COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..3219732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1136..1324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1246..1842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 assembly_gap 1295..1304 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1939..3006) product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065227.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene dctP CDS complement(3003..3794) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975370.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(4119..4391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(4483..5892) product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(6005..6391) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529414.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(6410..7177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(7174..8928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975260.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(8921..9985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 assembly_gap 9461..9470 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9973..10284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 assembly_gap 10001..10010 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10348..11334) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975258.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(11359..12801) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929684.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 12925..13803 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100419.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(13851..14150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 note possible pseudo, frameshifted CDS complement(14147..14446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 note possible pseudo, frameshifted CDS complement(14591..16318) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707307.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 16452..17282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 17279..18181 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640249.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene cysD CDS 18260..18613 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340660.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 18714..20600 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385211.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene cysN CDS 20738..21511 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818748.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene cysQ CDS 21662..22831 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703805.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 22818..24104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(24080..25408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(25408..26313) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035867.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene rfbD CDS complement(26310..26855) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene rfbC CDS complement(26852..27739) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene rfbA CDS complement(27761..28831) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771402.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene rfbB CDS complement(28937..30484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(30672..30878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(30972..31760) product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387737.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(31966..32928) product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391782.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(33109..37038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 37153..38094 product IS1595-like element ISXca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037261.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(38215..38496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(38577..38858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(38875..39744) product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945412.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(39969..40496) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050665004.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene radC CDS complement(40530..41339) product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234682.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(41445..42419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042012908.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(42544..43806) product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 44001..44387 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074395.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 44384..44665 product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007436.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene nadS CDS complement(44662..45024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 45450..45851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 note possible pseudo, frameshifted CDS complement(46459..46989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(47005..47304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(47519..49219) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207706.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(49470..50255) product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387737.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(50405..53314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(53865..54803) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266714.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(54806..55837) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414986.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene gmd CDS complement(55851..60041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(60041..61297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(61294..62517) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096884.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(63368..64498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(64505..65941) product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055873.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(65962..67335) product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009934990.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(67343..68905) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(68908..70284) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266724.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(70287..71981) product alkaline protease secretion ATP-binding protein AprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082539.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene aprD CDS complement(72634..72939) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962809.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(72939..73343) product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(73456..74718) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243779.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 75052..75291 product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 75288..75707 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(75849..78386) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267415.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(78383..79111) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 79143..79799 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994095.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(80096..80509) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269020.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(80865..81752) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704312.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 81872..82873 product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301878.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene zntB CDS complement(83101..83370) product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970743.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 83477..84793 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 84806..85327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 85462..85662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 85938..87599 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene ettA CDS complement(87684..87839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(87959..88873) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(89165..90265) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114351.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene alr CDS complement(90396..91865) product efflux transporter outer membrane subunit OpmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene opmH CDS complement(92022..92996) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113871.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene rpoS CDS complement(93153..94337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(94342..95271) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(95341..96015) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406213.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(95993..96748) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221538.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene surE CDS complement(96773..97738) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113870.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene truD CDS complement(97828..98316) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene ispF CDS complement(98313..99035) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036879.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene ispD CDS complement(99032..99367) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073295.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene ftsB CDS 99474..99785 product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(99978..100535) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 100687..101247 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266927.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 101317..101955 product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(102004..102789) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(102878..104326) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705619.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 104542..104922 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085915.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 104947..105306 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327476.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 105380..106312 product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 106380..107591 product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040383028.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 107594..108112 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226746.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(108103..109029) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705854.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 109372..111273 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene thiC CDS complement(111495..114047) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336989.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 114204..115256 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(115223..116146) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529161.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 116325..117449 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(117570..118457) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163530.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene cyoE CDS complement(118471..118797) product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208652.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(118799..119413) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179831.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(119415..121394) product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467180.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene cyoB CDS complement(121399..122232) product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082702.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene cyoA CDS 122747..123991 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707414.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 124134..125135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 125119..125529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(125541..127793) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111156.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(127901..131047) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(131047..132285) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 132419..133030 product efflux system transcriptional repressor NalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092152.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene nalD CDS complement(133039..133872) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838346.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(133915..135048) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 135163..135456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 135494..136900 product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529049.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(136935..137777) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(137817..139508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(139572..139949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(140285..141289) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114837.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene gap CDS 141488..143341 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091478.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene edd CDS 143338..144306 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216974.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 144303..145229 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895705.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 145226..146101 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146943968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 146245..147912 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932668.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene pgi CDS 147909..148889 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275390.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(148909..149577) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105021.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 149731..150666 product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118601.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 150807..151829 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084243.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 151957..152760 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942000.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene cysT CDS 152864..153673 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene cysW CDS 153670..154833 product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821532.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(154928..155782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(155809..156699) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737007.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(156696..157598) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113091.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(157600..158562) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104032.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 158979..159824 product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172619.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(160454..162223) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(162320..164374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(164364..166004) product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921572.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 166163..167794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(167898..168998) product glycine-betaine demethylase subunit GbcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096769.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene gbcB CDS 169379..170662 product glycine-betaine demethylase subunit GbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene gbcA CDS 170970..172721 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543739.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(172759..175092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(175339..175578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(175789..176178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(176328..177656) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776397.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(177698..178603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(178796..180994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(181108..182277) product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065227.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene dctP CDS complement(182415..182600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 182779..183567 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390684.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 183706..184689 product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(184727..186007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(186121..186933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114449.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(186923..188212) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114448.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(188209..190179) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075369439.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(190444..192528) product dimethylglycine demethylation protein DgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114446.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene dgcA CDS complement(192539..193084) product DUF5943 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107282.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(193235..194212) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114445.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 194501..195028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 195025..195759 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040306.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 195768..196106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 196258..196623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 196635..197042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(197068..197226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(197271..198260) product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077244862.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 assembly_gap 198353..198362 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(198470..198682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 note possible pseudo, internal stop codon, frameshifted CDS complement(198591..199088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 note possible pseudo, internal stop codon, frameshifted CDS complement(199190..199711) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004863699.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene lspA CDS complement(199765..201303) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene lnt CDS complement(201497..202255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(202369..203205) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574643.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 203364..203798 product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004364961.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene cadR CDS complement(203956..204678) product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546387.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 204900..205532 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(205687..206289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 206416..207408 product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217985.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(207398..208093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(208172..208618) product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166628.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene merR CDS 208692..209042 product mercuric transport protein MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294660.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 209056..209352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 209355..209612 product mercury resistance system transport protein MerF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654684.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene merF CDS 209686..209931 product mercury resistance system transport protein MerF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654684.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene merF CDS 209924..211573 product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281123.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene merA CDS complement(211796..211987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 211926..213629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(213831..214760) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971402.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(214877..215581) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103140.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene mtgA CDS complement(215834..216973) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096699.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(217294..217923) product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene pcaG CDS complement(217928..218665) product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102187.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene pcaH CDS 218875..219123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(219141..220055) product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765677.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene pcaQ CDS complement(220175..221467) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(221464..221982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(221997..223016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(223325..224509) product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284957.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene pcaD CDS complement(224591..225796) product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075194926.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene pcaF CDS complement(225800..226573) product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402699.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(226573..227391) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(227565..228911) product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196555.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 229049..229840 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807682.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 229876..230658 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 230694..231641 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207577.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 231864..233603 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113725.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 233600..234412 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084082.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(234496..234927) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339256.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene aroQ CDS complement(234924..235790) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112680.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(235844..237691) product sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083873.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 238075..239076 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339285.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 239148..239618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 239634..241133 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 241183..241866 product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(241874..242587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(242725..245757) product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene glnE CDS complement(245906..247933) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022341.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene aceF CDS complement(248027..250711) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene aceE CDS complement(251013..251585) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095590.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene ampD CDS 251662..252516 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770545.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene nadC CDS complement(252513..253028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 253137..253886 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212157.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene tsaA CDS complement(253909..254622) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108622.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(254732..255535) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(255535..256482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(256517..257401) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene dapA CDS 257625..258101 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104801.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(258092..259189) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(259186..259431) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317380.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 259533..260981 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767670.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(261291..262310) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115913.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene nadA tRNA complement(262546..262621) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(262653..262728) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(262771..262846) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(262917..263777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 note possible pseudo, internal stop codon CDS complement(263774..264601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(264594..265568) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040933466.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(265827..267644) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706128.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 267814..268050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(268133..272059) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene purL CDS 272236..273693 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080546580.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene mltF CDS complement(273697..274203) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092697.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene tadA CDS 274228..275040 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268943.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene tesB CDS complement(275122..276183) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244776.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 276412..277359 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769653.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(277346..278080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 278532..280055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(280146..280694) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970806.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(280698..280967) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970805.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(281120..281830) product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922379.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 281996..283300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(283372..284037) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339095.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 284178..285812 product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112648.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 285815..286375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 286375..286905 product chromate resistance efflux protein ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227840.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene chrA CDS 286993..287991 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582705.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 287988..288533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 288568..290067 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 290108..290914 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759079.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(290965..291831) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(291863..292870) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200388.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 293126..294238 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528460.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(294235..294456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 294343..295623 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(295693..296148) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946939.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(296272..296646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 296830..297555 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 297684..297875 product DUF3008 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812228.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 298018..299064 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097452.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 299221..299823 product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404639.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(300088..301548) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971553.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 302088..302384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 302481..303485 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113787.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene yejK CDS 303524..304528 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707351.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(304588..305844) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249937.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 305962..306732 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893817.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(306805..307674) product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530630.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene yghU CDS 307971..309941 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941696.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(309992..310657) product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114764.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 310875..312116 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(312120..313814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(314059..314628) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020423.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 314906..316414 product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 316707..317246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 317458..318837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 assembly_gap 319071..319080 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(319103..319429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 319806..320021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 320624..321538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 321653..321982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(321948..322472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(322469..323404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 note possible pseudo, frameshifted assembly_gap 322516..322525 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 323743..324378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(324671..325912) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974548.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 326469..326588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(326780..327415) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978560.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(327465..328823) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(328816..329451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(329454..330536) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403641.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 331063..332565 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(332837..334216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 334369..335223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 335223..335567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 335657..336649 product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217985.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 336630..337262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 337275..337688 product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970457.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 337901..339436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(339721..341295) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105901.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene guaA CDS complement(341495..342955) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092702.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene guaB CDS 343134..344546 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene xseA CDS complement(344558..345922) product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625590.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene glrR CDS complement(345993..346517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(346522..347967) product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001538042.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene qseE CDS complement(348861..350174) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925787.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene argA CDS complement(350549..351820) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100079.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(351873..352553) product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 352656..353549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 353565..354437 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(354495..355118) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396553.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(355187..356089) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767709.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 356184..356735 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947024.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 356769..357068 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 357238..359076 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402494.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 359229..361259 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114497.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene mnmC CDS complement(361287..362090) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948022.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(362137..363291) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085560.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 363508..364527 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704457.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 364517..365458 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704458.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 365455..366546 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704459.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(366766..367032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(367029..369080) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878165.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene ligA CDS complement(369206..370465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(370653..374147) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene smc CDS complement(374240..375478) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268399.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene ccmI CDS complement(375475..375921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(375933..376466) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298853.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(376463..378445) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(378460..378915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(378899..379138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(379375..380106) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083135.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(380119..380817) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815897.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene ccmB CDS complement(380817..381479) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene ccmA CDS 381623..382096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 382096..382716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 382799..383818 product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104220.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 tRNA complement(383993..384069) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(384181..384257) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(384282..384374) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(384550..384747) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305164.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene csrA CDS complement(384960..386210) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085971.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(386325..388934) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene alaS CDS complement(389217..389675) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098485.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene recX CDS complement(389685..390752) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092260.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene recA CDS complement(390873..391397) product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766018.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 391577..394171 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene mutS CDS 394387..394710 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(395212..396507) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene eno CDS complement(396585..397439) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121042.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene kdsA CDS complement(397447..399102) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(399228..399776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(399918..401336) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(401375..405826) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene gltB CDS complement(406238..407347) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114574.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene aroB CDS complement(407352..407894) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095833.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene aroK CDS complement(407894..409927) product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765499.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(409924..410514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(410511..411158) product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene pilO CDS complement(411155..411739) product PilN family type IV pilus biogenesis protein TapN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706969.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene tapN CDS complement(411736..412797) product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 412739..413029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 413026..415557 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958515.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 415654..416424 product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705111.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(416496..417764) product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(417952..419115) product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022426.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(419159..420103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(420346..422640) product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113616.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(422637..424316) product nuclease Fan1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113615.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene fan1 CDS complement(424584..425207) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 425351..426463 product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104504.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene aguA CDS 426584..428086 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 428199..428624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550533.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(428630..428815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(428927..430561) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002495210.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 430821..431522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 431515..433011 product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 433008..433688 product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 433675..434460 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 434488..435153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 435598..436599 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(436604..437374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 437422..437991 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 437988..438569 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112465.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(438711..439664) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351598.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene tal CDS complement(439828..441204) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440230.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(441201..441872) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920607.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(441880..442218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 442394..442801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 442840..443214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(443269..444102) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963355.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(444267..445409) product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268471.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene pobA CDS 445621..446505 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084097.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 446691..448082 product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189641.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene cueO CDS complement(448196..449050) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113869.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene fghA CDS complement(449104..450213) product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038487.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 450355..451230 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(451250..452038) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339467.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(452292..453671) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111339.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 453816..454751 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406407.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(454815..456677) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085035.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene rpoD CDS complement(456910..458727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(458873..459088) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085057.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene rpsU CDS 459624..460559 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109020.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene tsaD CDS complement(460702..461370) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703522.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene plsY CDS 461338..461739 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316242.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene folB CDS 461739..462278 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene folK CDS complement(462294..463436) product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708487.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene cca CDS complement(463433..463762) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085081.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene glpE CDS complement(463796..464623) product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110655318.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(464654..465040) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815381.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene apaG CDS complement(465037..465858) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene rsmA CDS complement(465911..466933) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109023.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene pdxA CDS complement(466933..468234) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103188.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(468252..470669) product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269131.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 470805..471839 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 471836..472504 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931409.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 472544..472969 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(473043..473684) product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269103.