545863..2546918 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169117.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 2547082..2547708 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170635.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene hflD CDS 2547737..2549107 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816141.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene purB CDS 2549339..2550034 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097911.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(2550075..2551127) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846205.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 2551462..2552136 product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265471.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene phoP CDS 2552133..2553599 product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170639.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene phoQ CDS 2553701..2554822 product [50S ribosomal protein L16]-arginine 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306875.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene roxA CDS complement(2554874..2555728) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816137.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene cobB CDS complement(2555741..2556685) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170645.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene nagK CDS complement(2556697..2557944) product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705054.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene lolE CDS complement(2557944..2558663) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158007.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene lolD CDS complement(2558656..2559858) product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170663.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene lolC CDS 2560063..2563524 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816135.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene mfd CDS complement(2563621..2564160) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043449.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(2564319..2565320) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097200.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(2565332..2566612) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213097.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 2567021..2567788 product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816270.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 2567887..2568135 product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157917.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene dinI CDS 2568323..2568577 product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157914.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene bssS CDS 2568722..2569846 product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211850.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene solA CDS 2570352..2570954 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157909.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 2571240..2572697 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226022.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(2572728..2573264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 2573678..2574340 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212173.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 2574502..2574720 product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498253.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene osmB CDS complement(2574814..2575140) product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640138.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene yciH CDS complement(2575162..2575884) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176265.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene pyrF CDS complement(2576007..2577176) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816262.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene lapB CDS complement(2577182..2577496) product lipopolysaccharide assembly protein LapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876284.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene lapA CDS 2577937..2578527 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366227.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene ribA CDS complement(2578732..2580165) product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213085.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene ptsG CDS complement(2580471..2581259) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213084.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(2581290..2582273) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213083.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene holB CDS complement(2582270..2582911) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213082.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene tmk CDS complement(2582901..2583929) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816078.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene mltG CDS complement(2583948..2584760) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816077.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene pabC CDS complement(2584848..2586089) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419106.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene fabF CDS complement(2586172..2586408) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220787.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene acpP CDS complement(2586563..2587297) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007236.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene fabG CDS complement(2587310..2588239) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816075.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene fabD CDS complement(2588262..2589215) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097122.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(2589222..2590256) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210932.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene plsX CDS complement(2590285..2590455) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210931.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene rpmF CDS complement(2590472..2590993) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705036.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene yceD CDS 2591105..2591728 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367195.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(2592044..2593006) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157930.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene rluC CDS 2593594..2596788 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816074.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene rne CDS complement(2596915..2597241) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705218.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 2597893..2598990 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706690.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene wecA CDS 2599181..2600296 product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706680.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 2600356..2600814 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706679.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 2600876..2603071 product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706678.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(2603285..2603548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 2603609..2604253 product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167297468.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 2604250..2604996 product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706676.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 2605131..2607092 product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226013994.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 2607368..2608414 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816073.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene pyrC CDS 2608487..2609188 product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157535.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene fetA CDS 2609181..2609939 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367890.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene fetB CDS complement(2610024..2611670) product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066681.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene fumB CDS complement(2612209..2612370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(2612744..2613520) product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273000.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene yecC CDS complement(2613619..2614173) product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene fliZ CDS complement(2614205..2614927) product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160341.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(2615117..2616376) product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704962.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(2616648..2617898) product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704962.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 2618180..2619598 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704960.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene fliD CDS 2619613..2620020 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160351.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene fliS CDS 2620025..2620387 product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367285.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene fliT CDS complement(2620696..2620992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(2621066..2621380) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367290.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene fliE CDS 2621632..2623353 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704955.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene fliF CDS 2623350..2624342 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367292.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene fliG CDS 2624335..2625087 product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704954.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene fliH CDS 2625084..2626442 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097732.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene fliI CDS 2626469..2626909 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160389.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene fliJ CDS 2626906..2628159 product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046695171.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 2628309..2628788 product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367297.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene fliL CDS 2628794..2629807 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160396.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene fliM CDS 2629800..2630213 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367299.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene fliN CDS 2630215..2630619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 2630619..2631359 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160406.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene fliP CDS 2631372..2631641 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160414.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene fliQ CDS 2631644..2632429 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211130.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene fliR CDS complement(2632490..2633137) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170954.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(2633219..2633767) product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170957.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(2634039..2635691) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830416.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene ldtD CDS complement(2636141..2640598) product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211308.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene mukB CDS complement(2640595..2641299) product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211309.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene mukE CDS complement(2641307..2642629) product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170970.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene mukF CDS complement(2642626..2643411) product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170971.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene cmoM CDS 2643606..2644403 product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899600.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene elyC CDS 2644400..2644684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(2644703..2646073) product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(2646120..2647526) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706406.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(2647896..2648789) product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170979.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(2648910..2649662) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097299.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene kdsB CDS complement(2649662..2649838) product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350058.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene ycaR CDS complement(2650102..2650311) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159937.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(2650529..2650738) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159934.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(2651044..2652039) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170991.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene lpxK CDS complement(2652036..2653790) product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097303.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene msbA CDS complement(2653827..2656100) product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419026.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(2656601..2656885) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858233.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene ihfB CDS complement(2656974..2658644) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140327.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene rpsA CDS complement(2658869..2659546) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211324.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene cmk CDS complement(2659844..2661133) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097306.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene aroA CDS complement(2661306..2662361) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171026.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene serC CDS complement(2662696..2663742) product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394115.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene ansB CDS 2663886..2665646 product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211330.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 2666043..2666900 product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166519.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene focA CDS 2666963..2669245 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292799.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene pflB CDS 2669520..2670260 product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171041.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene pflA CDS complement(2670301..2670921) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064378.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 2671032..2671493 product YkgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543907.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 2671493..2671870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 2671880..2672608 product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143609.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 2672646..2672915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 2673317..2673769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(2673841..2674986) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211335.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(2675130..2675702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(2675702..2676316) product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209430.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene dmsD CDS complement(2676365..2677225) product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097315.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(2677227..2677844) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213098.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene dmsB CDS complement(2677856..2680303) product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850332.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene dmsA CDS complement(2680863..2682155) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162747.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene serS CDS complement(2682276..2683619) product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067755.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene rarA CDS complement(2683636..2684253) product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171053.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene lolA CDS 2684210..2684392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(2684389..2688504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(2688657..2689151) product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228473.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene lrp CDS 2689875..2690840 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367489.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene trxB CDS 2691069..2692877 product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816031.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene cydD CDS 2692880..2694610 product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211344.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene cydC CDS 2694635..2695363 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816030.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene aat CDS 2695459..2695677 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211347.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene infA CDS complement(2695827..2698121) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934041.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene clpA CDS complement(2698149..2698469) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520781.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene clpS CDS 2698909..2699130 product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447499.