>Feature sequence01 1323 979 gene locus_tag LOCUS_00010 1323 979 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877101.1 protein_id gnl|my_center|LOCUS_00010 1573 4050 gene locus_tag LOCUS_00020 1573 4050 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948003.1 protein_id gnl|my_center|LOCUS_00020 4283 4735 gene locus_tag LOCUS_00030 4283 4735 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358683.1 protein_id gnl|my_center|LOCUS_00030 4847 5674 gene locus_tag LOCUS_00040 4847 5674 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430209.1 protein_id gnl|my_center|LOCUS_00040 5693 6049 gene locus_tag LOCUS_00050 5693 6049 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966444.1 protein_id gnl|my_center|LOCUS_00050 6500 6108 gene locus_tag LOCUS_00060 6500 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6760 7152 gene locus_tag LOCUS_00070 gene mscL 6760 7152 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386972.1 protein_id gnl|my_center|LOCUS_00070 7228 8322 gene locus_tag LOCUS_00080 7228 8322 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_00080 9615 8395 gene locus_tag LOCUS_00090 9615 8395 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963632.1 protein_id gnl|my_center|LOCUS_00090 9854 10069 gene locus_tag LOCUS_00100 9854 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12613 10145 gene locus_tag LOCUS_00110 12613 10145 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948680.1 protein_id gnl|my_center|LOCUS_00110 13717 12776 gene locus_tag LOCUS_00120 13717 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14123 14566 gene locus_tag LOCUS_00130 14123 14566 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047979.1 protein_id gnl|my_center|LOCUS_00130 14631 15047 gene locus_tag LOCUS_00140 14631 15047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15849 15160 gene locus_tag LOCUS_00150 15849 15160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16742 15912 gene locus_tag LOCUS_00160 16742 15912 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966201.1 protein_id gnl|my_center|LOCUS_00160 17257 16772 gene locus_tag LOCUS_00170 17257 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17689 17555 gene locus_tag LOCUS_00180 17689 17555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18097 17759 gene locus_tag LOCUS_00190 18097 17759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18736 18446 gene locus_tag LOCUS_00200 18736 18446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20388 18982 gene locus_tag LOCUS_00210 20388 18982 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_00210 20889 20758 gene locus_tag LOCUS_00220 20889 20758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21815 20967 gene locus_tag LOCUS_00230 21815 20967 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963925.1 protein_id gnl|my_center|LOCUS_00230 23503 21983 gene locus_tag LOCUS_00240 23503 21983 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948134.1 protein_id gnl|my_center|LOCUS_00240 24922 23540 gene locus_tag LOCUS_00250 24922 23540 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_00250 25609 24923 gene locus_tag LOCUS_00260 25609 24923 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356531.1 protein_id gnl|my_center|LOCUS_00260 26117 25788 gene locus_tag LOCUS_00270 26117 25788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27724 26240 gene locus_tag LOCUS_00280 27724 26240 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460469.1 protein_id gnl|my_center|LOCUS_00280 28590 27850 gene locus_tag LOCUS_00290 28590 27850 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948252.1 protein_id gnl|my_center|LOCUS_00290 28856 28620 gene locus_tag LOCUS_00300 28856 28620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 29072 28857 gene locus_tag LOCUS_00310 29072 28857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 29348 29617 gene locus_tag LOCUS_00320 29348 29617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 29604 29813 gene locus_tag LOCUS_00330 29604 29813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 29921 30637 gene locus_tag LOCUS_00340 29921 30637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 30824 32170 gene locus_tag LOCUS_00350 30824 32170 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963764.1 protein_id gnl|my_center|LOCUS_00350 32369 34360 gene locus_tag LOCUS_00360 gene tkt 32369 34360 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_00360 35012 34656 gene locus_tag LOCUS_00370 35012 34656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00370 35420 35590 gene locus_tag LOCUS_00380 35420 35590 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363046.1 protein_id gnl|my_center|LOCUS_00380 36505 35654 gene locus_tag LOCUS_00390 36505 35654 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099535.1 protein_id gnl|my_center|LOCUS_00390 38250 36859 gene locus_tag LOCUS_00400 gene asnS 38250 36859 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432177.1 protein_id gnl|my_center|LOCUS_00400 39106 38792 gene locus_tag LOCUS_00410 39106 38792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00410 39438 39115 gene locus_tag LOCUS_00420 39438 39115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00420 39921 39676 gene locus_tag LOCUS_00430 39921 39676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 40920 40057 gene locus_tag LOCUS_00440 40920 40057 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_00440 41969 41232 gene locus_tag LOCUS_00450 41969 41232 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017120.1 protein_id gnl|my_center|LOCUS_00450 42171 42539 gene locus_tag LOCUS_00460 42171 42539 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462292.1 protein_id gnl|my_center|LOCUS_00460 42719 43504 gene locus_tag LOCUS_00470 42719 43504 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963627.1 protein_id gnl|my_center|LOCUS_00470 43507 44256 gene locus_tag LOCUS_00480 43507 44256 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895795.1 protein_id gnl|my_center|LOCUS_00480 46615 44303 gene locus_tag LOCUS_00490 gene clpA 46615 44303 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965130.1 protein_id gnl|my_center|LOCUS_00490 46935 46618 gene locus_tag LOCUS_00500 46935 46618 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965129.1 protein_id gnl|my_center|LOCUS_00500 47203 47886 gene locus_tag LOCUS_00510 47203 47886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986229.1 protein_id gnl|my_center|LOCUS_00510 48124 48972 gene locus_tag LOCUS_00520 48124 48972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 49703 49323 gene locus_tag LOCUS_00530 49703 49323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 51031 50270 gene locus_tag LOCUS_00540 51031 50270 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963763.1 protein_id gnl|my_center|LOCUS_00540 51806 51063 gene locus_tag LOCUS_00550 51806 51063 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963752.1 protein_id gnl|my_center|LOCUS_00550 52870 51974 gene locus_tag LOCUS_00560 52870 51974 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_00560 53664 52963 gene locus_tag LOCUS_00570 53664 52963 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990781.1 protein_id gnl|my_center|LOCUS_00570 54554 53907 gene locus_tag LOCUS_00580 gene pgmB 54554 53907 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_00580 55418 54591 gene locus_tag LOCUS_00590 55418 54591 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_00590 56387 55431 gene locus_tag LOCUS_00600 56387 55431 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_00600 57682 56441 gene locus_tag LOCUS_00610 57682 56441 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_00610 58726 57716 gene locus_tag LOCUS_00620 58726 57716 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498680.1 protein_id gnl|my_center|LOCUS_00620 61061 58785 gene locus_tag LOCUS_00630 61061 58785 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886611.1 protein_id gnl|my_center|LOCUS_00630 61521 61285 gene locus_tag LOCUS_00640 61521 61285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 61616 62170 gene locus_tag LOCUS_00650 61616 62170 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986296.1 protein_id gnl|my_center|LOCUS_00650 62334 62747 gene locus_tag LOCUS_00660 62334 62747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385082.1 protein_id gnl|my_center|LOCUS_00660 63204 63452 gene locus_tag LOCUS_00670 63204 63452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00670 63680 64687 gene locus_tag LOCUS_00680 63680 64687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 64789 64968 gene locus_tag LOCUS_00690 64789 64968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 66263 65100 gene locus_tag LOCUS_00700 66263 65100 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048226.1 protein_id gnl|my_center|LOCUS_00700 66537 67697 gene locus_tag LOCUS_00710 66537 67697 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461367.1 protein_id gnl|my_center|LOCUS_00710 69215 67764 gene locus_tag LOCUS_00720 69215 67764 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048253.1 protein_id gnl|my_center|LOCUS_00720 70877 69426 gene locus_tag LOCUS_00730 70877 69426 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048253.1 protein_id gnl|my_center|LOCUS_00730 71682 70981 gene locus_tag LOCUS_00740 71682 70981 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902128.1 protein_id gnl|my_center|LOCUS_00740 73360 71687 gene locus_tag LOCUS_00750 73360 71687 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815872.1 protein_id gnl|my_center|LOCUS_00750 73581 73937 gene locus_tag LOCUS_00760 73581 73937 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_00760 74032 74640 gene locus_tag LOCUS_00770 74032 74640 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986310.1 protein_id gnl|my_center|LOCUS_00770 75147 74932 gene locus_tag LOCUS_00780 75147 74932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 75959 75234 gene locus_tag LOCUS_00790 75959 75234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 77159 76074 gene locus_tag LOCUS_00800 77159 76074 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986516.1 protein_id gnl|my_center|LOCUS_00800 78327 77182 gene locus_tag LOCUS_00810 78327 77182 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986515.1 protein_id gnl|my_center|LOCUS_00810 79499 78366 gene locus_tag LOCUS_00820 79499 78366 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986515.1 protein_id gnl|my_center|LOCUS_00820 80590 79508 gene locus_tag LOCUS_00830 80590 79508 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986516.1 protein_id gnl|my_center|LOCUS_00830 81705 80593 gene locus_tag LOCUS_00840 81705 80593 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986515.1 protein_id gnl|my_center|LOCUS_00840 82796 81702 gene locus_tag LOCUS_00850 82796 81702 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986516.1 protein_id gnl|my_center|LOCUS_00850 84286 82805 gene locus_tag LOCUS_00860 84286 82805 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986513.1 protein_id gnl|my_center|LOCUS_00860 84531 85148 gene locus_tag LOCUS_00870 84531 85148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 85980 85432 gene locus_tag LOCUS_00880 85980 85432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 86493 86095 gene locus_tag LOCUS_00890 86493 86095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00890 86968 86801 gene locus_tag LOCUS_00900 86968 86801 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026198.1 protein_id gnl|my_center|LOCUS_00900 88732 87203 gene locus_tag LOCUS_00910 88732 87203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 90173 88947 gene locus_tag LOCUS_00920 90173 88947 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459866.1 protein_id gnl|my_center|LOCUS_00920 90691 91137 gene locus_tag LOCUS_00930 90691 91137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 91181 93382 gene locus_tag LOCUS_00940 91181 93382 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_00940 94653 93460 gene locus_tag LOCUS_00950 94653 93460 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101557.1 protein_id gnl|my_center|LOCUS_00950 96577 94679 gene locus_tag LOCUS_00960 gene abc-f 96577 94679 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195117.1 protein_id gnl|my_center|LOCUS_00960 96918 96772 gene locus_tag LOCUS_00970 96918 96772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 97639 97013 gene locus_tag LOCUS_00980 97639 97013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 99848 97632 gene locus_tag LOCUS_00990 99848 97632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 101007 99904 gene locus_tag LOCUS_01000 101007 99904 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704264.1 protein_id gnl|my_center|LOCUS_01000 102166 101195 gene locus_tag LOCUS_01010 102166 101195 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582922.1 protein_id gnl|my_center|LOCUS_01010 103745 102276 gene locus_tag LOCUS_01020 gene gtfA 103745 102276 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775657.1 protein_id gnl|my_center|LOCUS_01020 104735 103779 gene locus_tag LOCUS_01030 104735 103779 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963746.1 protein_id gnl|my_center|LOCUS_01030 106312 104828 gene locus_tag LOCUS_01040 106312 104828 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582926.1 protein_id gnl|my_center|LOCUS_01040 107163 106336 gene locus_tag LOCUS_01050 107163 106336 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_01050 108048 107164 gene locus_tag LOCUS_01060 108048 107164 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_01060 109452 108136 gene locus_tag LOCUS_01070 109452 108136 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582923.1 protein_id gnl|my_center|LOCUS_01070 110109 109711 gene locus_tag LOCUS_01080 110109 109711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 110426 110109 gene locus_tag LOCUS_01090 110426 110109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 110708 111028 gene locus_tag LOCUS_01100 110708 111028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 111069 111680 gene locus_tag LOCUS_01110 111069 111680 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357726.1 protein_id gnl|my_center|LOCUS_01110 111680 112450 gene locus_tag LOCUS_01120 gene fdhD 111680 112450 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227709.1 protein_id gnl|my_center|LOCUS_01120 112816 113325 gene locus_tag LOCUS_01130 112816 113325 CDS product DUF5698 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357138.1 protein_id gnl|my_center|LOCUS_01130 113502 114071 gene locus_tag LOCUS_01140 113502 114071 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888695.1 protein_id gnl|my_center|LOCUS_01140 115522 114176 gene locus_tag LOCUS_01150 115522 114176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 116289 115819 gene locus_tag LOCUS_01160 gene ybaK 116289 115819 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_01160 116663 118168 gene locus_tag LOCUS_01170 gene yjeM 116663 118168 CDS product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986430.1 protein_id gnl|my_center|LOCUS_01170 119349 118273 gene locus_tag LOCUS_01180 119349 118273 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490874.1 protein_id gnl|my_center|LOCUS_01180 119803 119477 gene locus_tag LOCUS_01190 119803 119477 CDS product DUF3870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271313.1 protein_id gnl|my_center|LOCUS_01190 121082 119922 gene locus_tag LOCUS_01200 121082 119922 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430586.1 protein_id gnl|my_center|LOCUS_01200 122487 121111 gene locus_tag LOCUS_01210 gene pepV 122487 121111 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_01210 122795 123136 gene locus_tag LOCUS_01220 122795 123136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 123492 124619 gene locus_tag LOCUS_01230 123492 124619 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_01230 124775 126745 gene locus_tag LOCUS_01240 124775 126745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 126963 126829 gene locus_tag LOCUS_01250 126963 126829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 127591 127004 gene locus_tag LOCUS_01260 gene rubY 127591 127004 CDS product rubrerythrin RubY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965865.1 protein_id gnl|my_center|LOCUS_01260 128187 128681 gene locus_tag LOCUS_01270 128187 128681 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357340.1 protein_id gnl|my_center|LOCUS_01270 129078 129470 gene locus_tag LOCUS_01280 129078 129470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01280 129773 130138 gene locus_tag LOCUS_01290 129773 130138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01290 130398 131204 gene locus_tag LOCUS_01300 gene proC 130398 131204 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048171.1 protein_id gnl|my_center|LOCUS_01300 132236 131286 gene locus_tag LOCUS_01310 132236 131286 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233421.1 protein_id gnl|my_center|LOCUS_01310 133149 132229 gene locus_tag LOCUS_01320 133149 132229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245448.1 protein_id gnl|my_center|LOCUS_01320 133915 133379 gene locus_tag LOCUS_01330 133915 133379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 134698 135981 gene locus_tag LOCUS_01340 134698 135981 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966068.1 protein_id gnl|my_center|LOCUS_01340 136101 136235 gene locus_tag LOCUS_01350 136101 136235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 136319 138688 gene locus_tag LOCUS_01360 136319 138688 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_01360 139699 138788 gene locus_tag LOCUS_01370 gene cysK 139699 138788 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948444.1 protein_id gnl|my_center|LOCUS_01370 140135 139683 gene locus_tag LOCUS_01380 140135 139683 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948445.1 protein_id gnl|my_center|LOCUS_01380 140802 140158 gene locus_tag LOCUS_01390 140802 140158 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948446.1 protein_id gnl|my_center|LOCUS_01390 142341 141406 gene locus_tag LOCUS_01400 gene cysK 142341 141406 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_01400 143436 142597 gene locus_tag LOCUS_01410 gene larE 143436 142597 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896918.1 protein_id gnl|my_center|LOCUS_01410 144470 143571 gene locus_tag LOCUS_01420 gene metF 144470 143571 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_01420 145113 146030 gene locus_tag LOCUS_01430 gene metA 145113 146030 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_01430 148304 146124 gene locus_tag LOCUS_01440 148304 146124 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986267.1 protein_id gnl|my_center|LOCUS_01440 148974 148282 gene locus_tag LOCUS_01450 148974 148282 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949146.1 protein_id gnl|my_center|LOCUS_01450 149594 149025 gene locus_tag LOCUS_01460 149594 149025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986461.1 protein_id gnl|my_center|LOCUS_01460 149933 150589 gene locus_tag LOCUS_01470 149933 150589 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356430.1 protein_id gnl|my_center|LOCUS_01470 151090 150932 gene locus_tag LOCUS_01480 151090 150932 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_01480 152765 151119 gene locus_tag LOCUS_01490 gene hcp 152765 151119 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941334.1 protein_id gnl|my_center|LOCUS_01490 154505 153408 gene locus_tag LOCUS_01500 154505 153408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062194302.1 protein_id gnl|my_center|LOCUS_01500 155476 154625 gene locus_tag LOCUS_01510 155476 154625 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228625.1 protein_id gnl|my_center|LOCUS_01510 156370 155492 gene locus_tag LOCUS_01520 156370 155492 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_01520 157786 156485 gene locus_tag LOCUS_01530 157786 156485 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969647.1 protein_id gnl|my_center|LOCUS_01530 159520 157934 gene locus_tag LOCUS_01540 159520 157934 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_01540 161307 159517 gene locus_tag LOCUS_01550 161307 159517 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_01550 162785 161523 gene locus_tag LOCUS_01560 162785 161523 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198760.1 protein_id gnl|my_center|LOCUS_01560 165365 162855 gene locus_tag LOCUS_01570 165365 162855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 165607 165476 gene locus_tag LOCUS_01580 165607 165476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 165644 165814 gene locus_tag LOCUS_01590 165644 165814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 166926 165883 gene locus_tag LOCUS_01600 166926 165883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 167180 166995 gene locus_tag LOCUS_01610 167180 166995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 167653 167159 gene locus_tag LOCUS_01620 167653 167159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 168449 167817 gene locus_tag LOCUS_01630 168449 167817 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_01630 169040 169405 gene locus_tag LOCUS_01640 169040 169405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 170638 171270 gene locus_tag LOCUS_01650 gene thiT 170638 171270 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966211.1 protein_id gnl|my_center|LOCUS_01650 172991 171267 gene locus_tag LOCUS_01660 172991 171267 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_01660 173763 172996 gene locus_tag LOCUS_01670 173763 172996 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016216.1 protein_id gnl|my_center|LOCUS_01670 174970 173855 gene locus_tag LOCUS_01680 gene msrB 174970 173855 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462050.1 protein_id gnl|my_center|LOCUS_01680 175590 175027 gene locus_tag LOCUS_01690 175590 175027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 176322 175609 gene locus_tag LOCUS_01700 gene ccdA2 176322 175609 CDS product thiol-disulfide oxidoreductase-associated membrane protein CcdA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509847.1 protein_id gnl|my_center|LOCUS_01700 176782 176537 gene locus_tag LOCUS_01710 176782 176537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 177792 176761 gene locus_tag LOCUS_01720 177792 176761 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475724.1 protein_id gnl|my_center|LOCUS_01720 179382 177871 gene locus_tag LOCUS_01730 gene galT 179382 177871 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_01730 181357 179414 gene locus_tag LOCUS_01740 181357 179414 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575935.1 protein_id gnl|my_center|LOCUS_01740 182557 181397 gene locus_tag LOCUS_01750 182557 181397 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966242.1 protein_id gnl|my_center|LOCUS_01750 182886 184193 gene locus_tag LOCUS_01760 182886 184193 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582886.1 protein_id gnl|my_center|LOCUS_01760 184264 185157 gene locus_tag LOCUS_01770 184264 185157 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 protein_id gnl|my_center|LOCUS_01770 185154 185975 gene locus_tag LOCUS_01780 185154 185975 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582884.1 protein_id gnl|my_center|LOCUS_01780 186009 186281 gene locus_tag LOCUS_01790 186009 186281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01790 186359 187777 gene locus_tag LOCUS_01800 186359 187777 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836303.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01800 188847 187822 gene locus_tag LOCUS_01810 188847 187822 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966245.1 protein_id gnl|my_center|LOCUS_01810 189102 190040 gene locus_tag LOCUS_01820 189102 190040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 191857 190127 gene locus_tag LOCUS_01830 191857 190127 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087134.1 protein_id gnl|my_center|LOCUS_01830 193698 192250 gene locus_tag LOCUS_01840 193698 192250 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986715.1 protein_id gnl|my_center|LOCUS_01840 194453 193962 gene locus_tag LOCUS_01850 194453 193962 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358709.1 protein_id gnl|my_center|LOCUS_01850 194754 195578 gene locus_tag LOCUS_01860 194754 195578 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949075.