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene coq7 CDS complement(473806..474147) product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(474182..475054) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159760.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(475056..475499) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(475527..476813) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866856.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene purD CDS complement(476909..477361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 477480..478193 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095898.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 478425..479762 product biofilm dispersion protein BdlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082971.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene bdlA CDS complement(479765..481042) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114332.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 481183..482112 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105274.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene trxA CDS complement(482195..483349) product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257518.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 483402..483827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 484086..484901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463854.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 484950..485360 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 485357..485827 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene ybaK CDS 485854..486183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 486152..486673 product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229927.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 486698..487252 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 487308..488294 product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114796.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(488316..488834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(489010..489519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 489741..490772 product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930118.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 490866..491648 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266801.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene yaaA CDS 491757..492581 product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099685.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(492665..492862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 rRNA complement(493129..493239) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 assembly_gap 494549..494558 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 496143..496152 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(496156..496231) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(496355..496431) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 rRNA complement(496527..498059) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 CDS complement(498671..499867) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269097.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene tyrS CDS 499968..501077 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269098.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(501104..502249) product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene pilU CDS complement(502288..503328) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene pilT CDS 503376..504083 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 504112..504948 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene proC CDS 504961..505551 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 505639..506799 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 506799..507410 product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene metW CDS complement(507445..508203) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071164.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene sfsA CDS complement(508205..509395) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113459.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 509610..510047 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene dksA CDS 510108..510995 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115557.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene gluQRS CDS 511083..511259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095129.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 511249..514212 product two-component system sensor histidine kinase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene cbrA CDS 514103..515581 product two-component system response regulator CbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene cbrB CDS 516510..517919 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095142.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 517912..518412 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156774.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene folK CDS 518535..519326 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene panB CDS 519326..520177 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266657.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene panC CDS 520366..521544 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 521685..522743 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063930.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene hisC CDS complement(522834..524957) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095181.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene pnp CDS complement(525152..525421) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095184.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene rpsO CDS complement(525530..526432) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene truB CDS complement(526432..526833) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095188.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene rbfA CDS complement(526855..529365) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268881.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene infB CDS complement(529393..530886) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene nusA CDS complement(530915..531376) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene rimP tRNA complement(531519..531595) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(531705..531791) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(531915..532277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(532280..533029) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186004.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene tpiA CDS complement(533106..534455) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene glmM CDS complement(534452..535315) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113907.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene folP CDS complement(535412..537376) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095200.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene ftsH CDS complement(537470..538117) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene rlmE CDS 538359..538685 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095204.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene yhbY CDS complement(538810..539286) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148008.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene greA CDS complement(539283..542513) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095207.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene carB CDS complement(542565..543671) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095209.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene carA CDS complement(544006..544818) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400159.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene dapB CDS 544945..545916 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037718.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(545888..546814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(546879..547529) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971443.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(547689..548834) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene dnaJ CDS complement(548924..550858) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene dnaK CDS complement(550964..551584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 551780..553453 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113905.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene recN CDS 553672..554343 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 rRNA complement(554581..554691) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 assembly_gap 555002..555011 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(555253..556116) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene pssA CDS complement(556273..557289) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene ilvC CDS 557482..558432 product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene ilvY CDS complement(558422..558913) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552075.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene ilvN CDS complement(558913..560637) product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095071.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(561077..563662) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094682.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene clpB CDS complement(563816..564571) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene pgeF CDS complement(564568..565527) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209470.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene rluD CDS 565686..566477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(566613..568244) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 568401..568661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(568674..569756) product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene thiO CDS complement(569825..570202) product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071144.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(570232..570804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(570801..571454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(571501..571965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 572064..572582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(572632..573591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(573636..574214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(574211..574675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(574672..575151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(575129..575554) product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103296.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(575661..576614) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112824.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene ispH CDS complement(576670..577119) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102613.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene fkpB CDS complement(577145..577654) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112823.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene lspA CDS complement(577706..580540) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112822.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene ileS CDS complement(580550..581617) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371105.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene ribF CDS complement(581663..583315) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073367.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene murJ CDS complement(583452..583718) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073368.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene rpsT CDS complement(584115..585257) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene proB CDS complement(585315..586511) product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957543.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene cgtA CDS complement(586610..586867) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417307.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene rpmA CDS complement(586904..587215) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271393.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene rplU CDS 587557..588531 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344609.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 tRNA 588600..588676 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 589370..590194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 590181..590732 product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 590783..594217 product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene brxC CDS 594232..595545 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404780.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 595542..596000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839539.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 596097..597317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 597402..598394 product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217985.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 598375..599649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 599668..599946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 note possible pseudo, frameshifted CDS 599985..600818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 note possible pseudo, frameshifted CDS 601022..601888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 601920..603026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 603019..604326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 604328..606202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 606258..608591 product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene pglZ CDS 608620..610680 product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948297.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene brxL CDS 610837..611028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(611291..611521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(611562..612935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 613107..614078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 assembly_gap 614105..614114 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(614977..616278) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(616275..616751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(616837..617868) product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965687.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene dctP CDS complement(617959..620307) product cytochrome P450/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187052.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 620469..621131 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975875.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(621247..621729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(621831..622412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(622537..622782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 623067..623249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(623308..625350) product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742782.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(625389..626690) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226140.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 627043..627849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 628152..631088 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119658.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene rapA CDS complement(631215..632126) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114699.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 632253..633293 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 633286..633666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 633784..634701 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768834.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 634729..636144 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114697.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene phrB CDS 636498..636926 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736559.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 636951..637748 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266741.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 637745..639058 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 639284..639874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 note possible pseudo, frameshifted CDS 639871..641142 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036521.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(641167..642957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(643045..643227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 643220..643735 product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087475.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene fabA CDS 643749..644966 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene fabB CDS complement(645110..645865) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(645862..646728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 646927..647790 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918705.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 648048..648905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 649225..650385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 650509..653037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 653021..655396 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162234441.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 655547..656146 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836185.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 656196..657254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 657251..659011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 659063..660061 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419383.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 660099..660722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 660741..661820 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848110.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene rffG CDS 662086..662694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 note possible pseudo, frameshifted CDS 662772..663641 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103413.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene rfbA CDS 663793..664272 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036472525.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene rfbC CDS 664301..666661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 666866..667750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 668045..669448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(669591..669872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(669933..670964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 note possible pseudo, frameshifted CDS complement(670991..671500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 note possible pseudo, frameshifted assembly_gap 671542..671551 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 671608..671838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 671869..673128 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073075.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 673179..673532 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 673529..674530 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene rfbD CDS 674582..675157 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387749.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene rfbC CDS 675154..676029 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706707.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene rfbA CDS 676029..676229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 676269..677489 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338425.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(677581..678435) product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227634.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(678473..679750) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(679962..680861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228671.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(681006..681890) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973352.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 682080..682541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 682885..683337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 683337..683900 product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097615831.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 tmRNA complement(684204..684582) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(684641..685120) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100496.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene smpB CDS 685409..685846 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210715.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 685839..686138 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095218.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(686140..686616) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105026.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 686689..687120 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095216.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene fur CDS complement(687167..687922) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918305.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(688005..688199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 688451..688663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(688711..688908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 689206..691563 product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704820.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene ybiO CDS complement(691658..693025) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189169.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(693239..694462) product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772915.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(694459..695874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(695881..696669) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114032.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(696669..697616) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703979.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene hemC CDS 697933..699339 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene argH CDS 699336..699551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 699557..700825 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114343.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene lysA CDS 700825..701661 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103038.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene dapF CDS 701718..702437 product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266243.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 702421..703341 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114345.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene xerC CDS 703370..704074 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(704117..704734) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183327.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene yihA CDS 705091..705723 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763490.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 705804..706613 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266288.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 706772..707329 product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 707329..708735 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(708816..710264) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090482.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene nuoN CDS complement(710261..711808) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071275.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene nuoM CDS complement(711876..713735) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705658.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene nuoL CDS complement(713746..714054) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090475.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene nuoK CDS complement(714051..714596) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090473.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene nuoJ CDS complement(714618..715157) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090467.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene nuoI CDS complement(715174..716154) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705661.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene nuoH CDS complement(716151..718898) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113377.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene nuoG CDS complement(718944..720302) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861487.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene nuoF CDS complement(720299..720802) product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090460.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene nuoE CDS complement(720805..722466) product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619059.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene nuoC CDS complement(722628..723308) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090455.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(723396..723803) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554011.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(724007..724438) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337356.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 724502..725314 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547623.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene thiD CDS 725644..726489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 726707..727144 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765550.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene dtd CDS 727162..727941 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941357.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(727967..728242) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095983.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene bamE CDS complement(728245..730164) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 730213..730764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 730903..731529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 731563..732846 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813565.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(733200..734228) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813561.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 734419..735171 product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene mip CDS complement(735226..735747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 735872..736789 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096914.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(737024..737752) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118800.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene trmB CDS complement(737766..738563) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084517.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(738641..738841) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene thiS CDS complement(738920..740401) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706925.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 740583..740969 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261343.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(740996..741421) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087727.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(741647..743386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 assembly_gap 742307..742316 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(743383..743718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 assembly_gap 743531..743540 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 743976..744947 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 744944..745432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 745516..746622 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384956.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(746638..747690) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404758.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(747775..749295) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(749420..749824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 750133..750471 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene glnK CDS 750498..751742 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 751906..752244 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene glnK CDS complement(752492..753268) product ferredoxin-NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene fpr CDS 753417..754343 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091833.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 754681..757098 product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082816276.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene pgaA CDS 757095..759053 product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064163.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene pgaB CDS 759050..760315 product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098698.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene pgaC CDS 760305..760601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(760731..761699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(761765..762574) product sigma factor SigB/phosphatase RsbP regulator RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228292.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene rsbQ CDS 762977..764857 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene ftsH CDS complement(765398..765796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(765875..766675) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105307.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(766841..767518) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366445.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene narI CDS complement(767515..768276) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096258.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene narJ CDS complement(768269..769837) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092958.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene narH CDS complement(769834..773604) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032878.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(773632..776328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 776225..776446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 776632..778458 product two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105296.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene narX CDS 778455..779096 product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene narL CDS 779246..779953 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087410.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 780065..780682 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073378.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(781140..782336) product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707628.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(782350..783531) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113387.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene hmpA CDS 784116..785174 product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063658.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(785184..786155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(786210..789257) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239259.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(789366..791048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(791053..792945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(793126..793809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(793806..797174) product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(797308..797973) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112481.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(797976..799127) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114797.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(799124..799984) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091589.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(799968..800801) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091588.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(800798..801622) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114798.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(801678..802757) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479781.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 803181..803804 product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091585.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(803956..805299) product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986374.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(805404..806210) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091099.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 806130..806594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 806689..807861 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705827.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 807969..808367 product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468486.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 808465..809013 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392990.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 809050..811101 product bifunctional DedA family/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038389.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 811086..811457 product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382894.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(811485..812807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(812972..815701) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207762468.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(815717..816235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(816331..818238) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921802.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(818348..819238) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(819266..820726) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929820.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(820758..822032) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926811.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(822029..822628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(822685..823698) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039499.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(823803..824765) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194986.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(824800..825612) product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105295.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(825643..826290) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244129.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(826287..827567) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528722.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(827564..828496) product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528721.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 tRNA complement(828328..828420) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 828694..829722 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253376.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(829729..830481) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196745.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene ugpQ CDS complement(830478..831596) product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529416.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(831704..832549) product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339185.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene ugpE CDS complement(832549..833424) product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811262.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene ugpA CDS complement(833492..834838) product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211520.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene ugpB CDS 835148..836455 product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194851.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene hmgA CDS 836490..837509 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706476.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 837736..838080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 838077..838487 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085868.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene arsC CDS 838504..839814 product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095195.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 839977..841617 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(841720..841992) product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816743.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(841970..842245) product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213585.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 842532..844556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 844693..845673 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083539905.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 845670..847121 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918507.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 847118..848110 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 848175..849074 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962250.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 849138..852362 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704238.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 852428..857239 product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065729.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 tRNA complement(857598..857674) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(857760..858551) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463915.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(858645..859937) product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(859991..860344) product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329197.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene uraH CDS 860536..861063 product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083333.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene uraD CDS 861175..862014 product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174577.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene iclR CDS complement(862015..862869) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245662.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 862889..864061 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926366.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(864146..864592) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706917.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene ruvX CDS complement(864589..865146) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100947.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(865161..866087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(866103..867071) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100943.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene gshB CDS complement(867354..868094) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419139.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(868409..869137) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106127.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(869236..869721) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372189.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene secB CDS complement(869769..870188) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269284.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 870421..871995 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene gpmI CDS 872003..873163 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 873401..874732 product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene cptA CDS complement(874850..876088) product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266320.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(876115..877317) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103968835.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene ubiH CDS complement(877393..878730) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444958.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene pepP CDS complement(878768..879361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 879500..879802 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071078.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene zapA CDS 880084..880704 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096321.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(881064..882578) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene ilvA CDS 882748..883419 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084386.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene rpiA CDS complement(883421..884713) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene waaA CDS complement(884717..886147) product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707478.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene hldE CDS complement(886144..887229) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064632.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 887228..887959 product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036197.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(887974..888576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(890033..891082) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260993.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 891201..891974 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 892049..893626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(893674..894720) product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699268.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene waaF CDS complement(894713..895684) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene rfaD CDS 895815..896762 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene glyQ CDS 896765..898831 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114646.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene glyS CDS 899001..899567 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120688.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene gmhB CDS 899580..900458 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338699.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 900554..902926 product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992291.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(903039..905459) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097268.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene gyrB CDS complement(905479..906570) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377871.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene recF CDS complement(906617..907720) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene dnaN CDS complement(907792..909264) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102932.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene dnaA CDS 910017..910400 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239730.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene rnpA CDS 910462..912147 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114648.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene yidC CDS 912254..913630 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244945.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene mnmE CDS 913844..914863 product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077244862.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 assembly_gap 914825..914834 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(914931..915791) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909376.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(915785..916795) product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817430.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(916805..917635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(917646..918509) product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169047059.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(918506..918835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 918842..919039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(919768..921129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 assembly_gap 921222..921231 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(921448..922299) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816518.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene rlmJ CDS complement(922379..923053) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073706.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(923106..924272) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114885.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene hemW CDS complement(924278..924871) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174735.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 925323..925979 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707638.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 925985..926476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 926515..926922 product curli assembly protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073481.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 926937..927773 product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421307.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 928197..929048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 929017..929526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 note possible pseudo, frameshifted CDS 929553..930584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 note possible pseudo, frameshifted CDS 930613..931335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 931562..932044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 932135..933001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(933088..934656) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(934681..935967) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093150.