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene cspD CDS 2699295..2700260 product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097328.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(2700257..2700928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(2700947..2702617) product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816028.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 2702842..2703741 product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211358.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 2703921..2705576 product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816026.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene hcp CDS 2705670..2706635 product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816025.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene hcr CDS 2706654..2706833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 2707032..2707649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(2707794..2708330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(2708330..2708629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 2709301..2709981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 2710315..2711010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 2711052..2711804 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267299.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 2711866..2714313 product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 2714310..2715209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 2715321..2716373 product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211362.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene ltaE CDS 2716395..2717924 product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211363.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 2719053..2720063 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816020.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(2720064..2720912) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097358.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(2721018..2721662) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262787.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 2722242..2722763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 2722813..2723505 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677183.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 2723526..2725979 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945390.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 2725998..2727029 product putative fimbrial-like adhesin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765280.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 2727226..2727954 product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228008.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene artP CDS 2727992..2728723 product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162826.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene artJ CDS 2728817..2729533 product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001677.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene artQ CDS 2729533..2730201 product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211370.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene artM CDS 2730433..2731167 product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171154.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 2731262..2731750 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037783.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(2731741..2732880) product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208756.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene rlmC CDS complement(2732928..2733407) product YbjO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704855.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(2733521..2734012) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208763.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 2734168..2734362 product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705982.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(2734410..2735132) product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189165.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene nfsA CDS 2735410..2735682 product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004873700.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(2735785..2736252) product IS200/IS605-like element IS1004 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503164.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene tnpA CDS complement(2736406..2736786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 2737083..2738771 product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208766.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 2739555..2739785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(2739936..2740085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 2740155..2741015 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369221.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 2741282..2742196 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 2742304..2742783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 2742780..2744060 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003516526.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 2744187..2745188 product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817452.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene ghrB CDS 2745359..2745967 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172665986.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene ybjG CDS 2746238..2747002 product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208770.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene deoR CDS 2747828..2749120 product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450470.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene sdaC CDS 2749219..2750586 product L-serine ammonia-lyase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626410.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene sdaB CDS complement(2750659..2751858) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208774.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(2752114..2752308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 2752323..2752874 product Raf kinase inhibitor-like protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313946.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene ybcL CDS 2752894..2753727 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706902.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 2753830..2755155 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073304.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene rimO CDS complement(2755420..2756250) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211898.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 2756757..2757656 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211896.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene hisG CDS 2757661..2758971 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009629.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene hisD CDS 2758968..2760041 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108967.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene hisC CDS 2760044..2761123 product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080139.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene hisB CDS 2761123..2761728 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168362.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene hisH CDS 2761725..2762462 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097846.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 gene hisA CDS 2762444..2763220 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211890.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene hisF CDS 2763214..2763849 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954855.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene hisIE CDS 2764124..2765284 product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006798114.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 2765284..2767776 product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815998.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene torA CDS 2767923..2769137 product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706120.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene setB CDS complement(2769195..2769452) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035600.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 2769760..2771010 product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208812.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene mtr CDS 2771205..2771777 product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815996.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene yeiP CDS complement(2771880..2773070) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171409.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene uxuA CDS 2773473..2774945 product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815994.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(2775014..2776444) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095313.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 note possible pseudo, internal stop codon CDS complement(2776769..2778328) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707234.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(2778412..2779158) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161827.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(2779382..2779708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 2780088..2781083 product zinc-binding GTPase YeiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198822.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene yeiR CDS 2782014..2782430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 2782683..2784113 product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174531811.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene cycA CDS complement(2784172..2785872) product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854438.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene fruA CDS complement(2785887..2786825) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171387.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene fruK CDS complement(2786822..2787958) product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171391.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene fruB CDS 2788240..2788668 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707352.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 2789064..2789810 product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838671.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene glnH CDS 2789898..2790554 product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168189.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene glnP CDS 2790551..2791273 product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168188.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene glnQ CDS complement(2791336..2792262) product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602246.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene rlmF CDS 2792455..2794308 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208825.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(2794301..2794570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(2794826..2796022) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079955.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS complement(2796025..2796732) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171454.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene rsuA CDS complement(2796802..2796960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 2796976..2797218 product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349130.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 2797218..2798978 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208833.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 2799101..2799385 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494183.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene rplY CDS complement(2799486..2800490) product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365669.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene yejK CDS 2800661..2800888 product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208836.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 2800928..2802685 product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171465.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene yejM tRNA 2802761..2802837 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 CDS 2803044..2803469 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230381.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(2803473..2804468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(2804736..2806022) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095220.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene eno CDS complement(2806038..2806457) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365758.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(2806471..2807361) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095218.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(2807607..2808257) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705049.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 2808634..2808996 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096738.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(2809079..2810437) product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007101.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene rhlE CDS 2810686..2811429 product transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168102.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene cecR CDS 2811422..2812417 product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158910.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene hlyD CDS 2812429..2814165 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168099.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 2814158..2815297 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168097.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 2815312..2816424 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168094.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 2816520..2819231 product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815976.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene rcsD CDS 2819224..2819877 product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061910.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene rcsB CDS complement(2819946..2822825) product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815975.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene rcsC CDS complement(2823007..2825640) product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098009.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene gyrA CDS 2825883..2826590 product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210820.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 2827019..2829301 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815972.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene nrdA CDS 2829393..2830523 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815971.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene nrdB CDS 2830523..2830846 product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082045.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene yfaE CDS complement(2830843..2833122) product acid resistance putative oxidoreductase YdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726691.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene ydeP CDS complement(2833264..2833974) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158923.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(2834145..2834729) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038751.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(2834820..2835272) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704805.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene moaE CDS complement(2835274..2835516) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367604.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene moaD CDS complement(2835513..2835998) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080885.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene moaC CDS complement(2836036..2837025) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168084.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene moaA CDS 2837471..2838379 product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246034.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene yvcK CDS complement(2838376..2839578) product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171600.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 2839797..2841014 product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797555.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene tyrP CDS 2841200..2842228 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094618.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene trpS CDS complement(2842288..2842842) product YfaZ family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365610.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(2843191..2844582) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706153.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene menE CDS complement(2844582..2845553) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210244.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene menC CDS complement(2845553..2846410) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639989.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene menB CDS complement(2846463..2847236) product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210246.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene menH CDS complement(2847233..2848915) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210247.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene menD CDS complement(2849151..2850479) product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210248.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene menF CDS complement(2850617..2851114) product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705019.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 2851404..2852870 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760238.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(2852977..2853495) product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706345.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene hybE CDS complement(2853485..2853979) product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706346.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(2853979..2855682) product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706347.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene hybC CDS complement(2855679..2856869) product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706348.