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01860 195680 195814 gene locus_tag LOCUS_01870 195680 195814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 196026 198353 gene locus_tag LOCUS_01880 196026 198353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 198943 198401 gene locus_tag LOCUS_01890 198943 198401 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949045.1 protein_id gnl|my_center|LOCUS_01890 200583 199150 gene locus_tag LOCUS_01900 200583 199150 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387186.1 protein_id gnl|my_center|LOCUS_01900 202111 200855 gene locus_tag LOCUS_01910 202111 200855 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021362447.1 protein_id gnl|my_center|LOCUS_01910 202552 203043 gene locus_tag LOCUS_01920 202552 203043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 204509 203346 gene locus_tag LOCUS_01930 204509 203346 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386882.1 protein_id gnl|my_center|LOCUS_01930 204818 205843 gene locus_tag LOCUS_01940 204818 205843 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_01940 206963 205914 gene locus_tag LOCUS_01950 206963 205914 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861204.1 protein_id gnl|my_center|LOCUS_01950 207094 208491 gene locus_tag LOCUS_01960 207094 208491 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537911.1 protein_id gnl|my_center|LOCUS_01960 209618 208581 gene locus_tag LOCUS_01970 209618 208581 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435926.1 protein_id gnl|my_center|LOCUS_01970 210095 209667 gene locus_tag LOCUS_01980 210095 209667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 210886 210110 gene locus_tag LOCUS_01990 210886 210110 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434727.1 protein_id gnl|my_center|LOCUS_01990 212523 211045 gene locus_tag LOCUS_02000 212523 211045 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_02000 214780 213005 gene locus_tag LOCUS_02010 214780 213005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 216279 215236 gene locus_tag LOCUS_02020 216279 215236 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948238.1 protein_id gnl|my_center|LOCUS_02020 216621 217268 gene locus_tag LOCUS_02030 216621 217268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 217645 217421 gene locus_tag LOCUS_02040 217645 217421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 218048 218821 gene locus_tag LOCUS_02050 218048 218821 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896415.1 protein_id gnl|my_center|LOCUS_02050 218823 219584 gene locus_tag LOCUS_02060 218823 219584 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893083.1 protein_id gnl|my_center|LOCUS_02060 219571 220545 gene locus_tag LOCUS_02070 219571 220545 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434121.1 protein_id gnl|my_center|LOCUS_02070 221390 220653 gene locus_tag LOCUS_02080 gene gpmA 221390 220653 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594152.1 protein_id gnl|my_center|LOCUS_02080 221687 222763 gene locus_tag LOCUS_02090 221687 222763 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065256.1 protein_id gnl|my_center|LOCUS_02090 223980 222862 gene locus_tag LOCUS_02100 223980 222862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_02100 225184 224054 gene locus_tag LOCUS_02110 225184 224054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 226904 225531 gene locus_tag LOCUS_02120 226904 225531 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949126.1 protein_id gnl|my_center|LOCUS_02120 227554 226895 gene locus_tag LOCUS_02130 227554 226895 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405372.1 protein_id gnl|my_center|LOCUS_02130 229120 228395 gene locus_tag LOCUS_02140 229120 228395 CDS product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949125.1 protein_id gnl|my_center|LOCUS_02140 229845 229120 gene locus_tag LOCUS_02150 229845 229120 CDS product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986262.1 protein_id gnl|my_center|LOCUS_02150 231450 230068 gene locus_tag LOCUS_02160 231450 230068 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_02160 232148 231465 gene locus_tag LOCUS_02170 232148 231465 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814304.1 protein_id gnl|my_center|LOCUS_02170 233339 232194 gene locus_tag LOCUS_02180 233339 232194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 234642 233500 gene locus_tag LOCUS_02190 234642 233500 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948295.1 protein_id gnl|my_center|LOCUS_02190 236840 234756 gene locus_tag LOCUS_02200 236840 234756 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948168.1 protein_id gnl|my_center|LOCUS_02200 238204 236978 gene locus_tag LOCUS_02210 238204 236978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 239779 238289 gene locus_tag LOCUS_02220 239779 238289 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965086.1 protein_id gnl|my_center|LOCUS_02220 240516 239863 gene locus_tag LOCUS_02230 240516 239863 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965084.1 protein_id gnl|my_center|LOCUS_02230 241510 240587 gene locus_tag LOCUS_02240 241510 240587 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965083.1 protein_id gnl|my_center|LOCUS_02240 241773 242510 gene locus_tag LOCUS_02250 241773 242510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 243270 242623 gene locus_tag LOCUS_02260 243270 242623 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393503.1 protein_id gnl|my_center|LOCUS_02260 243653 243489 gene locus_tag LOCUS_02270 243653 243489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 243886 244119 gene locus_tag LOCUS_02280 243886 244119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 245763 244315 gene locus_tag LOCUS_02290 245763 244315 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039351.1 protein_id gnl|my_center|LOCUS_02290 246664 245810 gene locus_tag LOCUS_02300 246664 245810 CDS product DUF1186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882857.1 protein_id gnl|my_center|LOCUS_02300 247719 246937 gene locus_tag LOCUS_02310 247719 246937 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948498.1 protein_id gnl|my_center|LOCUS_02310 248416 247796 gene locus_tag LOCUS_02320 248416 247796 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203598.1 protein_id gnl|my_center|LOCUS_02320 250122 248443 gene locus_tag LOCUS_02330 250122 248443 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966477.1 protein_id gnl|my_center|LOCUS_02330 251062 250166 gene locus_tag LOCUS_02340 gene ftcD 251062 250166 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681237.1 protein_id gnl|my_center|LOCUS_02340 252405 251101 gene locus_tag LOCUS_02350 gene hutI 252405 251101 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108451.1 protein_id gnl|my_center|LOCUS_02350 254404 252377 gene locus_tag LOCUS_02360 254404 252377 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869356.1 protein_id gnl|my_center|LOCUS_02360 257619 254569 gene locus_tag LOCUS_02370 257619 254569 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017124.1 protein_id gnl|my_center|LOCUS_02370 258039 259346 gene locus_tag LOCUS_02380 258039 259346 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016320.1 protein_id gnl|my_center|LOCUS_02380 259408 260937 gene locus_tag LOCUS_02390 gene hutH 259408 260937 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032916282.1 protein_id gnl|my_center|LOCUS_02390 263311 261059 gene locus_tag LOCUS_02400 263311 261059 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868948.1 protein_id gnl|my_center|LOCUS_02400 264161 263304 gene locus_tag LOCUS_02410 264161 263304 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868949.1 protein_id gnl|my_center|LOCUS_02410 264636 264163 gene locus_tag LOCUS_02420 264636 264163 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_02420 266184 264667 gene locus_tag LOCUS_02430 266184 264667 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868947.1 protein_id gnl|my_center|LOCUS_02430 267909 266305 gene locus_tag LOCUS_02440 267909 266305 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 protein_id gnl|my_center|LOCUS_02440 268666 268154 gene locus_tag LOCUS_02450 268666 268154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02450 269086 268733 gene locus_tag LOCUS_02460 269086 268733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02460 269719 272577 gene locus_tag LOCUS_02470 269719 272577 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017124.1 protein_id gnl|my_center|LOCUS_02470 273606 272584 gene locus_tag LOCUS_02480 gene hutG 273606 272584 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862448.1 protein_id gnl|my_center|LOCUS_02480 273887 275335 gene locus_tag LOCUS_02490 273887 275335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 275789 275310 gene locus_tag LOCUS_02500 275789 275310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 276240 276878 gene locus_tag LOCUS_02510 276240 276878 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890743.1 protein_id gnl|my_center|LOCUS_02510 276890 277954 gene locus_tag LOCUS_02520 276890 277954 CDS product glycoprotein or S-layer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890742.1 protein_id gnl|my_center|LOCUS_02520 278531 278196 gene locus_tag LOCUS_02530 278531 278196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 279130 278768 gene locus_tag LOCUS_02540 279130 278768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02540 279552 279391 gene locus_tag LOCUS_02550 279552 279391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 279909 279798 gene locus_tag LOCUS_r00010 279909 279798 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence02 406 143 gene locus_tag LOCUS_02560 406 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 649 3111 gene locus_tag LOCUS_02570 gene leuS 649 3111 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948005.1 protein_id gnl|my_center|LOCUS_02570 4019 3225 gene locus_tag LOCUS_02580 4019 3225 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360523.1 protein_id gnl|my_center|LOCUS_02580 4245 5042 gene locus_tag LOCUS_02590 4245 5042 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948004.1 protein_id gnl|my_center|LOCUS_02590 5879 5190 gene locus_tag LOCUS_02600 5879 5190 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_02600 6202 5936 gene locus_tag LOCUS_02610 6202 5936 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356363.1 protein_id gnl|my_center|LOCUS_02610 8417 6306 gene locus_tag LOCUS_02620 8417 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 9806 8586 gene locus_tag LOCUS_02630 gene tyrS 9806 8586 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963956.1 protein_id gnl|my_center|LOCUS_02630 10740 10330 gene locus_tag LOCUS_02640 10740 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_02640 12004 10859 gene locus_tag LOCUS_02650 12004 10859 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048266.1 protein_id gnl|my_center|LOCUS_02650 13196 12111 gene locus_tag LOCUS_02660 13196 12111 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963955.1 protein_id gnl|my_center|LOCUS_02660 14475 13357 gene locus_tag LOCUS_02670 14475 13357 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963964.1 protein_id gnl|my_center|LOCUS_02670 15874 14462 gene locus_tag LOCUS_02680 15874 14462 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963963.1 protein_id gnl|my_center|LOCUS_02680 16026 17123 gene locus_tag LOCUS_02690 16026 17123 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963962.1 protein_id gnl|my_center|LOCUS_02690 17731 17189 gene locus_tag LOCUS_02700 17731 17189 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099527.1 protein_id gnl|my_center|LOCUS_02700 17814 18002 gene locus_tag LOCUS_02710 17814 18002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 18007 18189 gene locus_tag LOCUS_02720 18007 18189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 19858 18263 gene locus_tag LOCUS_02730 19858 18263 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_02730 21481 20483 gene locus_tag LOCUS_02740 gene trpS 21481 20483 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_02740 22220 21846 gene locus_tag LOCUS_02750 22220 21846 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048271.1 protein_id gnl|my_center|LOCUS_02750 22484 22693 gene locus_tag LOCUS_02760 22484 22693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 31366 22739 gene locus_tag LOCUS_02770 31366 22739 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963929.1 protein_id gnl|my_center|LOCUS_02770 32876 31575 gene locus_tag LOCUS_02780 32876 31575 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_02780 33099 34286 gene locus_tag LOCUS_02790 33099 34286 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_02790 36040 34742 gene locus_tag LOCUS_02800 gene lysA 36040 34742 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963928.1 protein_id gnl|my_center|LOCUS_02800 37265 36066 gene locus_tag LOCUS_02810 37265 36066 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048275.1 protein_id gnl|my_center|LOCUS_02810 37796 38125 gene locus_tag LOCUS_02820 37796 38125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 38421 38585 gene locus_tag LOCUS_02830 38421 38585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 38579 38908 gene locus_tag LOCUS_02840 38579 38908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 39469 39642 gene locus_tag LOCUS_02850 39469 39642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 39639 41204 gene locus_tag LOCUS_02860 39639 41204 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_02860 41507 41295 gene locus_tag LOCUS_02870 41507 41295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 41745 41581 gene locus_tag LOCUS_02880 41745 41581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 42218 41736 gene locus_tag LOCUS_02890 42218 41736 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902885.1 protein_id gnl|my_center|LOCUS_02890 42415 43188 gene locus_tag LOCUS_02900 42415 43188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 44584 43301 gene locus_tag LOCUS_02910 44584 43301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 45875 44790 gene locus_tag LOCUS_02920 45875 44790 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_02920 46057 47898 gene locus_tag LOCUS_02930 gene asnB 46057 47898 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333979.1 protein_id gnl|my_center|LOCUS_02930 48577 48350 gene locus_tag LOCUS_02940 48577 48350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 49116 48784 gene locus_tag LOCUS_02950 49116 48784 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896451.1 protein_id gnl|my_center|LOCUS_02950 49868 49116 gene locus_tag LOCUS_02960 49868 49116 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812271.1 protein_id gnl|my_center|LOCUS_02960 50763 49936 gene locus_tag LOCUS_02970 50763 49936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 51676 50780 gene locus_tag LOCUS_02980 gene cbiQ 51676 50780 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065744.1 protein_id gnl|my_center|LOCUS_02980 53101 52109 gene locus_tag LOCUS_02990 gene cbiM 53101 52109 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964089.1 protein_id gnl|my_center|LOCUS_02990 53461 53880 gene locus_tag LOCUS_03000 53461 53880 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545623.1 protein_id gnl|my_center|LOCUS_03000 54133 55323 gene locus_tag LOCUS_03010 54133 55323 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436139.1 protein_id gnl|my_center|LOCUS_03010 55762 56166 gene locus_tag LOCUS_03020 55762 56166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 56250 57362 gene locus_tag LOCUS_03030 56250 57362 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_03030 58561 57821 gene locus_tag LOCUS_03040 gene truA 58561 57821 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430279.1 protein_id gnl|my_center|LOCUS_03040 59054 59320 gene locus_tag LOCUS_03050 59054 59320 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377382.1 protein_id gnl|my_center|LOCUS_03050 60879 59515 gene locus_tag LOCUS_03060 60879 59515 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861789.1 protein_id gnl|my_center|LOCUS_03060 62006 60888 gene locus_tag LOCUS_03070 62006 60888 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861790.1 protein_id gnl|my_center|LOCUS_03070 62823 62020 gene locus_tag LOCUS_03080 62823 62020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861791.1 protein_id gnl|my_center|LOCUS_03080 64883 63528 gene locus_tag LOCUS_03090 64883 63528 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359871.1 protein_id gnl|my_center|LOCUS_03090 66947 65160 gene locus_tag LOCUS_03100 66947 65160 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861887.1 protein_id gnl|my_center|LOCUS_03100 67184 67546 gene locus_tag LOCUS_03110 67184 67546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 69887 67707 gene locus_tag LOCUS_03120 69887 67707 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963923.1 protein_id gnl|my_center|LOCUS_03120 71085 69997 gene locus_tag LOCUS_03130 71085 69997 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963516.1 protein_id gnl|my_center|LOCUS_03130 72772 71381 gene locus_tag LOCUS_03140 gene pepV 72772 71381 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_03140 73661 73146 gene locus_tag LOCUS_03150 gene lepB 73661 73146 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460080.1 protein_id gnl|my_center|LOCUS_03150 75247 74003 gene locus_tag LOCUS_03160 75247 74003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 76767 75376 gene locus_tag LOCUS_03170 gene rlmD 76767 75376 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_03170 77316 76957 gene locus_tag LOCUS_03180 77316 76957 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963842.1 protein_id gnl|my_center|LOCUS_03180 79492 77732 gene locus_tag LOCUS_03190 gene pyk 79492 77732 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048303.1 protein_id gnl|my_center|LOCUS_03190 80524 79565 gene locus_tag LOCUS_03200 gene pfkA 80524 79565 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963839.1 protein_id gnl|my_center|LOCUS_03200 82163 80988 gene locus_tag LOCUS_03210 82163 80988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 83416 82556 gene locus_tag LOCUS_03220 83416 82556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 85859 83472 gene locus_tag LOCUS_03230 85859 83472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 86216 85932 gene locus_tag LOCUS_03240 86216 85932 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963837.1 protein_id gnl|my_center|LOCUS_03240 87629 86325 gene locus_tag LOCUS_03250 87629 86325 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963836.1 protein_id gnl|my_center|LOCUS_03250 88588 87638 gene locus_tag LOCUS_03260 gene whiA 88588 87638 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_03260 90003 88672 gene locus_tag LOCUS_03270 90003 88672 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048305.1 protein_id gnl|my_center|LOCUS_03270 90884 90000 gene locus_tag LOCUS_03280 gene rapZ 90884 90000 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_03280 92155 91238 gene locus_tag LOCUS_03290 gene murB 92155 91238 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963832.1 protein_id gnl|my_center|LOCUS_03290 94176 92311 gene locus_tag LOCUS_03300 gene uvrC 94176 92311 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_03300 95892 94468 gene locus_tag LOCUS_03310 95892 94468 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963828.1 protein_id gnl|my_center|LOCUS_03310 97129 95885 gene locus_tag LOCUS_03320 97129 95885 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963827.1 protein_id gnl|my_center|LOCUS_03320 97712 97284 gene locus_tag LOCUS_03330 97712 97284 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963826.1 protein_id gnl|my_center|LOCUS_03330 100604 97782 gene locus_tag LOCUS_03340 gene uvrA 100604 97782 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_03340 102669 100684 gene locus_tag LOCUS_03350 gene uvrB 102669 100684 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357634.1 protein_id gnl|my_center|LOCUS_03350 103008 103649 gene locus_tag LOCUS_03360 103008 103649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 104441 104007 gene locus_tag LOCUS_03370 104441 104007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 105055 104627 gene locus_tag LOCUS_03380 105055 104627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 105844 105368 gene locus_tag LOCUS_03390 105844 105368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 107897 106605 gene locus_tag LOCUS_03400 107897 106605 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963822.1 protein_id gnl|my_center|LOCUS_03400 109359 108079 gene locus_tag LOCUS_03410 109359 108079 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357628.1 protein_id gnl|my_center|LOCUS_03410 110337 109447 gene locus_tag LOCUS_03420 gene ftsX 110337 109447 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_03420 111013 110327 gene locus_tag LOCUS_03430 gene ftsE 111013 110327 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_03430 111626 111270 gene locus_tag LOCUS_03440 111626 111270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 112681 111743 gene locus_tag LOCUS_03450 112681 111743 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_03450 113505 112681 gene locus_tag LOCUS_03460 113505 112681 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389978.1 protein_id gnl|my_center|LOCUS_03460 114057 113710 gene locus_tag LOCUS_03470 114057 113710 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_03470 114337 114017 gene locus_tag LOCUS_03480 114337 114017 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963815.1 protein_id gnl|my_center|LOCUS_03480 115657 114497 gene locus_tag LOCUS_03490 gene alr 115657 114497 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_03490 116329 115715 gene locus_tag LOCUS_03500 116329 115715 CDS product germination lipoprotein GerS-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048316.1 protein_id gnl|my_center|LOCUS_03500 116869 116468 gene locus_tag LOCUS_03510 gene acpS 116869 116468 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963811.1 protein_id gnl|my_center|LOCUS_03510 117634 117281 gene locus_tag LOCUS_03520 117634 117281 CDS product DUF6514 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357321.1 protein_id gnl|my_center|LOCUS_03520 118632 118003 gene locus_tag LOCUS_03530 118632 118003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 119972 118731 gene locus_tag LOCUS_03540 119972 118731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 121099 119969 gene locus_tag LOCUS_03550 121099 119969 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583075.1 protein_id gnl|my_center|LOCUS_03550 122214 121177 gene locus_tag LOCUS_03560 122214 121177 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583074.1 protein_id gnl|my_center|LOCUS_03560 123167 122709 gene locus_tag LOCUS_03570 123167 122709 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888743.1 protein_id gnl|my_center|LOCUS_03570 124228 123338 gene locus_tag LOCUS_03580 124228 123338 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_03580 124447 126996 gene locus_tag LOCUS_03590 124447 126996 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861274.1 protein_id gnl|my_center|LOCUS_03590 127394 127155 gene locus_tag LOCUS_03600 127394 127155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 128611 127712 gene locus_tag LOCUS_03610 128611 127712 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385331.1 protein_id gnl|my_center|LOCUS_03610 128994 129476 gene locus_tag LOCUS_03620 128994 129476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 130575 129919 gene locus_tag LOCUS_03630 130575 129919 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656023.1 protein_id gnl|my_center|LOCUS_03630 131791 130964 gene locus_tag LOCUS_03640 gene yidA 131791 130964 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048269.1 protein_id gnl|my_center|LOCUS_03640 132190 134478 gene locus_tag LOCUS_03650 132190 134478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 135337 134555 gene locus_tag LOCUS_03660 135337 134555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 135946 135773 gene locus_tag LOCUS_03670 135946 135773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 136169 136561 gene locus_tag LOCUS_03680 136169 136561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 136565 136783 gene locus_tag LOCUS_03690 136565 136783 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860891.1 protein_id gnl|my_center|LOCUS_03690 137652 137107 gene locus_tag LOCUS_03700 137652 137107 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870161.1 protein_id gnl|my_center|LOCUS_03700 137863 138342 gene locus_tag LOCUS_03710 137863 138342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 138662 140173 gene locus_tag LOCUS_03720 138662 140173 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861171.1 protein_id gnl|my_center|LOCUS_03720 141055 140192 gene locus_tag LOCUS_03730 141055 140192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 141249 143072 gene locus_tag LOCUS_03740 141249 143072 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460338.1 protein_id gnl|my_center|LOCUS_03740 143754 143137 gene locus_tag LOCUS_03750 143754 143137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 145002 144007 gene locus_tag LOCUS_03760 145002 144007 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964264.1 protein_id gnl|my_center|LOCUS_03760 145290 145433 gene locus_tag LOCUS_03770 145290 145433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 146260 145520 gene locus_tag LOCUS_03780 gene nfsA 146260 145520 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234479.1 protein_id gnl|my_center|LOCUS_03780 148227 147241 gene locus_tag LOCUS_03790 gene galE 148227 147241 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964738.1 protein_id gnl|my_center|LOCUS_03790 148483 149826 gene locus_tag LOCUS_03800 gene mgtE 148483 149826 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934126.1 protein_id gnl|my_center|LOCUS_03800 150485 149985 gene locus_tag LOCUS_03810 150485 149985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 151054 150554 gene locus_tag LOCUS_03820 151054 150554 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966355.1 protein_id gnl|my_center|LOCUS_03820 151200 152336 gene locus_tag LOCUS_03830 151200 152336 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659298.1 protein_id gnl|my_center|LOCUS_03830 152588 153214 gene locus_tag LOCUS_03840 152588 153214 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966135.1 protein_id gnl|my_center|LOCUS_03840 >Feature sequence03 881 1714 gene locus_tag LOCUS_03850 gene rfbD 881 1714 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582730.1 protein_id gnl|my_center|LOCUS_03850 3223 2747 gene locus_tag LOCUS_03860 gene def 3223 2747 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401351.1 protein_id gnl|my_center|LOCUS_03860 4046 3375 gene locus_tag LOCUS_03870 4046 3375 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 protein_id gnl|my_center|LOCUS_03870 5431 4049 gene locus_tag LOCUS_03880 5431 4049 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986932.1 protein_id gnl|my_center|LOCUS_03880 7196 5424 gene locus_tag LOCUS_03890 7196 5424 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_03890 7522 7214 gene locus_tag LOCUS_03900 7522 7214 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 protein_id gnl|my_center|LOCUS_03900 8516 7515 gene locus_tag LOCUS_03910 8516 7515 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986935.1 protein_id gnl|my_center|LOCUS_03910 9182 8583 gene locus_tag LOCUS_03920 9182 8583 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986936.1 protein_id gnl|my_center|LOCUS_03920 9715 9239 gene locus_tag LOCUS_03930 9715 9239 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986937.1 protein_id gnl|my_center|LOCUS_03930 11687 9729 gene locus_tag LOCUS_03940 11687 9729 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986938.1 protein_id gnl|my_center|LOCUS_03940 12000 11674 gene locus_tag LOCUS_03950 12000 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 14082 12325 gene locus_tag LOCUS_03960 14082 12325 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_03960 14596 14057 gene locus_tag LOCUS_03970 14596 14057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359115.1 protein_id gnl|my_center|LOCUS_03970 15388 14687 gene locus_tag LOCUS_03980 15388 14687 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359294.1 protein_id gnl|my_center|LOCUS_03980 16761 15463 gene locus_tag LOCUS_03990 16761 15463 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047903.1 protein_id gnl|my_center|LOCUS_03990 17461 16889 gene locus_tag LOCUS_04000 17461 16889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 17706 19211 gene locus_tag LOCUS_04010 gene spoVB 17706 19211 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949021.1 protein_id gnl|my_center|LOCUS_04010 20882 19254 gene locus_tag LOCUS_04020 20882 19254 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949020.1 protein_id gnl|my_center|LOCUS_04020 21878 20925 gene locus_tag LOCUS_04030 21878 20925 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964333.1 protein_id gnl|my_center|LOCUS_04030 23216 22044 gene locus_tag LOCUS_04040 23216 22044 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358751.1 protein_id gnl|my_center|LOCUS_04040 25405 23306 gene locus_tag LOCUS_04050 25405 23306 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964331.1 protein_id gnl|my_center|LOCUS_04050 25838 25539 gene locus_tag LOCUS_04060 25838 25539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401779.1 protein_id gnl|my_center|LOCUS_04060 26363 25965 gene locus_tag LOCUS_04070 26363 25965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 