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene hemL CDS complement(936044..936694) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene thiE CDS complement(936681..937517) product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(937517..937948) product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113170.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene hemJ CDS complement(937988..939715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 939936..940289 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085254.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene erpA CDS 940459..941226 product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937418.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene glnH CDS 941340..942011 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937417.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 942022..942795 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228477.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 943350..945254 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114649.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene mnmG CDS 945251..945877 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377883.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene rsmG CDS 945916..946683 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958543.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 946713..947642 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 947849..948247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 948263..949129 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100237.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene atpB CDS 949181..949429 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555987.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene atpE CDS 949495..949965 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100235.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 949977..950516 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 950533..952077 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097134.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene atpA CDS 952142..953017 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene atpG CDS 953069..954445 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene atpD CDS 954472..954900 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097128.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 955085..956446 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114651.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene glmU CDS 956551..957321 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005339356.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 957338..959173 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269442.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene glmS CDS complement(959183..960310) product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549948.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 960445..961362 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021454571.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 961856..963217 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(963282..963482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 963682..964569 product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096857.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene hexR CDS 964622..966871 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096872.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene uvrD CDS 966893..967351 product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152114.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 967486..968571 product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene dctP CDS complement(968602..969018) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096677.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 969349..970077 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401254.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene phoU CDS 970163..970906 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408742.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene cysZ CDS complement(970986..972335) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene phoR CDS complement(972346..973035) product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096653.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene phoB CDS complement(973162..974061) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104612.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene ubiA CDS complement(974092..974565) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114374.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 974731..975903 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 976026..976301 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096630.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 976383..976739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 976847..979021 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113274.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene yccS CDS complement(979032..981113) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene recG CDS complement(981110..982003) product oxidative stress transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096622.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene oxyR CDS 982108..982983 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(983005..983538) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807724.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene thpR CDS complement(983727..984116) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217718.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(984222..986363) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene spoT CDS complement(986468..986722) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003320174.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene rpoZ CDS complement(986799..987431) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene gmk CDS 987534..988727 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896567.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 988749..989798 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213109.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene pyrC CDS 989909..990382 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363288.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 990379..991491 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067010.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 991484..993064 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081361309.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 993175..994368 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275407.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 994439..996241 product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 996287..996589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(996562..997782) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331457.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 998024..998776 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(998901..999806) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808483.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 1000009..1001313 product salicylate 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207155.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene salA CDS complement(1001739..1002080) product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(1002170..1003291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(1003362..1003871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(1003868..1004443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881788.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(1004530..1004781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(1004849..1005082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(1005127..1005555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(1005617..1007950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 1008151..1009356 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398095.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 1009365..1011065 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338059.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 1011099..1011749 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968331.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 1011903..1012304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 note possible pseudo, frameshifted assembly_gap 1012719..1012728 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1013077..1013370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 1013717..1014385 product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838970.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 1014429..1014743 product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482613.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 1014789..1015505 product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256873.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 1015495..1016127 product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 1016205..1016828 product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194486.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 1017043..1017945 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707711.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(1017932..1018246) product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728716.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(1018327..1018779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(1018889..1019584) product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258735.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 1019762..1020319 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 1020554..1022701 product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(1022761..1023624) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098315.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 1023769..1024506 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene rph CDS complement(1024576..1025343) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551505.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 1025442..1026110 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096586.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene pyrE CDS 1026192..1026743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 1026841..1027389 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932331.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene trmL CDS 1027393..1029423 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110454.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene rep CDS complement(1029452..1029856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 note possible pseudo, internal stop codon, frameshifted CDS complement(1029888..1030289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 note possible pseudo, internal stop codon, frameshifted CDS complement(1030430..1031173) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767814.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 1031470..1032408 product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521217.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene puuE CDS 1032588..1033421 product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392210.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 1033604..1034092 product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083329.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 1034372..1036150 product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114301.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene gcl CDS 1036311..1037090 product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087181.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene hyi CDS 1037306..1038190 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392230.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene glxR CDS 1038381..1039733 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244121.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 1039733..1041202 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814419.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene pyk CDS 1041316..1042473 product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728729.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 1042421..1043056 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230606.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(1043120..1043956) product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370329.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene efeO CDS complement(1043997..1045298) product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene efeB CDS complement(1045333..1046478) product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268391.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene efeO CDS complement(1046492..1047328) product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268390.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 1047517..1048767 product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267732.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(1048781..1049590) product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(1049628..1050110) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 1050278..1051177 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(1051165..1052232) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250267.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(1052225..1052701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(1052698..1053687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(1053674..1053877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 1053980..1056088 product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692046.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene pqqU repeat_region 1056122..1059751 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagccgcctgctcggcggtgaac CDS complement(1059893..1060450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(1060455..1061486) product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121972636.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene csy3 CDS complement(1061525..1062412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(1062409..1063578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 1063880..1066696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(1066875..1068125) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene serA CDS 1068457..1068747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 1068737..1069627 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 1069762..1071702 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266507.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene dxs CDS 1071715..1072494 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704885.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene djlA CDS complement(1072495..1073085) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324738.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 1073157..1073612 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089301.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene soxR CDS complement(1073620..1074279) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136889.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(1074320..1074955) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412070.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene ribA CDS 1075128..1076195 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114569.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene hemE CDS 1076200..1076553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(1076570..1077499) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931519.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(1077672..1078124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(1078276..1078851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(1078851..1081829) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene fdhF CDS 1082176..1082796 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811946.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 1082971..1083399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 1083581..1085455 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525719.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(1085498..1085995) product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036969.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 1086141..1087832 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063730.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 tRNA complement(1087065..1087143) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(1087837..1090362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 1090596..1090769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(1090785..1091378) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391007.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 1091563..1092441 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811290.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 1092551..1094347 product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 1094397..1096115 product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene cysI CDS complement(1096459..1096761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063654.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(1096758..1097558) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(1097546..1098307) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808828.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(1098304..1099341) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(1099479..1101368) product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(1101365..1102051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(1102065..1102739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(1102750..1103196) product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871651.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(1103184..1104983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(1104980..1105594) product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(1105551..1106927) product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556695.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(1107271..1107903) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 1107793..1108017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(1108027..1108575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 1108787..1109749 product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115797.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(1110074..1111018) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418863.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(1111022..1111252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(1111242..1113323) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(1113528..1114064) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101793.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene gloA CDS complement(1114403..1115551) product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083820.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(1115548..1118058) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336818.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(1118055..1118720) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268625.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(1119133..1120095) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931286.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 1120197..1121018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(1121023..1121919) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376994.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(1121916..1122638) product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064719.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene aztA CDS complement(1122638..1122784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(1122872..1123561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 1123734..1124003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(1124013..1125908) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009950383.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 1126464..1129151 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091704098.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 1129479..1131137 product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084093.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene casA CDS 1131134..1131790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 1131820..1132893 product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206445.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene cas7e CDS 1132904..1133659 product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666425.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene cas5e CDS 1133659..1134351 product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281463.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene cas6e CDS 1134376..1135296 product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144875.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene cas1e CDS 1135298..1135594 product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378852.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene cas2e repeat_region 1135701..1145622 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgatccccgcaggcgcggggataacccg CDS complement(1146003..1146179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(1146237..1146440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(1146689..1146997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 1147181..1147642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(1147694..1148320) product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460838.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene ompW CDS complement(1148541..1150472) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096009.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene typA CDS 1150547..1151185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(1151196..1152185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(1152266..1152829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 1153388..1154797 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096016.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene glnA CDS 1154933..1155529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 1155733..1156776 product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene ntrB CDS 1156862..1158271 product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene ntrC CDS 1158698..1159648 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256277.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 1159654..1160883 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051056494.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1160906..1161901 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098088.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 1161898..1162371 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268760.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 1162385..1163887 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114173.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 1164122..1165174 product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500869.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene fbaB CDS complement(1165292..1167286) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110216.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene tkt CDS 1167819..1169039 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084948.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene metK CDS 1169296..1169688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 1169984..1171396 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099900.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene ahcY CDS 1171502..1172758 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105667.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(1172769..1173227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 1173410..1174144 product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227530.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 1174458..1174709 product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272729.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 1174796..1177111 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 1177165..1177503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 1177586..1178437 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070077545.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 1178513..1179244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1179463..1180395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 1180530..1181417 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083056.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 1181474..1182427 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723624.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 1182577..1183416 product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118821.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene metF CDS complement(1183583..1183798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 1183713..1184711 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073027.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 1184777..1185337 product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073028.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 1185334..1186716 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073029.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 1186850..1187380 product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167260.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1187494..1187736) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083624.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(1187797..1189848) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene prlC CDS 1190048..1191388 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 1191410..1191952 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1192072..1192743 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1192764..1194149) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332950.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(1194142..1196406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(1196432..1197217) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 1197587..1198342 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389167.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 1198339..1199781 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 1199778..1200458 product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389165.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 1200455..1203316 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123510.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 rRNA 1203826..1205358 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 tRNA 1205454..1205530 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 1205654..1205729 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 assembly_gap 1205733..1205742 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1207327..1207336 estimated_length known gap_type within scaffold linkage_evidence paired-ends rRNA 1208645..1208755 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 CDS 1208930..1209916 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene birA CDS 1209913..1210752 product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093768.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 tRNA 1210860..1210943 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 1210991..1211064 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 1211079..1211153 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 1211297..1211372 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 1211446..1211814 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768918.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene secE CDS 1211823..1212356 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317113.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene nusG CDS 1212449..1212880 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093751.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene rplK CDS 1212883..1213575 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093749.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene rplA CDS 1213815..1214315 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070609.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene rplJ CDS 1214406..1214777 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093747.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene rplL CDS 1215025..1219101 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene rpoB CDS 1219185..1223402 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene rpoC CDS 1223542..1223916 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093744.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene rpsL CDS 1224032..1224502 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093742.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene rpsG CDS 1224521..1226641 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003028885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene fusA CDS 1226671..1227864 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115146.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene tuf CDS 1228025..1228336 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555491.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene rpsJ CDS 1228482..1229120 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579663.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene rplC CDS 1229134..1229739 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555489.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene rplD CDS 1229736..1230032 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093736.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene rplW CDS 1230050..1230877 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103878.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene rplB CDS 1230900..1231175 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093734.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene rpsS CDS 1231194..1231526 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982638.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene rplV CDS 1231538..1232239 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093727.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene rpsC CDS 1232255..1232668 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene rplP CDS 1232668..1232859 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644741.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene rpmC CDS 1232852..1233121 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene rpsQ CDS 1233172..1233543 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555479.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene rplN CDS 1233558..1233875 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093711.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene rplX CDS 1233894..1234433 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096208.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene rplE CDS 1234444..1234749 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099026.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene rpsN CDS 1234781..1235173 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093700.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene rpsH CDS 1235183..1235713 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene rplF CDS 1235723..1236073 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049741.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene rplR CDS 1236085..1236585 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093697.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene rpsE CDS 1236592..1236774 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307985.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene rpmD CDS 1236778..1237212 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450562.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene rplO CDS 1237213..1238544 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555469.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene secY CDS 1238813..1239169 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093692.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene rpsM CDS 1239207..1239593 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093689.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene rpsK CDS 1239606..1240226 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093678.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene rpsD CDS 1240317..1241315 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093675.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene rpoA CDS 1241350..1241736 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093672.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene rplQ CDS complement(1241863..1244733) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene uvrA CDS 1245012..1246391 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 1246420..1246968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 1247208..1249331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1249370..1250947) product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene norR CDS 1251180..1252358 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113387.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene hmpA CDS 1252491..1253588 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 1253687..1254160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 1254252..1255631 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071454.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene radA CDS 1255867..1256904 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211671.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene selD CDS 1256901..1257998 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064861.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene mnmH CDS complement(1258041..1258751) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084901.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1258848..1259144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 1259171..1259770 product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073305.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 1259798..1260583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(1260619..1261137) product palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082771.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene pagP CDS complement(1261142..1261915) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106334.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene hisF CDS complement(1261921..1262670) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106336.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene hisA CDS complement(1262742..1263383) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121251.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene hisH CDS complement(1263406..1263999) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene hisB CDS 1264189..1264635 product acetyl-CoA sensor PanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112623.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 1264632..1266953 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112620.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 1267018..1268115 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110600.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene mutY CDS 1268115..1268387 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096100.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 tRNA 1268473..1268548 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 1268555..1268629 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 1268647..1268722 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(1269019..1269774) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525063.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(1269953..1270699) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626248.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 1270904..1272319 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728383.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 1272439..1272840 product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063969.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 1273230..1273400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 tRNA 1273456..1273531 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(1273622..1274434) product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1274520..1275281) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337109.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 1275640..1276584 product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230318.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene thpD CDS 1276716..1277396 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941248.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(1277400..1279298) product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071982.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene speA CDS complement(1279401..1280351) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114124.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(1280436..1280735) product DUF2782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096984.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 1280960..1283728 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114123.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene polA CDS complement(1283804..1284832) product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 1285005..1286153 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020477356.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(1286115..1287905) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 1288027..1288554 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103819.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 1288649..1290052 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550944.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 1290327..1291442 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 1291442..1292074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 1292067..1293422 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 1293599..1294171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1294168..1294821) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068893.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 1294976..1296109 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387917.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 1296106..1297659 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528867.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 1297871..1299775 product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237714.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 1299834..1302071 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707540.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 1302122..1303876 product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941872.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene cydD CDS 1303873..1305666 product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene cydC CDS 1305795..1307378 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037377.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 1307382..1308515 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037378.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene cydB CDS 1308532..1308726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 1308884..1310362 product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707191.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(1310343..1311434) product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(1311530..1312093) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090767.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(1312309..1312782) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(1312927..1313535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 1313467..1314024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 1314128..1314802 product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057744.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1314809..1315945) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104473.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 1316085..1316636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 1316633..1317013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 1317010..1318857 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268779.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 1318854..1320215 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099712.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 1320411..1321871 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704972.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 1321903..1323177 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063970.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene ectB CDS complement(1323184..1323606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 1323822..1324838 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459299.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 1324950..1327082 product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560769.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 1327079..1327825 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 1327893..1328024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 1328153..1328284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(1328400..1329164) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172667606.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(1329161..1330195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(1330223..1331416) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532240.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(1331420..1332337) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168154.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 1332532..1332846 product I78 family peptidase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722114.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 1332938..1333981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(1333982..1334968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838772.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(1334999..1335508) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121395.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(1335640..1336956) product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(1337026..1338375) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244661.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(1338457..1338705) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(1338734..1339231) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084466.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene coaD CDS complement(1339356..1341263) product beta-ketoacyl-ACP synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114068.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene fabY CDS 1341479..1342159 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208259.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1342166..1343044) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114539.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1343182..1343574 product multidrug/biocide efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403809.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 1343574..1343903 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191709.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 1343986..1345428 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387893.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 1345526..1346860 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 1346960..1348096 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414924.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1348087..1348884 product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367744.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene rna CDS complement(1348885..1349796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(1349869..1350930) product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484099.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene adrA CDS 1351029..1351904 product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089916.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(1351989..1352981) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082273.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(1353069..1353485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(1353535..1353909) product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313912.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(1354004..1354693) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085574.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(1354815..1356056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1356185..1357171) product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113741.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1357344..1357517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(1357651..1358622) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089272.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 1359076..1360827 product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 1360814..1361110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 1361139..1362080 product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(1362179..1363561) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421601.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 1363732..1364817 product type III secretion-associated outer membrane-bound protein HpaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275397.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene hpaM CDS complement(1364836..1365129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 1365349..1365675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(1365693..1366565) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267711.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 1366747..1367958 product benzoate/H(+) symporter BenE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206210.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene benE CDS 1368008..1368766 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763057.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 1368877..1369020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1369132..1370529) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703817.