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene hybB CDS complement(2856862..2857845) product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706349.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene hybA CDS complement(2857849..2858973) product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706350.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene hybO CDS 2859762..2860298 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079074.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 2860497..2862800 product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871504.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 gene bglX CDS 2862927..2863082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(2863172..2864629) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815945.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 gene nuoN CDS complement(2864636..2866159) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815944.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene nuoM CDS complement(2866240..2868084) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815943.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene nuoL CDS complement(2868081..2868383) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159229.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 gene nuoK CDS complement(2868380..2868952) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159228.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene nuoJ CDS complement(2868963..2869505) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172749.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene nuoI CDS complement(2869526..2870500) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118519.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene nuoH CDS complement(2870497..2873232) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210275.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene nuoG CDS complement(2873294..2874640) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210276.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene nuoF CDS complement(2874637..2875137) product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545038.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 gene nuoE CDS complement(2875140..2876936) product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815938.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene nuoC CDS complement(2877037..2877711) product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913178.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene nuoB CDS complement(2877766..2878125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(2878820..2879749) product virulence transcriptional regulator RovM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210280.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene rovM CDS complement(2880141..2880815) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460538.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 2880958..2882250 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097038.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(2882258..2882896) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705775.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(2882889..2883482) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097040.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 2883753..2884973 product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074540.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene alaA CDS 2885057..2885662 product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706162.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene yfbR CDS complement(2885696..2887537) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082012.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(2887939..2888598) product sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019083548.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(2888629..2889123) product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210286.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(2889350..2889805) product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171754.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene yfbV CDS 2890363..2891562 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171756.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 gene ackA CDS 2891693..2893834 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082007.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene pta CDS complement(2893938..2894405) product IS200/IS605-like element IS1004 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503164.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene tnpA CDS complement(2894566..2895153) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940018.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(2895296..2895940) product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209742.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene yfcD CDS complement(2896030..2896575) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158446.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene yfcE CDS complement(2896674..2897315) product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816195.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene yfcF CDS 2897562..2898188 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446421.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 2898256..2898630 product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365570.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene folX CDS 2898675..2899571 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209739.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 2899785..2900498 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531692.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(2900504..2901097) product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098133.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(2901218..2902735) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365559.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene purF CDS complement(2902757..2903266) product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158480.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene cvpA CDS complement(2903457..2904266) product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209731.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene dedD CDS complement(2904256..2905527) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098137.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene folC CDS complement(2905664..2906572) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815925.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene accD CDS complement(2906846..2907511) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171830.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(2907526..2908353) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283581.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene truA CDS complement(2908353..2909363) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209726.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(2909478..2910605) product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815922.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene pdxB CDS complement(2910744..2911208) product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907521.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(2911244..2911843) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132918.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(2911847..2913856) product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703424.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(2913908..2914249) product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118904.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 2914426..2914800 product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191031.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 2914931..2915425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(2915510..2916256) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112447.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(2916556..2917767) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815909.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene fabB CDS 2917939..2920038 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209716.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene mnmC CDS complement(2920113..2920385) product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171926.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(2920424..2920972) product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171927.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(2921060..2921860) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209713.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(2922170..2922991) product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209712.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene mepA CDS complement(2923005..2924090) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171931.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene aroC CDS complement(2924178..2925110) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171935.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene prmB CDS 2925327..2925872 product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171938.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 gene smrB CDS complement(2925914..2926390) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158598.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene sixA CDS complement(2926773..2927069) product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227845.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 2927469..2928788 product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078223.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene fadL CDS complement(2929044..2929811) product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815902.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene mlaA CDS complement(2929883..2931097) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815901.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene ccmI CDS complement(2931094..2931594) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214855.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(2931591..2932145) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171969.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(2932142..2934106) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209698.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(2934113..2934601) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209697.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene ccmE CDS complement(2934598..2934831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(2934828..2935553) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815898.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(2935758..2936417) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209694.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene ccmB CDS complement(2936414..2937037) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209693.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene ccmA CDS 2937779..2937988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 2938000..2938989 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114928.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 2938998..2940662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 tRNA 2940877..2940951 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 CDS 2941467..2941682 product cold shock protein CspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163087.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene cspG CDS complement(2942050..2942223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 note possible pseudo, internal stop codon, frameshifted CDS 2942996..2943907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(2944273..2945622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(2945644..2946669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(2946678..2948051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(2948315..2949031) product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703386.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene aphA CDS 2950660..2951256 product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175175.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 2951370..2952077 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829798.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(2952137..2952811) product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261034.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 2953268..2954194 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705752.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 2954594..2956231 product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 2956228..2959809 product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705395.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene nifJ CDS complement(2959866..2960399) product rhodanese family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703230.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(2960412..2960720) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137417.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(2960880..2961968) product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211594.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene mltB CDS 2962448..2962639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 2962966..2965080 product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043156.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene cstA CDS 2965126..2965323 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460619.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 2965413..2966456 product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094852.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene yjiA CDS complement(2966643..2966882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 2967486..2967695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 2967900..2968541 product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457207.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene leuE CDS 2968742..2969125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS complement(2969161..2969664) product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764187.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene eco CDS complement(2969821..2971416) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961457.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 2972202..2973104 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704553.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 2973301..2974965 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816617.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 2975123..2975470 product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367133.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene yajD CDS complement(2975521..2976231) product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263818.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(2976537..2977118) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209889.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(2977131..2977985) product tagatose bisphosphate family class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209888.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(2978085..2979575) product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209887.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(2979643..2981259) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209886.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(2981274..2982467) product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209885.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(2982699..2983748) product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209884.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(2983886..2985043) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209882.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene nagA CDS complement(2985045..2985485) product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981389.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene agaF CDS complement(2985554..2986444) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209880.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(2986434..2987204) product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209879.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene agaW CDS complement(2987258..2987755) product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209878.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene agaV CDS complement(2987742..2988938) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209877.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(2988952..2990232) product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209876.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene kbaZ CDS complement(2990283..2991062) product transcriptional repressor AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209875.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene agaR CDS complement(2991738..2992643) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(2992766..2993695) product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816789.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene pbpG CDS complement(2993714..2993890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 2994112..2995011 product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526255.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 2995135..2996106 product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810823.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(2996171..2997127) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264869.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene dusC CDS complement(2997200..2997472) product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445805.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(2997548..2999566) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042501.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene uvrB CDS complement(3000129..3000857) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704797.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene bioD CDS complement(3000850..3001620) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072084097.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene bioC CDS complement(3001604..3002755) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210763.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene bioF CDS complement(3002757..3003803) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951218.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene bioB CDS 3004006..3005307 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704793.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene bioA CDS 3005447..3006265 product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816800.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(3006307..3007365) product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210758.