28457 26424 gene locus_tag LOCUS_04080 28457 26424 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949010.1 protein_id gnl|my_center|LOCUS_04080 28615 30093 gene locus_tag LOCUS_04090 28615 30093 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949007.1 protein_id gnl|my_center|LOCUS_04090 30140 30499 gene locus_tag LOCUS_04100 30140 30499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 31190 30717 gene locus_tag LOCUS_04110 31190 30717 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870778.1 protein_id gnl|my_center|LOCUS_04110 31490 31275 gene locus_tag LOCUS_04120 31490 31275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358798.1 protein_id gnl|my_center|LOCUS_04120 31824 32183 gene locus_tag LOCUS_04130 31824 32183 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388928.1 protein_id gnl|my_center|LOCUS_04130 32351 32701 gene locus_tag LOCUS_04140 32351 32701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949004.1 protein_id gnl|my_center|LOCUS_04140 33310 32771 gene locus_tag LOCUS_04150 33310 32771 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949003.1 protein_id gnl|my_center|LOCUS_04150 33544 34794 gene locus_tag LOCUS_04160 33544 34794 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949002.1 protein_id gnl|my_center|LOCUS_04160 35217 34930 gene locus_tag LOCUS_04170 35217 34930 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355819.1 protein_id gnl|my_center|LOCUS_04170 36520 35615 gene locus_tag LOCUS_04180 36520 35615 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583014.1 protein_id gnl|my_center|LOCUS_04180 36839 38599 gene locus_tag LOCUS_04190 36839 38599 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948795.1 protein_id gnl|my_center|LOCUS_04190 40937 38904 gene locus_tag LOCUS_04200 40937 38904 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_04200 43924 41027 gene locus_tag LOCUS_04210 43924 41027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 45282 43936 gene locus_tag LOCUS_04220 45282 43936 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815696.1 protein_id gnl|my_center|LOCUS_04220 45311 45496 gene locus_tag LOCUS_04230 45311 45496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 45549 46586 gene locus_tag LOCUS_04240 gene ltaE 45549 46586 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903270.1 protein_id gnl|my_center|LOCUS_04240 47795 47211 gene locus_tag LOCUS_04250 47795 47211 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392053.1 protein_id gnl|my_center|LOCUS_04250 49300 48554 gene locus_tag LOCUS_04260 49300 48554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 51828 49504 gene locus_tag LOCUS_04270 51828 49504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 52136 53365 gene locus_tag LOCUS_04280 52136 53365 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891452.1 protein_id gnl|my_center|LOCUS_04280 54195 53605 gene locus_tag LOCUS_04290 54195 53605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 55197 54421 gene locus_tag LOCUS_04300 55197 54421 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948927.1 protein_id gnl|my_center|LOCUS_04300 55900 55454 gene locus_tag LOCUS_04310 55900 55454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 57904 56177 gene locus_tag LOCUS_04320 gene ade 57904 56177 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_04320 58701 58027 gene locus_tag LOCUS_04330 58701 58027 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986204.1 protein_id gnl|my_center|LOCUS_04330 58928 59161 gene locus_tag LOCUS_04340 58928 59161 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356062.1 protein_id gnl|my_center|LOCUS_04340 59286 61049 gene locus_tag LOCUS_04350 gene feoB 59286 61049 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948746.1 protein_id gnl|my_center|LOCUS_04350 61090 61254 gene locus_tag LOCUS_04360 61090 61254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 62057 61359 gene locus_tag LOCUS_04370 62057 61359 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518885.1 protein_id gnl|my_center|LOCUS_04370 63974 62265 gene locus_tag LOCUS_04380 gene argS 63974 62265 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948742.1 protein_id gnl|my_center|LOCUS_04380 66454 64397 gene locus_tag LOCUS_04390 66454 64397 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948731.1 protein_id gnl|my_center|LOCUS_04390 66837 66628 gene locus_tag LOCUS_04400 66837 66628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 69316 66953 gene locus_tag LOCUS_04410 69316 66953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 69623 70096 gene locus_tag LOCUS_04420 69623 70096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 72729 70264 gene locus_tag LOCUS_04430 72729 70264 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948516.1 protein_id gnl|my_center|LOCUS_04430 72904 73059 gene locus_tag LOCUS_04440 72904 73059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 74977 73217 gene locus_tag LOCUS_04450 74977 73217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 75775 75284 gene locus_tag LOCUS_04460 75775 75284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 76825 75935 gene locus_tag LOCUS_04470 76825 75935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 77988 76987 gene locus_tag LOCUS_04480 77988 76987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 78826 78137 gene locus_tag LOCUS_04490 78826 78137 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_04490 80331 78823 gene locus_tag LOCUS_04500 80331 78823 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963640.1 protein_id gnl|my_center|LOCUS_04500 81591 80350 gene locus_tag LOCUS_04510 81591 80350 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404919.1 protein_id gnl|my_center|LOCUS_04510 82330 81638 gene locus_tag LOCUS_04520 82330 81638 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404917.1 protein_id gnl|my_center|LOCUS_04520 83451 82330 gene locus_tag LOCUS_04530 83451 82330 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947946.1 protein_id gnl|my_center|LOCUS_04530 84004 86376 gene locus_tag LOCUS_04540 84004 86376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 86667 86485 gene locus_tag LOCUS_04550 86667 86485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 88054 86789 gene locus_tag LOCUS_04560 88054 86789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 88639 88208 gene locus_tag LOCUS_04570 88639 88208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 89889 88993 gene locus_tag LOCUS_04580 89889 88993 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106652674.1 protein_id gnl|my_center|LOCUS_04580 91810 90062 gene locus_tag LOCUS_04590 91810 90062 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965989.1 protein_id gnl|my_center|LOCUS_04590 92085 92288 gene locus_tag LOCUS_04600 92085 92288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 92852 92415 gene locus_tag LOCUS_04610 92852 92415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04610 93043 92864 gene locus_tag LOCUS_04620 93043 92864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 93848 93033 gene locus_tag LOCUS_04630 93848 93033 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687382.1 protein_id gnl|my_center|LOCUS_04630 94939 93836 gene locus_tag LOCUS_04640 gene phnW 94939 93836 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138251.1 protein_id gnl|my_center|LOCUS_04640 95947 94961 gene locus_tag LOCUS_04650 95947 94961 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892094.1 protein_id gnl|my_center|LOCUS_04650 97622 95997 gene locus_tag LOCUS_04660 97622 95997 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425530.1 protein_id gnl|my_center|LOCUS_04660 98367 97615 gene locus_tag LOCUS_04670 98367 97615 CDS product spermidine/putrescine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166424.1 protein_id gnl|my_center|LOCUS_04670 98684 99451 gene locus_tag LOCUS_04680 98684 99451 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418385.1 protein_id gnl|my_center|LOCUS_04680 100056 99457 gene locus_tag LOCUS_04690 100056 99457 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964131.1 protein_id gnl|my_center|LOCUS_04690 102306 100222 gene locus_tag LOCUS_04700 102306 100222 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964123.1 protein_id gnl|my_center|LOCUS_04700 103244 102627 gene locus_tag LOCUS_04710 103244 102627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 105139 103436 gene locus_tag LOCUS_04720 105139 103436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 106862 105363 gene locus_tag LOCUS_04730 106862 105363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 107621 109048 gene locus_tag LOCUS_04740 107621 109048 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963597.1 protein_id gnl|my_center|LOCUS_04740 109283 110569 gene locus_tag LOCUS_04750 109283 110569 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_04750 114248 110868 gene locus_tag LOCUS_04760 114248 110868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 115040 114498 gene locus_tag LOCUS_04770 115040 114498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 117334 115046 gene locus_tag LOCUS_04780 117334 115046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 118162 117359 gene locus_tag LOCUS_04790 118162 117359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 119420 118179 gene locus_tag LOCUS_04800 119420 118179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 119979 119407 gene locus_tag LOCUS_04810 119979 119407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 121074 119989 gene locus_tag LOCUS_04820 121074 119989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 121910 121479 gene locus_tag LOCUS_04830 121910 121479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 123245 122037 gene locus_tag LOCUS_04840 123245 122037 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837690.1 protein_id gnl|my_center|LOCUS_04840 124959 123271 gene locus_tag LOCUS_04850 124959 123271 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 protein_id gnl|my_center|LOCUS_04850 126518 125268 gene locus_tag LOCUS_04860 126518 125268 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461660.1 protein_id gnl|my_center|LOCUS_04860 127870 126698 gene locus_tag LOCUS_04870 127870 126698 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_04870 129238 127928 gene locus_tag LOCUS_04880 129238 127928 CDS product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680734.1 protein_id gnl|my_center|LOCUS_04880 129618 131198 gene locus_tag LOCUS_04890 129618 131198 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948042.1 protein_id gnl|my_center|LOCUS_04890 131195 131884 gene locus_tag LOCUS_04900 131195 131884 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948043.1 protein_id gnl|my_center|LOCUS_04900 131943 132506 gene locus_tag LOCUS_04910 131943 132506 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963779.1 protein_id gnl|my_center|LOCUS_04910 132685 135072 gene locus_tag LOCUS_04920 gene lon 132685 135072 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963778.1 protein_id gnl|my_center|LOCUS_04920 135262 135999 gene locus_tag LOCUS_04930 gene nfsA 135262 135999 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004543.1 protein_id gnl|my_center|LOCUS_04930 137343 136291 gene locus_tag LOCUS_04940 137343 136291 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_04940 137724 137452 gene locus_tag LOCUS_04950 137724 137452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 137890 137765 gene locus_tag LOCUS_04960 137890 137765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 138066 138617 gene locus_tag LOCUS_04970 138066 138617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 140075 138957 gene locus_tag LOCUS_04980 140075 138957 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939260.1 protein_id gnl|my_center|LOCUS_04980 141099 140062 gene locus_tag LOCUS_04990 141099 140062 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948771.1 protein_id gnl|my_center|LOCUS_04990 141337 141173 gene locus_tag LOCUS_05000 141337 141173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 141339 141566 gene locus_tag LOCUS_05010 141339 141566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 142833 141958 gene locus_tag LOCUS_05020 142833 141958 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948769.1 protein_id gnl|my_center|LOCUS_05020 144065 142833 gene locus_tag LOCUS_05030 144065 142833 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948768.1 protein_id gnl|my_center|LOCUS_05030 144816 144124 gene locus_tag LOCUS_05040 144816 144124 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986922.1 protein_id gnl|my_center|LOCUS_05040 145453 144860 gene locus_tag LOCUS_05050 145453 144860 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022395.1 protein_id gnl|my_center|LOCUS_05050 146177 145524 gene locus_tag LOCUS_05060 146177 145524 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_05060 147819 146401 gene locus_tag LOCUS_05070 147819 146401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 148120 147860 gene locus_tag LOCUS_05080 148120 147860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 >Feature sequence04 921 250 gene locus_tag LOCUS_05090 921 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 2072 1413 gene locus_tag LOCUS_05100 2072 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 3434 2556 gene locus_tag LOCUS_05110 3434 2556 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731865.1 protein_id gnl|my_center|LOCUS_05110 4324 3467 gene locus_tag LOCUS_05120 4324 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 4842 4357 gene locus_tag LOCUS_05130 4842 4357 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948700.1 protein_id gnl|my_center|LOCUS_05130 5261 4875 gene locus_tag LOCUS_05140 5261 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 5794 5312 gene locus_tag LOCUS_05150 5794 5312 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876564.1 protein_id gnl|my_center|LOCUS_05150 7925 7110 gene locus_tag LOCUS_05160 7925 7110 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_05160 8605 7916 gene locus_tag LOCUS_05170 8605 7916 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964614.1 protein_id gnl|my_center|LOCUS_05170 9504 8617 gene locus_tag LOCUS_05180 9504 8617 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047990.1 protein_id gnl|my_center|LOCUS_05180 10719 9622 gene locus_tag LOCUS_05190 gene rpoD 10719 9622 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_05190 12509 10740 gene locus_tag LOCUS_05200 gene dnaG 12509 10740 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_05200 13763 12735 gene locus_tag LOCUS_05210 13763 12735 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047991.1 protein_id gnl|my_center|LOCUS_05210 14024 15097 gene locus_tag LOCUS_05220 14024 15097 CDS product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047992.1 protein_id gnl|my_center|LOCUS_05220 17814 15178 gene locus_tag LOCUS_05230 gene ppdK 17814 15178 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_05230 18553 17912 gene locus_tag LOCUS_05240 18553 17912 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358068.1 protein_id gnl|my_center|LOCUS_05240 19542 18910 gene locus_tag LOCUS_05250 19542 18910 CDS product DUF4342 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357722.1 protein_id gnl|my_center|LOCUS_05250 20159 19587 gene locus_tag LOCUS_05260 gene recO 20159 19587 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047994.1 protein_id gnl|my_center|LOCUS_05260 21229 20348 gene locus_tag LOCUS_05270 gene era 21229 20348 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964607.1 protein_id gnl|my_center|LOCUS_05270 21711 21313 gene locus_tag LOCUS_05280 21711 21313 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357963.1 protein_id gnl|my_center|LOCUS_05280 22571 21873 gene locus_tag LOCUS_05290 22571 21873 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358036.1 protein_id gnl|my_center|LOCUS_05290 23132 22632 gene locus_tag LOCUS_05300 gene ybeY 23132 22632 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047996.1 protein_id gnl|my_center|LOCUS_05300 25243 23129 gene locus_tag LOCUS_05310 25243 23129 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047997.1 protein_id gnl|my_center|LOCUS_05310 26431 25313 gene locus_tag LOCUS_05320 gene yqfD 26431 25313 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047998.1 protein_id gnl|my_center|LOCUS_05320 26708 26424 gene locus_tag LOCUS_05330 gene yqfC 26708 26424 CDS product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357863.1 protein_id gnl|my_center|LOCUS_05330 27243 27064 gene locus_tag LOCUS_05340 gene rpsU 27243 27064 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357777.1 protein_id gnl|my_center|LOCUS_05340 27778 27428 gene locus_tag LOCUS_05350 27778 27428 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047999.1 protein_id gnl|my_center|LOCUS_05350 29214 27904 gene locus_tag LOCUS_05360 gene mtaB 29214 27904 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048000.1 protein_id gnl|my_center|LOCUS_05360 29966 29211 gene locus_tag LOCUS_05370 29966 29211 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_05370 30974 30033 gene locus_tag LOCUS_05380 gene prmA 30974 30033 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_05380 32270 31149 gene locus_tag LOCUS_05390 gene dnaJ 32270 31149 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 protein_id gnl|my_center|LOCUS_05390 34297 32444 gene locus_tag LOCUS_05400 gene dnaK 34297 32444 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_05400 35092 34379 gene locus_tag LOCUS_05410 35092 34379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 36188 35142 gene locus_tag LOCUS_05420 gene hrcA 36188 35142 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964592.1 protein_id gnl|my_center|LOCUS_05420 37459 36431 gene locus_tag LOCUS_05430 gene hemW 37459 36431 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 protein_id gnl|my_center|LOCUS_05430 39450 37645 gene locus_tag LOCUS_05440 gene lepA 39450 37645 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_05440 39886 39629 gene locus_tag LOCUS_05450 39886 39629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 41145 39976 gene locus_tag LOCUS_05460 41145 39976 CDS product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048006.1 protein_id gnl|my_center|LOCUS_05460 42247 41273 gene locus_tag LOCUS_05470 gene gpr 42247 41273 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048007.1 protein_id gnl|my_center|LOCUS_05470 42488 42760 gene locus_tag LOCUS_05480 gene rpsT 42488 42760 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_05480 43834 42800 gene locus_tag LOCUS_05490 gene holA 43834 42800 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964585.1 protein_id gnl|my_center|LOCUS_05490 45616 43850 gene locus_tag LOCUS_05500 45616 43850 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048009.1 protein_id gnl|my_center|LOCUS_05500 45901 45668 gene locus_tag LOCUS_05510 45901 45668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048010.1 protein_id gnl|my_center|LOCUS_05510 48547 46049 gene locus_tag LOCUS_05520 48547 46049 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964581.1 protein_id gnl|my_center|LOCUS_05520 49206 48655 gene locus_tag LOCUS_05530 49206 48655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358684.1 protein_id gnl|my_center|LOCUS_05530 49534 49394 gene locus_tag LOCUS_05540 49534 49394 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359149.1 protein_id gnl|my_center|LOCUS_05540 49910 49731 gene locus_tag LOCUS_05550 49910 49731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 50877 50257 gene locus_tag LOCUS_05560 50877 50257 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_05560 52261 50879 gene locus_tag LOCUS_05570 52261 50879 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_05570 54069 52312 gene locus_tag LOCUS_05580 54069 52312 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_05580 54757 54140 gene locus_tag LOCUS_05590 54757 54140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 55158 54850 gene locus_tag LOCUS_05600 55158 54850 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_05600 55601 55176 gene locus_tag LOCUS_05610 55601 55176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 57679 55712 gene locus_tag LOCUS_05620 57679 55712 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_05620 58758 57718 gene locus_tag LOCUS_05630 58758 57718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 59085 58771 gene locus_tag LOCUS_05640 59085 58771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 59395 59694 gene locus_tag LOCUS_05650 59395 59694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 60554 59772 gene locus_tag LOCUS_05660 60554 59772 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986759.1 protein_id gnl|my_center|LOCUS_05660 61349 60585 gene locus_tag LOCUS_05670 61349 60585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 61608 61512 gene locus_tag LOCUS_t00010 61608 61512 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 63622 61706 gene locus_tag LOCUS_05680 gene selB 63622 61706 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048014.1 protein_id gnl|my_center|LOCUS_05680 65047 63668 gene locus_tag LOCUS_05690 gene selA 65047 63668 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048015.1 protein_id gnl|my_center|LOCUS_05690 66060 65098 gene locus_tag LOCUS_05700 gene selD 66060 65098 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012159590.1 protein_id gnl|my_center|LOCUS_05700 67003 66299 gene locus_tag LOCUS_05710 67003 66299 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990138.1 protein_id gnl|my_center|LOCUS_05710 67150 68439 gene locus_tag LOCUS_05720 67150 68439 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048018.1 protein_id gnl|my_center|LOCUS_05720 69525 68524 gene locus_tag LOCUS_05730 69525 68524 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964578.1 protein_id gnl|my_center|LOCUS_05730 69898 69515 gene locus_tag LOCUS_05740 69898 69515 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964577.1 protein_id gnl|my_center|LOCUS_05740 71242 69968 gene locus_tag LOCUS_05750 71242 69968 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048020.1 protein_id gnl|my_center|LOCUS_05750 71817 71239 gene locus_tag LOCUS_05760 gene yqeK 71817 71239 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360010.1 protein_id gnl|my_center|LOCUS_05760 72506 71907 gene locus_tag LOCUS_05770 gene nadD 72506 71907 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964574.1 protein_id gnl|my_center|LOCUS_05770 72953 72663 gene locus_tag LOCUS_05780 gene yhbY 72953 72663 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358089.1 protein_id gnl|my_center|LOCUS_05780 74289 73006 gene locus_tag LOCUS_05790 gene obgE 74289 73006 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048021.1 protein_id gnl|my_center|LOCUS_05790 74892 74356 gene locus_tag LOCUS_05800 74892 74356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 75257 74946 gene locus_tag LOCUS_05810 gene rpmA 75257 74946 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_05810 75594 75262 gene locus_tag LOCUS_05820 75594 75262 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048022.1 protein_id gnl|my_center|LOCUS_05820 75908 75597 gene locus_tag LOCUS_05830 gene rplU 75908 75597 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964569.1 protein_id gnl|my_center|LOCUS_05830 77494 76052 gene locus_tag LOCUS_05840 77494 76052 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358087.1 protein_id gnl|my_center|LOCUS_05840 78223 77516 gene locus_tag LOCUS_05850 78223 77516 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048024.1 protein_id gnl|my_center|LOCUS_05850 80060 78198 gene locus_tag LOCUS_05860 80060 78198 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 protein_id gnl|my_center|LOCUS_05860 81122 80238 gene locus_tag LOCUS_05870 81122 80238 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048026.1 protein_id gnl|my_center|LOCUS_05870 81556 81185 gene locus_tag LOCUS_05880 81556 81185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 82076 81702 gene locus_tag LOCUS_05890 gene mgsA 82076 81702 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230640.1 protein_id gnl|my_center|LOCUS_05890 83259 82138 gene locus_tag LOCUS_05900 gene rodA 83259 82138 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048028.1 protein_id gnl|my_center|LOCUS_05900 83601 83338 gene locus_tag LOCUS_05910 gene minE 83601 83338 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358099.1 protein_id gnl|my_center|LOCUS_05910 84420 83614 gene locus_tag LOCUS_05920 gene minD 84420 83614 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360024.1 protein_id gnl|my_center|LOCUS_05920 85067 84435 gene locus_tag LOCUS_05930 gene minC 85067 84435 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024932954.1 protein_id gnl|my_center|LOCUS_05930 88239 85372 gene locus_tag LOCUS_05940 88239 85372 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048030.1 protein_id gnl|my_center|LOCUS_05940 88746 88255 gene locus_tag LOCUS_05950 gene mreD 88746 88255 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099493.1 protein_id gnl|my_center|LOCUS_05950 89611 88757 gene locus_tag LOCUS_05960 gene mreC 89611 88757 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048032.1 protein_id gnl|my_center|LOCUS_05960 90619 89612 gene locus_tag LOCUS_05970 90619 89612 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_05970 91326 90640 gene locus_tag LOCUS_05980 gene radC 91326 90640 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360029.1 protein_id gnl|my_center|LOCUS_05980 91914 91339 gene locus_tag LOCUS_05990 91914 91339 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048033.1 protein_id gnl|my_center|LOCUS_05990 92185 91925 gene locus_tag LOCUS_06000 92185 91925 CDS product DUF4321 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403495.1 protein_id gnl|my_center|LOCUS_06000 93157 92441 gene locus_tag LOCUS_06010 93157 92441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048034.1 protein_id gnl|my_center|LOCUS_06010 93889 93362 gene locus_tag LOCUS_06020 93889 93362 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048035.1 protein_id gnl|my_center|LOCUS_06020 94693 94130 gene locus_tag LOCUS_06030 94693 94130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 95242 95111 gene locus_tag LOCUS_06040 95242 95111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 95643 95562 gene locus_tag LOCUS_t00020 95643 95562 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 96372 95794 gene locus_tag LOCUS_06050 96372 95794 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048036.1 protein_id gnl|my_center|LOCUS_06050 96977 96369 gene locus_tag LOCUS_06060 gene coaE 96977 96369 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048037.1 protein_id gnl|my_center|LOCUS_06060 99667 97052 gene locus_tag LOCUS_06070 gene polA 99667 97052 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_06070 100893 99976 gene locus_tag LOCUS_06080 gene glsA 100893 99976 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399984.1 protein_id gnl|my_center|LOCUS_06080 101168 101254 gene locus_tag LOCUS_t00030 101168 101254 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 