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(1370596..1371501) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(1371551..1371853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1371926..1372990) product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084964.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene fba CDS complement(1373071..1374234) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209963.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene pgk CDS complement(1374304..1375326) product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084958.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene epd CDS complement(1375423..1376400) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704193.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 1376575..1376943 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706544.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 1377122..1377778 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene adk CDS 1377914..1378612 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113851.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene tsaB CDS 1378668..1379483 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 1379480..1380241 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(1380205..1382715) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266965.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene plsB CDS 1382850..1383902 product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120863.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(1384075..1384722) product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767637.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 1384790..1385338 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082453.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 1385519..1387471 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287249.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene acs CDS 1387746..1388408 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003319664.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(1388493..1389767) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878155.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(1389842..1393795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(1393892..1394407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(1394505..1396286) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(1396293..1396553) product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 1397303..1399120 product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478579.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 1399120..1399737 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114810.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 1399778..1399999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 1400082..1400936 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082462.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene ttcA CDS complement(1400963..1401706) product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene anr CDS complement(1401795..1403204) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene hemN CDS complement(1403274..1403996) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(1403993..1404238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(1404235..1406679) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(1406676..1407185) product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(1407188..1408585) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244349.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene ccoG CDS complement(1408636..1409559) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087308.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene ccoP CDS complement(1409556..1409741) product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087314.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(1409745..1410353) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene ccoO CDS complement(1410376..1411800) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103797.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene ccoN CDS 1411962..1412660 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105706.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 tRNA 1412856..1412931 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 1412952..1413028 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 1413112..1413188 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 1413219..1413295 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 1413300..1413376 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 1413718..1415733 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031412.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 1415859..1416905 product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944019.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 1417126..1419048 product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 1419167..1420447 product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099579.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 1420470..1422017 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099581.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(1422058..1422372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 1422631..1423098 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730198.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 1423169..1423444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 1423490..1424347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 tRNA complement(1424523..1424609) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 assembly_gap 1424610..1424619 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(1424622..1424708) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 1424912..1427287 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407829.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene rnr CDS 1427284..1428123 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073677.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene rlmB CDS 1428265..1428657 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308887.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene rpsF CDS 1428685..1428912 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene rpsR CDS 1428927..1429778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095630.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 1429794..1430240 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317208.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene rplI CDS 1430414..1431802 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317209.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene dnaB CDS 1431904..1432206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 1432273..1434045 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895651.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 1434170..1434472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(1434476..1434859) product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125616.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 1435020..1436009 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816874.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene hemH CDS complement(1436014..1436397) product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051234295.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1436429..1436698) product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(1436692..1437189) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(1437186..1438724) product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(1438724..1439074) product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1439074..1441872) product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(1441963..1442124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 1442388..1443797 product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140837.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 1443858..1444322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 tRNA complement(1444479..1444555) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 1444726..1445472 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507974.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(1445553..1448270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1448555..1449310 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114802.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene minC CDS 1449362..1450180 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091579.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene minD CDS 1450177..1450425 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091581.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene minE CDS 1450496..1451986 product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072723.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene sbcB CDS complement(1452016..1454853) product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072980.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(1454853..1455539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 1455755..1456369 product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456899.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 1456366..1458249 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625959.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(1458256..1459539) product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534099.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(1459615..1460415) product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 1460635..1462056 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704629.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene ffh CDS 1462225..1462488 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209458.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene rpsP CDS 1462503..1463051 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113830.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene rimM CDS 1463105..1463905 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502493.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene trmD CDS 1464046..1464402 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092637.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene rplS CDS 1464514..1465419 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene xerD CDS 1465423..1466166 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406382.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene dsbC CDS 1466302..1467618 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 1467812..1469200 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113831.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene thrC CDS 1469390..1471210 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020281.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene recJ CDS complement(1471327..1474317) product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083983.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene copA CDS complement(1474310..1474738) product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768479.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene cadR CDS complement(1474908..1475120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 1475074..1476243 product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054987912.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 1476676..1477509 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895661.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene prfB note possible pseudo, frameshifted CDS 1477695..1479245 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113846.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene lysS CDS 1479504..1479890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 1479921..1481363 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705407.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 1481429..1481740 product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456570.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene bolA CDS 1481730..1482560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 1482557..1483015 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700855.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene rimI CDS complement(1483032..1483235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(1483303..1483932) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763630.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene rsmD CDS 1484022..1484750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 assembly_gap 1484546..1484555 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1484804..1485634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 1485639..1486322 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555631.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene ftsE CDS 1486319..1487302 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene ftsX CDS 1487472..1488338 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084510.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene rpoH CDS complement(1488417..1489034) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073926.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene slmA CDS complement(1489147..1490064) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene argB CDS complement(1490126..1491508) product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102983.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(1491789..1492277) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976081.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene dut CDS complement(1492274..1493602) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene coaBC CDS complement(1493671..1495116) product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 1495502..1496176 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene radC CDS 1496374..1496610 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014822.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene rpmB CDS 1496626..1496781 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene rpmG CDS 1496950..1497765 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene mutM CDS 1497880..1499070 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 1499094..1499534 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 1499716..1500834 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391433.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene ald CDS 1500946..1501971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 1502309..1503493 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114098.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(1503482..1504663) product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925781.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 1504882..1506561 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103761.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(1506666..1509419) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105996.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene acnA CDS 1509777..1509986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 1510115..1510717 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085842.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 1510910..1511863 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097640.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene trxB CDS complement(1512012..1512290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 1512375..1512839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(1512912..1513853) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(1513915..1514301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(1514309..1515466) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082377.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene dapE CDS complement(1515520..1516545) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377783.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene dapD CDS complement(1516580..1516927) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043162216.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(1516944..1518143) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406264.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene dapC CDS complement(1518254..1520929) product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(1520974..1521822) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092395.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene map CDS 1522029..1522760 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092394.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene rpsB CDS 1522937..1523806 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092393.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene tsf CDS 1523918..1524679 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092391.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene pyrH CDS 1524684..1525241 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092390.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene frr CDS 1525297..1526040 product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705097.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene uppS CDS 1526033..1526830 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266974.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 1526841..1528046 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266975.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene ispC CDS 1528062..1529417 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098594.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene rseP CDS 1529526..1531859 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092382.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene bamA CDS 1531888..1532385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 1532382..1533458 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene lpxD CDS 1533584..1534027 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092375.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene fabZ CDS 1534024..1534794 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene lpxA CDS 1534799..1535980 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113865.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene lpxB CDS 1535977..1536618 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927570.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene rnhB CDS 1536660..1540163 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098578.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene dnaE CDS 1540341..1541294 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene accA CDS 1541278..1542588 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418721.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene tilS CDS complement(1542638..1544161) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120380.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene ppx CDS 1544291..1544623 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280776.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene trxA CDS 1545036..1546295 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene rho CDS 1546537..1548021 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161496900.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene ubiD CDS 1548058..1548864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 1549376..1550434 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104335.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(1550666..1551019) product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109258.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene cyoD CDS complement(1551016..1551639) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704586.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(1551636..1553747) product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931208.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene cyoB CDS complement(1553744..1554712) product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036356.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene cyoA CDS complement(1554914..1557118) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099209.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene ppk1 CDS complement(1557162..1558169) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene hemB CDS complement(1558332..1559129) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115041.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene tatC CDS complement(1559126..1559524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(1559531..1559806) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456852.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene tatA CDS complement(1559837..1560175) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(1560225..1561847) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095885.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene ubiB CDS complement(1561844..1562491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(1562499..1563245) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103462.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene ubiE CDS complement(1563400..1563783) product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463876.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(1563972..1565297) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095854.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene hslU CDS complement(1565300..1565821) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208249.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene hslV CDS complement(1566165..1566845) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(1566849..1568534) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038936.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene argS CDS complement(1568872..1571115) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266372.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 1571276..1571491 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643446.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene rpmE CDS complement(1571578..1572207) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070529.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 1572416..1574722 product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047729.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(1574789..1576225) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528485.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(1576225..1576407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(1576469..1577347) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087746.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 1577803..1578063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 1578083..1579291 product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 1579348..1580745 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102128.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 1580856..1581611 product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(1581662..1582522) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368478.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 1582699..1583736 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399686.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 1584026..1585330 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207236.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 1585358..1586608 product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148382.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 1586789..1587181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 1587178..1590228 product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142077.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 1590221..1590865 product sarcosine oxidase subunit gamma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096784.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 1591037..1591903 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096786.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(1591969..1593270) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039977.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(1593326..1593889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(1593980..1594978) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811098.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(1595053..1596000) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085704.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1596012..1596449) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 1596688..1597440 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113623.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 1597437..1598150 product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113622.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 1598147..1599088 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147543.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(1599298..1599927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(1600093..1603041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(1603472..1604212) product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112468.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(1604209..1604844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 tRNA 1604937..1605012 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 1605110..1606180 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463959.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 1606512..1607696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 1608459..1608692 product Plasmid-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040072.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 1608679..1609365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 1609440..1609763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 1609766..1610416 product P-type DNA transfer protein VirB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264014.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene virB5 CDS 1610426..1610719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 1610716..1611711 product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042069.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 1611715..1612008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 1612005..1612256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(1612608..1613579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 1613739..1614161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 1614178..1614453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(1614503..1615612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(1615749..1616723) product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083539905.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(1616723..1618480) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110084.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(1618477..1619982) product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387312.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(1620062..1622485) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819018.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 1623402..1623629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 1623668..1624852 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021995751.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene ltrA CDS complement(1625159..1625356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(1625730..1626308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 1626337..1626846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 note possible pseudo, frameshifted CDS 1626873..1627904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 note possible pseudo, frameshifted CDS 1628017..1628292 product formaldehyde-responsive transcriptional repressor FrmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141271.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene frmR CDS 1628352..1629461 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400756.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 1629505..1629903 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811632.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 1630086..1631420 product DUF3422 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530349.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 1631479..1632309 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038485.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene fghA CDS 1632326..1633633 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969686.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 1633685..1634356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 1634369..1634878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 note possible pseudo, frameshifted CDS 1634905..1635936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 note possible pseudo, frameshifted CDS complement(1635952..1636320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(1636333..1637298) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450998.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(1637366..1638364) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792065.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(1638378..1639355) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537325.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(1639352..1640773) product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456652.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(1640817..1642007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(1642078..1642335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(1642374..1643945) product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456668.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(1644124..1644801) product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456561.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene cpaB CDS complement(1644798..1646156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456587.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(1646205..1646354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(1646296..1646757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 note possible pseudo, frameshifted CDS complement(1646825..1647013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(1647602..1649695) product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074303.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(1649692..1651053) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074304.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 1651436..1652281 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261996.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 1652351..1653058 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419416.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 1653079..1653768 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396189.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 1653812..1654411 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706868.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene mobA CDS 1654539..1655105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 note possible pseudo, frameshifted CDS 1655102..1656367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 note possible pseudo, frameshifted CDS complement(1656434..1657624) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113969.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(1657617..1658141) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091240.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene moaB CDS complement(1658138..1658458) product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346198.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(1658563..1659606) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453863.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(1659618..1660262) product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706855.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene fdh3B CDS complement(1660322..1663183) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706856.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(1663217..1663420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(1663482..1664162) product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074126.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(1664165..1665838) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925937.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1666028..1666636) product DUF3306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479426.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(1666641..1667066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 1667489..1668379 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074122.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 1668372..1669292 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029299489.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(1669314..1670294) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390710.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(1670346..1670978) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267941.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(1671049..1671936) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350644.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 1672074..1672286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 1672279..1673739 product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404732.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 1673759..1675075 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029435.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 1675107..1675715 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071529.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(1675794..1676627) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027169.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene nadE CDS complement(1676701..1677210) product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947530.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(1677350..1678252) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089870.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 1678357..1679475 product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162708822.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 1679562..1679852 product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897236.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene catC CDS 1679911..1680885 product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705528.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene catA CDS 1680970..1682331 product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705527.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 1682348..1682836 product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366457.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene benB CDS 1682860..1683903 product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705526.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene benC CDS 1683900..1684694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 1684769..1686010 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096644.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 1686194..1687369 product benzoate/H(+) symporter BenE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206210.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene benE CDS complement(1687416..1688792) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947022.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(1688789..1689427) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 1689662..1690027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 1690149..1690514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(1690883..1691353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(1691545..1693506) product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966821.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(1693610..1694725) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099197.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(1694727..1697453) product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene rbbA CDS complement(1697450..1698526) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099200.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 1698717..1699262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(1699395..1700906) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861192.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene glpK CDS 1701080..1702030 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092728.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 1702139..1703173 product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113812.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene dctP CDS 1703248..1703757 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113811.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 1703754..1705034 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113810.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 1705042..1705818 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(1705822..1706457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 1706676..1708085 product GntR family transcriptional regulator MpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113004.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene mapR CDS complement(1708107..1709084) product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766216.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene gnd CDS complement(1709231..1710463) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120001.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(1710570..1713479) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082358.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 1714058..1714762 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 1714768..1716405 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463925.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 1716420..1716890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(1716887..1717819) product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092181.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene metR CDS 1717935..1720232 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926372.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene metE CDS 1720347..1721111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 1721212..1721826 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549943.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(1721861..1723186) product DUF2252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099477.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(1723281..1723817) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037880.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 1723950..1724390 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530919.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 1724597..1725283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(1725445..1725849) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811318.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 1726298..1727434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(1727480..1730320) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113794.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(1730743..1731183) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764092.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(1731458..1732555) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(1732772..1734289) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 1734493..1735572 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316899.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene lptF CDS 1735572..1736636 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764084.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene lptG CDS 1736779..1736982 product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396478.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 1737155..1737631 product bacterioferritin BfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092078.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene bfrB CDS complement(1737736..1738827) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105529.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(1738830..1739336) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106314.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene purE CDS complement(1739680..1739913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(1739903..1740724) product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103587.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene tcdA CDS complement(1740721..1741509) product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044922.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 1741806..1742528 product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 1742625..1743389 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098478.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(1743394..1744614) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(1744759..1746207) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070440.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(1746254..1747627) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768190.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene trkA CDS complement(1747793..1747999) product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930433.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(1748077..1749399) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene rsmB CDS complement(1749392..1750369) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114642.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene fmt CDS complement(1750497..1751009) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107059.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene def CDS 1751290..1752378 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 1752375..1753487 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929874.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene dprA CDS 1753556..1754110 product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174593.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene tsaC CDS 1754168..1755103 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097311.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene hemF CDS 1755096..1755908 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111201.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene aroE CDS complement(1755915..1756706) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753571.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 1756835..1757692 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766802.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(1757711..1759123) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092786.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene der CDS complement(1759449..1760600) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene bamB CDS complement(1760597..1761256) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770804.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(1761315..1762595) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705646.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene hisS CDS complement(1762619..1763734) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380613.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene ispG CDS complement(1763753..1764823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(1764849..1765598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(1765746..1766873) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771021.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene rlmN CDS complement(1766953..1767378) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072285.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene ndk CDS complement(1767537..1767863) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216984.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene iscA CDS complement(1767904..1769052) product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365095.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(1769094..1769579) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380601.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene iscR CDS complement(1769738..1770601) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene cysE CDS complement(1770702..1771481) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene trmJ CDS 1771628..1772422 product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380594.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene suhB CDS complement(1772573..1773502) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene secF CDS complement(1773506..1775356) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100609.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene secD CDS complement(1775426..1775761) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene yajC CDS complement(1775857..1777032) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100607.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene tgt CDS complement(1777049..1778089) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816912.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene queA tRNA 1778245..1778331 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(1778345..1779391) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116248.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(1779394..1780692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115206.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(1780766..1781521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(1781518..1782717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(1782758..1783825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(1783825..1784175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(1784178..1785299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(1785719..1785994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(1786211..1786528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(1786545..1786898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(1786900..1787577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(1787574..1787780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 1787905..1788189 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094527.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 1788510..1789229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(1789219..1789542) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(1789539..1789907) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 1790638..1791246 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073456.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(1791250..1792896) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268974.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 1793092..1793586 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090910.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(1793600..1793992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 1794151..1795359 product enoyl-[acyl-carrier-protein] reductase FabV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035373.