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene modC CDS complement(3007367..3008059) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210757.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene modB CDS complement(3008069..3008836) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210756.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene modA CDS complement(3008947..3009723) product DUF218 domain-containing protein YdcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027967.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene ydcF CDS complement(3009854..3009997) product AcrZ family multidrug efflux pump-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217291.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 3010219..3011010 product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210754.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene modE CDS 3011154..3011969 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114479.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 3012175..3013191 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168055.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene galE CDS 3013203..3014246 product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191531.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene galT CDS 3014266..3015423 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053415.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene galK CDS 3015417..3016463 product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168049.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene galM CDS complement(3016496..3017812) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211405.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 3018182..3018934 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301554.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene gpmA CDS complement(3018984..3020048) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109193.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene aroG tRNA complement(3020493..3020568) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 tRNA complement(3020816..3020891) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 tRNA complement(3021140..3021215) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 tRNA complement(3021363..3021438) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 tRNA complement(3021641..3021716) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00810 tRNA complement(3021865..3021940) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00820 CDS complement(3022114..3022899) product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165506.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene cpoB CDS complement(3022923..3023435) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393299.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene pal CDS complement(3023482..3024774) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165502.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene tolB CDS complement(3024922..3026118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS complement(3026254..3026676) product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393306.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene tolR CDS complement(3026689..3027363) product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393307.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene tolQ CDS complement(3027369..3027659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(3027918..3028214) product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077798.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene ybgE CDS complement(3028344..3029483) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210731.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene cydB CDS complement(3029499..3031061) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367666.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene cydA CDS complement(3031759..3032631) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501094.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 gene sucD CDS complement(3032631..3033797) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210728.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene sucC CDS complement(3033875..3035092) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210727.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene odhB CDS complement(3035152..3037959) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210726.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene sucA CDS complement(3038306..3039022) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210725.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(3039041..3040807) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775540.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene sdhA CDS complement(3040808..3041155) product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700691.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene sdhD CDS complement(3041149..3041538) product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210722.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene sdhC CDS 3042171..3043454 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097545.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 3043601..3044137 product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229308.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene rimL CDS 3044433..3044771 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300891.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 3045579..3046298 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211655.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(3046279..3046947) product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215903.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(3047546..3048289) product type 2 GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168004.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(3048343..3049398) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298484.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS complement(3049388..3050821) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816818.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene phrB CDS complement(3050831..3051784) product transcriptional regulator MlrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060717.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene mlrB CDS complement(3051879..3052082) product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167995.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 3052720..3054417 product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816819.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene kdpA CDS 3054443..3056509 product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209651.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene kdpB CDS 3056521..3057126 product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene kdpC CDS 3057153..3059861 product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209649.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene kdpD CDS 3059858..3060547 product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517659.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene kdpE CDS complement(3060647..3062287) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167960.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene pgm CDS complement(3062317..3062847) product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816824.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene seqA CDS 3063037..3063828 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704754.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene ybfF CDS 3063936..3064307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 3064502..3065029 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018618.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene fldA CDS 3065310..3065774 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163370.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene fur CDS complement(3066117..3068789) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816825.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(3068803..3069135) product ChiQ/YbfN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167950.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene chiQ CDS complement(3069193..3070590) product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097565.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene chiP CDS complement(3071118..3072785) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816826.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene glnS CDS complement(3073026..3075053) product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816827.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene nagE CDS 3075389..3076189 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367707.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene nagB CDS 3076213..3077367 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816828.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene nagA CDS 3077392..3078618 product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051352.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(3078634..3078855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 3078808..3079560 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167939.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 3079776..3081437 product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337077.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene asnB tRNA 3081665..3081741 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00830 tRNA 3081761..3081845 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00840 tRNA 3081868..3081942 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00850 tRNA 3081982..3082056 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00860 tRNA 3082116..3082192 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00870 tRNA 3082197..3082271 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00880 tRNA 3082325..3082399 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00890 CDS complement(3082500..3083675) product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704745.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene ubiF CDS 3083898..3085322 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162748.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 gene miaB CDS 3085554..3086732 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493272.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 3086729..3087202 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158419.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene ybeY CDS 3087289..3088176 product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210342.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 gene corC CDS complement(3088211..3089224) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477975.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene ald CDS 3089481..3091010 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210341.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene lnt CDS 3091356..3092258 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167919.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 3092356..3093096 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167917.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 3093096..3093773 product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272824.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 gene gltK CDS 3093770..3094495 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210336.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 3094625..3095584 product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097582.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 gene rihA CDS 3095581..3096519 product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705366.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene rihA CDS complement(3096551..3097033) product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816834.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 3097336..3099918 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816835.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 gene leuS CDS 3099933..3100601 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816836.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene lptE CDS 3100598..3101632 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167898.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene holA CDS 3101622..3102287 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210330.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene nadD CDS 3102466..3102783 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161664.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene rsfS CDS 3102788..3103258 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210328.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene rlmH CDS 3103325..3105220 product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167891.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene mrdA CDS 3105239..3106351 product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816839.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene mrdB CDS 3106360..3107529 product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167887.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene rlpA CDS 3107682..3108893 product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167886.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene dacA CDS 3109007..3109270 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210322.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene ybeD CDS 3109415..3110083 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218201.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 gene lipB CDS 3110094..3111041 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042632.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene lipA CDS complement(3111343..3111543) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167881.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene tatA CDS complement(3111754..3112083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(3112239..3113156) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288005.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 3113458..3114489 product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703254.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 3114621..3115232 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216686.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(3115333..3115578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(3115596..3117140) product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355790.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene caiC CDS 3117346..3117561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(3117777..3118562) product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004377.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene caiD CDS complement(3118664..3120223) product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309938.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene caiC CDS complement(3120292..3121512) product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349928.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene caiB CDS complement(3121614..3122756) product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene caiA CDS complement(3122788..3124311) product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787084.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene caiT CDS 3124978..3125751 product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692187.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 3125763..3126704 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091510.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 3126763..3128055 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287774.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 3128052..3128339 product ferredoxin-like protein FixX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203737.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene fixX CDS 3128452..3129780 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136163.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(3129826..3130797) product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801813.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene aes CDS 3131257..3131703 product carnitine metabolism transcriptional regulator CaiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333324.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene caiF CDS 3132261..3133076 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904003.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 3133073..3133921 product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576821.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene modD CDS complement(3133967..3134539) product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 3134999..3135448 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798706.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 3135732..3136193 product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001796324.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(3136206..3136841) product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502842.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(3136843..3137937) product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283067.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 3138377..3140257 product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357009.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(3140323..3142728) product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798121.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(3142906..3143337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(3143347..3143685) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562568.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(3143682..3144944) product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(3145082..3145636) product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277849.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 gene pagP CDS 3146100..3147977 product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295514.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 gene gss CDS complement(3148077..3148409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(3148916..3150181) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205459.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 3150640..3152274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 3152641..3154539 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175141.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(3154657..3155553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 3155872..3157956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 3158093..3158806 product ZirU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223931156.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 3159001..3160308 product invasin domain 3-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097364336.