101860 101645 gene locus_tag LOCUS_06090 101860 101645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 102352 103743 gene locus_tag LOCUS_06100 102352 103743 CDS product DUF4317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948416.1 protein_id gnl|my_center|LOCUS_06100 104210 103956 gene locus_tag LOCUS_06110 104210 103956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06110 104667 104987 gene locus_tag LOCUS_06120 104667 104987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 106562 105168 gene locus_tag LOCUS_06130 106562 105168 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_06130 107691 106750 gene locus_tag LOCUS_06140 107691 106750 CDS product 4Fe-4S-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430299.1 protein_id gnl|my_center|LOCUS_06140 107813 108691 gene locus_tag LOCUS_06150 107813 108691 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439497.1 protein_id gnl|my_center|LOCUS_06150 110159 108750 gene locus_tag LOCUS_06160 110159 108750 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_06160 110310 110471 gene locus_tag LOCUS_06170 110310 110471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 111436 110624 gene locus_tag LOCUS_06180 111436 110624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 112004 112144 gene locus_tag LOCUS_06190 112004 112144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 113245 112289 gene locus_tag LOCUS_06200 113245 112289 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965723.1 protein_id gnl|my_center|LOCUS_06200 114323 113226 gene locus_tag LOCUS_06210 114323 113226 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965722.1 protein_id gnl|my_center|LOCUS_06210 115215 114277 gene locus_tag LOCUS_06220 115215 114277 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965721.1 protein_id gnl|my_center|LOCUS_06220 115724 116068 gene locus_tag LOCUS_06230 115724 116068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 116225 121087 gene locus_tag LOCUS_06240 116225 121087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986914.1 protein_id gnl|my_center|LOCUS_06240 121133 122377 gene locus_tag LOCUS_06250 121133 122377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986915.1 protein_id gnl|my_center|LOCUS_06250 122451 123503 gene locus_tag LOCUS_06260 122451 123503 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986916.1 protein_id gnl|my_center|LOCUS_06260 124387 123569 gene locus_tag LOCUS_06270 gene folK 124387 123569 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966210.1 protein_id gnl|my_center|LOCUS_06270 125273 124467 gene locus_tag LOCUS_06280 gene folP 125273 124467 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_06280 125850 125314 gene locus_tag LOCUS_06290 125850 125314 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966208.1 protein_id gnl|my_center|LOCUS_06290 127695 125995 gene locus_tag LOCUS_06300 gene tlpC 127695 125995 CDS product methyl-accepting chemotaxis protein TlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246498.1 protein_id gnl|my_center|LOCUS_06300 128040 128885 gene locus_tag LOCUS_06310 128040 128885 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964407.1 protein_id gnl|my_center|LOCUS_06310 130508 129102 gene locus_tag LOCUS_06320 130508 129102 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_06320 131666 130743 gene locus_tag LOCUS_06330 gene hprK 131666 130743 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964404.1 protein_id gnl|my_center|LOCUS_06330 131901 131701 gene locus_tag LOCUS_06340 131901 131701 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986921.1 protein_id gnl|my_center|LOCUS_06340 132238 132414 gene locus_tag LOCUS_06350 132238 132414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 132838 132440 gene locus_tag LOCUS_06360 132838 132440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359215.1 protein_id gnl|my_center|LOCUS_06360 134266 133094 gene locus_tag LOCUS_06370 134266 133094 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986928.1 protein_id gnl|my_center|LOCUS_06370 134574 134410 gene locus_tag LOCUS_06380 134574 134410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence05 977 222 gene locus_tag LOCUS_06390 977 222 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_06390 1670 1029 gene locus_tag LOCUS_06400 1670 1029 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948207.1 protein_id gnl|my_center|LOCUS_06400 2505 1705 gene locus_tag LOCUS_06410 2505 1705 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_06410 3144 4241 gene locus_tag LOCUS_06420 gene ribD 3144 4241 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943609.1 protein_id gnl|my_center|LOCUS_06420 4266 4916 gene locus_tag LOCUS_06430 4266 4916 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_06430 5044 6246 gene locus_tag LOCUS_06440 5044 6246 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987154.1 protein_id gnl|my_center|LOCUS_06440 6299 6760 gene locus_tag LOCUS_06450 gene ribE 6299 6760 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963913.1 protein_id gnl|my_center|LOCUS_06450 7186 7491 gene locus_tag LOCUS_06460 7186 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 8686 7610 gene locus_tag LOCUS_06470 8686 7610 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942915.1 protein_id gnl|my_center|LOCUS_06470 9542 8814 gene locus_tag LOCUS_06480 9542 8814 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356878.1 protein_id gnl|my_center|LOCUS_06480 10187 9606 gene locus_tag LOCUS_06490 10187 9606 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_06490 11587 10604 gene locus_tag LOCUS_06500 11587 10604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 12689 14269 gene locus_tag LOCUS_06510 12689 14269 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250383.1 protein_id gnl|my_center|LOCUS_06510 14489 14902 gene locus_tag LOCUS_06520 14489 14902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 15448 16437 gene locus_tag LOCUS_06530 15448 16437 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_06530 16424 16810 gene locus_tag LOCUS_06540 16424 16810 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948150.1 protein_id gnl|my_center|LOCUS_06540 16834 17346 gene locus_tag LOCUS_06550 16834 17346 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_06550 18525 17680 gene locus_tag LOCUS_06560 18525 17680 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355995.1 protein_id gnl|my_center|LOCUS_06560 19113 18526 gene locus_tag LOCUS_06570 19113 18526 CDS product electron transport complex protein RnfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356420.1 protein_id gnl|my_center|LOCUS_06570 19839 19147 gene locus_tag LOCUS_06580 19839 19147 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948148.1 protein_id gnl|my_center|LOCUS_06580 20405 19839 gene locus_tag LOCUS_06590 20405 19839 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_06590 21326 20406 gene locus_tag LOCUS_06600 21326 20406 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_06600 22664 21342 gene locus_tag LOCUS_06610 gene rsxC 22664 21342 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_06610 23088 24731 gene locus_tag LOCUS_06620 23088 24731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 24831 25931 gene locus_tag LOCUS_06630 24831 25931 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966276.1 protein_id gnl|my_center|LOCUS_06630 26060 27382 gene locus_tag LOCUS_06640 26060 27382 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_06640 29461 27674 gene locus_tag LOCUS_06650 29461 27674 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679753.1 protein_id gnl|my_center|LOCUS_06650 29940 29599 gene locus_tag LOCUS_06660 29940 29599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428670.1 protein_id gnl|my_center|LOCUS_06660 30465 29971 gene locus_tag LOCUS_06670 30465 29971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 30738 31469 gene locus_tag LOCUS_06680 30738 31469 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_06680 33120 31513 gene locus_tag LOCUS_06690 33120 31513 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_06690 33464 33288 gene locus_tag LOCUS_06700 33464 33288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 33520 33759 gene locus_tag LOCUS_06710 33520 33759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 33923 33705 gene locus_tag LOCUS_06720 33923 33705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06720 34258 35901 gene locus_tag LOCUS_06730 gene hcp 34258 35901 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272545.1 protein_id gnl|my_center|LOCUS_06730 36015 36173 gene locus_tag LOCUS_06740 36015 36173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 36463 36624 gene locus_tag LOCUS_06750 36463 36624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 36929 37420 gene locus_tag LOCUS_06760 36929 37420 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473665.1 protein_id gnl|my_center|LOCUS_06760 37434 37694 gene locus_tag LOCUS_06770 37434 37694 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965126.1 protein_id gnl|my_center|LOCUS_06770 37889 39103 gene locus_tag LOCUS_06780 37889 39103 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963608.1 protein_id gnl|my_center|LOCUS_06780 39204 40067 gene locus_tag LOCUS_06790 39204 40067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 40167 41522 gene locus_tag LOCUS_06800 40167 41522 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_06800 41725 41964 gene locus_tag LOCUS_06810 41725 41964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 41986 42162 gene locus_tag LOCUS_06820 41986 42162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 42306 42935 gene locus_tag LOCUS_06830 42306 42935 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966826.1 protein_id gnl|my_center|LOCUS_06830 43297 44184 gene locus_tag LOCUS_06840 43297 44184 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965718.1 protein_id gnl|my_center|LOCUS_06840 44252 45241 gene locus_tag LOCUS_06850 44252 45241 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948775.1 protein_id gnl|my_center|LOCUS_06850 45388 45630 gene locus_tag LOCUS_06860 45388 45630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 45803 46303 gene locus_tag LOCUS_06870 45803 46303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 46449 47024 gene locus_tag LOCUS_06880 46449 47024 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361269.1 protein_id gnl|my_center|LOCUS_06880 47089 47793 gene locus_tag LOCUS_06890 47089 47793 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947949.1 protein_id gnl|my_center|LOCUS_06890 49609 48029 gene locus_tag LOCUS_06900 49609 48029 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966292.1 protein_id gnl|my_center|LOCUS_06900 50245 49721 gene locus_tag LOCUS_06910 50245 49721 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_06910 50591 51841 gene locus_tag LOCUS_06920 50591 51841 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048166.1 protein_id gnl|my_center|LOCUS_06920 51844 52701 gene locus_tag LOCUS_06930 gene recX 51844 52701 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048165.1 protein_id gnl|my_center|LOCUS_06930 52787 53953 gene locus_tag LOCUS_06940 52787 53953 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099514.1 protein_id gnl|my_center|LOCUS_06940 54329 53973 gene locus_tag LOCUS_06950 54329 53973 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357692.1 protein_id gnl|my_center|LOCUS_06950 55260 54460 gene locus_tag LOCUS_06960 55260 54460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393844.1 protein_id gnl|my_center|LOCUS_06960 56017 55241 gene locus_tag LOCUS_06970 56017 55241 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357525.1 protein_id gnl|my_center|LOCUS_06970 56384 60664 gene locus_tag LOCUS_06980 56384 60664 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048163.1 protein_id gnl|my_center|LOCUS_06980 62685 61663 gene locus_tag LOCUS_06990 62685 61663 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048162.1 protein_id gnl|my_center|LOCUS_06990 63200 65842 gene locus_tag LOCUS_07000 63200 65842 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048157.1 protein_id gnl|my_center|LOCUS_07000 65997 67382 gene locus_tag LOCUS_07010 65997 67382 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048156.1 protein_id gnl|my_center|LOCUS_07010 67629 68510 gene locus_tag LOCUS_07020 67629 68510 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357551.1 protein_id gnl|my_center|LOCUS_07020 69079 68552 gene locus_tag LOCUS_07030 69079 68552 CDS product DUF4364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357273.1 protein_id gnl|my_center|LOCUS_07030 69316 70065 gene locus_tag LOCUS_07040 gene pdaB 69316 70065 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965679.1 protein_id gnl|my_center|LOCUS_07040 70291 70983 gene locus_tag LOCUS_07050 70291 70983 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_07050 72040 71330 gene locus_tag LOCUS_07060 gene dapD 72040 71330 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965677.1 protein_id gnl|my_center|LOCUS_07060 72336 73499 gene locus_tag LOCUS_07070 72336 73499 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048151.1 protein_id gnl|my_center|LOCUS_07070 74341 73586 gene locus_tag LOCUS_07080 gene dapB 74341 73586 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_07080 75234 74341 gene locus_tag LOCUS_07090 gene dapA 75234 74341 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_07090 76553 77488 gene locus_tag LOCUS_07100 76553 77488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048147.1 protein_id gnl|my_center|LOCUS_07100 77499 78416 gene locus_tag LOCUS_07110 77499 78416 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048146.1 protein_id gnl|my_center|LOCUS_07110 78429 79448 gene locus_tag LOCUS_07120 78429 79448 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966892.1 protein_id gnl|my_center|LOCUS_07120 79448 80413 gene locus_tag LOCUS_07130 79448 80413 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048144.1 protein_id gnl|my_center|LOCUS_07130 80771 82468 gene locus_tag LOCUS_07140 80771 82468 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048148.1 protein_id gnl|my_center|LOCUS_07140 82651 82890 gene locus_tag LOCUS_07150 82651 82890 CDS product small, acid-soluble spore protein, alpha/beta type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048143.1 protein_id gnl|my_center|LOCUS_07150 82994 83737 gene locus_tag LOCUS_07160 82994 83737 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048142.1 protein_id gnl|my_center|LOCUS_07160 83764 84645 gene locus_tag LOCUS_07170 gene hslO 83764 84645 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048141.1 protein_id gnl|my_center|LOCUS_07170 84899 84974 gene locus_tag LOCUS_t00040 84899 84974 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 84980 85056 gene locus_tag LOCUS_t00050 84980 85056 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 85104 85179 gene locus_tag LOCUS_t00060 85104 85179 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 85185 85259 gene locus_tag LOCUS_t00070 85185 85259 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 85278 85352 gene locus_tag LOCUS_t00080 85278 85352 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 85477 85827 gene locus_tag LOCUS_07180 85477 85827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 87018 86323 gene locus_tag LOCUS_07190 87018 86323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048138.1 protein_id gnl|my_center|LOCUS_07190 87174 88076 gene locus_tag LOCUS_07200 gene ytxC 87174 88076 CDS product putative sporulation protein YtxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048137.1 protein_id gnl|my_center|LOCUS_07200 88361 88888 gene locus_tag LOCUS_07210 gene infC 88361 88888 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965658.1 protein_id gnl|my_center|LOCUS_07210 88909 89106 gene locus_tag LOCUS_07220 gene rpmI 88909 89106 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_07220 89134 89493 gene locus_tag LOCUS_07230 gene rplT 89134 89493 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386545.1 protein_id gnl|my_center|LOCUS_07230 89627 90991 gene locus_tag LOCUS_07240 89627 90991 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048134.1 protein_id gnl|my_center|LOCUS_07240 91003 91662 gene locus_tag LOCUS_07250 91003 91662 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_07250 91675 92457 gene locus_tag LOCUS_07260 91675 92457 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_07260 92817 93836 gene locus_tag LOCUS_07270 gene pheS 92817 93836 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_07270 93928 96306 gene locus_tag LOCUS_07280 gene pheT 93928 96306 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_07280 96487 97086 gene locus_tag LOCUS_07290 96487 97086 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965652.1 protein_id gnl|my_center|LOCUS_07290 97346 98164 gene locus_tag LOCUS_07300 97346 98164 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047707.1 protein_id gnl|my_center|LOCUS_07300 98201 98851 gene locus_tag LOCUS_07310 98201 98851 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358158.1 protein_id gnl|my_center|LOCUS_07310 98844 99566 gene locus_tag LOCUS_07320 98844 99566 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_07320 100023 101657 gene locus_tag LOCUS_07330 100023 101657 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945209.1 protein_id gnl|my_center|LOCUS_07330 102133 103845 gene locus_tag LOCUS_07340 102133 103845 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963500.1 protein_id gnl|my_center|LOCUS_07340 103994 104956 gene locus_tag LOCUS_07350 103994 104956 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963501.1 protein_id gnl|my_center|LOCUS_07350 104968 105885 gene locus_tag LOCUS_07360 104968 105885 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963502.1 protein_id gnl|my_center|LOCUS_07360 105898 106875 gene locus_tag LOCUS_07370 105898 106875 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963503.1 protein_id gnl|my_center|LOCUS_07370 106876 107841 gene locus_tag LOCUS_07380 106876 107841 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963504.1 protein_id gnl|my_center|LOCUS_07380 107922 108125 gene locus_tag LOCUS_07390 107922 108125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 108248 110182 gene locus_tag LOCUS_07400 108248 110182 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460031.1 protein_id gnl|my_center|LOCUS_07400 110238 112604 gene locus_tag LOCUS_07410 110238 112604 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964979.1 protein_id gnl|my_center|LOCUS_07410 113579 113127 gene locus_tag LOCUS_07420 113579 113127 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229573.1 protein_id gnl|my_center|LOCUS_07420 113911 114387 gene locus_tag LOCUS_07430 113911 114387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 114771 114526 gene locus_tag LOCUS_07440 114771 114526 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388120.1 protein_id gnl|my_center|LOCUS_07440 115591 115100 gene locus_tag LOCUS_07450 115591 115100 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_07450 115966 116613 gene locus_tag LOCUS_07460 115966 116613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 116644 117402 gene locus_tag LOCUS_07470 116644 117402 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897796.1 protein_id gnl|my_center|LOCUS_07470 117460 117843 gene locus_tag LOCUS_07480 117460 117843 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546622.1 protein_id gnl|my_center|LOCUS_07480 118152 120326 gene locus_tag LOCUS_07490 gene recQ 118152 120326 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948677.1 protein_id gnl|my_center|LOCUS_07490 120342 121544 gene locus_tag LOCUS_07500 120342 121544 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986366.1 protein_id gnl|my_center|LOCUS_07500 121652 123268 gene locus_tag LOCUS_07510 121652 123268 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633861.1 protein_id gnl|my_center|LOCUS_07510 123552 123316 gene locus_tag LOCUS_07520 123552 123316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 123657 123818 gene locus_tag LOCUS_07530 123657 123818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 124074 124463 gene locus_tag LOCUS_07540 124074 124463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 125051 124506 gene locus_tag LOCUS_07550 125051 124506 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362795.1 protein_id gnl|my_center|LOCUS_07550 125090 125332 gene locus_tag LOCUS_07560 125090 125332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 125411 126841 gene locus_tag LOCUS_07570 125411 126841 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948125.1 protein_id gnl|my_center|LOCUS_07570 126907 127983 gene locus_tag LOCUS_07580 126907 127983 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356041.1 protein_id gnl|my_center|LOCUS_07580 128100 129629 gene locus_tag LOCUS_07590 128100 129629 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429527.1 protein_id gnl|my_center|LOCUS_07590 129951 130784 gene locus_tag LOCUS_07600 129951 130784 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_07600 130854 131690 gene locus_tag LOCUS_07610 130854 131690 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_07610 132579 131809 gene locus_tag LOCUS_07620 132579 131809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 133456 132602 gene locus_tag LOCUS_07630 133456 132602 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047975.1 protein_id gnl|my_center|LOCUS_07630 133832 133446 gene locus_tag LOCUS_07640 133832 133446 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167463.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence06 1979 354 gene locus_tag LOCUS_07650 1979 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2389 2949 gene locus_tag LOCUS_07660 2389 2949 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948983.1 protein_id gnl|my_center|LOCUS_07660 3160 3306 gene locus_tag LOCUS_07670 3160 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3528 3603 gene locus_tag LOCUS_t00090 3528 3603 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3980 6217 gene locus_tag LOCUS_07680 3980 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 6399 6875 gene locus_tag LOCUS_07690 gene nuoE 6399 6875 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582933.1 protein_id gnl|my_center|LOCUS_07690 6877 8751 gene locus_tag LOCUS_07700 gene nuoF 6877 8751 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817338.1 protein_id gnl|my_center|LOCUS_07700 8756 10444 gene locus_tag LOCUS_07710 8756 10444 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_07710 10450 10701 gene locus_tag LOCUS_07720 10450 10701 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_07720 11467 10853 gene locus_tag LOCUS_07730 11467 10853 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966864.1 protein_id gnl|my_center|LOCUS_07730 11873 11589 gene locus_tag LOCUS_07740 11873 11589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 12081 12473 gene locus_tag LOCUS_07750 12081 12473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 12743 13684 gene locus_tag LOCUS_07760 12743 13684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948491.1 protein_id gnl|my_center|LOCUS_07760 13868 16948 gene locus_tag LOCUS_07770 13868 16948 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966288.1 protein_id gnl|my_center|LOCUS_07770 17076 22514 gene locus_tag LOCUS_07780 17076 22514 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965911.1 protein_id gnl|my_center|LOCUS_07780 22690 25941 gene locus_tag LOCUS_07790 22690 25941 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966576.1 protein_id gnl|my_center|LOCUS_07790 26006 26443 gene locus_tag LOCUS_07800 26006 26443 CDS product DUF2383 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949133.1 protein_id gnl|my_center|LOCUS_07800 27186 26479 gene locus_tag LOCUS_07810 27186 26479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 27367 27756 gene locus_tag LOCUS_07820 27367 27756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 28030 28698 gene locus_tag LOCUS_07830 28030 28698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 28682 29848 gene locus_tag LOCUS_07840 28682 29848 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963567.1 protein_id gnl|my_center|LOCUS_07840 29841 30536 gene locus_tag LOCUS_07850 29841 30536 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963568.1 protein_id gnl|my_center|LOCUS_07850 30733 31257 gene locus_tag LOCUS_07860 30733 31257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 32767 31319 gene locus_tag LOCUS_07870 gene nhaC 32767 31319 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_07870 33341 33919 gene locus_tag LOCUS_07880 33341 33919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 34100 35206 gene locus_tag LOCUS_07890 34100 35206 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986543.1 protein_id gnl|my_center|LOCUS_07890 36561 35317 gene locus_tag LOCUS_07900 36561 35317 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_07900 38627 37242 gene locus_tag LOCUS_07910 38627 37242 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948793.1 protein_id gnl|my_center|LOCUS_07910 38916 42311 gene locus_tag LOCUS_07920 38916 42311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 43018 42401 gene locus_tag LOCUS_07930 43018 42401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 43862 43158 gene locus_tag LOCUS_07940 43862 43158 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_07940 44215 45138 gene locus_tag LOCUS_07950 44215 45138 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399477.1 protein_id gnl|my_center|LOCUS_07950 45250 45798 gene locus_tag LOCUS_07960 45250 45798 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948772.1 protein_id gnl|my_center|LOCUS_07960 46139 46987 gene locus_tag LOCUS_07970 46139 46987 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114815.1 protein_id gnl|my_center|LOCUS_07970 47469 47221 gene locus_tag LOCUS_07980 47469 47221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 47792 48475 gene locus_tag LOCUS_07990 47792 48475 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355974.1 protein_id gnl|my_center|LOCUS_07990 48939 48643 gene locus_tag LOCUS_08000 48939 48643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 49330 48908 gene locus_tag LOCUS_08010 49330 48908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 49626 51017 gene locus_tag LOCUS_08020 49626 51017 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948273.1 protein_id gnl|my_center|LOCUS_08020 51192 51479 gene locus_tag LOCUS_08030 51192 51479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 52848 51745 gene locus_tag LOCUS_08040 52848 51745 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359094.1 protein_id gnl|my_center|LOCUS_08040 53175 53786 gene locus_tag LOCUS_08050 53175 53786 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_08050 54348 55835 gene locus_tag LOCUS_08060 54348 55835 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_08060 55849 56904 gene locus_tag LOCUS_08070 55849 56904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 57069 58508 gene locus_tag LOCUS_08080 57069 58508 