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene fabV CDS 1795407..1796372 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096699.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1796473..1797090) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405053.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(1797201..1797995) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082773.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 1798259..1799473 product bifunctional succinylornithine transaminase/acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112608.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene aruC CDS 1799506..1800570 product arginine/ornithine succinyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085950.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene aruF CDS 1800570..1801589 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989429.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene astA CDS 1801612..1803081 product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895527.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene astD CDS 1803078..1804463 product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085956.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene astB CDS complement(1804650..1805609) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107361.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 1805784..1806710 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(1806618..1808174) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390880.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 1808288..1808761 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074117.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 1808943..1810202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(1810513..1811277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(1811332..1814211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(1814251..1815444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943169.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(1815422..1815934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 1816353..1817384 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927014.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(1817434..1817967) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943045.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 1818188..1818919 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537174.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 1819101..1819811 product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462640.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1819939..1820883) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259194.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 1821044..1821667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 1821784..1822572 product OBAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698597.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 1822701..1824263 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110915.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(1824328..1825524) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810258.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(1825541..1826689) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965135.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(1826729..1828273) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081361309.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(1828572..1829321) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936067.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(1829395..1830288) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072431.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 1830425..1831609 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705534.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 1831722..1832018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 1832100..1832378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(1832471..1832674) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196837.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(1832958..1833887) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084071.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(1833891..1834214) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544592.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(1834417..1835214) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528749.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(1835235..1835876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 1836090..1836476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 1836602..1837273 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313094.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 1837270..1838628 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339149.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(1838625..1839929) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385254.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(1839930..1840481) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930617.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(1840478..1841494) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385252.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 1841875..1842375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(1842363..1842887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1842884..1843819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 note possible pseudo, frameshifted assembly_gap 1842931..1842940 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1843914..1845188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(1845455..1846753) product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091313186.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(1847106..1847333) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764045.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1847330..1848508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(1848806..1849747) product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338543.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(1850042..1850653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564969.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(1850875..1851531) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397352.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 1851740..1852084 product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088462.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 1852332..1852712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 1852792..1854153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 1854329..1854511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 assembly_gap 1854382..1854391 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1854612..1855571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(1855748..1857529) product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene phaC CDS 1857934..1858296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(1858424..1859437) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726719.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(1859617..1861899) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103277.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene recD CDS complement(1861896..1865648) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266564.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene recB CDS complement(1865645..1869319) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793829.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene recC CDS complement(1869405..1870292) product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067733.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(1870315..1870536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(1870567..1871184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(1871276..1872793) product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967081.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1872790..1874151) product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089468.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(1874177..1875499) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970023.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(1875483..1876118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(1876131..1877123) product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970021.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene dctP CDS 1877278..1877952 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970020.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 1878109..1879608 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813760.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 1879916..1883032 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942010.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(1883144..1883833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 1884091..1885488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 1885617..1887311 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258705.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene ilvD CDS complement(1887399..1887707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(1887827..1888513) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932977.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(1888598..1889701) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172623.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 1890160..1892415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 1892567..1893295 product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947958.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 1893523..1893981 product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene cadR CDS complement(1894021..1894974) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947147.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene corA CDS complement(1895091..1895861) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419848.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(1895995..1896723) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085936.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(1896726..1897427) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886243.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(1897447..1898217) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133012.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(1898458..1899450) product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112605.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene astE CDS complement(1899440..1900267) product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070950.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 1900553..1901164 product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367251.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene wrbA CDS complement(1901211..1901777) product outer membrane lipoprotein Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175561.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene blc CDS complement(1901985..1902425) product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466989.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(1902535..1903611) product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728063.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 1903732..1904637 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206176.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 1904723..1906036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(1906052..1906738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(1906864..1907793) product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104841.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(1907862..1909031) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533011.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 1909152..1910039 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 1910250..1910828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(1910835..1912565) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038828.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(1912599..1912886) product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(1912883..1913680) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269433.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 1913979..1914641 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194706.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 1914638..1916077 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706998.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(1916086..1916889) product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266523.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(1916900..1918465) product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(1918550..1919269) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198629.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(1919414..1919680) product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(1919857..1921803) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925701.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(1921800..1922135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 assembly_gap 1921948..1921957 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1922211..1922612) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765145.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(1922779..1924017) product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268367.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene glcF CDS complement(1924019..1925134) product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114371.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene glcE CDS complement(1925144..1926643) product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268365.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene glcD CDS 1926906..1927682 product transcriptional regulator GlcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115387.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene glcC CDS 1927833..1928813 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973404.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 1928911..1929897 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(1929989..1931686) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462890.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 1932060..1932764 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240876.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(1932842..1934137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703847.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(1934332..1936359) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113160.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 tRNA 1935710..1935790 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(1936367..1937233) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091654.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(1937233..1937454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 1937670..1938890 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(1939034..1939987) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(1939987..1940856) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(1940858..1941565) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(1941562..1942371) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 1942722..1943096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(1943188..1943532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 note possible pseudo, frameshifted CDS 1943601..1944107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 1944193..1944681 product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173648.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(1944695..1945429) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 1945744..1946751 product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812403.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 1946823..1947302 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938007.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 1947292..1948587 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389892.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(1948664..1949713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 assembly_gap 1949189..1949198 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1949701..1950048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 assembly_gap 1949729..1949738 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1950489..1951457 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723317.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 1951635..1954232 product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704330.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 1954243..1954671 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261090.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 1954806..1955633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 1955733..1956236 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315770.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 1956289..1958496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(1958512..1960419) product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115754.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(1960511..1961173) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928746.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(1961252..1962259) product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104372.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene cra CDS 1962508..1965390 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119534.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene ptsP CDS 1965390..1966370 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112874.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene pfkB CDS 1966367..1968115 product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706188.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene fruA CDS 1968295..1969395 product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387905.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 1969547..1970128 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346204.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(1970134..1971894) product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(1972118..1972846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(1972843..1975248) product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972374.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene mprF CDS complement(1975789..1976013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 1976435..1976746 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 1977404..1978924 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118247.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(1979005..1979955) product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530058.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene choX CDS 1980120..1980602 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene nrdR CDS 1980645..1981778 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113051.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene ribD CDS 1981945..1983129 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093313.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene ribBA CDS 1983231..1983713 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555427.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene ribE CDS 1983710..1984210 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene nusB CDS 1984290..1985177 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene thiL CDS 1985174..1985647 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 1985738..1988158 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101982.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene lon CDS 1988251..1989255 product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529762.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene thiB CDS 1989252..1990949 product thiamine/thiamine pyrophosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704815.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene thiP CDS 1990942..1991601 product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915973.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene thiQ CDS 1991690..1993534 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084436.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene ilvD CDS complement(1993630..1993881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 1993909..1994970 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210585.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 1995237..1995566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(1995700..1996074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(1996478..1996810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(1997290..1997640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(1997876..1998454) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114066.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene nudE CDS 1998532..1999197 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene yrfG CDS 1999203..1999598 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098853.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene hslR CDS 1999644..2000519 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096245.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene hslO CDS 2000983..2002431 product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367573.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 2002572..2003081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(2003086..2004762) product methyl-accepting chemotaxis protein II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096061.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene tar CDS 2005041..2007407 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099617780.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 2007517..2009118 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene gshA CDS 2009167..2009685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 2010005..2011363 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 2011471..2011974 product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120370.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene rsd CDS complement(2012045..2015110) product multidrug efflux RND transporter permease subunit VexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494544.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene vexF CDS complement(2015110..2016186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(2016321..2017850) product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099345.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene mqo CDS complement(2018068..2018721) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 2018785..2019387 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084400.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 2019427..2021700 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene ptsP CDS complement(2021716..2022510) product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 2022674..2023579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 2023610..2024410 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene lgt CDS 2024460..2025254 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 2025251..2025820 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976149.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 2025921..2026574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 2027011..2028105 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704799.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 2028263..2029291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 2029509..2031542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 2031628..2031945 product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379501.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(2032409..2032942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 2032832..2033167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 2033639..2034838 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 2034842..2036008 product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene nspC CDS 2036843..2037775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 tRNA complement(2038074..2038150) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(2038229..2040307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 2040455..2041231 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407968.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(2041246..2042919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 2043178..2044173 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099371.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(2044196..2044735) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037693.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene greB CDS 2044904..2045539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 2045639..2046268 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 2046272..2046718 product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102067.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 2046803..2047537 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056616.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene cpdA CDS 2047661..2048584 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene cysD CDS 2048584..2050011 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454657.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene cysN CDS 2050517..2051557 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095916.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(2051622..2052614) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365980.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene cmoB CDS complement(2052604..2053371) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457217.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene cmoA CDS 2053689..2055353 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208058.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene pgi CDS 2055381..2056025 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113918.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 2056061..2057941 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212181.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene parE CDS 2058104..2060359 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene parC CDS 2060423..2061643 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene serB CDS 2061725..2063440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 2063518..2063769 product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096418.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 2064189..2065898 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113805.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene leuA CDS complement(2065987..2067003) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene epmB CDS 2067125..2067691 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772139.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene efp CDS 2067918..2068886 product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207420.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene epmA CDS complement(2069064..2070221) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931024.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(2070203..2070892) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931025.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(2071178..2072068) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811301.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene asd CDS complement(2072147..2072980) product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene rhdA CDS complement(2073069..2074082) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366295.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene rsgA CDS 2074190..2074774 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704162.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene orn CDS complement(2074933..2076048) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene queG CDS 2076163..2077665 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148264.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 2077679..2078158 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209146.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene tsaE CDS 2078155..2079624 product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene amiB CDS 2079635..2081587 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene mutL CDS 2081593..2082579 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113929.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene miaA CDS 2082690..2082935 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene hfq CDS 2082950..2084278 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113930.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene hflX CDS 2084347..2085570 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266497.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene hflK CDS 2085570..2086469 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366315.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene hflC CDS 2086578..2087777 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095644.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 2087842..2089137 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(2089221..2090219) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897538.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(2090513..2093233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 tRNA 2090907..2090998 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(2093333..2094580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(2094623..2095516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(2095578..2097158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(2097195..2099135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(2099339..2100700) product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932849.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 2101119..2101586 product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 2101644..2103086 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772922.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene sufB CDS 2103301..2104053 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene sufC CDS 2104050..2105447 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene sufD CDS 2105431..2106672 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 2106693..2107256 product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene sufT CDS 2107350..2108027 product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365714.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene sanA CDS complement(2108031..2108477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(2108618..2109526) product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096254.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene rimK CDS complement(2109568..2110005) product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(2110023..2111063) product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071774.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 2111309..2111635 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650459.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 2111637..2112137 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200916.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(2112219..2112803) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707635.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 2113050..2113328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(2113429..2114919) product proline transporter OpuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242814.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene opuE CDS complement(2115248..2118439) product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704727.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene putA CDS complement(2118773..2119573) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085585.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(2119634..2119993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 tRNA complement(2120193..2120268) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(2120506..2120913) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262101.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(2121000..2122469) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809405.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 2122714..2122998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 2123029..2123187 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310667.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(2123266..2123739) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996417.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(2123926..2125524) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(2125872..2126306) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090444.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(2126303..2127496) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097663.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(2127686..2129050) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113371.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene purB CDS complement(2129114..2129752) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405097.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene hflD CDS complement(2129749..2130876) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007019485.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene mnmA CDS complement(2130952..2131401) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037129.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(2131398..2132012) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114324.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 2132291..2134522 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038863.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 2134776..2135138 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097649.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene clpS CDS 2135235..2137499 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene clpA CDS complement(2137751..2137945) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553999.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene infA CDS complement(2138089..2138835) product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108766.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(2138825..2139547) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113368.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene aat CDS 2139726..2142962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 2143120..2143749 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090414.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene lolA CDS complement(2143981..2145117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 2145391..2146761 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211158.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 2146976..2147536 product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095285.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 2147672..2148001 product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 2147998..2149224 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 2149284..2150114 product 3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281389.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene hcaB CDS 2150134..2151069 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064791.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 2151127..2152500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 2152672..2153499 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119813.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 2153850..2154428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 2154451..2155386 product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044321.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene mhpF CDS 2155400..2156437 product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013510.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene dmpG CDS complement(2156454..2156783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 note possible pseudo, frameshifted CDS complement(2156780..2157397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 note possible pseudo, frameshifted CDS complement(2157586..2158929) product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704877.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene rarA CDS 2159107..2159655 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706927.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 2159798..2160577 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703959.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene murI CDS 2160623..2161750 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480873.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene trmA CDS 2161928..2166778 product NAD-glutamate dehydrogenase GdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103491.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene gdhB CDS 2166885..2167169 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 2167284..2168345 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(2168421..2168630) product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553055.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 2168851..2171034 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene rlmKL CDS complement(2171093..2171368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(2171365..2171595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 2171482..2172633 product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766914.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene pdxB CDS complement(2172732..2173631) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090915.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene htpX CDS complement(2173773..2175092) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(2175134..2176069) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454328.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene ylqF CDS complement(2176148..2176549) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391288.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene msrB tRNA 2176762..2176837 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 2176867..2176941 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 2176949..2177024 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 2177053..2177127 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 2177211..2177286 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 2177315..2177389 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 2177609..2178577 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 2178574..2179347 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 2179349..2180179 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930727.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene queF CDS 2180232..2180792 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 2180797..2181303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 tRNA 2181397..2181484 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(2181917..2183056) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071377.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(2183135..2183791) product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210159.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene ytfE CDS 2183957..2185480 product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene norR CDS complement(2185600..2186040) product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000382.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(2186248..2186574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(2186932..2188209) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629647.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(2188217..2188657) product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219995814.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene umuD CDS complement(2188877..2190334) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401360.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(2190350..2191081) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252839.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(2191092..2191796) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972260.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(2191886..2192674) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974386.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(2192746..2193525) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407276.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(2193637..2194833) product arginine--pyruvate transaminase AruH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102073.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene aruH CDS complement(2194865..2196460) product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112428.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(2196457..2197038) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729004.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(2197035..2198195) product gamma-butyrobetaine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 2198321..2199364 product HTH-type transcriptional regulator CdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114442.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene cdhR CDS complement(2199382..2200650) product gamma-butyrobetaine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(2200750..2201787) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186852.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 2201905..2202465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 2202602..2202865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(2202964..2206413) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene mfd CDS 2206657..2208111 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315085.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 2208396..2209748 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 2209748..2210980 product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 2210980..2211765 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 2211769..2212437 product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119802.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene nqrD CDS 2212438..2213058 product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene nqrE CDS 2213085..2214317 product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113984.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene nqrF CDS 2214314..2215381 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246830.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 2215383..2215640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 2215711..2217102 product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091177.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene sthA CDS 2217185..2217469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(2217477..2218343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(2218449..2219387) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085861.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(2219566..2220465) product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(2220467..2221534) product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 2221690..2222931 product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119805.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 2222924..2223646 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene lolD CDS complement(2223678..2224262) product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 2224328..2226655 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 2226694..2227347 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 2227344..2227775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 2227772..2229514 product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114544.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene msbA CDS 2229511..2230548 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018915793.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene lpxK CDS 2230541..2230756 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947637.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 2230753..2231526 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317470.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene kdsB CDS 2231523..2231996 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 2231993..2233021 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106928.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene murB tRNA complement(2233096..2233172) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(2233400..2234491) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050104.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene ychF CDS complement(2234658..2235242) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099278.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene pth CDS complement(2235285..2236025) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(2236056..2236997) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099281.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 tRNA complement(2237064..2237138) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(2237210..2238061) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene ispE CDS complement(2238058..2238669) product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095005.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene lolB CDS complement(2238673..2240391) product proteolytic complex protein LbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352693.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene lbcA CDS 2240726..2242000 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene hemA CDS 2242009..2243094 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114692.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene prfA CDS 2243094..2243948 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456476.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene prmC CDS 2244120..2244620 product transcriptional regulator DadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096535.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene dadR CDS 2244644..2245393 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365615.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 2245554..2246843 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388774.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 2246918..2248048 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443464.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 2248064..2248984 product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457403.