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 tRNA complement(3160703..3160777) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00900 tRNA complement(3160783..3160858) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00910 tRNA complement(3161487..3161563) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00920 CDS 3161805..3162662 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816853.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene folD CDS 3162778..3162990 product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310620.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene ybcJ CDS complement(3163052..3164437) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222677.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene cysS CDS 3164624..3165118 product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158275.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene ppiB CDS 3165127..3165861 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212237.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene lpxH CDS complement(3165858..3167213) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830281.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 3167561..3168070 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208569.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene purE CDS 3168067..3169137 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704628.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene purK CDS complement(3169344..3171746) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208571.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(3171743..3172429) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208572.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 3172397..3173053 product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167777.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene tesA CDS 3173100..3173885 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208574.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 3173953..3174807 product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167772.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(3174789..3174983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 3175097..3175843 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480162.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 3175843..3176307 product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073203.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 3176328..3177440 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097629.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 3177608..3177829 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296778.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(3177898..3179199) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036723.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene eno CDS complement(3179280..3180917) product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703305.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 gene pyrG CDS complement(3181177..3181971) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167245.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene mazG CDS complement(3182060..3184306) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167242.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 gene relA CDS complement(3184346..3185668) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167240.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 gene rlmD CDS 3185752..3188556 product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369963.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 gene barA CDS complement(3188605..3188988) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172734.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene acpS CDS complement(3188988..3189719) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211569.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene pdxJ CDS complement(3189887..3190618) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370291.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene recO CDS complement(3190624..3191529) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159414.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene era CDS complement(3191526..3192206) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172746.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene rnc CDS complement(3192386..3193366) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815754.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene lepB CDS complement(3193452..3195245) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790169.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene lepA CDS complement(3195387..3195863) product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209675.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene rseC CDS complement(3195871..3196824) product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098322.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene rseB CDS complement(3196824..3197462) product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168446.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene rseA CDS complement(3197492..3198067) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003307.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene rpoE CDS complement(3198000..3198158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(3198381..3199748) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815019.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene brnQ CDS complement(3199985..3200728) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703186.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 3200933..3202279 product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219193.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene srmB CDS complement(3202469..3202852) product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627802.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene grcA CDS 3203282..3203980 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209663.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene ung CDS complement(3204057..3204659) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172778.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene grpE CDS 3204761..3205639 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172782.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene nadK CDS 3205763..3207424 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081869.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene recN CDS 3207624..3207980 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203437.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene bamE CDS complement(3208053..3208340) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900741.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(3208333..3208767) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815744.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 3208921..3209403 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166313.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene smpB tmRNA 3209452..3209815 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(3210847..3211227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 3211256..3211468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 3211727..3211888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 3212794..3213090 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096224.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 3213148..3213696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 3214286..3215701 product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302010.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene tnaA CDS 3215786..3217036 product low affinity tryptophan permease TnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131908.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene tnaB CDS complement(3217125..3218579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(3218848..3219840) product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261333.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 3219949..3220827 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705966.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 3220970..3221494 product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966677.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 3221660..3222145 product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094815.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 3222753..3223271 product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167476.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene mprA CDS 3223638..3224813 product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816950.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene emrA CDS 3224870..3226366 product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208746.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene emrB CDS 3226628..3227677 product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191691.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 3227727..3229340 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063864.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 3229337..3230026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(3230121..3231533) product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167236.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene degP CDS complement(3231754..3233277) product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209369.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene dgt CDS 3233505..3234179 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209368.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene mtnN CDS 3234183..3235049 product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175631671.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene btuF CDS 3235339..3235950 product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095644.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(3236109..3236453) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278668.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene erpA CDS complement(3236560..3237984) product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368182.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 gene clcA CDS 3238214..3239497 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704436.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene hemL CDS complement(3239773..3240042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 3240190..3240501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 3240458..3240637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(3241359..3241529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(3241713..3243290) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138293.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene guaA CDS complement(3243374..3244840) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172545.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene guaB CDS 3245012..3246397 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209810.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene xseA CDS complement(3246421..3247005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(3247002..3247391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(3247391..3249070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(3249104..3250054) product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199631.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene nrfD CDS complement(3250051..3250722) product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278023.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene nrfC CDS complement(3250719..3251318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(3251362..3252816) product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101783.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene nrfA CDS complement(3253259..3253480) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209811.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(3253490..3254446) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209812.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(3254540..3256030) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172557.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene der CDS complement(3256166..3257344) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177072.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 gene bamB CDS complement(3257356..3257976) product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172568.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(3257990..3259264) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107147.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene hisS CDS complement(3259374..3260495) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209817.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene ispG CDS complement(3260521..3261534) product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370323.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene rodZ CDS complement(3261560..3262288) product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172603.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 gene pilW CDS complement(3262391..3263626) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003317.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(3263814..3264245) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172605.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 gene ndk CDS complement(3264547..3265413) product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050129781.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene sseB CDS complement(3265493..3266794) product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081828.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene pepB CDS complement(3266928..3267128) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523621.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene iscX CDS complement(3267130..3267465) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124474.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene fdx CDS complement(3267468..3269318) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098292.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene hscA CDS complement(3269349..3269867) product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209833.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene hscB CDS complement(3269935..3270258) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209834.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene iscA CDS complement(3270325..3270711) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860661.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene iscU CDS complement(3270742..3271956) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775265.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene iscS CDS complement(3272026..3272559) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222202.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene iscR CDS complement(3272745..3273482) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815777.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene trmJ CDS 3273711..3274514 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213305.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene suhB CDS 3274711..3275742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(3275790..3277043) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098302.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 3277401..3278594 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883122.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene hmpA tRNA complement(3278945..3279021) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00930 CDS complement(3279153..3279833) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670675.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene dnaQ CDS 3279738..3279941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS 3279952..3280422 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210699.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene rnhA CDS complement(3280419..3281174) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173047.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 3281173..3281928 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210697.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene gloB CDS 3282211..3283377 product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018127.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene mltD CDS complement(3283442..3284206) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173073.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 tRNA complement(3284676..3284752) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00940 rRNA complement(3284803..3284913) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00240 rRNA complement(3285007..3287910) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00250 tRNA complement(3288103..3288178) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00950 rRNA complement(3288263..3289800) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00260 CDS complement(3290274..3292847) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167451.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 gene clpB CDS complement(3293027..3293761) product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815687.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene yfiH CDS complement(3293758..3294738) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079130.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene rluD CDS 3294871..3295608 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166516.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene bamD CDS 3295959..3296297 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914111.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene raiA CDS 3296592..3297758 product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815647.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene pheA CDS complement(3297783..3298904) product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703194.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene tyrA CDS complement(3298909..3299979) product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098343.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 gene aroF CDS 3300212..3300928 product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815646.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene btsR CDS 3301389..3302300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(3302314..3303210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 3304269..3305612 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167439.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 3305783..3306553 product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209462.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 3306712..3307260 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208694.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(3307411..3307758) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914145.