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519112.1 protein_id gnl|my_center|LOCUS_08080 59246 60313 gene locus_tag LOCUS_08090 59246 60313 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943078.1 protein_id gnl|my_center|LOCUS_08090 60541 62031 gene locus_tag LOCUS_08100 gene glpK 60541 62031 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_08100 62233 62003 gene locus_tag LOCUS_08110 62233 62003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 62779 62354 gene locus_tag LOCUS_08120 62779 62354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 63235 63630 gene locus_tag LOCUS_08130 63235 63630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 63659 64483 gene locus_tag LOCUS_08140 gene thiD 63659 64483 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948480.1 protein_id gnl|my_center|LOCUS_08140 64476 65690 gene locus_tag LOCUS_08150 gene cytX 64476 65690 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225706.1 protein_id gnl|my_center|LOCUS_08150 65669 66505 gene locus_tag LOCUS_08160 gene thiM 65669 66505 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_08160 66495 67121 gene locus_tag LOCUS_08170 gene thiE 66495 67121 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_08170 67382 68599 gene locus_tag LOCUS_08180 67382 68599 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_08180 68713 70086 gene locus_tag LOCUS_08190 68713 70086 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328014.1 protein_id gnl|my_center|LOCUS_08190 71373 70144 gene locus_tag LOCUS_08200 71373 70144 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897308.1 protein_id gnl|my_center|LOCUS_08200 71632 72849 gene locus_tag LOCUS_08210 71632 72849 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861720.1 protein_id gnl|my_center|LOCUS_08210 73057 73473 gene locus_tag LOCUS_08220 73057 73473 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_08220 73424 73618 gene locus_tag LOCUS_08230 73424 73618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 73771 75459 gene locus_tag LOCUS_08240 73771 75459 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048183.1 protein_id gnl|my_center|LOCUS_08240 75895 77451 gene locus_tag LOCUS_08250 75895 77451 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_08250 77516 78892 gene locus_tag LOCUS_08260 77516 78892 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819390.1 protein_id gnl|my_center|LOCUS_08260 79116 79544 gene locus_tag LOCUS_08270 79116 79544 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084116061.1 protein_id gnl|my_center|LOCUS_08270 79668 81590 gene locus_tag LOCUS_08280 79668 81590 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518851.1 protein_id gnl|my_center|LOCUS_08280 81595 82770 gene locus_tag LOCUS_08290 gene yhbH 81595 82770 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963900.1 protein_id gnl|my_center|LOCUS_08290 82772 84145 gene locus_tag LOCUS_08300 82772 84145 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518852.1 protein_id gnl|my_center|LOCUS_08300 84469 86139 gene locus_tag LOCUS_08310 84469 86139 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965429.1 protein_id gnl|my_center|LOCUS_08310 86288 87310 gene locus_tag LOCUS_08320 86288 87310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 87621 88622 gene locus_tag LOCUS_08330 gene add 87621 88622 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948672.1 protein_id gnl|my_center|LOCUS_08330 89005 90141 gene locus_tag LOCUS_08340 89005 90141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 90438 90602 gene locus_tag LOCUS_08350 90438 90602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 90709 91170 gene locus_tag LOCUS_08360 90709 91170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 91361 91927 gene locus_tag LOCUS_08370 91361 91927 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357101.1 protein_id gnl|my_center|LOCUS_08370 92029 93063 gene locus_tag LOCUS_08380 92029 93063 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964016.1 protein_id gnl|my_center|LOCUS_08380 93300 93767 gene locus_tag LOCUS_08390 93300 93767 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_08390 94554 94715 gene locus_tag LOCUS_08400 94554 94715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 94845 94770 gene locus_tag LOCUS_t00100 94845 94770 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 95199 97796 gene locus_tag LOCUS_08410 gene clpB 95199 97796 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948176.1 protein_id gnl|my_center|LOCUS_08410 98688 97867 gene locus_tag LOCUS_08420 98688 97867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 98983 99222 gene locus_tag LOCUS_08430 98983 99222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 99404 99685 gene locus_tag LOCUS_08440 99404 99685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 99775 101226 gene locus_tag LOCUS_08450 99775 101226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 101470 102651 gene locus_tag LOCUS_08460 101470 102651 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966934.1 protein_id gnl|my_center|LOCUS_08460 103002 104093 gene locus_tag LOCUS_08470 gene chvE 103002 104093 CDS product sugar ABC transporter substrate-binding protein ChvE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311697.1 protein_id gnl|my_center|LOCUS_08470 104167 105702 gene locus_tag LOCUS_08480 gene gguA 104167 105702 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533633.1 protein_id gnl|my_center|LOCUS_08480 105702 106877 gene locus_tag LOCUS_08490 gene gguB 105702 106877 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085994.1 protein_id gnl|my_center|LOCUS_08490 107017 107640 gene locus_tag LOCUS_08500 107017 107640 CDS product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 protein_id gnl|my_center|LOCUS_08500 107696 109177 gene locus_tag LOCUS_08510 107696 109177 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_08510 109281 110813 gene locus_tag LOCUS_08520 gene xylB 109281 110813 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_08520 111673 112692 gene locus_tag LOCUS_08530 111673 112692 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075125.1 protein_id gnl|my_center|LOCUS_08530 112729 113559 gene locus_tag LOCUS_08540 gene kduI 112729 113559 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383257.1 protein_id gnl|my_center|LOCUS_08540 113611 114645 gene locus_tag LOCUS_08550 113611 114645 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567704.1 protein_id gnl|my_center|LOCUS_08550 114673 115155 gene locus_tag LOCUS_08560 114673 115155 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288258.1 protein_id gnl|my_center|LOCUS_08560 115172 116479 gene locus_tag LOCUS_08570 115172 116479 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 protein_id gnl|my_center|LOCUS_08570 116561 117322 gene locus_tag LOCUS_08580 116561 117322 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_08580 117389 118150 gene locus_tag LOCUS_08590 117389 118150 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029015.1 protein_id gnl|my_center|LOCUS_08590 118164 119114 gene locus_tag LOCUS_08600 118164 119114 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_08600 119256 119879 gene locus_tag LOCUS_08610 119256 119879 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963716.1 protein_id gnl|my_center|LOCUS_08610 119898 120644 gene locus_tag LOCUS_08620 119898 120644 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837540.1 protein_id gnl|my_center|LOCUS_08620 120847 121809 gene locus_tag LOCUS_08630 120847 121809 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963717.1 protein_id gnl|my_center|LOCUS_08630 121912 122298 gene locus_tag LOCUS_08640 121912 122298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 122477 123118 gene locus_tag LOCUS_08650 122477 123118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 123255 123755 gene locus_tag LOCUS_08660 123255 123755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 124540 123875 gene locus_tag LOCUS_08670 124540 123875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 125019 124639 gene locus_tag LOCUS_08680 125019 124639 CDS product DUF6262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361059.1 protein_id gnl|my_center|LOCUS_08680 125317 125012 gene locus_tag LOCUS_08690 125317 125012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 125850 125407 gene locus_tag LOCUS_08700 125850 125407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08700 126435 125860 gene locus_tag LOCUS_08710 126435 125860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08710 126622 126422 gene locus_tag LOCUS_08720 126622 126422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 126810 128045 gene locus_tag LOCUS_08730 126810 128045 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188697727.1 protein_id gnl|my_center|LOCUS_08730 128740 129009 gene locus_tag LOCUS_08740 128740 129009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 128990 129853 gene locus_tag LOCUS_08750 128990 129853 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967849.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence07 437 928 gene locus_tag LOCUS_08760 437 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 1895 1035 gene locus_tag LOCUS_08770 1895 1035 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431317.1 protein_id gnl|my_center|LOCUS_08770 2053 3006 gene locus_tag LOCUS_08780 2053 3006 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_08780 3228 4220 gene locus_tag LOCUS_08790 3228 4220 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682144.1 protein_id gnl|my_center|LOCUS_08790 4953 6110 gene locus_tag LOCUS_08800 4953 6110 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_08800 6207 7130 gene locus_tag LOCUS_08810 6207 7130 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_08810 7140 8096 gene locus_tag LOCUS_08820 7140 8096 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018191.1 protein_id gnl|my_center|LOCUS_08820 8083 8883 gene locus_tag LOCUS_08830 8083 8883 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_08830 8876 9580 gene locus_tag LOCUS_08840 8876 9580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_08840 9888 10688 gene locus_tag LOCUS_08850 9888 10688 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965735.1 protein_id gnl|my_center|LOCUS_08850 10749 11477 gene locus_tag LOCUS_08860 10749 11477 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878933.1 protein_id gnl|my_center|LOCUS_08860 12176 12322 gene locus_tag LOCUS_08870 12176 12322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 12361 13596 gene locus_tag LOCUS_08880 12361 13596 CDS product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868876.1 protein_id gnl|my_center|LOCUS_08880 13691 15316 gene locus_tag LOCUS_08890 13691 15316 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868877.1 protein_id gnl|my_center|LOCUS_08890 15304 16338 gene locus_tag LOCUS_08900 15304 16338 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868878.1 protein_id gnl|my_center|LOCUS_08900 16342 17454 gene locus_tag LOCUS_08910 16342 17454 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868879.1 protein_id gnl|my_center|LOCUS_08910 17882 19297 gene locus_tag LOCUS_08920 gene hydG 17882 19297 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868901.1 protein_id gnl|my_center|LOCUS_08920 20528 19335 gene locus_tag LOCUS_08930 20528 19335 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947948.1 protein_id gnl|my_center|LOCUS_08930 20983 21588 gene locus_tag LOCUS_08940 20983 21588 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964139.1 protein_id gnl|my_center|LOCUS_08940 21599 22087 gene locus_tag LOCUS_08950 21599 22087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 22138 23346 gene locus_tag LOCUS_08960 22138 23346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 23699 24547 gene locus_tag LOCUS_08970 23699 24547 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119646.1 protein_id gnl|my_center|LOCUS_08970 24732 26255 gene locus_tag LOCUS_08980 gene gntK 24732 26255 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255195.1 protein_id gnl|my_center|LOCUS_08980 26271 27590 gene locus_tag LOCUS_08990 gene gntT 26271 27590 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174795.1 protein_id gnl|my_center|LOCUS_08990 27651 29060 gene locus_tag LOCUS_09000 gene gndA 27651 29060 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_09000 29227 30642 gene locus_tag LOCUS_09010 gene gndA 29227 30642 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_09010 31484 30714 gene locus_tag LOCUS_09020 gene fetB 31484 30714 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082840.1 protein_id gnl|my_center|LOCUS_09020 32116 31487 gene locus_tag LOCUS_09030 32116 31487 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470311.1 protein_id gnl|my_center|LOCUS_09030 33418 32258 gene locus_tag LOCUS_09040 33418 32258 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808433.1 protein_id gnl|my_center|LOCUS_09040 33648 36602 gene locus_tag LOCUS_09050 33648 36602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 36799 36984 gene locus_tag LOCUS_09060 36799 36984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 37586 40132 gene locus_tag LOCUS_09070 37586 40132 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099839674.1 protein_id gnl|my_center|LOCUS_09070 40261 40671 gene locus_tag LOCUS_09080 40261 40671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 41076 41828 gene locus_tag LOCUS_09090 41076 41828 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_09090 43830 42046 gene locus_tag LOCUS_09100 gene feoB 43830 42046 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861233.1 protein_id gnl|my_center|LOCUS_09100 43733 44071 gene locus_tag LOCUS_09110 43733 44071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 44336 44127 gene locus_tag LOCUS_09120 44336 44127 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_09120 44833 45060 gene locus_tag LOCUS_09130 44833 45060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09130 45096 45356 gene locus_tag LOCUS_09140 45096 45356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09140 45789 46805 gene locus_tag LOCUS_09150 45789 46805 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966318.1 protein_id gnl|my_center|LOCUS_09150 46965 48206 gene locus_tag LOCUS_09160 46965 48206 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775660.1 protein_id gnl|my_center|LOCUS_09160 48302 49171 gene locus_tag LOCUS_09170 48302 49171 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 protein_id gnl|my_center|LOCUS_09170 49171 49998 gene locus_tag LOCUS_09180 49171 49998 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 protein_id gnl|my_center|LOCUS_09180 50014 51693 gene locus_tag LOCUS_09190 gene malL 50014 51693 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415176.1 protein_id gnl|my_center|LOCUS_09190 52160 53377 gene locus_tag LOCUS_09200 52160 53377 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_09200 53395 54885 gene locus_tag LOCUS_09210 gene thrC 53395 54885 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_09210 54914 56227 gene locus_tag LOCUS_09220 54914 56227 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_09220 56283 57572 gene locus_tag LOCUS_09230 56283 57572 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964316.1 protein_id gnl|my_center|LOCUS_09230 57717 58541 gene locus_tag LOCUS_09240 57717 58541 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_09240 58811 59290 gene locus_tag LOCUS_09250 58811 59290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 59533 59892 gene locus_tag LOCUS_09260 59533 59892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 60235 60101 gene locus_tag LOCUS_09270 60235 60101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 60640 60269 gene locus_tag LOCUS_09280 60640 60269 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_09280 60910 61365 gene locus_tag LOCUS_09290 60910 61365 CDS product DUF441 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963419.1 protein_id gnl|my_center|LOCUS_09290 61583 61786 gene locus_tag LOCUS_09300 61583 61786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 61901 62572 gene locus_tag LOCUS_09310 61901 62572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425116.1 protein_id gnl|my_center|LOCUS_09310 62727 62909 gene locus_tag LOCUS_09320 62727 62909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 63459 63217 gene locus_tag LOCUS_09330 63459 63217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09330 63733 64032 gene locus_tag LOCUS_09340 63733 64032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 64263 64583 gene locus_tag LOCUS_09350 gene sugE 64263 64583 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417824.1 protein_id gnl|my_center|LOCUS_09350 65249 64671 gene locus_tag LOCUS_09360 65249 64671 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815839.1 protein_id gnl|my_center|LOCUS_09360 65457 66347 gene locus_tag LOCUS_09370 65457 66347 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255173.1 protein_id gnl|my_center|LOCUS_09370 67104 66589 gene locus_tag LOCUS_09380 67104 66589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 67386 67577 gene locus_tag LOCUS_09390 67386 67577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356034.1 protein_id gnl|my_center|LOCUS_09390 67884 68471 gene locus_tag LOCUS_09400 67884 68471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 68681 68541 gene locus_tag LOCUS_09410 68681 68541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047889.1 protein_id gnl|my_center|LOCUS_09410 68997 69839 gene locus_tag LOCUS_09420 68997 69839 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941438.1 protein_id gnl|my_center|LOCUS_09420 70107 70487 gene locus_tag LOCUS_09430 70107 70487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 70477 71667 gene locus_tag LOCUS_09440 70477 71667 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_09440 71745 72254 gene locus_tag LOCUS_09450 71745 72254 CDS product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986320.1 protein_id gnl|my_center|LOCUS_09450 72355 73533 gene locus_tag LOCUS_09460 72355 73533 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_09460 73740 74231 gene locus_tag LOCUS_09470 73740 74231 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949067.1 protein_id gnl|my_center|LOCUS_09470 74513 74301 gene locus_tag LOCUS_09480 74513 74301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 75335 74820 gene locus_tag LOCUS_09490 75335 74820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 75772 77490 gene locus_tag LOCUS_09500 75772 77490 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987099.1 protein_id gnl|my_center|LOCUS_09500 78099 77659 gene locus_tag LOCUS_09510 78099 77659 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048682.1 protein_id gnl|my_center|LOCUS_09510 78431 78892 gene locus_tag LOCUS_09520 78431 78892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 78940 79317 gene locus_tag LOCUS_09530 78940 79317 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986456.1 protein_id gnl|my_center|LOCUS_09530 79342 80601 gene locus_tag LOCUS_09540 79342 80601 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_09540 80708 81028 gene locus_tag LOCUS_09550 80708 81028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 81664 81230 gene locus_tag LOCUS_09560 81664 81230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 81917 83353 gene locus_tag LOCUS_09570 81917 83353 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278133.1 protein_id gnl|my_center|LOCUS_09570 83459 83881 gene locus_tag LOCUS_09580 83459 83881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 84005 84163 gene locus_tag LOCUS_09590 84005 84163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 84799 84221 gene locus_tag LOCUS_09600 84799 84221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 85134 85289 gene locus_tag LOCUS_09610 85134 85289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 85419 85763 gene locus_tag LOCUS_09620 85419 85763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 85795 86265 gene locus_tag LOCUS_09630 85795 86265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 88604 86514 gene locus_tag LOCUS_09640 88604 86514 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048194.1 protein_id gnl|my_center|LOCUS_09640 89567 88989 gene locus_tag LOCUS_09650 89567 88989 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_09650 89747 90103 gene locus_tag LOCUS_09660 89747 90103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 90093 90533 gene locus_tag LOCUS_09670 90093 90533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 90639 90809 gene locus_tag LOCUS_09680 90639 90809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 91200 91877 gene locus_tag LOCUS_09690 91200 91877 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404330.1 protein_id gnl|my_center|LOCUS_09690 91846 92397 gene locus_tag LOCUS_09700 91846 92397 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_09700 92486 93502 gene locus_tag LOCUS_09710 92486 93502 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948238.1 protein_id gnl|my_center|LOCUS_09710 93549 94577 gene locus_tag LOCUS_09720 93549 94577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356452.1 protein_id gnl|my_center|LOCUS_09720 94675 95658 gene locus_tag LOCUS_09730 94675 95658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 95948 96523 gene locus_tag LOCUS_09740 95948 96523 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986540.1 protein_id gnl|my_center|LOCUS_09740 96903 97085 gene locus_tag LOCUS_09750 96903 97085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 97243 97389 gene locus_tag LOCUS_09760 97243 97389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 97606 100686 gene locus_tag LOCUS_09770 97606 100686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 100676 104101 gene locus_tag LOCUS_09780 100676 104101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 104200 104403 gene locus_tag LOCUS_09790 104200 104403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965216.1 protein_id gnl|my_center|LOCUS_09790 104535 105653 gene locus_tag LOCUS_09800 104535 105653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 105858 107318 gene locus_tag LOCUS_09810 105858 107318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 107482 107829 gene locus_tag LOCUS_09820 107482 107829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 108108 107983 gene locus_tag LOCUS_09830 108108 107983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 109681 108140 gene locus_tag LOCUS_09840 109681 108140 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986561.1 protein_id gnl|my_center|LOCUS_09840 111201 109816 gene locus_tag LOCUS_09850 111201 109816 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943364.1 protein_id gnl|my_center|LOCUS_09850 111516 111280 gene locus_tag LOCUS_09860 111516 111280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 111676 112140 gene locus_tag LOCUS_09870 111676 112140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 112146 113024 gene locus_tag LOCUS_09880 112146 113024 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039694.1 protein_id gnl|my_center|LOCUS_09880 113436 113161 gene locus_tag LOCUS_09890 113436 113161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 113691 114506 gene locus_tag LOCUS_09900 gene spo0A 113691 114506 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 protein_id gnl|my_center|LOCUS_09900 114816 114959 gene locus_tag LOCUS_09910 114816 114959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 114956 115213 gene locus_tag LOCUS_09920 114956 115213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 115730 115927 gene locus_tag LOCUS_09930 115730 115927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 115933 116181 gene locus_tag LOCUS_09940 115933 116181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 116174 116404 gene locus_tag LOCUS_09950 116174 116404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 116567 116848 gene locus_tag LOCUS_09960 116567 116848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09960 117183 118082 gene locus_tag LOCUS_09970 117183 118082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 118113 119165 gene locus_tag LOCUS_09980 118113 119165 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684567.1 protein_id gnl|my_center|LOCUS_09980 119221 120090 gene locus_tag LOCUS_09990 119221 120090 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986311.1 protein_id gnl|my_center|LOCUS_09990 120731 120183 gene locus_tag LOCUS_10000 120731 120183 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354975.1 protein_id gnl|my_center|LOCUS_10000 121703 120747 gene locus_tag LOCUS_10010 gene bioB 121703 120747 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_10010 121944 122831 gene locus_tag LOCUS_10020 121944 122831 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890749.