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene potB CDS 2248981..2249778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 note possible pseudo, internal stop codon, frameshifted CDS 2249817..2250881 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968765.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 2250947..2252311 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707799.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 2252342..2253415 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974518.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 2253475..2254767 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114430.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 2254977..2255534 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092848.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(2255599..2256978) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112937.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 2257232..2258626 product putrescine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084297.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene spuC CDS 2258623..2260116 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704251.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 2260237..2261931 product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226890.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(2261958..2262509) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096513.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(2262563..2264014) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112870.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene gatB CDS complement(2264014..2265474) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091960758.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene gatA CDS complement(2265523..2265810) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene gatC CDS 2266032..2267069 product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene mreB CDS 2267189..2268049 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene mreC CDS 2268046..2268531 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094389.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene mreD CDS 2268594..2269187 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 2269222..2270685 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene rng CDS 2270705..2274553 product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103968156.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 2274550..2276004 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene tldD CDS complement(2276176..2276691) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094378.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene yjgA CDS 2276756..2278096 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene pmbA CDS complement(2278140..2279543) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073704.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene mgtE CDS complement(2279589..2279858) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918130.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(2279845..2280735) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene rapZ CDS complement(2280776..2281264) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766506.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene ptsN CDS complement(2281276..2281584) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene raiA CDS complement(2281711..2283102) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340639.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(2283235..2283960) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene lptB CDS complement(2283983..2284498) product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946573.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene lptA CDS complement(2284498..2285082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(2285087..2285644) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413390.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(2285686..2286666) product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134758.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene kdsD CDS 2286854..2287654 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620333.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 2287651..2288478 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094341.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene mlaE CDS 2288475..2288939 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene mlaD CDS 2288957..2289622 product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094337.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 2289619..2289954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 2290080..2290337 product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306001.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene ibaG CDS 2290347..2291612 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene murA CDS 2291685..2292341 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098837.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene hisG CDS 2292381..2293709 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene hisD CDS complement(2293777..2294988) product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene algW CDS 2295099..2295857 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(2295936..2296391) product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502832.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene zapG CDS 2296588..2297784 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094297.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene zapE CDS 2297933..2298361 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210132.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene rplM CDS 2298375..2298764 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098810.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene rpsI CDS 2298945..2299571 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene sspA CDS 2299623..2300123 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458208.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene sspB CDS complement(2300201..2300779) product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(2300785..2301378) product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620308.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(2301402..2301683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(2301769..2303634) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268851.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 2303754..2304608 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035951.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene rsmI CDS 2305034..2305987 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095568.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene rsmH CDS 2305997..2306320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 2306317..2308020 product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene ftsI CDS 2308017..2309540 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775075.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene murE CDS 2309537..2310904 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103103.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 2310914..2311996 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene mraY CDS 2312040..2313434 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene murD CDS 2313431..2314591 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094125.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene ftsW CDS 2314625..2315743 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766568.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene murG CDS 2315733..2317199 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene murC CDS 2317196..2318146 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 2318152..2318880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 2319093..2320367 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene ftsA CDS 2320399..2321562 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766576.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene ftsZ CDS 2321679..2322593 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene lpxC CDS complement(2322664..2323152) product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377653.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 2323220..2323573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 2323643..2326357 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112752.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene secA CDS 2326390..2327604 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208443.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene argJ CDS 2327667..2328614 product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(2328861..2329175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 assembly_gap 2329027..2329036 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2329436..2330800) product Ktr system potassium transporter KtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243582.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene ktrB CDS complement(2330811..2331467) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514290.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(2331494..2331967) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 2332205..2332867 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625985.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene maiA CDS 2333034..2334494 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243715.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 2334677..2335546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 2335619..2337529 product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483278.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 2337526..2338260 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483201.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(2338368..2340023) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723553.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 2340357..2342180 product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113245.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(2342250..2343053) product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118502.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(2343108..2343497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(2343781..2344122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(2344211..2344426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(2344589..2345506) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104892.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene argF CDS 2345786..2346130 product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108172.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene grxD CDS complement(2346218..2346880) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene rnt CDS 2347081..2348301 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 2348353..2348646 product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460998.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 2348784..2349449 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817296.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 2349528..2350598 product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 2350684..2351628 product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 2351631..2351924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(2351953..2352591) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210602.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene nth CDS complement(2352588..2353541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(2353549..2355591) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211829411.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene metG CDS complement(2355694..2357166) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367986.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene thiI CDS complement(2357262..2358839) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150912620.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(2358975..2359595) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838198.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 2359753..2360226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(2360233..2361105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 2361286..2361648 product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 2361702..2362115 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene arfB CDS 2362284..2363507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 2363678..2364865 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339317.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 2364969..2365772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 2365885..2366451 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381535.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene dcd CDS complement(2366573..2367304) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268589.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene purN CDS complement(2367301..2368377) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268588.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene purM CDS 2368489..2369568 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 2369565..2370266 product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102398.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene hda CDS complement(2370270..2370689) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096441.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 2370858..2372255 product class II fumarate hydratase FumC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112741.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene fumC CDS complement(2372283..2373353) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(2373441..2374952) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098460.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene glpD CDS complement(2375329..2376135) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705542.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 tRNA 2376494..2376570 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA 2376612..2376688 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(2376745..2377698) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(2377832..2378296) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114769.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(2378371..2379168) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704853.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene metQ CDS complement(2379278..2379931) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704854.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(2379912..2380955) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863666.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene metN CDS 2381371..2381985 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705976.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 2382176..2383489 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396212.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 2383489..2384037 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446416.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 2384115..2384615 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938365.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene gpt CDS 2384644..2385336 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972337.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene ung CDS 2385458..2386087 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860560.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene upp CDS 2386225..2387469 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457676.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 2387635..2388435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 2388438..2388890 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736458.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene moaE CDS 2388887..2389879 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059643243.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene moaA CDS 2390044..2390337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(2390495..2392078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 2392301..2393152 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene purU CDS complement(2393158..2394204) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104818.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene dinB CDS complement(2394221..2394862) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091196.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene lexA CDS 2395059..2395718 product transcriptional regulator PsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403692.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene psrA CDS 2395715..2396239 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 2396311..2397345 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118092.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene nagZ CDS 2397347..2398582 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263282.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 2398575..2399153 product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(2399259..2400974) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113337.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(2401018..2401452) product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350830.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 2401615..2402781 product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085499.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 2402815..2403915 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114169.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 2403957..2404859 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113890.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene mmsB CDS 2404856..2405251 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531694.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 2405314..2405886 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418115.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 2405937..2407337 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(2407324..2408157) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382474.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 2408039..2408251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 2408425..2410797 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406749.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene ppsA CDS complement(2410861..2412693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(2412749..2413234) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765718.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene rraA CDS complement(2413424..2416027) product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104702.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene acnB CDS 2416293..2416745 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113583.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 2416751..2417377 product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122839.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 2417443..2421345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(2421371..2422105) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267205.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene lpxH CDS complement(2422183..2422677) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 2422822..2424501 product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113586.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 2424504..2425883 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113587.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene cysS CDS complement(2425988..2426713) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967881.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene mtnN CDS complement(2426739..2427206) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723733.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(2427263..2428132) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087898.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene folD tRNA 2428331..2428407 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA 2428483..2428559 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA 2428618..2428692 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA 2428724..2428798 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS 2429049..2430401 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460612.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene tig CDS 2430514..2431134 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene clpP CDS 2431202..2432479 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene clpX CDS 2432644..2435052 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene lon CDS 2435231..2435503 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene hupB CDS 2435691..2437526 product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267217.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(2437649..2437945) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460076.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(2437942..2438835) product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042007654.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(2438835..2439485) product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810901.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene queE CDS complement(2439488..2440183) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene queC CDS 2440560..2440970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(2441036..2441485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(2441521..2441793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(2441903..2442625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 2442783..2443196 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887042.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene flgB CDS 2443201..2443608 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197251.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene flgC CDS 2443644..2444330 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367328.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene flgD CDS 2444379..2445689 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034888230.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene flgE CDS 2445759..2446514 product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097135.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 2446541..2447323 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050114401.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene flgG CDS 2447353..2448045 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367324.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene flgH CDS 2448068..2449201 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817185.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 2449201..2450265 product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080846.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene flgJ CDS 2450339..2452294 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203463.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene flgK CDS 2452318..2453529 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946958.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene flgL CDS complement(2453606..2454391) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene fliR CDS complement(2454408..2454677) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811859.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene fliQ CDS complement(2454718..2455491) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704950.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene fliP CDS complement(2455488..2455898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(2455895..2456404) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811853.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene fliN CDS complement(2456397..2457437) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043526237.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene fliM CDS complement(2457441..2457929) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367297.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene fliL CDS complement(2458093..2459493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(2459511..2459981) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367295.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene fliJ CDS complement(2460009..2461427) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213259.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene fliI CDS complement(2461424..2462194) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063740.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene fliH CDS complement(2462187..2463182) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367292.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene fliG CDS complement(2463179..2464981) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704955.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene fliF CDS 2465316..2465645 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811835.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene fliE CDS complement(2465755..2468556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(2468564..2468938) product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089169839.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(2469067..2469612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(2469626..2470285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(2470417..2471409) product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217985.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(2471564..2472241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(2472344..2476849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(2477005..2477895) product flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096009.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(2478053..2479654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 2479750..2481129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(2481294..2481491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 2481753..2482031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 2482089..2484656 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(2484684..2485739) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707130.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene ansA CDS complement(2485776..2486990) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(2487008..2487562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(2487663..2488277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(2488334..2488837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 2489057..2490445 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146762.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene fliD CDS 2490476..2490871 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287765.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene fliS CDS 2490877..2491239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 2491236..2492414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 2492411..2492713 product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523065.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 2493012..2493350 product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096050.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene flhD CDS 2493355..2493951 product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene flhC CDS 2494038..2494910 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210888.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene motA CDS 2494907..2495851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 2495869..2498043 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063729.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene cheA CDS 2498040..2498555 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147301.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene cheW CDS 2498782..2500479 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039842.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 2500605..2502686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 assembly_gap 2502589..2502598 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2502608..2502901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 note possible pseudo, frameshifted CDS 2502898..2503803 product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811915.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 2503867..2504931 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 2505010..2505399 product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811911.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene cheY CDS 2505425..2506087 product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983609.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene cheZ CDS 2506249..2507409 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938913.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene flhB CDS 2507406..2509487 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066986.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene flhA CDS 2509487..2511877 product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063732.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene flhF CDS 2511874..2512500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 2512497..2512925 product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367334.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 2513035..2513751 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087467.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene fliA CDS complement(2513800..2514450) product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367436.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene pqiC CDS complement(2514472..2516118) product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457973.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene pqiB CDS complement(2516111..2517418) product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457979.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 2517598..2518572 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 2518871..2520283 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188183.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 2520287..2521288 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268936.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene cydB CDS 2521295..2522962 product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816031.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene cydD CDS 2522955..2524676 product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815160.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene cydC CDS 2524682..2524822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 2524871..2525731 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(2525828..2527183) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142418.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene guaD CDS complement(2527180..2528055) product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267256.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene xdhC CDS complement(2528042..2530531) product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene xdhB CDS complement(2530515..2531993) product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083347.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene xdhA CDS 2532173..2532817 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770041.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(2532837..2533583) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423373.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 2533930..2534652 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083340.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(2534815..2535039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(2535153..2535380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(2535536..2535778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(2535857..2536909) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728538.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene hypE CDS complement(2536906..2538006) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene hypD CDS complement(2537993..2538253) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(2538244..2540574) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene hypF CDS complement(2540580..2540843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(2540836..2541315) product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940796.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(2541319..2542608) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(2542598..2543380) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(2543384..2544229) product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(2544213..2544680) product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(2544677..2545801) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 tRNA complement(2546196..2546272) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS 2546485..2546847 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390179.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 2546844..2547572 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258956.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(2547587..2547949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 2548186..2548653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 2548680..2549825 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 2550079..2550966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 2551090..2551236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 2551275..2553173 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738829.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene thrS CDS 2553253..2553744 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106936.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene infC CDS 2553832..2554026 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553160.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene rpmI CDS 2554063..2554416 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099086.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene rplT CDS 2554550..2555569 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367019.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene pheS CDS 2555596..2557980 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267471.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene pheT CDS 2558009..2558311 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553164.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene ihfA CDS complement(2558409..2558720) product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 2558841..2559872 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene sohB CDS complement(2559882..2560202) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053149.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 2560652..2562565 product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477696.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(2562605..2562811) product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093125.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 2562933..2563397 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212126.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 2563408..2563782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(2563863..2565227) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054702.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene ppnN CDS 2565539..2566456 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071264.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(2566572..2569466) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071084.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene gcvP CDS complement(2569557..2569949) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703428.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene gcvH CDS 2570509..2571888 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 2571926..2573038 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478448.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene gcvT CDS complement(2573115..2573735) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275445.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(2573740..2574546) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819395.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(2574588..2575487) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707863.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(2575584..2577533) product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 2578023..2579549 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387979.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(2579572..2580339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(2580413..2581591) product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338822.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(2581588..2582538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(2582706..2582981) product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495513.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(2583114..2583806) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072272.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene suhB CDS complement(2583983..2584519) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400057.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(2584553..2585824) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS 2586018..2587607 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071441.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene prfC CDS 2587693..2588169 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene mscL CDS 2588218..2588994 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707415.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(2589028..2590077) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114180.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 2590215..2590409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 2590422..2590838 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929270.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 2590870..2592900 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104590.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene uvrB CDS complement(2592951..2594747) product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530887.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(2594796..2596373) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082931.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 2596626..2598131 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093938.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 2598335..2599753 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144064.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene cls CDS 2599892..2600809 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418861.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(2600824..2601921) product bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038544.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 2602055..2602960 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173331.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 2603009..2603281 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958585.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(2603290..2604234) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255265.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(2604270..2605190) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338796.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(2605289..2606239) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 2606432..2606704 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038148.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 2606769..2608550 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123218.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene aspS CDS 2608652..2609401 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086107.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 2609444..2609983 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169179.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene ruvC CDS 2610056..2610661 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406125.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene ruvA CDS 2610668..2611705 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409396.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene ruvB CDS 2611702..2612121 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201529.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene ybgC CDS 2612118..2612807 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086125.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene tolQ CDS 2612818..2613261 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126827401.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene tolR CDS 2613271..2614362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 2614362..2615648 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112572.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene tolB CDS 2615710..2616261 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418623.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene pal CDS 2616323..2617120 product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120698.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene ybgF CDS 2617151..2617912 product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706896.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(2617935..2618606) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039473.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(2618603..2619334) product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 2619705..2620592 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208056.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene galU CDS 2620596..2621882 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208057.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(2621990..2622568) product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094005.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene sodB CDS 2622766..2623560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 2623617..2625473 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046695507.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 2625437..2629549 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154295113.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(2629518..2629880) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819879.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 2630012..2630647 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113738.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene msrA CDS complement(2630628..2631656) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261065.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(2631724..2633034) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070438.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene pepQ CDS complement(2633012..2633941) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418861.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(2634069..2635124) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937476.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(2635121..2636155) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937477.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(2636160..2637107) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455202.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(2637104..2638150) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455219.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(2638282..2639871) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421494.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(2640107..2640763) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345939.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene can CDS 2640904..2642265 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766202.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene gorA CDS 2642564..2643142 product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930801.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene ectA CDS 2643232..2644497 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040099.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene ectB CDS 2644579..2644974 product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637098.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 2645191..2646279 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene pdhA CDS 2646283..2647263 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289463.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 2647277..2648701 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429288.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene aceF CDS 2648730..2650157 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene lpdA CDS 2650502..2652010 product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001562609.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene mdoG CDS 2652087..2653355 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112774.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 2653479..2654285 product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418596.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 2654295..2655797 product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457220.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 2655802..2656794 product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506955.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 2656798..2657280 product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene zur CDS 2657317..2657760 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene hisI CDS 2657744..2658112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(2658123..2658536) product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055037.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(2658599..2659849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 2660003..2660968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(2661048..2661638) product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553665.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene nfuA CDS 2661904..2665614 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene metH CDS 2665611..2666933 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 2667099..2668751 product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 2668744..2669274 product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(2669316..2669909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 2670038..2670466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 2670544..2670897 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112580.