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 gene rplS CDS complement(3307808..3308608) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393426.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene trmD CDS complement(3308605..3309150) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098350.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene rimM CDS complement(3309169..3309417) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166006.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene rpsP CDS complement(3309567..3310928) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167432.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene ffh CDS 3311122..3311910 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167431.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 3311989..3313275 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162197874.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(3313389..3313904) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209453.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene luxS CDS complement(3314070..3315629) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209452.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene gshA CDS complement(3315692..3316120) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209451.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS complement(3316117..3316692) product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098435.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene yqaB tRNA complement(3317030..3317106) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00960 tRNA complement(3317178..3317254) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00970 tRNA complement(3317326..3317402) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00980 tRNA complement(3317481..3317557) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00990 tRNA complement(3317562..3317654) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01000 CDS complement(3318281..3318466) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209449.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene csrA CDS complement(3318720..3321347) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047198.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene alaS CDS complement(3321482..3321958) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167422.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene recX CDS complement(3321961..3323022) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707431.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene recA CDS complement(3323086..3323577) product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301974.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene pncC CDS complement(3323730..3324374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(3324359..3325654) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982172.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(3325660..3326595) product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883041.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene glsA CDS complement(3326681..3328264) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(3328302..3329696) product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358927.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(3329949..3331526) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193473.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 3331927..3332250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS 3332373..3333029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 3333197..3335755 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815614.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene mutS CDS complement(3335842..3336828) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209397.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene rpoS CDS complement(3336880..3337821) product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209396.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene nlpD CDS 3337978..3338151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(3338196..3338828) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167299.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(3338822..3339586) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295182.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene surE CDS complement(3339567..3340613) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815611.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene truD CDS complement(3340617..3341090) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167293.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 gene ispF CDS complement(3341106..3341825) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209391.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene ispD CDS complement(3341878..3342222) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209390.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 gene ftsB CDS complement(3342311..3344569) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228076.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 gene ptsP CDS complement(3344570..3345103) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211381.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene rppH CDS 3345790..3346479 product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369924.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene mutH CDS 3346566..3347282 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895635.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(3347358..3348203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(3348350..3349807) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814403.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene phoA CDS complement(3349945..3351135) product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209842.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene lplT CDS complement(3351128..3353296) product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816988.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene aas CDS 3353924..3354931 product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209845.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene galR CDS 3354979..3355989 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098564.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 3356165..3356779 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098468.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 3356776..3358677 product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816729.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene hyfB CDS 3358688..3359623 product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098466.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 3359699..3361399 product formate hydrogenlyase subunit HycE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461354.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene hycE CDS 3361419..3361976 product hydrogenase 4 subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816732.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene hyfH CDS 3361973..3362797 product formate hydrogenlyase subunit HycG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067399.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene hycG CDS 3362794..3363237 product formate hydrogenlyase maturation HycH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816734.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 3363230..3363715 product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132961.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene hycI CDS 3364004..3366148 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077681898.1 transl_table 11 codon_start 1 transl_except (pos:3364421..3364423,aa:Sec) note codon on position 140 is selenocysteine opal codon. locus_tag LOCUS_30500 gene fdhF CDS 3366327..3366869 product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078791.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene hydN CDS 3367181..3369505 product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817173.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene hypF CDS 3369575..3369916 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544945.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene hypA CDS complement(3369919..3370491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 3370411..3371061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 3371061..3371354 product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817175.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene hybG CDS 3371358..3372476 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817174.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene hypD CDS 3372479..3373510 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077175158.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene hypE CDS complement(3373656..3374126) product formate hydrogenlyase regulator HycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158074.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene hycA CDS complement(3374415..3376517) product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816738.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene flhA CDS complement(3376710..3377963) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209846.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 gene lysA CDS 3378109..3379059 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173367.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 3379507..3381072 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209873.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 3381221..3382105 product OmpG porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209868.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 3382142..3384232 product autotransporter YapM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209869.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene yapM CDS 3384259..3387330 product chondroitinase family polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214081.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS 3387398..3390445 product chondroitinase family polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767535.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 3391016..3391942 product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484016.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene lpxP CDS 3392716..3393168 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602838.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 3393181..3393783 product DUF5384 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755800.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 tRNA complement(3393924..3393997) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01010 CDS 3394675..3395670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(3395736..3397253) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817018.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene lysS CDS complement(3397263..3398144) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095908218.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene prfB note possible pseudo, frameshifted CDS 3398025..3398261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(3398700..3400433) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173449.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene recJ CDS complement(3400438..3401154) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745614.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene dsbC CDS complement(3401182..3402081) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209933.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene xerD CDS 3402219..3402737 product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098613.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene fldB CDS complement(3402821..3403243) product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215144.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(3403224..3403490) product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004390965.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene sdhE CDS 3404061..3405056 product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209940.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 gene ygfZ CDS complement(3405109..3405933) product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215853.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS complement(3406144..3407019) product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295827.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene tsx CDS 3407595..3408245 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008806429.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(3408326..3409738) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948912.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(3410277..3413159) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817028.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene gcvP CDS complement(3413251..3413637) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703428.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene gcvH CDS complement(3413706..3414800) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209949.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene gcvT CDS complement(3415182..3416396) product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192220.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene ubiI CDS complement(3416425..3417576) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209951.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene ubiH CDS complement(3417600..3418922) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193684.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene pepP CDS complement(3419255..3419824) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209953.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 3420002..3420331 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004706812.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene zapA CDS 3420646..3421305 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262563.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(3421343..3422581) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163339.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene serA CDS complement(3422876..3423535) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369772.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene rpiA CDS 3423843..3424736 product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209958.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(3424838..3425557) product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173525.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(3425709..3426326) product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173528.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene argO CDS complement(3426485..3427351) product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817032.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene mscS CDS complement(3427611..3428687) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173534.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene fbaA CDS complement(3428799..3429962) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157067.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene pgk CDS complement(3430020..3431045) product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817037.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene epd CDS complement(3431378..3433372) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209965.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene tkt CDS 3433788..3435407 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(3435534..3436448) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434404.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene speB CDS complement(3436661..3438637) product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209969.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene speA CDS complement(3438630..3438836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 3439623..3440777 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098658.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 gene metK CDS 3441355..3442761 product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113171.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene galP CDS complement(3443177..3444517) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817275.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene pmbA CDS complement(3444848..3445255) product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169306.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene hns CDS 3445769..3446323 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166270.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene yjgA CDS complement(3446366..3446644) product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817276.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(3446650..3447099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(3447271..3448671) product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705235.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(3448783..3449043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(3449334..3449822) product IS200/IS605-like element IS1004 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503164.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene tnpA CDS complement(3449941..3451242) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS complement(3451242..3451745) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577036.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(3451812..3452798) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784004.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 3453170..3454090 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262119.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 3454216..3455331 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946317.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 3455335..3456591 product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467000.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 gene dcuC CDS 3456775..3457506 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225956012.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 3457515..3458261 product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182428.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 3458261..3458989 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168038.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene pnuC CDS complement(3459026..3459466) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706546.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(3459568..3460821) product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098677.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(3461219..3462481) product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049802.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 3463482..3464627 product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816380.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene cfa CDS 3464720..3465682 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136620923.