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence08 3185 585 gene locus_tag LOCUS_10030 gene gyrA 3185 585 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947899.1 protein_id gnl|my_center|LOCUS_10030 5179 3275 gene locus_tag LOCUS_10040 gene gyrB 5179 3275 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_10040 5463 5200 gene locus_tag LOCUS_10050 5463 5200 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359336.1 protein_id gnl|my_center|LOCUS_10050 6594 5503 gene locus_tag LOCUS_10060 gene recF 6594 5503 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_10060 6943 6737 gene locus_tag LOCUS_10070 gene yaaA 6943 6737 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359394.1 protein_id gnl|my_center|LOCUS_10070 8096 6987 gene locus_tag LOCUS_10080 gene dnaN 8096 6987 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_10080 9720 8368 gene locus_tag LOCUS_10090 gene dnaA 9720 8368 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_10090 10264 10398 gene locus_tag LOCUS_10100 gene rpmH 10264 10398 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359452.1 protein_id gnl|my_center|LOCUS_10100 10451 10831 gene locus_tag LOCUS_10110 gene rnpA 10451 10831 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966998.1 protein_id gnl|my_center|LOCUS_10110 10794 11003 gene locus_tag LOCUS_10120 gene yidD 10794 11003 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048456.1 protein_id gnl|my_center|LOCUS_10120 11024 11707 gene locus_tag LOCUS_10130 11024 11707 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359437.1 protein_id gnl|my_center|LOCUS_10130 11753 12379 gene locus_tag LOCUS_10140 11753 12379 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_10140 12428 13804 gene locus_tag LOCUS_10150 gene mnmE 12428 13804 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359423.1 protein_id gnl|my_center|LOCUS_10150 13813 15696 gene locus_tag LOCUS_10160 gene mnmG 13813 15696 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_10160 15739 16458 gene locus_tag LOCUS_10170 gene rsmG 15739 16458 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048453.1 protein_id gnl|my_center|LOCUS_10170 16572 17351 gene locus_tag LOCUS_10180 gene noc 16572 17351 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048452.1 protein_id gnl|my_center|LOCUS_10180 17583 18359 gene locus_tag LOCUS_10190 17583 18359 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048451.1 protein_id gnl|my_center|LOCUS_10190 18356 19207 gene locus_tag LOCUS_10200 18356 19207 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_10200 19247 19750 gene locus_tag LOCUS_10210 19247 19750 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398925.1 protein_id gnl|my_center|LOCUS_10210 19854 20111 gene locus_tag LOCUS_10220 19854 20111 CDS product YkuS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048449.1 protein_id gnl|my_center|LOCUS_10220 20759 20157 gene locus_tag LOCUS_10230 gene yyaC 20759 20157 CDS product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048448.1 protein_id gnl|my_center|LOCUS_10230 21860 20808 gene locus_tag LOCUS_10240 gene ytvI 21860 20808 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048447.1 protein_id gnl|my_center|LOCUS_10240 23024 21870 gene locus_tag LOCUS_10250 23024 21870 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048446.1 protein_id gnl|my_center|LOCUS_10250 23410 23994 gene locus_tag LOCUS_10260 gene yedF 23410 23994 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986892.1 protein_id gnl|my_center|LOCUS_10260 24103 24375 gene locus_tag LOCUS_10270 24103 24375 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361815.1 protein_id gnl|my_center|LOCUS_10270 24362 24580 gene locus_tag LOCUS_10280 24362 24580 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398916.1 protein_id gnl|my_center|LOCUS_10280 24677 24964 gene locus_tag LOCUS_10290 gene rpsF 24677 24964 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_10290 24976 25416 gene locus_tag LOCUS_10300 24976 25416 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966983.1 protein_id gnl|my_center|LOCUS_10300 25442 25711 gene locus_tag LOCUS_10310 gene rpsR 25442 25711 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966982.1 protein_id gnl|my_center|LOCUS_10310 26046 26360 gene locus_tag LOCUS_10320 26046 26360 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359330.1 protein_id gnl|my_center|LOCUS_10320 26376 27383 gene locus_tag LOCUS_10330 26376 27383 CDS product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048443.1 protein_id gnl|my_center|LOCUS_10330 27397 29388 gene locus_tag LOCUS_10340 27397 29388 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397329.1 protein_id gnl|my_center|LOCUS_10340 29388 29831 gene locus_tag LOCUS_10350 gene rplI 29388 29831 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966977.1 protein_id gnl|my_center|LOCUS_10350 29903 31801 gene locus_tag LOCUS_10360 gene lonC 29903 31801 CDS product Lon family ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048441.1 protein_id gnl|my_center|LOCUS_10360 31883 33214 gene locus_tag LOCUS_10370 31883 33214 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_10370 33930 34985 gene locus_tag LOCUS_10380 33930 34985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 34988 35377 gene locus_tag LOCUS_10390 34988 35377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 35466 35792 gene locus_tag LOCUS_10400 35466 35792 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282554.1 protein_id gnl|my_center|LOCUS_10400 35817 35892 gene locus_tag LOCUS_t00110 35817 35892 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 36069 36740 gene locus_tag LOCUS_10410 36069 36740 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271956.1 protein_id gnl|my_center|LOCUS_10410 37005 37967 gene locus_tag LOCUS_10420 37005 37967 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_10420 37997 38209 gene locus_tag LOCUS_10430 37997 38209 CDS product DUF3006 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359442.1 protein_id gnl|my_center|LOCUS_10430 38516 39934 gene locus_tag LOCUS_10440 38516 39934 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_10440 40084 41370 gene locus_tag LOCUS_10450 40084 41370 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048438.1 protein_id gnl|my_center|LOCUS_10450 41632 41817 gene locus_tag LOCUS_10460 41632 41817 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359346.1 protein_id gnl|my_center|LOCUS_10460 42447 41860 gene locus_tag LOCUS_10470 42447 41860 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963654.1 protein_id gnl|my_center|LOCUS_10470 42799 43551 gene locus_tag LOCUS_10480 42799 43551 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048437.1 protein_id gnl|my_center|LOCUS_10480 45375 44146 gene locus_tag LOCUS_10490 45375 44146 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966853.1 protein_id gnl|my_center|LOCUS_10490 45717 45791 gene locus_tag LOCUS_t00120 45717 45791 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 45804 45879 gene locus_tag LOCUS_t00130 45804 45879 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 45885 45961 gene locus_tag LOCUS_t00140 45885 45961 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 45973 46047 gene locus_tag LOCUS_t00150 45973 46047 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 46071 46145 gene locus_tag LOCUS_t00160 46071 46145 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 46159 46234 gene locus_tag LOCUS_t00170 46159 46234 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 46240 46316 gene locus_tag LOCUS_t00180 46240 46316 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 46324 46398 gene locus_tag LOCUS_t00190 46324 46398 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 47531 46551 gene locus_tag LOCUS_10500 47531 46551 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048435.1 protein_id gnl|my_center|LOCUS_10500 48510 47524 gene locus_tag LOCUS_10510 48510 47524 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048434.1 protein_id gnl|my_center|LOCUS_10510 48760 49959 gene locus_tag LOCUS_10520 48760 49959 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048433.1 protein_id gnl|my_center|LOCUS_10520 50095 50757 gene locus_tag LOCUS_10530 50095 50757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986295.1 protein_id gnl|my_center|LOCUS_10530 50948 51160 gene locus_tag LOCUS_10540 50948 51160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 51387 51202 gene locus_tag LOCUS_10550 51387 51202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 52169 51525 gene locus_tag LOCUS_10560 gene uppS 52169 51525 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948936.1 protein_id gnl|my_center|LOCUS_10560 52523 53086 gene locus_tag LOCUS_10570 52523 53086 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963361.1 protein_id gnl|my_center|LOCUS_10570 53272 55821 gene locus_tag LOCUS_10580 53272 55821 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678103.1 protein_id gnl|my_center|LOCUS_10580 55959 56894 gene locus_tag LOCUS_10590 55959 56894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 57875 56988 gene locus_tag LOCUS_10600 57875 56988 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986202.1 protein_id gnl|my_center|LOCUS_10600 58771 58139 gene locus_tag LOCUS_10610 gene tapT 58771 58139 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703189.1 protein_id gnl|my_center|LOCUS_10610 59276 58851 gene locus_tag LOCUS_10620 59276 58851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 60153 59326 gene locus_tag LOCUS_10630 gene aacC 60153 59326 CDS product BA2930 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879231.1 protein_id gnl|my_center|LOCUS_10630 60566 60432 gene locus_tag LOCUS_10640 60566 60432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 60966 61412 gene locus_tag LOCUS_10650 60966 61412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 61953 61459 gene locus_tag LOCUS_10660 61953 61459 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963585.1 protein_id gnl|my_center|LOCUS_10660 62463 62164 gene locus_tag LOCUS_10670 62463 62164 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255008.1 protein_id gnl|my_center|LOCUS_10670 63532 62579 gene locus_tag LOCUS_10680 gene corA 63532 62579 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002003436.1 protein_id gnl|my_center|LOCUS_10680 63864 64937 gene locus_tag LOCUS_10690 63864 64937 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966843.1 protein_id gnl|my_center|LOCUS_10690 65085 65537 gene locus_tag LOCUS_10700 65085 65537 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048431.1 protein_id gnl|my_center|LOCUS_10700 65555 66538 gene locus_tag LOCUS_10710 65555 66538 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_10710 66559 66789 gene locus_tag LOCUS_10720 gene acpP 66559 66789 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965054.1 protein_id gnl|my_center|LOCUS_10720 66966 67898 gene locus_tag LOCUS_10730 gene fabK 66966 67898 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_10730 67946 68881 gene locus_tag LOCUS_10740 gene fabD 67946 68881 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_10740 68934 69677 gene locus_tag LOCUS_10750 gene fabG 68934 69677 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_10750 69767 71008 gene locus_tag LOCUS_10760 gene fabF 69767 71008 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_10760 71011 71529 gene locus_tag LOCUS_10770 gene accB 71011 71529 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966835.1 protein_id gnl|my_center|LOCUS_10770 71597 72046 gene locus_tag LOCUS_10780 gene fabZ 71597 72046 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048424.1 protein_id gnl|my_center|LOCUS_10780 72076 73422 gene locus_tag LOCUS_10790 72076 73422 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_10790 73487 74347 gene locus_tag LOCUS_10800 gene accD 73487 74347 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_10800 74378 75328 gene locus_tag LOCUS_10810 74378 75328 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966831.1 protein_id gnl|my_center|LOCUS_10810 75484 76365 gene locus_tag LOCUS_10820 75484 76365 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986891.1 protein_id gnl|my_center|LOCUS_10820 76601 76455 gene locus_tag LOCUS_10830 76601 76455 CDS product small, acid-soluble spore protein, alpha/beta type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357301.1 protein_id gnl|my_center|LOCUS_10830 76837 77646 gene locus_tag LOCUS_10840 gene proC 76837 77646 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048171.1 protein_id gnl|my_center|LOCUS_10840 78871 77714 gene locus_tag LOCUS_10850 78871 77714 CDS product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964588.1 protein_id gnl|my_center|LOCUS_10850 79739 78945 gene locus_tag LOCUS_10860 79739 78945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 80338 80496 gene locus_tag LOCUS_10870 80338 80496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 81094 80711 gene locus_tag LOCUS_10880 81094 80711 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417583.1 protein_id gnl|my_center|LOCUS_10880 81385 82635 gene locus_tag LOCUS_10890 81385 82635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812185.1 protein_id gnl|my_center|LOCUS_10890 82741 83466 gene locus_tag LOCUS_10900 82741 83466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812187.1 protein_id gnl|my_center|LOCUS_10900 83453 84205 gene locus_tag LOCUS_10910 83453 84205 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812189.1 protein_id gnl|my_center|LOCUS_10910 84250 85692 gene locus_tag LOCUS_10920 84250 85692 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812190.1 protein_id gnl|my_center|LOCUS_10920 85702 86397 gene locus_tag LOCUS_10930 85702 86397 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459873.1 protein_id gnl|my_center|LOCUS_10930 86634 86891 gene locus_tag LOCUS_10940 86634 86891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 88095 86977 gene locus_tag LOCUS_10950 88095 86977 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963600.1 protein_id gnl|my_center|LOCUS_10950 88360 89649 gene locus_tag LOCUS_10960 88360 89649 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808454.1 protein_id gnl|my_center|LOCUS_10960 89922 90785 gene locus_tag LOCUS_10970 89922 90785 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_10970 91265 96718 gene locus_tag LOCUS_10980 91265 96718 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965911.1 protein_id gnl|my_center|LOCUS_10980 96948 99878 gene locus_tag LOCUS_10990 96948 99878 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_10990 99956 100903 gene locus_tag LOCUS_11000 99956 100903 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048420.1 protein_id gnl|my_center|LOCUS_11000 100972 102201 gene locus_tag LOCUS_11010 100972 102201 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_11010 102848 102336 gene locus_tag LOCUS_11020 102848 102336 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403076.1 protein_id gnl|my_center|LOCUS_11020 104258 103065 gene locus_tag LOCUS_11030 104258 103065 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048419.1 protein_id gnl|my_center|LOCUS_11030 105353 104451 gene locus_tag LOCUS_11040 105353 104451 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359449.1 protein_id gnl|my_center|LOCUS_11040 105934 105506 gene locus_tag LOCUS_11050 105934 105506 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966812.1 protein_id gnl|my_center|LOCUS_11050 106505 106020 gene locus_tag LOCUS_11060 106505 106020 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048418.1 protein_id gnl|my_center|LOCUS_11060 107092 106544 gene locus_tag LOCUS_11070 107092 106544 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359388.1 protein_id gnl|my_center|LOCUS_11070 107679 107131 gene locus_tag LOCUS_11080 107679 107131 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359388.1 protein_id gnl|my_center|LOCUS_11080 107869 108027 gene locus_tag LOCUS_11090 107869 108027 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966805.1 protein_id gnl|my_center|LOCUS_11090 108344 109600 gene locus_tag LOCUS_11100 108344 109600 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_11100 109626 110411 gene locus_tag LOCUS_11110 109626 110411 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_11110 110426 110989 gene locus_tag LOCUS_11120 110426 110989 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359354.1 protein_id gnl|my_center|LOCUS_11120 111123 111620 gene locus_tag LOCUS_11130 111123 111620 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966802.1 protein_id gnl|my_center|LOCUS_11130 111901 112524 gene locus_tag LOCUS_11140 111901 112524 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393623.1 protein_id gnl|my_center|LOCUS_11140 112586 113470 gene locus_tag LOCUS_11150 112586 113470 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_11150 113476 114273 gene locus_tag LOCUS_11160 113476 114273 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461285.1 protein_id gnl|my_center|LOCUS_11160 114364 115161 gene locus_tag LOCUS_11170 114364 115161 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262273.1 protein_id gnl|my_center|LOCUS_11170 115363 115842 gene locus_tag LOCUS_11180 gene rlmH 115363 115842 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966801.1 protein_id gnl|my_center|LOCUS_11180 115987 116634 gene locus_tag LOCUS_11190 115987 116634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 116829 118499 gene locus_tag LOCUS_11200 116829 118499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 118615 118977 gene locus_tag LOCUS_11210 118615 118977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 119052 119345 gene locus_tag LOCUS_11220 119052 119345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 119368 119886 gene locus_tag LOCUS_11230 119368 119886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 119901 120209 gene locus_tag LOCUS_11240 119901 120209 CDS product DUF960 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002501910.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence09 1765 608 gene locus_tag LOCUS_11250 1765 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2875 1847 gene locus_tag LOCUS_11260 2875 1847 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461701.1 protein_id gnl|my_center|LOCUS_11260 3572 3066 gene locus_tag LOCUS_11270 3572 3066 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948700.1 protein_id gnl|my_center|LOCUS_11270 5096 3894 gene locus_tag LOCUS_11280 5096 3894 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870329.1 protein_id gnl|my_center|LOCUS_11280 5424 5855 gene locus_tag LOCUS_11290 5424 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 6633 5914 gene locus_tag LOCUS_11300 6633 5914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_11300 7408 6623 gene locus_tag LOCUS_11310 7408 6623 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080269.1 protein_id gnl|my_center|LOCUS_11310 8460 7408 gene locus_tag LOCUS_11320 8460 7408 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869389.1 protein_id gnl|my_center|LOCUS_11320 9357 8464 gene locus_tag LOCUS_11330 9357 8464 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869388.1 protein_id gnl|my_center|LOCUS_11330 10605 9436 gene locus_tag LOCUS_11340 10605 9436 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_11340 11871 10855 gene locus_tag LOCUS_11350 11871 10855 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_11350 12234 12950 gene locus_tag LOCUS_11360 12234 12950 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722821.1 protein_id gnl|my_center|LOCUS_11360 15012 13012 gene locus_tag LOCUS_11370 15012 13012 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966555.1 protein_id gnl|my_center|LOCUS_11370 16784 15012 gene locus_tag LOCUS_11380 16784 15012 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966556.1 protein_id gnl|my_center|LOCUS_11380 17296 16856 gene locus_tag LOCUS_11390 17296 16856 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942998.1 protein_id gnl|my_center|LOCUS_11390 18473 17535 gene locus_tag LOCUS_11400 18473 17535 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_11400 19528 18470 gene locus_tag LOCUS_11410 19528 18470 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_11410 21061 19541 gene locus_tag LOCUS_11420 21061 19541 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_11420 22200 21076 gene locus_tag LOCUS_11430 22200 21076 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_11430 22692 23813 gene locus_tag LOCUS_11440 22692 23813 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_11440 24560 23907 gene locus_tag LOCUS_11450 24560 23907 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898654.1 protein_id gnl|my_center|LOCUS_11450 25644 24676 gene locus_tag LOCUS_11460 gene hemB 25644 24676 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963427.1 protein_id gnl|my_center|LOCUS_11460 27112 25637 gene locus_tag LOCUS_11470 gene cobA 27112 25637 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948608.1 protein_id gnl|my_center|LOCUS_11470 28004 27132 gene locus_tag LOCUS_11480 gene hemC 28004 27132 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948607.1 protein_id gnl|my_center|LOCUS_11480 28780 28055 gene locus_tag LOCUS_11490 gene cobK 28780 28055 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681810.1 protein_id gnl|my_center|LOCUS_11490 29496 28777 gene locus_tag LOCUS_11500 gene cobJ 29496 28777 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903755.1 protein_id gnl|my_center|LOCUS_11500 30461 29496 gene locus_tag LOCUS_11510 gene cbiG 30461 29496 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016779.1 protein_id gnl|my_center|LOCUS_11510 31219 30458 gene locus_tag LOCUS_11520 gene cobM 31219 30458 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681800.1 protein_id gnl|my_center|LOCUS_11520 31878 31219 gene locus_tag LOCUS_11530 31878 31219 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964688.1 protein_id gnl|my_center|LOCUS_11530 32426 31875 gene locus_tag LOCUS_11540 gene cbiT 32426 31875 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680297.1 protein_id gnl|my_center|LOCUS_11540 33009 32413 gene locus_tag LOCUS_11550 gene cbiE 33009 32413 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680295.1 protein_id gnl|my_center|LOCUS_11550 34088 33006 gene locus_tag LOCUS_11560 gene cbiD 34088 33006 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669153.1 protein_id gnl|my_center|LOCUS_11560 34713 34081 gene locus_tag LOCUS_11570 34713 34081 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948611.1 protein_id gnl|my_center|LOCUS_11570 35072 34704 gene locus_tag LOCUS_11580 35072 34704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 35241 35086 gene locus_tag LOCUS_11590 35241 35086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 36072 35524 gene locus_tag LOCUS_11600 36072 35524 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015829.1 protein_id gnl|my_center|LOCUS_11600 37059 36091 gene locus_tag LOCUS_11610 37059 36091 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243040.1 protein_id gnl|my_center|LOCUS_11610 37813 37076 gene locus_tag LOCUS_11620 37813 37076 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901765.1 protein_id gnl|my_center|LOCUS_11620 38768 37818 gene locus_tag LOCUS_11630 38768 37818 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627760.1 protein_id gnl|my_center|LOCUS_11630 38923 38765 gene locus_tag LOCUS_11640 38923 38765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 40082 39177 gene locus_tag LOCUS_11650 40082 39177 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048289.1 protein_id gnl|my_center|LOCUS_11650 41282 40107 gene locus_tag LOCUS_11660 gene anmK 41282 40107 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439909.1 protein_id gnl|my_center|LOCUS_11660 42870 41296 gene locus_tag LOCUS_11670 gene nagZ 42870 41296 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963506.1 protein_id gnl|my_center|LOCUS_11670 44058 42910 gene locus_tag LOCUS_11680 44058 42910 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963509.1 protein_id gnl|my_center|LOCUS_11680 44780 44073 gene locus_tag LOCUS_11690 44780 44073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 45744 44764 gene locus_tag LOCUS_11700 45744 44764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 46230 45766 gene locus_tag LOCUS_11710 46230 45766 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527000.1 protein_id gnl|my_center|LOCUS_11710 47161 46301 gene locus_tag LOCUS_11720 47161 46301 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989564.1 protein_id gnl|my_center|LOCUS_11720 48102 47185 gene locus_tag LOCUS_11730 48102 47185 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722208.1 protein_id gnl|my_center|LOCUS_11730 49643 48222 gene locus_tag LOCUS_11740 49643 48222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 50650 49742 gene locus_tag LOCUS_11750 gene murQ 50650 49742 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963499.1 protein_id gnl|my_center|LOCUS_11750 51645 50782 gene locus_tag LOCUS_11760 51645 50782 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963515.1 protein_id gnl|my_center|LOCUS_11760 51972 53333 gene locus_tag LOCUS_11770 51972 53333 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681233.1 protein_id gnl|my_center|LOCUS_11770 53330 54637 gene locus_tag LOCUS_11780 53330 54637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 55024 54704 gene locus_tag LOCUS_11790 55024 54704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 55343 54981 gene locus_tag LOCUS_11800 55343 54981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 55628 55374 gene locus_tag LOCUS_11810 55628 55374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 55728 55606 gene locus_tag LOCUS_11820 55728 55606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 56469 56248 gene locus_tag LOCUS_11830 56469 56248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 56567 56695 gene locus_tag LOCUS_11840 56567 56695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 57242 58735 gene locus_tag LOCUS_11850 57242 58735 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986513.1 protein_id gnl|my_center|LOCUS_11850 58716 59801 gene locus_tag LOCUS_11860 58716 59801 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986516.1 protein_id gnl|my_center|LOCUS_11860 59798 60916 gene locus_tag LOCUS_11870 59798 60916 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986515.1 protein_id gnl|my_center|LOCUS_11870 61543 61082 gene locus_tag LOCUS_11880 61543 61082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11880 62077 61631 gene locus_tag LOCUS_11890 62077 61631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11890 62462 62058 gene locus_tag LOCUS_11900 62462 62058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11900 64361 62661 gene locus_tag LOCUS_11910 64361 62661 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_11910 66119 64473 gene locus_tag LOCUS_11920 66119 64473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 66585 66436 gene locus_tag LOCUS_11930 66585 66436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 66770 66582 gene locus_tag LOCUS_11940 66770 66582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 67470 66922 gene locus_tag LOCUS_11950 67470 66922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 68722 67850 gene locus_tag LOCUS_11960 68722 67850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 69108 68740 gene locus_tag LOCUS_11970 69108 68740 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245707.1 protein_id gnl|my_center|LOCUS_11970 69334 69843 gene locus_tag LOCUS_11980 69334 69843 CDS product DUF5698 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357138.1 protein_id gnl|my_center|LOCUS_11980 70085 69888 gene locus_tag LOCUS_11990 70085 69888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 70310 70149 gene locus_tag LOCUS_12000 70310 70149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 70246 71364 gene locus_tag LOCUS_12010 70246 71364 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 protein_id gnl|my_center|LOCUS_12010 71798 71493 gene locus_tag LOCUS_12020 71798 71493 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986763.1 protein_id gnl|my_center|LOCUS_12020 72315 71791 gene locus_tag LOCUS_12030 72315 71791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986764.1 protein_id gnl|my_center|LOCUS_12030 72754 72296 gene locus_tag LOCUS_12040 72754 72296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400743.1 protein_id gnl|my_center|LOCUS_12040 73260 72751 gene locus_tag LOCUS_12050 73260 72751 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986765.1 protein_id gnl|my_center|LOCUS_12050 73542 74522 gene locus_tag LOCUS_12060 73542 74522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 75063 74569 gene locus_tag LOCUS_12070 75063 74569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 76531 75137 gene locus_tag LOCUS_12080 76531 75137 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_12080 76748 77212 gene locus_tag LOCUS_12090 gene greA 76748 77212 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965725.1 protein_id gnl|my_center|LOCUS_12090 78972 77338 gene locus_tag LOCUS_12100 gene aspD 78972 77338 CDS product aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948813.1 protein_id gnl|my_center|LOCUS_12100 79374 79177 gene locus_tag LOCUS_12110 79374 79177 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358646.1 protein_id gnl|my_center|LOCUS_12110 80384 79512 gene locus_tag LOCUS_12120 gene speE 80384 79512 