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene arsC CDS 2670937..2671557 product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363251.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene wrbA CDS 2671550..2671927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 2671915..2673192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 2673271..2673717 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(2673728..2674399) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 2674503..2675213 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 2675210..2675554 product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065708.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 2675684..2676325 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268697.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene pdxH CDS complement(2676449..2677345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(2677441..2678283) product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939573.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(2678283..2679485) product glycine/proline betaine ABC transporter ATP-binding protein OpuAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246301.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene opuAA CDS complement(2679708..2682377) product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016415173.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 2682562..2683500 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821521.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 2683639..2684268 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287804.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(2684303..2684851) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768620.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(2684861..2685214) product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119979.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(2685214..2685516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(2685525..2685899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(2685912..2686325) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707698.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene tusD CDS complement(2686404..2687072) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553978.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(2687235..2687510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(2687561..2687818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(2687846..2688043) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391853.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 tRNA 2688257..2688346 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS 2688498..2689751 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337713.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 2689861..2690622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 2690726..2690920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 2690920..2691369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 2691366..2691614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 2691611..2691886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 2691883..2692884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 2692856..2694751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 2694748..2695374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 2695371..2695631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 2695649..2696140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 2696282..2696446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 2696439..2696675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 2696678..2697718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 2697718..2697891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 2697884..2698498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 2698526..2698762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 2698764..2699645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 2699650..2700483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 2700476..2700817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 2700853..2701194 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 2701191..2701496 product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210705.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 2701859..2702182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 2702175..2702318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(2702435..2704876) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene hrpB CDS 2705026..2705286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 2705370..2705579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(2705598..2707304) product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170818.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 2707456..2708604 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389332.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(2708680..2709468) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(2709532..2710197) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260946.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(2710349..2711155) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267693.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene nudC CDS complement(2711125..2711865) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene dnaQ CDS complement(2711912..2712373) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene rnhA CDS complement(2712366..2713160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 2713296..2714063 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267224.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene gloB CDS 2714110..2715411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 2715545..2717377 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104691.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 2717384..2718463 product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 2718463..2719593 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 2719583..2721160 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968391.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(2721198..2721905) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706653.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene rsuA CDS complement(2721905..2722708) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 2722849..2723757 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044965.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene rarD CDS complement(2723815..2724855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(2725015..2726607) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246966.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(2726710..2728065) product beta-alanine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083801.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene bauA CDS 2728316..2730055 product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(2730095..2731219) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067372.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene ugpC CDS complement(2731234..2732112) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387855.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(2732105..2733037) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375907.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(2733110..2734363) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091472.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(2734401..2735702) product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036696.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(2735718..2737169) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348991.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(2737178..2737891) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252794.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 2738139..2738693 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 2738672..2739382 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765563.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(2739399..2740592) product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271983.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene lhgO CDS 2740727..2741272 product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 2741280..2742644 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403127.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(2742662..2743438) product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077244862.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 assembly_gap 2743583..2743592 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2744909..2745754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(2745827..2746591) product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113007.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene hpaI CDS complement(2746759..2747763) product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064905.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(2747760..2748689) product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(2748707..2749189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(2749179..2750690) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339266.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 note possible pseudo, internal stop codon, frameshifted CDS complement(2750757..2751740) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339265.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 2752078..2752875 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188685.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(2752959..2753948) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075125.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(2753968..2754729) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729052.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(2754731..2756044) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728086.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene hisD CDS complement(2756192..2757499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(2757511..2758056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(2758049..2759233) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462087.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(2759298..2759501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 2759681..2760718 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921512.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(2760771..2761940) product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460953.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(2761943..2762227) product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(2762446..2763336) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 2763449..2764447 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137966.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(2764547..2765884) product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932849.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(2765907..2766944) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706682.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(2767000..2767506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(2767610..2767843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(2767915..2768862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(2768855..2769592) product flagellar motor protein MotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398692.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene motP CDS 2769528..2769716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(2769852..2770097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(2770341..2770718) product transcriptional regulator MvaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093888.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene mvaT CDS 2771003..2772307 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052123603.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene bioA CDS complement(2772541..2773836) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038731.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(2773912..2774085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 2774341..2775696 product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266553.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 2775766..2777115 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 2777318..2778487 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946749.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 2778500..2780107 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072003.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 2780115..2780948 product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088598.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 2780945..2782999 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555739.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 2783203..2784105 product bifunctional 3-hydroxy-3-isohexenylglutaryl-CoA lyase/hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088593.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene liuE CDS complement(2784191..2785138) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303519.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(2785268..2786908) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967567.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(2787116..2787916) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551489.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(2787943..2788392) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401653.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 2788680..2790101 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063882.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 2790596..2791069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 2791121..2792311 product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113342.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 2792328..2792774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 2792810..2793115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 2793324..2793701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 note possible pseudo, frameshifted CDS 2793643..2793822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 note possible pseudo, frameshifted CDS 2794374..2795429 product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 2795712..2796188 product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530675.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 2796185..2797198 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975921.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 2797342..2798217 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246877.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene purU CDS 2798231..2799091 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene folD CDS complement(2799240..2801723) product YbcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993482.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(2801726..2803300) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292956.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 2803401..2804300 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216246.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(2804472..2804705) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070876.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(2804715..2805326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(2806529..2806819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 2807179..2807640 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071100.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 2807886..2808287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(2808352..2810559) product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 2810828..2811376 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408503.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 2811496..2812083 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091136546.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(2812088..2812834) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815396.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(2812903..2813466) product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776976.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(2813483..2813917) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070806.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene trxC CDS 2814053..2814955 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 2815064..2815987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(2816009..2816554) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705566.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 2816667..2817905 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816265.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(2817944..2818840) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105232.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(2818837..2819325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 2819439..2820374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 note possible pseudo, frameshifted assembly_gap 2820318..2820327 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2820371..2820895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 assembly_gap 2820909..2820918 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2820962..2823139) product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112286.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(2823278..2826607) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529825.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 2826830..2828284 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 2828290..2829279 product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(2829378..2830424) product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146514848.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(2830514..2832031) product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096875.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 2832244..2833155 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338368.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 2833253..2834962 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163997.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 gene proS CDS 2834943..2835533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 2835636..2837027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(2837276..2837785) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036503.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(2837831..2838373) product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268290.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene rfaH CDS 2838531..2839901 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(2839902..2841740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 2841878..2843785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 2843870..2845876 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707714.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 2845873..2846760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(2847038..2849686) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113850.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene ppc CDS complement(2849679..2850533) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268591.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene mazG CDS complement(2850530..2852791) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene relA CDS complement(2852846..2854213) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102417.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene rlmD CDS complement(2854215..2855111) product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616363.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene cysM CDS 2855272..2857929 product two-component system sensor histidine kinase GacS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102426.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene gacS CDS complement(2858159..2858947) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101974.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene pdxJ CDS complement(2859009..2859722) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101972.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene recO CDS complement(2859875..2860774) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363707.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene era CDS complement(2860771..2861460) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554906.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene rnc CDS complement(2861504..2862307) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090229819.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene lepB CDS complement(2862322..2864139) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739190.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene lepA CDS complement(2864335..2865768) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764764.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(2866164..2867132) product sigma factor AlgU regulator MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101960.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene mucB CDS complement(2867132..2867842) product anti sigma-E factor RseA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405339.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(2868025..2868630) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554912.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene rpoE CDS 2868912..2869991 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382491.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(2870073..2872220) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112522.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene dinG CDS complement(2872353..2873627) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119269.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene rhlB CDS 2873772..2874011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 2874011..2874826 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104469.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene xthA CDS complement(2874834..2876075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(2876072..2876806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 note possible pseudo, frameshifted CDS complement(2876806..2877210) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(2877203..2877736) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458945.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(2877720..2879129) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707899.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(2879126..2879950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 tRNA 2880653..2880751 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS complement(2881059..2881808) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091107.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 2882117..2883775 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406170.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(2883919..2884743) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109274.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(2884798..2887002) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542538.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene pcrA CDS complement(2887002..2887571) product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972175.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(2887596..2888423) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091117.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(2888466..2888801) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(2888824..2889810) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104126.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(2889798..2890442) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267153.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene tmk CDS complement(2890458..2891459) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430993.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene mltG CDS complement(2891503..2892312) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene pabC CDS complement(2892318..2893535) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072710.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene fabF CDS complement(2893728..2893961) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091135.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene acpP CDS complement(2894061..2894804) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318510.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene fabG CDS complement(2894819..2895784) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032624.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene fabD CDS complement(2895790..2896881) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054091481.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene plsX CDS complement(2896918..2897088) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947121.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene rpmF CDS complement(2897120..2897647) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705036.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene yceD CDS 2897764..2898348 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(2898368..2899420) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene sppA CDS complement(2899444..2900115) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(2900112..2901068) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201356046.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene rluC CDS 2901757..2905089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(2905190..2906488) product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 2906613..2908667 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 2908779..2910506 product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103125.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene ligB CDS complement(2910583..2911179) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202069.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene folE CDS 2911378..2911830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26830 tRNA complement(2911842..2911917) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA complement(2911946..2912021) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA complement(2912092..2912167) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA complement(2912305..2912381) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 CDS complement(2912473..2913429) product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104841.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 2913644..2914243 product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096684.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene betI CDS 2914291..2915760 product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114436.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene betB CDS 2915836..2917527 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704691.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene betA CDS 2917680..2920130 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108955.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(2920266..2921243) product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111202.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 2921389..2922147 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene kduD CDS complement(2922167..2922754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 2922846..2923601 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391533.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 2923685..2924506 product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 2924499..2925143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 2925679..2927484 product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275301.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene btuB CDS 2927583..2929193 product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925635.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(2929226..2930881) product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253201.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene panP CDS 2931062..2932138 product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083628.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 2932174..2932491 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266452.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 2932550..2933149 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278887.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene cobO CDS complement(2933143..2934015) product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 2934063..2934836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(2934858..2936138) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097631.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene serS CDS 2936509..2939700 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104207.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 2939759..2939959 product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040115264.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 2940226..2942064 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(2942120..2942923) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767891.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene trpC CDS complement(2942920..2943957) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085203.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene trpD CDS complement(2943972..2944547) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767895.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(2944847..2946373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(2946370..2946543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(2946749..2948248) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113204.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene trpE CDS complement(2948472..2949137) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113205.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 2949364..2950662 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816134.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(2950680..2951003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(2951009..2951707) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085122.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene rpe CDS 2951845..2953596 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene ggt CDS 2953738..2954907 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275363.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 2955029..2955649 product YajG family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094953.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(2955653..2956306) product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036586.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(2956329..2956961) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104779.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(2957168..2957494) product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 2957703..2959052 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093158.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene miaB CDS 2959278..2960366 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 2960363..2960896 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191149949.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene ybeY CDS 2960893..2961774 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 2961841..2963325 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268977.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene lnt CDS complement(2963344..2963877) product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261461.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 2964134..2966716 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100324.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene leuS CDS 2966744..2967250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 2967247..2968305 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene holA CDS 2968401..2969813 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711525.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene nhaC CDS 2970176..2970841 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967771.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 2970874..2972040 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969992.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 2972045..2972776 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969991.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 2972827..2973717 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969990.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 2973787..2974629 product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 2974655..2975956 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104356.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(2975987..2976589) product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210965.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(2976990..2977466) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444179.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS complement(2977637..2978053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 2978327..2979346 product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077244862.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 assembly_gap 2979312..2979321 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2979804..2981291) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101230.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(2981561..2982844) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528700.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(2982903..2983793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228671.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 2983901..2984830 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921339.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS complement(2984847..2985383) product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338119.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene idi CDS 2985490..2985921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(2985996..2987174) product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065826.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene fadA CDS complement(2987202..2989376) product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091204.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene fadB CDS 2989576..2990703 product DUF5924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102998.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 2990788..2991240 product virulence master transcriptional regulator RovA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210955.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene rovA CDS complement(2991274..2991795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 2991890..2992348 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091210.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(2992390..2994315) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245346.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 2994432..2995295 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS 2995292..2995774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(2995787..2996323) product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(2996437..2997009) product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098148.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 2997128..2998570 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705975.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 2998560..2999630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 2999702..3000397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(3000409..3000651) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105999.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene tusA CDS complement(3000689..3001771) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268413.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene rlmM CDS 3001892..3002623 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217034.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene trmJ CDS complement(3002713..3004389) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene rpsA CDS complement(3004585..3005283) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106707.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene cmk CDS complement(3005280..3007505) product bifunctional prephenate dehydrogenase/3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207213.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS complement(3007506..3008597) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091446.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene pheA CDS complement(3008612..3009694) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207406.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene serC CDS complement(3009764..3012481) product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098009.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene gyrA CDS complement(3012638..3013072) product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194531.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene fadM CDS 3013259..3014188 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706841.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene rdgC CDS 3014185..3015348 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114706.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(3015697..3017175) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114825.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 3017254..3018417 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958179.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 3018507..3018788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(3018828..3019286) product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223804324.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 3019599..3021419 product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene pilB CDS 3021461..3022795 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 3023000..3023866 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 3023911..3024549 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112838.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene coaE CDS 3024546..3024791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(3024958..3026442) product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103059.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene prpD CDS complement(3026644..3027771) product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070709.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene prpC CDS complement(3027863..3028744) product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070710.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene prpB CDS complement(3028741..3029466) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463438.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 3029685..3031031 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267422.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene pabB CDS 3031054..3032130 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061357.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 3032127..3032927 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208783.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 3033104..3033724 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038282.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(3033802..3034773) product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene cysB CDS 3035034..3035357 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene trxA CDS complement(3035433..3036482) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(3036619..3038430) product phenylacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084842.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(3038574..3039335) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(3039404..3039991) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812436.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 3040099..3041286 product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103022.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(3041295..3041621) product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425054.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(3041618..3042013) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene crcB CDS complement(3042246..3043133) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918181.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene pstB CDS complement(3043162..3044328) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864528.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 gene pstA CDS complement(3044351..3045607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(3045747..3046760) product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(3047067..3048269) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 3048443..3050182 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205290.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(3050309..3050818) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315067.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(3050805..3051977) product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407019.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(3051989..3052729) product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(3052726..3053868) product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(3053914..3057927) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene hrpA CDS complement(3058022..3059383) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(3059512..3061179) product long-chain-fatty-acid--CoA ligase FadD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104873.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene fadD1 CDS complement(3061282..3062109) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208719.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(3062102..3063925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(3063935..3064366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 3064419..3066563 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112365.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(3066615..3067082) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119281.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(3067082..3067372) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100122.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(3067378..3068520) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895548.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene rnd CDS complement(3068551..3069156) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087237.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene recR CDS complement(3069269..3069595) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706069.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(3069644..3071527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(3071665..3071931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 3072432..3073655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 3073688..3075712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(3075812..3077326) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706152.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(3077326..3077781) product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268760.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(3077781..3078767) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365605.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 3078976..3079602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 3079599..3080261 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194607.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS 3080258..3081619 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268758.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 3081616..3082725 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972346.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS 3082722..3083489 product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(3083510..3086839) product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208612.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene mscK CDS 3087010..3087939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 3087999..3088340 product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098866.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 3088340..3088735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 3088722..3089015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(3089114..3090973) product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993346.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(3091087..3092583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(3092685..3093866) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819957.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 3093984..3094397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(3094437..3094955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 3095215..3095970 product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 gene anr CDS 3096027..3097025 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403237.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(3097053..3098114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 3098245..3099894 product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931517.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(3099902..3100492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 3100619..3101641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(3101742..3102650) product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040098.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene thpD CDS complement(3102780..3104621) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070916.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(3104641..3106305) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072332.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(3106331..3107308) product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072331.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(3107301..3108506) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072330.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 3108859..3110793 product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804218.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(3110811..3111296) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418921.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(3111327..3112157) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088305.