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS complement(3465729..3466499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(3466803..3467939) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460796.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 gene appB CDS complement(3467957..3469495) product cytochrome bd-II oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263563.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene appC CDS complement(3469712..3469909) product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089673.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(3469902..3470759) product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063377.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(3470756..3471160) product hydrogenase-1 operon protein HyaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262577.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene hyaE CDS complement(3471154..3471747) product hydrogenase 1 maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003653.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(3471744..3472478) product Ni/Fe-hydrogenase b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147028.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene hyaC CDS complement(3472497..3474290) product Ni/Fe-hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070982.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene hyaB CDS complement(3474287..3475405) product hydrogenase 1 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058323.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene hyaA CDS 3476628..3478793 product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817119.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene speF CDS 3478899..3480230 product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173672.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene potE CDS 3480246..3482387 product lysine decarboxylase CadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295383.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene cadA CDS 3482815..3483456 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211263.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(3483524..3484747) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348936.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(3484894..3485631) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704105.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS complement(3485609..3487300) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216141.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS complement(3487390..3488769) product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS complement(3488809..3489774) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530994.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(3489779..3490528) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530993.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(3490528..3491526) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530992.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 3491879..3492295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(3492338..3493039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(3493286..3494590) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431603.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS complement(3495070..3496131) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216059.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 3496337..3496780 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307534.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 3496807..3497094 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004714840.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 3497105..3498361 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815933.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 3498532..3498687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS 3498650..3498916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(3499087..3499776) product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891449.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS complement(3500039..3501211) product invasin domain 3-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097364336.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(3501558..3502268) product ZirU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223931156.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(3502398..3504542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(3504773..3505069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(3506133..3506762) product tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824704.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(3507276..3507833) product tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824704.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS 3508051..3508785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 3508782..3509270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(3509588..3509929) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095004.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(3509932..3510240) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704006.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(3510314..3511213) product PEP phosphonomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901609.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(3511206..3512486) product PTS lichenan transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243273.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene licC CDS 3512720..3512881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 3513323..3516610 product protein YjiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191772790.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 gene yjiT CDS 3517028..3522943 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213431.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(3522983..3523321) product endoribonuclease SymE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681523.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene symE CDS complement(3523547..3524923) product type I restriction-modification system specificity subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272447.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene hsdS CDS complement(3524920..3526509) product type I restriction-modification system methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063204.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 gene hsdM CDS complement(3526581..3530093) product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043493.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 gene hsdR CDS complement(3530702..3531577) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141174869.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 tRNA complement(3531949..3532033) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01020 CDS complement(3532269..3533189) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689864.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene ldtB CDS 3533525..3534676 product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830736.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 gene ampH CDS complement(3534840..3535910) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175277.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 gene lptG CDS complement(3535910..3537010) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584132.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 gene lptF CDS 3537460..3538971 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098951.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 gene pepA CDS 3539127..3539576 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209309.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 3539601..3542456 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368547.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 3542680..3544416 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192556.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 3544438..3545754 product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192968.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 3545850..3546353 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815474.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(3546430..3546861) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209303.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 gene rraB CDS 3547033..3548037 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175288.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 gene argF CDS complement(3548089..3548577) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175289.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(3548769..3549968) product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050076855.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene glpC CDS complement(3549965..3551230) product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176408.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene glpB CDS complement(3551220..3552869) product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815350.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene glpA CDS 3553298..3554653 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948719.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene glpT CDS 3554765..3555838 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050076852.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene glpQ CDS 3556063..3556674 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094937.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 3556781..3558172 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703787.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene selA CDS 3558169..3560046 product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817432.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene selB CDS 3560201..3561730 product aldehyde dehydrogenase AldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183998.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene aldB CDS 3561836..3563122 product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807739.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 gene kch CDS complement(3563176..3563562) product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162498.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene ridA CDS complement(3563738..3564199) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148566.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene pyrI CDS complement(3564212..3565147) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817264.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 gene pyrB CDS complement(3565493..3567427) product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210095.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene aaeB CDS complement(3567445..3568368) product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174322.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene aaeA CDS complement(3568379..3568582) product p-hydroxybenzoic acid efflux pump operon protein AaeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174323.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene aaeX CDS 3568866..3569786 product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174326.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene aaeR CDS complement(3569839..3571284) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210082.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene tldD CDS complement(3571291..3572133) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210081.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(3572130..3575924) product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817280.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene yhdP CDS complement(3575984..3577453) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210079.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene rng CDS complement(3577443..3578036) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817281.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(3578072..3578560) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210077.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 gene mreD CDS complement(3578560..3579540) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802540.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene mreC CDS complement(3579533..3579730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(3579773..3580816) product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918653.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene mreB CDS complement(3581288..3583183) product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210075.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene csrD CDS 3583635..3584612 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210074.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 3584735..3585736 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050115893.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene msrP CDS 3585736..3586335 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241496.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene msrQ CDS 3586577..3587029 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210071.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene aroQ CDS 3587109..3587576 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369456.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene accB CDS 3587587..3588936 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884620.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene accC CDS 3589080..3589322 product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098993.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 3589312..3590766 product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817285.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene panF CDS 3590782..3591663 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817286.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene prmA CDS 3592215..3593171 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210062.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 gene dusB CDS 3593153..3593449 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene fis CDS complement(3593559..3594104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(3594107..3594391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 3594743..3595153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 3595391..3595726 product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173008.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(3595765..3596454) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174368.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(3596451..3596882) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257347.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 3597015..3597962 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174372.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(3598039..3599685) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174376.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(3599890..3601257) product guanine/hypoxanthine transporter GhxQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012163.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene ghxQ CDS complement(3601496..3602812) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295158.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene guaD CDS complement(3602843..3604261) product xanthine/proton symporter XanQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280215.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 gene xanQ CDS complement(3604467..3607337) product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583656.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(3607334..3608113) product molybdopterin-dependent oxidoreductase FAD-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572452.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 gene ygfM CDS complement(3608170..3609498) product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906252.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene ssnA CDS complement(3609501..3612608) product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502395.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene ygfK CDS complement(3612952..3613545) product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817484.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene mocA CDS 3613585..3614403 product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705211.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene yqeC CDS 3614432..3616024 product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706024.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene yqeB CDS complement(3616167..3617102) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037992.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene arcC CDS complement(3617183..3618568) product D-phenylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264448.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene hyuA CDS complement(3618627..3619844) product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107117.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(3619911..3621110) product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705214.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene dpaL CDS complement(3621183..3622370) product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303128.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene ygeW CDS 3622918..3624699 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366900.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(3624731..3625060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(3625206..3625760) product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209100.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene ssb1 CDS 3625980..3628811 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357740.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene uvrA CDS complement(3628867..3629211) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165225.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(3629204..3629632) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270375.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(3629840..3631036) product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368753.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene tyrB CDS 3631173..3632042 product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174084.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene dkgA CDS complement(3632092..3634368) product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174086.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS complement(3634570..3635499) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095021.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene metA CDS complement(3635657..3636775) product CMY2/MIR/ACT/EC family class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704504.