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943180.1 protein_id gnl|my_center|LOCUS_12120 80683 81135 gene locus_tag LOCUS_12130 80683 81135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 81178 81333 gene locus_tag LOCUS_12140 81178 81333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 82043 81510 gene locus_tag LOCUS_12150 82043 81510 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949119.1 protein_id gnl|my_center|LOCUS_12150 82326 82102 gene locus_tag LOCUS_12160 82326 82102 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360814.1 protein_id gnl|my_center|LOCUS_12160 83011 82352 gene locus_tag LOCUS_12170 83011 82352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 83979 83023 gene locus_tag LOCUS_12180 gene trxB 83979 83023 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583127.1 protein_id gnl|my_center|LOCUS_12180 84662 84222 gene locus_tag LOCUS_12190 84662 84222 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475872.1 protein_id gnl|my_center|LOCUS_12190 85244 84816 gene locus_tag LOCUS_12200 85244 84816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 85433 85651 gene locus_tag LOCUS_12210 85433 85651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 86644 85916 gene locus_tag LOCUS_12220 86644 85916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 86921 86637 gene locus_tag LOCUS_12230 86921 86637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 87971 87057 gene locus_tag LOCUS_12240 87971 87057 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964901.1 protein_id gnl|my_center|LOCUS_12240 88138 88821 gene locus_tag LOCUS_12250 88138 88821 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680537.1 protein_id gnl|my_center|LOCUS_12250 89025 88813 gene locus_tag LOCUS_12260 89025 88813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 89217 89041 gene locus_tag LOCUS_12270 89217 89041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 89165 89623 gene locus_tag LOCUS_12280 89165 89623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 89959 90951 gene locus_tag LOCUS_12290 89959 90951 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815048.1 protein_id gnl|my_center|LOCUS_12290 90967 92529 gene locus_tag LOCUS_12300 90967 92529 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815046.1 protein_id gnl|my_center|LOCUS_12300 92544 93356 gene locus_tag LOCUS_12310 92544 93356 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942544.1 protein_id gnl|my_center|LOCUS_12310 93824 94777 gene locus_tag LOCUS_12320 gene corA 93824 94777 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391811.1 protein_id gnl|my_center|LOCUS_12320 95299 94967 gene locus_tag LOCUS_12330 95299 94967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 95631 95503 gene locus_tag LOCUS_12340 95631 95503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 96755 95805 gene locus_tag LOCUS_12350 96755 95805 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_12350 97703 96882 gene locus_tag LOCUS_12360 97703 96882 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898793.1 protein_id gnl|my_center|LOCUS_12360 98681 97842 gene locus_tag LOCUS_12370 98681 97842 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228625.1 protein_id gnl|my_center|LOCUS_12370 99575 98694 gene locus_tag LOCUS_12380 99575 98694 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_12380 100010 99738 gene locus_tag LOCUS_12390 100010 99738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 101045 100062 gene locus_tag LOCUS_12400 101045 100062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 101365 101036 gene locus_tag LOCUS_12410 101365 101036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence10 347 868 gene locus_tag LOCUS_12420 347 868 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270894.1 protein_id gnl|my_center|LOCUS_12420 2057 1530 gene locus_tag LOCUS_12430 2057 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3105 2206 gene locus_tag LOCUS_12440 3105 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3301 3534 gene locus_tag LOCUS_12450 3301 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 4666 4304 gene locus_tag LOCUS_12460 4666 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 5474 4671 gene locus_tag LOCUS_12470 5474 4671 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730515.1 protein_id gnl|my_center|LOCUS_12470 5958 5491 gene locus_tag LOCUS_12480 5958 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 6618 6010 gene locus_tag LOCUS_12490 6618 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 8000 6618 gene locus_tag LOCUS_12500 8000 6618 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963189.1 protein_id gnl|my_center|LOCUS_12500 8316 8462 gene locus_tag LOCUS_12510 8316 8462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 8536 9066 gene locus_tag LOCUS_12520 8536 9066 CDS product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986320.1 protein_id gnl|my_center|LOCUS_12520 9185 10189 gene locus_tag LOCUS_12530 gene purR 9185 10189 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457245.1 protein_id gnl|my_center|LOCUS_12530 10215 11969 gene locus_tag LOCUS_12540 10215 11969 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966041.1 protein_id gnl|my_center|LOCUS_12540 11908 13707 gene locus_tag LOCUS_12550 11908 13707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966042.1 protein_id gnl|my_center|LOCUS_12550 15251 13764 gene locus_tag LOCUS_12560 15251 13764 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_12560 15927 15241 gene locus_tag LOCUS_12570 15927 15241 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965730.1 protein_id gnl|my_center|LOCUS_12570 17485 16487 gene locus_tag LOCUS_12580 17485 16487 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860719.1 protein_id gnl|my_center|LOCUS_12580 18491 17583 gene locus_tag LOCUS_12590 gene rbsB 18491 17583 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419502.1 protein_id gnl|my_center|LOCUS_12590 19441 18512 gene locus_tag LOCUS_12600 gene rbsC 19441 18512 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463702.1 protein_id gnl|my_center|LOCUS_12600 20988 19483 gene locus_tag LOCUS_12610 gene rbsA 20988 19483 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387770.1 protein_id gnl|my_center|LOCUS_12610 21423 21028 gene locus_tag LOCUS_12620 gene rbsD 21423 21028 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262034.1 protein_id gnl|my_center|LOCUS_12620 22400 21471 gene locus_tag LOCUS_12630 gene rbsK 22400 21471 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014525052.1 protein_id gnl|my_center|LOCUS_12630 23279 22599 gene locus_tag LOCUS_12640 23279 22599 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151672826.1 protein_id gnl|my_center|LOCUS_12640 24273 23338 gene locus_tag LOCUS_12650 gene menA 24273 23338 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990028.1 protein_id gnl|my_center|LOCUS_12650 24674 24336 gene locus_tag LOCUS_12660 24674 24336 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_12660 26195 24825 gene locus_tag LOCUS_12670 26195 24825 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537911.1 protein_id gnl|my_center|LOCUS_12670 26411 26683 gene locus_tag LOCUS_12680 26411 26683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 27920 26709 gene locus_tag LOCUS_12690 27920 26709 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404919.1 protein_id gnl|my_center|LOCUS_12690 28626 27934 gene locus_tag LOCUS_12700 28626 27934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404917.1 protein_id gnl|my_center|LOCUS_12700 29830 28676 gene locus_tag LOCUS_12710 29830 28676 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947946.1 protein_id gnl|my_center|LOCUS_12710 30965 30093 gene locus_tag LOCUS_12720 30965 30093 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_12720 32071 31019 gene locus_tag LOCUS_12730 32071 31019 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_12730 32608 32147 gene locus_tag LOCUS_12740 32608 32147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 33050 33364 gene locus_tag LOCUS_12750 33050 33364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 33687 33529 gene locus_tag LOCUS_12760 33687 33529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 34550 33921 gene locus_tag LOCUS_12770 34550 33921 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048198.1 protein_id gnl|my_center|LOCUS_12770 34819 35034 gene locus_tag LOCUS_12780 34819 35034 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_12780 35741 35923 gene locus_tag LOCUS_12790 35741 35923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 37199 36045 gene locus_tag LOCUS_12800 37199 36045 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966309.1 protein_id gnl|my_center|LOCUS_12800 39146 37257 gene locus_tag LOCUS_12810 39146 37257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 40242 39244 gene locus_tag LOCUS_12820 40242 39244 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518875.1 protein_id gnl|my_center|LOCUS_12820 40810 41457 gene locus_tag LOCUS_12830 gene pgmB 40810 41457 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_12830 41502 43808 gene locus_tag LOCUS_12840 41502 43808 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_12840 43961 44416 gene locus_tag LOCUS_12850 43961 44416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 44506 45093 gene locus_tag LOCUS_12860 44506 45093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948732.1 protein_id gnl|my_center|LOCUS_12860 45644 45165 gene locus_tag LOCUS_12870 45644 45165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 45949 46137 gene locus_tag LOCUS_12880 45949 46137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 48241 46232 gene locus_tag LOCUS_12890 48241 46232 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_12890 48545 48931 gene locus_tag LOCUS_12900 48545 48931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 49029 50267 gene locus_tag LOCUS_12910 49029 50267 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462130.1 protein_id gnl|my_center|LOCUS_12910 50651 50340 gene locus_tag LOCUS_12920 50651 50340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392386.1 protein_id gnl|my_center|LOCUS_12920 51561 50704 gene locus_tag LOCUS_12930 51561 50704 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964932.1 protein_id gnl|my_center|LOCUS_12930 52115 51792 gene locus_tag LOCUS_12940 52115 51792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 52350 52502 gene locus_tag LOCUS_12950 52350 52502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 52926 52621 gene locus_tag LOCUS_12960 52926 52621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 53972 53028 gene locus_tag LOCUS_12970 53972 53028 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059329.1 protein_id gnl|my_center|LOCUS_12970 55024 54116 gene locus_tag LOCUS_12980 55024 54116 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948290.1 protein_id gnl|my_center|LOCUS_12980 57862 55115 gene locus_tag LOCUS_12990 gene pulA 57862 55115 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167510.1 protein_id gnl|my_center|LOCUS_12990 58103 59470 gene locus_tag LOCUS_13000 58103 59470 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868530.1 protein_id gnl|my_center|LOCUS_13000 59690 59559 gene locus_tag LOCUS_13010 59690 59559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 60099 59863 gene locus_tag LOCUS_13020 60099 59863 CDS product TIGR04540 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948481.1 protein_id gnl|my_center|LOCUS_13020 60476 60838 gene locus_tag LOCUS_13030 60476 60838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13030 62435 61404 gene locus_tag LOCUS_13040 62435 61404 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986244.1 protein_id gnl|my_center|LOCUS_13040 63312 62599 gene locus_tag LOCUS_13050 gene deoD 63312 62599 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020631.1 protein_id gnl|my_center|LOCUS_13050 64942 63788 gene locus_tag LOCUS_13060 64942 63788 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_13060 65218 66045 gene locus_tag LOCUS_13070 gene nudC 65218 66045 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_13070 66615 67790 gene locus_tag LOCUS_13080 66615 67790 CDS product DUF4317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459653.1 protein_id gnl|my_center|LOCUS_13080 68520 67825 gene locus_tag LOCUS_13090 68520 67825 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948043.1 protein_id gnl|my_center|LOCUS_13090 70096 68513 gene locus_tag LOCUS_13100 70096 68513 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948042.1 protein_id gnl|my_center|LOCUS_13100 70467 70114 gene locus_tag LOCUS_13110 70467 70114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 71365 70622 gene locus_tag LOCUS_13120 71365 70622 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877600.1 protein_id gnl|my_center|LOCUS_13120 72114 71578 gene locus_tag LOCUS_13130 72114 71578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13130 72557 72111 gene locus_tag LOCUS_13140 72557 72111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 72939 72550 gene locus_tag LOCUS_13150 72939 72550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13150 73173 73042 gene locus_tag LOCUS_13160 73173 73042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 74208 73237 gene locus_tag LOCUS_13170 74208 73237 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733043.1 protein_id gnl|my_center|LOCUS_13170 76212 74368 gene locus_tag LOCUS_13180 76212 74368 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726299.1 protein_id gnl|my_center|LOCUS_13180 76879 77148 gene locus_tag LOCUS_13190 76879 77148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 77174 77848 gene locus_tag LOCUS_13200 77174 77848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 79188 77995 gene locus_tag LOCUS_13210 79188 77995 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_13210 79618 79241 gene locus_tag LOCUS_13220 79618 79241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 80429 79698 gene locus_tag LOCUS_13230 80429 79698 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016780.1 protein_id gnl|my_center|LOCUS_13230 81684 80422 gene locus_tag LOCUS_13240 81684 80422 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_13240 81862 82356 gene locus_tag LOCUS_13250 gene ogt 81862 82356 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232502.1 protein_id gnl|my_center|LOCUS_13250 82669 82463 gene locus_tag LOCUS_13260 82669 82463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 83692 82748 gene locus_tag LOCUS_13270 83692 82748 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454848.1 protein_id gnl|my_center|LOCUS_13270 84984 83848 gene locus_tag LOCUS_13280 84984 83848 CDS product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391447.1 protein_id gnl|my_center|LOCUS_13280 85756 85013 gene locus_tag LOCUS_13290 85756 85013 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966599.1 protein_id gnl|my_center|LOCUS_13290 86453 85770 gene locus_tag LOCUS_13300 86453 85770 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966598.1 protein_id gnl|my_center|LOCUS_13300 87263 86466 gene locus_tag LOCUS_13310 87263 86466 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966597.1 protein_id gnl|my_center|LOCUS_13310 87750 87397 gene locus_tag LOCUS_13320 87750 87397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 87984 88808 gene locus_tag LOCUS_13330 87984 88808 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987059.1 protein_id gnl|my_center|LOCUS_13330 89314 89108 gene locus_tag LOCUS_13340 89314 89108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 89942 89757 gene locus_tag LOCUS_13350 89942 89757 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_13350 90352 90191 gene locus_tag LOCUS_13360 90352 90191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 91054 90413 gene locus_tag LOCUS_13370 91054 90413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460670.1 protein_id gnl|my_center|LOCUS_13370 92280 91204 gene locus_tag LOCUS_13380 92280 91204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13380 93116 92334 gene locus_tag LOCUS_13390 93116 92334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13390 93973 93116 gene locus_tag LOCUS_13400 93973 93116 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_13400 95055 93982 gene locus_tag LOCUS_13410 gene potA 95055 93982 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948297.1 protein_id gnl|my_center|LOCUS_13410 95783 95950 gene locus_tag LOCUS_13420 95783 95950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 96178 95978 gene locus_tag LOCUS_13430 96178 95978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13430 96873 96484 gene locus_tag LOCUS_13440 96873 96484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 99047 97620 gene locus_tag LOCUS_13450 99047 97620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 99169 99408 gene locus_tag LOCUS_13460 99169 99408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence11 1226 303 gene locus_tag LOCUS_13470 1226 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1563 3161 gene locus_tag LOCUS_13480 1563 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 3330 3869 gene locus_tag LOCUS_13490 3330 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 4734 3979 gene locus_tag LOCUS_13500 4734 3979 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948384.1 protein_id gnl|my_center|LOCUS_13500 4858 5067 gene locus_tag LOCUS_13510 4858 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 5232 7445 gene locus_tag LOCUS_13520 5232 7445 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209617549.1 protein_id gnl|my_center|LOCUS_13520 7783 7947 gene locus_tag LOCUS_13530 7783 7947 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_13530 7990 8310 gene locus_tag LOCUS_13540 7990 8310 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393397.1 protein_id gnl|my_center|LOCUS_13540 9171 9644 gene locus_tag LOCUS_13550 9171 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 10219 10743 gene locus_tag LOCUS_13560 10219 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13560 10878 11705 gene locus_tag LOCUS_13570 10878 11705 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357212.1 protein_id gnl|my_center|LOCUS_13570 11806 12348 gene locus_tag LOCUS_13580 11806 12348 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_13580 12408 13574 gene locus_tag LOCUS_13590 12408 13574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 13850 14572 gene locus_tag LOCUS_13600 13850 14572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 14640 14867 gene locus_tag LOCUS_13610 14640 14867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 14885 15379 gene locus_tag LOCUS_13620 14885 15379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 15376 15969 gene locus_tag LOCUS_13630 15376 15969 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550094.1 protein_id gnl|my_center|LOCUS_13630 16499 17038 gene locus_tag LOCUS_13640 16499 17038 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965733.1 protein_id gnl|my_center|LOCUS_13640 17287 17862 gene locus_tag LOCUS_13650 17287 17862 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041926503.1 protein_id gnl|my_center|LOCUS_13650 17941 18099 gene locus_tag LOCUS_13660 17941 18099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 19970 18687 gene locus_tag LOCUS_13670 19970 18687 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939821.1 protein_id gnl|my_center|LOCUS_13670 21009 21395 gene locus_tag LOCUS_13680 21009 21395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047920.1 protein_id gnl|my_center|LOCUS_13680 21561 22583 gene locus_tag LOCUS_13690 gene mnmH 21561 22583 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861175.1 protein_id gnl|my_center|LOCUS_13690 22705 24660 gene locus_tag LOCUS_13700 22705 24660 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964935.1 protein_id gnl|my_center|LOCUS_13700 24738 27692 gene locus_tag LOCUS_13710 24738 27692 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964936.1 protein_id gnl|my_center|LOCUS_13710 28236 27769 gene locus_tag LOCUS_13720 28236 27769 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987051.1 protein_id gnl|my_center|LOCUS_13720 28399 29649 gene locus_tag LOCUS_13730 28399 29649 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964938.1 protein_id gnl|my_center|LOCUS_13730 29694 29957 gene locus_tag LOCUS_13740 29694 29957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 30385 30609 gene locus_tag LOCUS_13750 30385 30609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 31449 30871 gene locus_tag LOCUS_13760 31449 30871 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408018.1 protein_id gnl|my_center|LOCUS_13760 31636 32358 gene locus_tag LOCUS_13770 31636 32358 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948488.1 protein_id gnl|my_center|LOCUS_13770 32982 34319 gene locus_tag LOCUS_13780 32982 34319 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375121.1 protein_id gnl|my_center|LOCUS_13780 34337 36748 gene locus_tag LOCUS_13790 34337 36748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 37002 38822 gene locus_tag LOCUS_13800 37002 38822 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435847.1 protein_id gnl|my_center|LOCUS_13800 38813 39400 gene locus_tag LOCUS_13810 38813 39400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 39417 41180 gene locus_tag LOCUS_13820 gene recJ 39417 41180 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_13820 41928 41293 gene locus_tag LOCUS_13830 41928 41293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 42126 42584 gene locus_tag LOCUS_13840 42126 42584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 42635 42835 gene locus_tag LOCUS_13850 42635 42835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 42997 43809 gene locus_tag LOCUS_13860 42997 43809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 45010 44705 gene locus_tag LOCUS_13870 45010 44705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 45433 45170 gene locus_tag LOCUS_13880 45433 45170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 45977 45609 gene locus_tag LOCUS_13890 45977 45609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 46773 46000 gene locus_tag LOCUS_13900 46773 46000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 47391 48911 gene locus_tag LOCUS_13910 47391 48911 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070743.1 protein_id gnl|my_center|LOCUS_13910 48941 49201 gene locus_tag LOCUS_13920 48941 49201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 49221 50519 gene locus_tag LOCUS_13930 49221 50519 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162146334.1 protein_id gnl|my_center|LOCUS_13930 50535 51941 gene locus_tag LOCUS_13940 50535 51941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 51958 55146 gene locus_tag LOCUS_13950 51958 55146 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070740.1 protein_id gnl|my_center|LOCUS_13950 55224 55937 gene locus_tag LOCUS_13960 55224 55937 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_13960 56024 56764 gene locus_tag LOCUS_13970 56024 56764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 57244 57396 gene locus_tag LOCUS_13980 57244 57396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 57473 58009 gene locus_tag LOCUS_13990 57473 58009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 59114 58167 gene locus_tag LOCUS_14000 59114 58167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 59325 59083 gene locus_tag LOCUS_14010 59325 59083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 59638 59874 gene locus_tag LOCUS_14020 59638 59874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 60169 60471 gene locus_tag LOCUS_14030 60169 60471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 60776 62263 gene locus_tag LOCUS_14040 gene recJ 60776 62263 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987047.1 protein_id gnl|my_center|LOCUS_14040 62842 62660 gene locus_tag LOCUS_14050 62842 62660 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_14050 63282 63097 gene locus_tag LOCUS_14060 63282 63097 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_14060 63530 64603 gene locus_tag LOCUS_14070 63530 64603 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965529.1 protein_id gnl|my_center|LOCUS_14070 64784 66178 gene locus_tag LOCUS_14080 64784 66178 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_14080 66337 66762 gene locus_tag LOCUS_14090 66337 66762 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965747.1 protein_id gnl|my_center|LOCUS_14090 66937 70455 gene locus_tag LOCUS_14100 gene nifJ 66937 70455 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_14100 70704 71102 gene locus_tag LOCUS_14110 70704 71102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 71301 71945 gene locus_tag LOCUS_14120 71301 71945 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965525.1 protein_id gnl|my_center|LOCUS_14120 71973 72854 gene locus_tag LOCUS_14130 71973 72854 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987041.1 protein_id gnl|my_center|LOCUS_14130 72945 74975 gene locus_tag LOCUS_14140 72945 74975 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987038.1 protein_id gnl|my_center|LOCUS_14140 74987 75436 gene locus_tag LOCUS_14150 74987 75436 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987037.1 protein_id gnl|my_center|LOCUS_14150 75451 75939 gene locus_tag LOCUS_14160 75451 75939 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359122.1 protein_id gnl|my_center|LOCUS_14160 75971 76999 gene locus_tag LOCUS_14170 75971 76999 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987036.1 protein_id gnl|my_center|LOCUS_14170 77009 77773 gene locus_tag LOCUS_14180 77009 77773 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359187.1 protein_id gnl|my_center|LOCUS_14180 77806 79842 gene locus_tag LOCUS_14190 77806 79842 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987035.1 protein_id gnl|my_center|LOCUS_14190 79855 80454 gene locus_tag LOCUS_14200 79855 80454 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965517.1 protein_id gnl|my_center|LOCUS_14200 80470 80829 gene locus_tag LOCUS_14210 80470 80829 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965516.1 protein_id gnl|my_center|LOCUS_14210 80842 81243 gene locus_tag LOCUS_14220 80842 81243 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965515.1 protein_id gnl|my_center|LOCUS_14220 81301 82296 gene locus_tag LOCUS_14230 gene fliM 81301 82296 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987033.1 protein_id gnl|my_center|LOCUS_14230 82289 83461 gene locus_tag LOCUS_14240 gene fliY 82289 83461 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965513.1 protein_id gnl|my_center|LOCUS_14240 83687 83959 gene locus_tag LOCUS_14250 83687 83959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 83962 84372 gene locus_tag LOCUS_14260 83962 84372 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965511.1 protein_id gnl|my_center|LOCUS_14260 84394 86160 gene locus_tag LOCUS_14270 gene flgK 84394 86160 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987031.1 protein_id gnl|my_center|LOCUS_14270 86214 87479 gene locus_tag LOCUS_14280 gene flgL 86214 87479 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965509.1 protein_id gnl|my_center|LOCUS_14280 87581 88018 gene locus_tag LOCUS_14290 gene fliW 87581 88018 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987029.1 protein_id gnl|my_center|LOCUS_14290 88057 88272 gene locus_tag LOCUS_14300 gene csrA 88057 88272 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987028.1 protein_id gnl|my_center|LOCUS_14300 88289 88636 gene locus_tag LOCUS_14310 88289 88636 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987027.1 protein_id gnl|my_center|LOCUS_14310 88688 88978 gene locus_tag LOCUS_14320 88688 88978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987026.1 protein_id gnl|my_center|LOCUS_14320 88990 89385 gene locus_tag LOCUS_14330 gene fliS 88990 89385 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987025.1 protein_id gnl|my_center|LOCUS_14330 89404 91473 gene locus_tag LOCUS_14340 gene fliD 89404 91473 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987024.1 protein_id gnl|my_center|LOCUS_14340 91480 91869 gene locus_tag LOCUS_14350 91480 91869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 92060 92989 gene locus_tag LOCUS_14360 92060 92989 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965501.1 protein_id gnl|my_center|LOCUS_14360 93093 94037 gene locus_tag LOCUS_14370 93093 94037 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965501.1 protein_id gnl|my_center|LOCUS_14370 94144 95073 gene locus_tag LOCUS_14380 94144 95073 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965501.1 protein_id gnl|my_center|LOCUS_14380 95434 95240 gene locus_tag LOCUS_14390 95434 95240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 95908 95528 gene locus_tag LOCUS_14400 95908 95528 CDS product DUF6262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361059.1 protein_id gnl|my_center|LOCUS_14400 98012 95922 gene locus_tag LOCUS_14410 98012 95922 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026851.