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(3112320..3112562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(3112660..3113118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(3113115..3115748) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268332.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 gene topA CDS 3116173..3117645 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814419.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene pyk CDS 3117642..3118118 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367424.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene mgsA CDS complement(3118126..3120372) product DUF3141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040308.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 3120689..3121882 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484151.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(3121899..3122243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(3122320..3122955) product DUF533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040504.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(3123065..3124870) product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105539.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 gene oadA CDS complement(3124881..3126296) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096848.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 3126475..3127461 product LysR family transcriptional regulator PycR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene pycR CDS 3127643..3128695 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946482.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene lipA CDS complement(3128774..3129427) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707033.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene lipB CDS complement(3129427..3129738) product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100311.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(3130007..3131143) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(3131276..3132238) product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929963.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(3132235..3133266) product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene mltB CDS complement(3133319..3134464) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244673.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 gene rodA CDS complement(3134451..3136343) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene mrdA CDS complement(3136433..3136900) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093193.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 gene rlmH CDS complement(3136897..3137259) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene rsfS CDS complement(3137296..3137973) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161458274.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene nadD CDS complement(3137966..3139243) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 3139398..3140255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 3140256..3141200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 3141197..3142603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(3142771..3143394) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705371.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(3143447..3144067) product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene ubiX CDS complement(3144060..3145427) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093229.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene mpl CDS 3145618..3146877 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(3146922..3148637) product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004342954.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 3148805..3149335 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093248.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene ppa CDS complement(3149423..3150646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 3150744..3152669 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene dsbD CDS 3153088..3153543 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene accB CDS 3153572..3154912 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095391.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene accC CDS 3154937..3155842 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399696.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene prmA CDS 3155942..3156970 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399694.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene dusB CDS 3156967..3157266 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121116.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene fis CDS 3157350..3158942 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057885.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene purH CDS complement(3159161..3160618) product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene gabD CDS complement(3160629..3161186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(3161269..3162252) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(3162309..3162992) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 3163103..3164158 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763762.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene bioB CDS 3164160..3165326 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269172.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene bioF CDS 3165323..3166045 product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817359.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene bioH CDS 3166042..3166854 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113247.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene bioC CDS 3166851..3167540 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103336.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene bioD tRNA 3167583..3167667 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 CDS 3168329..3169096 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339467.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(3170101..3170358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 tRNA complement(3170594..3170669) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 CDS 3170871..3171518 product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090351.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene uvrY CDS 3171582..3173396 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene uvrC CDS 3173458..3174006 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene pgsA tRNA 3174064..3174138 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA 3174255..3174328 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA 3174371..3174457 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 CDS 3174583..3175749 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706870.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 3175736..3177313 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764756.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene nadB CDS complement(3177290..3177685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(3177645..3177923) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085532.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 3178118..3178414 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420161.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 gene ihfB CDS 3178452..3178757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 3178758..3179942 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene lapB CDS complement(3179946..3180650) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090975.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene pyrF CDS 3180866..3181135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(3181257..3182018) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 3182190..3182705 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094066.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene fxsA CDS 3182889..3183182 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 3183252..3184892 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094059.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 gene groL CDS complement(3185026..3186048) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182236.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene dusA CDS complement(3186137..3187177) product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183315.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(3187287..3187901) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(3187901..3188671) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031073.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 3188898..3189872 product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS 3189907..3190305 product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 3190302..3191366 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230077.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 3191368..3192270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 3192267..3193961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS 3194103..3195218 product GTP cyclohydrolase II RibA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038822.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene ribA CDS complement(3195194..3196009) product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 3196129..3197685 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228222.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 3197764..3198759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 3198756..3199460 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 3199584..3201257 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113843.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(3201369..3201797) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(3201890..3202465) product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071856.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS 3202567..3203457 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843742.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(3203466..3204212) product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037843.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene nfi CDS 3204285..3205532 product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406534.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 3205529..3208834 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104711.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(3208859..3210037) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 3210126..3211361 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921458.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene argE CDS 3211458..3212234 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171057.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(3212303..3214102) product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086692.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 3214445..3215719 product bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(3215854..3217599) product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206894.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 3218095..3219114 product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065227.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 gene dctP sequence2 source 1..306746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS 199..1197 product GguC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267192.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene gguC CDS 1225..2802 product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS complement(2869..3855) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036922.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 4010..5314 product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703671.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 5509..6561 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 6623..7108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 7105..8361 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974961.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 8381..9808 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111807168.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 10043..10792 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216393.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 10849..11691 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703672.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS 11743..13383 product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919362.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(13496..14218) product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525327.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene nanR CDS complement(14276..15346) product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257444.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(15360..16739) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(16762..17316) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089572.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(17392..18390) product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965680.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS complement(18519..19667) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393103.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(19660..20655) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339282.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene pdxA CDS complement(20652..21416) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529934.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 21564..22736 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205727.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(22824..23027) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196837.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 23281..24123 product 2OG-Fe(II) oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455357.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS 24191..24601 product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404557.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS 24657..25238 product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390496.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS 25266..25907 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236662.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(26075..27406) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477179.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(27550..28362) product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035524.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene dkgB CDS 28544..29680 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939260.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(29768..30451) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810926.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(30591..31787) product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(31801..33318) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381064.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene purF CDS complement(33325..33936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(33933..34595) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104736.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(34631..35920) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115014.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene folC CDS complement(35921..36922) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104199.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene accD CDS complement(37006..37809) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 gene trpA CDS complement(37908..39122) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116129.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene trpB CDS complement(39151..39774) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(39804..40739) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098140.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 gene truA CDS complement(40855..43029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(43233..44348) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552957.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene asd CDS complement(44642..45721) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208285.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene leuB CDS complement(45852..46499) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 gene leuD CDS complement(46503..47942) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091399.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene leuC CDS 48114..49007 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(49041..50879) product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486234.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(51007..51540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(51646..52014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(52147..53232) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405788.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene aroC CDS complement(53253..54206) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087648.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene prmB CDS 54343..54915 product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087642.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(54922..55956) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087542.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS complement(55977..56843) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 57116..58063 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766467.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 58177..58602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(58677..58817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(58849..59571) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243745.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(59749..60549) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972793.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(60604..61467) product D-galactarolactone isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972788.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(61470..62606) product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(62638..63918) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919324.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(63923..64459) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275128.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(64526..65530) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566022.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(65562..66479) product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038348.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene kdgD CDS complement(66774..67256) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406129.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 gene sixA CDS complement(67256..68320) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267382.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(68403..69842) product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163901150.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(69865..71436) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720404.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(71921..72517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(72625..74094) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114563.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(74235..76133) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769616.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 gene htpG CDS complement(76269..76598) product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232481.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 76700..78643 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705455.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(78930..80627) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896448.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 81062..81511 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704544.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(81567..81695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(81754..83403) product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446850.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(83984..84985) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767387.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(85067..85975) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 86075..86920 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071178.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 87137..88819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 88970..89446 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532767.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS 89618..91252 product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813960.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene betT CDS 91475..92326 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535100.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 92339..93097 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS 93114..93854 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 93859..94530 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081260.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 94593..94976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 95058..95873 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073621.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene modA CDS 95881..96576 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097514.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene modB CDS 96593..97687 product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385100.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene modC CDS complement(97719..99272) product sigma-54-dependent phenylalanine hydroxylase transcriptional regulator PhhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114242.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 99556..100353 product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114241.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene phhA CDS 100406..100762 product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085898.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 100746..101936 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114240.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(102134..102724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(102797..103234) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393272.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(103269..104192) product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477542.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene yegS CDS complement(104269..105456) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074161.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(105516..106214) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337653.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 106345..107163 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815895.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(107261..108946) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706534.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene leuA CDS 109226..109714 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS 109803..110150 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261433.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 110248..110679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 110756..111925 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227876.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 112044..112670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(112740..112946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 113220..113513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113255.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 113606..114127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(114207..116888) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene pepN CDS complement(116973..117428) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385268.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(117671..118156) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038715.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(118202..118723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 118900..120384 product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(120397..121464) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(121481..122974) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104915.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(122985..123434) product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283754.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS complement(123431..124417) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085519.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 124558..125226 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194607.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 125223..126617 product sensor histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS 126619..127659 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392183.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(127656..128492) product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(128480..128740) product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104989.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(128801..129652) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(129838..130836) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091336.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(130844..131725) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382947.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 131825..132784 product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113939.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(132801..133841) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200942.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(133974..134840) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262779.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS 134839..135357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(135383..135667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 136168..136650 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207342.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS complement(136718..137359) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097039.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(137375..139537) product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 139666..140268 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene msrA CDS complement(140278..141483) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705687.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 141576..142463 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705688.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(142474..143061) product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706124.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 gene mepS CDS complement(143282..145732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 145971..147248 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527918.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(147371..147616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(147677..148222) product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 148468..150072 product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435016.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 150205..151611 product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045970399.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 151608..152636 product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138748.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 152741..153181 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967578.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(153369..153599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS complement(153635..156523) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195994.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene fdhF CDS complement(156520..158085) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(158085..158630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 158964..159593 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245344.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 159693..161633 product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485046.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 161996..163870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(163987..164859) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087428.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene sucD CDS complement(164859..166025) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087425.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene sucC CDS complement(166165..167604) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene lpdA CDS complement(167643..169208) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019797.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene odhB CDS complement(169250..172069) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(172351..173061) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316554.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(173073..174845) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087407.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 gene sdhA CDS complement(174849..175196) product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316551.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene sdhD CDS complement(175190..175567) product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104388.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene sdhC CDS 175979..177268 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087400.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene gltA CDS 177416..177631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31200 tRNA complement(177995..178070) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA complement(178109..178184) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 CDS complement(178313..179794) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738107.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene gltX CDS 179898..180638 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266205.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(180643..181566) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 182115..182714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 182801..183004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(183137..184237) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106569.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene hppD CDS complement(184474..185064) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094003.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 185154..186053 product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268819.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(186084..187277) product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118811.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene fdhA CDS complement(187424..187726) product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117857.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 187924..189075 product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096932.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene cfa CDS complement(189501..189959) product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073765.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 gene slyA CDS complement(190095..190487) product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329247.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(190560..191228) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064925.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(191353..191931) product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889427.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS 192000..193973 product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236934.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(194004..194345) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(194461..195378) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243788.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 195529..196662 product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704356.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 196718..197848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS 197918..199885 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395919.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 200034..200159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS 200159..201265 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529931.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(201270..202946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 203223..203405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 203622..205031 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206399.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(205117..205344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(205438..206073) product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525148.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 206282..208150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31490 note possible pseudo, frameshifted CDS 208143..209912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS complement(210051..210713) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113440.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(210734..211408) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113441.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene pgl CDS complement(211424..212899) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266836.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene zwf CDS 213100..213966 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375897.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 214045..214911 product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 214914..215624 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113154.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 215617..217119 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707871.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene phnE CDS 217107..217553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 217836..218303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 218328..218906 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197654.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 219235..219891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS 219840..220076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 220317..220889 product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318883.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene mntP CDS 221021..221698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 221698..222486 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402969.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 222494..222757 product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551687.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 222781..223332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014366.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS 223332..225044 product acyl-CoA synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765442.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS 225041..225805 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266398.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS 225802..226746 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105312.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 226736..228310 product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245619.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 228331..228894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS 228891..231239 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479011.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 231214..232473 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074032.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS 232470..233048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 233041..234243 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266391.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 234240..234692 product 3-hydroxy-fatty acyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369293.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 234685..235422 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765466.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene fabG CDS 235536..236144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(236316..236696) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(236724..237563) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836249.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(237637..239127) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(239427..240302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(240431..241120) product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368060.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene csiR CDS 241287..242249 product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993126.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 gene glaH CDS 242522..243718 product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271942.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 gene lhgO CDS complement(243741..245225) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189443605.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 245410..246834 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 246848..248296 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706799.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 248511..249788 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039517.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene gabT CDS complement(249819..250643) product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958256.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(250640..252115) product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665631.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(252203..254041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 254261..255445 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398095.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 255442..257130 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338059.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 257127..257786 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968331.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(257787..258455) product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241077.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 258776..259726 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene argC CDS complement(259805..260764) product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974132.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene eutC CDS complement(260831..261832) product hydroxyectoine utilization dehydratase EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992461.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene eutB CDS complement(261933..263345) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969340.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(263569..265038) product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772894.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene gabD CDS complement(265199..265978) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769867.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene fdhD CDS complement(266039..266509) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530324.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(266571..267602) product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401275.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene doeB CDS complement(267634..268833) product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974131.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 gene doeA CDS 269043..270449 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530325.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 270491..271420 product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930857.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(271428..271709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(271750..272790) product DUF2955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705154.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(272859..273920) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119629.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 274238..275221 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS 275221..275982 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089319.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(276060..276620) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930417.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS 276771..277469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 277577..278503 product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705573.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 278629..279891 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS 279888..282995 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 283492..285546 product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097646.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 gene betT CDS complement(285631..286965) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640422.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 287304..287513 product DUF2061 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074324.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(287531..288373) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976315.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(288417..288908) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114441.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(288905..289858) product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096713.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(289855..290763) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494032.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 291034..292506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 292590..294494 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103572.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene dsbD CDS 294491..295327 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089792.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 295382..296125 product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089790.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene dsbG CDS complement(296156..297463) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103567.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(297460..298137) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(298266..298679) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818372.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(298676..299137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(299197..300450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(300539..301405) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(301609..302487) product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949103.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 302856..303338 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369339.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene gntK CDS complement(303629..304540) product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127104.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 gene dgoK CDS complement(304537..305223) product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918669.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(305421..306569) product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975371.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 gene dgoD sequence3 source 1..13452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(114..269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(345..578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 955..1146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556012.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 1133..1408 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740380.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 1727..1927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 2143..3000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(3011..3625) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103083.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(4536..5444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(5441..8008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS complement(7998..8465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(8623..8826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(8829..9104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(9115..9315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(9312..9563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 9774..10172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(10177..10956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(10956..11189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(11192..11752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(11749..12081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(12128..12469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069482.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(12466..12888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(12917..13201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32620 sequence4 source 1..2790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(74..1525) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707307.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 1658..2509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32640 sequence5 source 1..2701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 862..1497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(1568..2188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32660 sequence6 source 1..2319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1303..1590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS complement(1590..1946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 sequence7 source 1..1763 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1485..1763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 sequence8 source 1..1300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 241..585 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340660.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700