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 gene ampC rRNA complement(3637145..3637255) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00270 rRNA complement(3637349..3640252) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00280 tRNA complement(3640416..3640491) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01030 tRNA complement(3640546..3640622) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01040 rRNA complement(3640697..3642236) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00290 rRNA complement(3642527..3642637) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00300 rRNA complement(3642730..3645633) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00310 tRNA complement(3645827..3645902) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01050 rRNA complement(3645987..3647528) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00320 CDS 3648046..3648603 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174588.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(3648576..3648845) product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070570.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(3648842..3649657) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451217.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene aroE CDS complement(3649661..3650233) product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361937.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene tsaC CDS complement(3650238..3650798) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369441.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(3650836..3651306) product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099011.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene smg sequence2 source 1..145764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 371..757 product conjugal transfer relaxosome DNA-binding protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151564.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene traM CDS 814..1554 product conjugal transfer complement resistance protein TraT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782438.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 gene traT CDS 1795..2496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 2628..2840 product conjugal transfer relaxosome protein TraY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254388.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene traY CDS 2912..3259 product type IV conjugative transfer system pilin TraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098988.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene traA CDS 3275..3580 product type IV conjugative transfer system protein TraL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012106.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene traL CDS 3598..4164 product type IV conjugative transfer system protein TraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399792.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene traE CDS 4151..4882 product type-F conjugative transfer system secretin TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230787.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene traK CDS 4882..6264 product F-type conjugal transfer pilus assembly protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146665.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene traB CDS 6264..6635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS 6632..6844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS 6856..7422 product type IV conjugative transfer system lipoprotein TraV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809888.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene traV CDS 7551..10178 product type IV secretion system protein TraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069778.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 gene traC CDS 10175..10546 product type-F conjugative transfer system protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214082.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene trbI CDS 10548..11183 product type-F conjugative transfer system protein TraW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203728.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene traW CDS 11180..12190 product conjugal transfer pilus assembly protein TraU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830838.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 gene traU CDS 12201..12866 product type-F conjugative transfer system pilin assembly protein TrbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080256.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene trbC CDS 12859..14694 product type-F conjugative transfer system mating-pair stabilization protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821859.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene traN CDS 14725..15477 product type-F conjugative transfer system pilin assembly protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030371.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene traF CDS 15488..15721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS 15699..16241 product type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059830.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene trbB CDS 16238..17605 product conjugal transfer pilus assembly protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309243.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene traH CDS 17605..20457 product conjugal transfer mating-pair stabilization protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007018.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene traG CDS 20454..20972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 21059..23269 product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009324.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 gene traD CDS complement(23347..23745) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911313.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(23745..23972) product toxin-antitoxin system antitoxin VapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450524.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene vapB CDS 24087..29324 product conjugative transfer relaxase/helicase TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986959.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 gene traI CDS 29407..30132 product conjugal transfer pilus acetylase TraX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205736.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 gene traX CDS 30146..30766 product fertility inhibition protein FinO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139315.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 30987..31169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS 31950..33026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049778728.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS 34103..35896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 35906..36163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 36211..36393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS 36538..36795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 36843..37025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 37256..38179 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002353252.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(39004..40449) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS complement(40487..41632) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS 41829..41981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(42002..42196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 note possible pseudo, frameshifted CDS complement(42771..45917) product Cu(+)/Ag(+) efflux RND transporter permease subunit SilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574029.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 gene silA CDS complement(45928..47142) product Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087116.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 gene silB CDS complement(47309..47659) product cation efflux system protein CusF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096581.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 gene cusF CDS complement(47693..49078) product Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475506.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene silC CDS 49264..49947 product copper response regulator transcription factor CusR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770953.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 gene cusR CDS 49937..51397 product copper/silver sensor histidine kinase SilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555736.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene silS CDS 51573..52022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 52552..52821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 52849..53322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33250 note possible pseudo, internal stop codon, frameshifted CDS 54015..54803 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024524434.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 54841..57351 product F1 capsule-anchoring usher protein Caf1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211763.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 gene caf1A CDS 57415..57936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(58051..58986) product IS481-like element ISSod13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073373.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 note possible pseudo, frameshifted CDS complement(59255..59794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 note possible pseudo, frameshifted CDS complement(60842..61282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 61327..62178 product IS5-like element IS903B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087110.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 62513..63457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 63759..63971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 64965..65402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 note possible pseudo, internal stop codon CDS 65852..66124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS 67335..68006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 note possible pseudo, frameshifted CDS complement(69042..69269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33380 note possible pseudo, internal stop codon, frameshifted CDS complement(69419..70840) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818491.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS 72103..72309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33400 note possible pseudo, internal stop codon, frameshifted CDS 74758..74922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33410 note possible pseudo, internal stop codon, frameshifted CDS 75533..75919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(76237..76863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(76860..78032) product CfaE/CblD family pilus tip adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705404.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(78016..80679) product TcfC E-set like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358674.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS complement(80702..81184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(81212..81919) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705402.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(82472..82657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 note possible pseudo, internal stop codon, frameshifted CDS complement(82716..83372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 note possible pseudo, internal stop codon, frameshifted CDS complement(83710..83883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 note possible pseudo, internal stop codon CDS complement(84479..86623) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038598.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(86755..87321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(87450..88214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(88241..89044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(89246..90028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(90230..90751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(90786..91577) product long polar fimbrial biogenesis chaperone LpfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822643.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 gene lpfB CDS complement(91570..93999) product F1 capsule-anchoring usher protein Caf1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211763.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 gene caf1A CDS complement(94013..94546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS complement(94566..94967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 95926..96135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 note possible pseudo, frameshifted CDS complement(96729..96920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33620 note possible pseudo, frameshifted CDS complement(97045..98139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(98957..99262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS 100655..101419 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176599.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(101478..102461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 103084..104283 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200287.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS 104291..105274 product ParB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431558.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS 106159..108768 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229117.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS 108783..110318 product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229116.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene casA CDS 110315..110851 product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229115.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene casB CDS 110851..111987 product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene cas7e CDS 111989..112636 product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 gene cas5e CDS 112627..113253 product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229112.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 gene cas6e CDS 113298..114164 product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220066.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene cas1e CDS 114167..114460 product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062282.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 gene cas2e repeat_region 114544..115489 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtattccccgcgtccgcggggatgaaccg CDS complement(115519..116652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS 116901..117590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(117622..118311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS 118695..118925 product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261288.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 gene vapB CDS 118922..119344 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044768.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS 119388..119783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33820 note possible pseudo, frameshifted CDS 119677..120579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33830 note possible pseudo, internal stop codon, frameshifted CDS 120610..121410 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208015.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(121996..122328) product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254750.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene mazF CDS complement(122328..122573) product type II toxin-antitoxin system antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581940.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene mazE CDS complement(122865..123473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194575.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(123461..123730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS 124235..124888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796228.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS 124900..125523 product DUF2913 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087265.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS 125520..126353 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013214009.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS complement(126399..126674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS complement(126720..127418) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556051.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS 127846..128814 product plasmid segregation protein ParM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103694.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene parM CDS 128816..129208 product plasmid partitioning/stability family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602156.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS complement(129405..132623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS 133298..133978 product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086135.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS 134036..134455 product DUF1380 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215082.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 134903..135331 product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198903.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 136230..136460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218642.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS 136512..137888 product DUF3560 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170671.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS 139327..139872 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290840.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS 139979..141943 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211744.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS 141988..142419 product conjugation system SOS inhibitor PsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845908.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene psiB CDS 142416..143144 product plasmid SOS inhibition protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276270.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS 143813..144718 product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155898.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(145223..145696) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817036.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 sequence3 source 1..5676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(374..607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS complement(614..1132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(1810..2148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 2198..2389 product Rop family plasmid primer RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213433.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(3850..5523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34120