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence12 55 130 gene locus_tag LOCUS_t00200 55 130 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 146 229 gene locus_tag LOCUS_t00210 146 229 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 277 351 gene locus_tag LOCUS_t00220 277 351 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 357 430 gene locus_tag LOCUS_t00230 357 430 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 484 560 gene locus_tag LOCUS_t00240 484 560 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1315 734 gene locus_tag LOCUS_14420 1315 734 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_14420 1606 1319 gene locus_tag LOCUS_14430 1606 1319 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964646.1 protein_id gnl|my_center|LOCUS_14430 1860 1606 gene locus_tag LOCUS_14440 1860 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2142 1963 gene locus_tag LOCUS_14450 2142 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2215 3438 gene locus_tag LOCUS_14460 2215 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 7720 3533 gene locus_tag LOCUS_14470 7720 3533 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963675.1 protein_id gnl|my_center|LOCUS_14470 8451 8023 gene locus_tag LOCUS_14480 8451 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 8819 9745 gene locus_tag LOCUS_14490 gene pyrB 8819 9745 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_14490 9745 10179 gene locus_tag LOCUS_14500 9745 10179 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_14500 10326 11522 gene locus_tag LOCUS_14510 10326 11522 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048209.1 protein_id gnl|my_center|LOCUS_14510 11582 12445 gene locus_tag LOCUS_14520 gene pyrF 11582 12445 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965940.1 protein_id gnl|my_center|LOCUS_14520 12565 13299 gene locus_tag LOCUS_14530 12565 13299 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965939.1 protein_id gnl|my_center|LOCUS_14530 13292 14188 gene locus_tag LOCUS_14540 13292 14188 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965938.1 protein_id gnl|my_center|LOCUS_14540 14301 14867 gene locus_tag LOCUS_14550 gene pyrE 14301 14867 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361660.1 protein_id gnl|my_center|LOCUS_14550 15555 15205 gene locus_tag LOCUS_14560 15555 15205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001999997.1 protein_id gnl|my_center|LOCUS_14560 15939 16259 gene locus_tag LOCUS_14570 15939 16259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 16261 16467 gene locus_tag LOCUS_14580 16261 16467 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860795.1 protein_id gnl|my_center|LOCUS_14580 16965 16675 gene locus_tag LOCUS_14590 16965 16675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 17248 17057 gene locus_tag LOCUS_14600 17248 17057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 18369 17620 gene locus_tag LOCUS_14610 gene pflA 18369 17620 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048195.1 protein_id gnl|my_center|LOCUS_14610 20809 18581 gene locus_tag LOCUS_14620 gene pflB 20809 18581 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964298.1 protein_id gnl|my_center|LOCUS_14620 21220 22044 gene locus_tag LOCUS_14630 21220 22044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048206.1 protein_id gnl|my_center|LOCUS_14630 22061 22858 gene locus_tag LOCUS_14640 22061 22858 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048205.1 protein_id gnl|my_center|LOCUS_14640 23123 24415 gene locus_tag LOCUS_14650 gene tig 23123 24415 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048204.1 protein_id gnl|my_center|LOCUS_14650 24577 25161 gene locus_tag LOCUS_14660 gene clpP 24577 25161 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_14660 25196 26488 gene locus_tag LOCUS_14670 gene clpX 25196 26488 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_14670 26788 28470 gene locus_tag LOCUS_14680 gene lonB 26788 28470 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357503.1 protein_id gnl|my_center|LOCUS_14680 28867 31224 gene locus_tag LOCUS_14690 gene lon 28867 31224 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357593.1 protein_id gnl|my_center|LOCUS_14690 31205 31807 gene locus_tag LOCUS_14700 gene yihA 31205 31807 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045119.1 protein_id gnl|my_center|LOCUS_14700 32063 32443 gene locus_tag LOCUS_14710 32063 32443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 32552 32788 gene locus_tag LOCUS_14720 32552 32788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 32843 33742 gene locus_tag LOCUS_14730 32843 33742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 34252 33848 gene locus_tag LOCUS_14740 34252 33848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 35601 34588 gene locus_tag LOCUS_14750 35601 34588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965923.1 protein_id gnl|my_center|LOCUS_14750 35715 36962 gene locus_tag LOCUS_14760 35715 36962 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357289.1 protein_id gnl|my_center|LOCUS_14760 37432 37022 gene locus_tag LOCUS_14770 37432 37022 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965922.1 protein_id gnl|my_center|LOCUS_14770 37609 38985 gene locus_tag LOCUS_14780 37609 38985 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948237.1 protein_id gnl|my_center|LOCUS_14780 39152 40183 gene locus_tag LOCUS_14790 39152 40183 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948238.1 protein_id gnl|my_center|LOCUS_14790 40214 41242 gene locus_tag LOCUS_14800 40214 41242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356452.1 protein_id gnl|my_center|LOCUS_14800 41718 42371 gene locus_tag LOCUS_14810 41718 42371 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965916.1 protein_id gnl|my_center|LOCUS_14810 42534 42680 gene locus_tag LOCUS_14820 42534 42680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 42784 43449 gene locus_tag LOCUS_14830 gene trmB 42784 43449 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355768.1 protein_id gnl|my_center|LOCUS_14830 43781 44956 gene locus_tag LOCUS_14840 43781 44956 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964900.1 protein_id gnl|my_center|LOCUS_14840 45018 45899 gene locus_tag LOCUS_14850 45018 45899 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409939.1 protein_id gnl|my_center|LOCUS_14850 46535 48094 gene locus_tag LOCUS_14860 46535 48094 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948601.1 protein_id gnl|my_center|LOCUS_14860 48290 48448 gene locus_tag LOCUS_14870 48290 48448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 48484 49452 gene locus_tag LOCUS_14880 gene cbiB 48484 49452 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963902.1 protein_id gnl|my_center|LOCUS_14880 49813 50727 gene locus_tag LOCUS_14890 49813 50727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 52560 51475 gene locus_tag LOCUS_14900 gene asd 52560 51475 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963889.1 protein_id gnl|my_center|LOCUS_14900 52839 53657 gene locus_tag LOCUS_14910 gene speD 52839 53657 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101641.1 protein_id gnl|my_center|LOCUS_14910 53901 55205 gene locus_tag LOCUS_14920 gene murA 53901 55205 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413260.1 protein_id gnl|my_center|LOCUS_14920 55306 55653 gene locus_tag LOCUS_14930 55306 55653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 55701 55835 gene locus_tag LOCUS_14940 55701 55835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 56197 57351 gene locus_tag LOCUS_14950 56197 57351 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_14950 57369 58481 gene locus_tag LOCUS_14960 gene glgD 57369 58481 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_14960 58506 59939 gene locus_tag LOCUS_14970 gene glgA 58506 59939 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_14970 60009 62441 gene locus_tag LOCUS_14980 60009 62441 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964971.1 protein_id gnl|my_center|LOCUS_14980 62969 63544 gene locus_tag LOCUS_14990 62969 63544 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948791.1 protein_id gnl|my_center|LOCUS_14990 63852 64883 gene locus_tag LOCUS_15000 gene rpsA 63852 64883 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986222.1 protein_id gnl|my_center|LOCUS_15000 65771 64992 gene locus_tag LOCUS_15010 65771 64992 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862006.1 protein_id gnl|my_center|LOCUS_15010 66081 66314 gene locus_tag LOCUS_15020 66081 66314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 66487 67563 gene locus_tag LOCUS_15030 gene cobT 66487 67563 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_15030 67560 68153 gene locus_tag LOCUS_15040 gene cobC 67560 68153 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948519.1 protein_id gnl|my_center|LOCUS_15040 68295 69083 gene locus_tag LOCUS_15050 gene cobS 68295 69083 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948521.1 protein_id gnl|my_center|LOCUS_15050 69260 70381 gene locus_tag LOCUS_15060 69260 70381 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948603.1 protein_id gnl|my_center|LOCUS_15060 70438 71763 gene locus_tag LOCUS_15070 70438 71763 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948610.1 protein_id gnl|my_center|LOCUS_15070 71969 72196 gene locus_tag LOCUS_15080 71969 72196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 72483 74876 gene locus_tag LOCUS_15090 72483 74876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 75389 76237 gene locus_tag LOCUS_15100 75389 76237 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356136.1 protein_id gnl|my_center|LOCUS_15100 76244 76699 gene locus_tag LOCUS_15110 76244 76699 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964267.1 protein_id gnl|my_center|LOCUS_15110 76985 77137 gene locus_tag LOCUS_15120 76985 77137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 77635 77255 gene locus_tag LOCUS_15130 77635 77255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 77669 77944 gene locus_tag LOCUS_15140 77669 77944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15140 78160 79113 gene locus_tag LOCUS_15150 78160 79113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15150 79097 79438 gene locus_tag LOCUS_15160 79097 79438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15160 80700 79675 gene locus_tag LOCUS_15170 80700 79675 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_15170 81735 81049 gene locus_tag LOCUS_15180 81735 81049 CDS product DUF4397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986895.1 protein_id gnl|my_center|LOCUS_15180 82347 83339 gene locus_tag LOCUS_15190 82347 83339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 83573 87493 gene locus_tag LOCUS_15200 83573 87493 CDS product cell wall-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461026.1 protein_id gnl|my_center|LOCUS_15200 87574 90138 gene locus_tag LOCUS_15210 87574 90138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 90771 91370 gene locus_tag LOCUS_15220 90771 91370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 91372 91725 gene locus_tag LOCUS_15230 91372 91725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 91728 92633 gene locus_tag LOCUS_15240 91728 92633 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049808538.1 protein_id gnl|my_center|LOCUS_15240 92825 92971 gene locus_tag LOCUS_15250 92825 92971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 93109 93486 gene locus_tag LOCUS_15260 93109 93486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 93564 93941 gene locus_tag LOCUS_15270 93564 93941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 93917 94453 gene locus_tag LOCUS_15280 93917 94453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 94472 94783 gene locus_tag LOCUS_15290 94472 94783 CDS product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296262.1 protein_id gnl|my_center|LOCUS_15290 94801 95151 gene locus_tag LOCUS_15300 94801 95151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 95901 95362 gene locus_tag LOCUS_15310 95901 95362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 96349 95894 gene locus_tag LOCUS_15320 96349 95894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 97159 97773 gene locus_tag LOCUS_15330 97159 97773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 98080 98928 gene locus_tag LOCUS_15340 98080 98928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 99002 100816 gene locus_tag LOCUS_15350 99002 100816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 101063 101302 gene locus_tag LOCUS_15360 101063 101302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 101641 102504 gene locus_tag LOCUS_15370 gene xerD 101641 102504 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700300.1 protein_id gnl|my_center|LOCUS_15370 102525 103310 gene locus_tag LOCUS_15380 102525 103310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 103525 103698 gene locus_tag LOCUS_15390 103525 103698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 103695 104069 gene locus_tag LOCUS_15400 103695 104069 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_15400 104310 106304 gene locus_tag LOCUS_15410 104310 106304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 107006 107359 gene locus_tag LOCUS_15420 107006 107359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 107507 108634 gene locus_tag LOCUS_15430 107507 108634 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868132.1 protein_id gnl|my_center|LOCUS_15430 108635 110596 gene locus_tag LOCUS_15440 108635 110596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 110596 110970 gene locus_tag LOCUS_15450 110596 110970 CDS product DUF6262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361059.1 protein_id gnl|my_center|LOCUS_15450 110989 111153 gene locus_tag LOCUS_15460 110989 111153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 111259 112164 gene locus_tag LOCUS_15470 111259 112164 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049808538.1 protein_id gnl|my_center|LOCUS_15470 112257 113102 gene locus_tag LOCUS_15480 112257 113102 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809044.1 protein_id gnl|my_center|LOCUS_15480 113292 113438 gene locus_tag LOCUS_15490 113292 113438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 113566 113934 gene locus_tag LOCUS_15500 113566 113934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 113910 114449 gene locus_tag LOCUS_15510 113910 114449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 114641 115858 gene locus_tag LOCUS_15520 114641 115858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 116588 119398 gene locus_tag LOCUS_15530 116588 119398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 119675 119857 gene locus_tag LOCUS_15540 119675 119857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 120241 120879 gene locus_tag LOCUS_15550 120241 120879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 121547 121744 gene locus_tag LOCUS_15560 121547 121744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 122498 121980 gene locus_tag LOCUS_15570 122498 121980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 122702 123895 gene locus_tag LOCUS_15580 122702 123895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 124049 125362 gene locus_tag LOCUS_15590 124049 125362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 125422 126738 gene locus_tag LOCUS_15600 125422 126738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 126756 126905 gene locus_tag LOCUS_15610 126756 126905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 127551 128426 gene locus_tag LOCUS_15620 127551 128426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 128460 131066 gene locus_tag LOCUS_15630 128460 131066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 131297 131665 gene locus_tag LOCUS_15640 131297 131665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 131715 131909 gene locus_tag LOCUS_15650 131715 131909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 133215 135110 gene locus_tag LOCUS_15660 133215 135110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 135320 135940 gene locus_tag LOCUS_15670 135320 135940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 137414 136098 gene locus_tag LOCUS_15680 137414 136098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 137788 140265 gene locus_tag LOCUS_15690 137788 140265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 140519 140812 gene locus_tag LOCUS_15700 140519 140812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 140881 141132 gene locus_tag LOCUS_15710 140881 141132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 141250 142056 gene locus_tag LOCUS_15720 141250 142056 CDS product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948162.1 protein_id gnl|my_center|LOCUS_15720 142987 142577 gene locus_tag LOCUS_15730 142987 142577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 143601 145598 gene locus_tag LOCUS_15740 143601 145598 CDS product cell wall-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272538.1 protein_id gnl|my_center|LOCUS_15740 145757 146371 gene locus_tag LOCUS_15750 145757 146371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 146736 147812 gene locus_tag LOCUS_15760 146736 147812 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963600.1 protein_id gnl|my_center|LOCUS_15760 148543 147953 gene locus_tag LOCUS_15770 148543 147953 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948455.1 protein_id gnl|my_center|LOCUS_15770 148930 149382 gene locus_tag LOCUS_15780 148930 149382 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137628160.1 protein_id gnl|my_center|LOCUS_15780 149406 149849 gene locus_tag LOCUS_15790 149406 149849 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010708068.1 protein_id gnl|my_center|LOCUS_15790 150028 150246 gene locus_tag LOCUS_15800 150028 150246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 150482 151495 gene locus_tag LOCUS_15810 150482 151495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 151971 152141 gene locus_tag LOCUS_15820 151971 152141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 152138 152578 gene locus_tag LOCUS_15830 152138 152578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15830 152878 153024 gene locus_tag LOCUS_15840 152878 153024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 153030 153521 gene locus_tag LOCUS_15850 153030 153521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 153664 155454 gene locus_tag LOCUS_15860 153664 155454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 155451 156629 gene locus_tag LOCUS_15870 155451 156629 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963643.1 protein_id gnl|my_center|LOCUS_15870 156692 158170 gene locus_tag LOCUS_15880 156692 158170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 158350 158910 gene locus_tag LOCUS_15890 158350 158910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 159047 159751 gene locus_tag LOCUS_15900 159047 159751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816854.1 protein_id gnl|my_center|LOCUS_15900 159757 162075 gene locus_tag LOCUS_15910 gene mubY 159757 162075 CDS product mutanobactin A system ABC transporter permease subunit MubY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002282912.1 protein_id gnl|my_center|LOCUS_15910 162187 163713 gene locus_tag LOCUS_15920 162187 163713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 163789 165552 gene locus_tag LOCUS_15930 163789 165552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 165723 166553 gene locus_tag LOCUS_15940 165723 166553 CDS product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948162.1 protein_id gnl|my_center|LOCUS_15940 166815 170216 gene locus_tag LOCUS_15950 166815 170216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 170366 170857 gene locus_tag LOCUS_15960 170366 170857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 172422 170971 gene locus_tag LOCUS_15970 172422 170971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 173702 172761 gene locus_tag LOCUS_15980 173702 172761 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384427.1 protein_id gnl|my_center|LOCUS_15980 173922 174470 gene locus_tag LOCUS_15990 173922 174470 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964268.1 protein_id gnl|my_center|LOCUS_15990 174488 175948 gene locus_tag LOCUS_16000 gene pepD 174488 175948 CDS product beta-Ala-His dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287514.1 protein_id gnl|my_center|LOCUS_16000 176142 176576 gene locus_tag LOCUS_16010 176142 176576 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964269.1 protein_id gnl|my_center|LOCUS_16010 176592 176990 gene locus_tag LOCUS_16020 176592 176990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964271.1 protein_id gnl|my_center|LOCUS_16020 177136 178194 gene locus_tag LOCUS_16030 177136 178194 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948166.1 protein_id gnl|my_center|LOCUS_16030 178244 179248 gene locus_tag LOCUS_16040 178244 179248 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948167.1 protein_id gnl|my_center|LOCUS_16040 181202 179442 gene locus_tag LOCUS_16050 gene ftsH 181202 179442 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948169.1 protein_id gnl|my_center|LOCUS_16050 181626 182612 gene locus_tag LOCUS_16060 181626 182612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 182674 182850 gene locus_tag LOCUS_16070 182674 182850 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964274.1 protein_id gnl|my_center|LOCUS_16070 183057 184355 gene locus_tag LOCUS_16080 183057 184355 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948172.1 protein_id gnl|my_center|LOCUS_16080 184423 185715 gene locus_tag LOCUS_16090 184423 185715 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948173.1 protein_id gnl|my_center|LOCUS_16090 186568 185843 gene locus_tag LOCUS_16100 186568 185843 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964279.1 protein_id gnl|my_center|LOCUS_16100 187914 186610 gene locus_tag LOCUS_16110 187914 186610 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948178.1 protein_id gnl|my_center|LOCUS_16110 189367 188159 gene locus_tag LOCUS_16120 189367 188159 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_16120 189601 190458 gene locus_tag LOCUS_16130 189601 190458 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459274.1 protein_id gnl|my_center|LOCUS_16130 190918 192495 gene locus_tag LOCUS_16140 gene pckA 190918 192495 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_16140 192710 193822 gene locus_tag LOCUS_16150 192710 193822 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948180.1 protein_id gnl|my_center|LOCUS_16150 193923 194750 gene locus_tag LOCUS_16160 193923 194750 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357212.1 protein_id gnl|my_center|LOCUS_16160 195003 196100 gene locus_tag LOCUS_16170 195003 196100 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_16170 196193 196975 gene locus_tag LOCUS_16180 196193 196975 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963514.1 protein_id gnl|my_center|LOCUS_16180 198221 197334 gene locus_tag LOCUS_16190 198221 197334 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948181.1 protein_id gnl|my_center|LOCUS_16190 198401 199159 gene locus_tag LOCUS_16200 198401 199159 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_16200 200673 199225 gene locus_tag LOCUS_16210 200673 199225 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966919.1 protein_id gnl|my_center|LOCUS_16210 201135 200827 gene locus_tag LOCUS_16220 201135 200827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 201193 201633 gene locus_tag LOCUS_16230 201193 201633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964287.1 protein_id gnl|my_center|LOCUS_16230 202061 201840 gene locus_tag LOCUS_16240 202061 201840 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964294.1 protein_id gnl|my_center|LOCUS_16240 202584 202201 gene locus_tag LOCUS_16250 202584 202201 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948189.1 protein_id gnl|my_center|LOCUS_16250 203500 202652 gene locus_tag LOCUS_16260 gene panC 203500 202652 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_16260 204390 203563 gene locus_tag LOCUS_16270 gene panB 204390 203563 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356105.1 protein_id gnl|my_center|LOCUS_16270 205245 204394 gene locus_tag LOCUS_16280 205245 204394 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002349114.1 protein_id gnl|my_center|LOCUS_16280 205541 205924 gene locus_tag LOCUS_16290 205541 205924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948271.1 protein_id gnl|my_center|LOCUS_16290 206278 206661 gene locus_tag LOCUS_16300 206278 206661 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184510.1 protein_id gnl|my_center|LOCUS_16300 206674 208533 gene locus_tag LOCUS_16310 206674 208533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 208631 209629 gene locus_tag LOCUS_16320 208631 209629 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948238.1 protein_id gnl|my_center|LOCUS_16320 209675 210703 gene locus_tag LOCUS_16330 209675 210703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356452.1 protein_id gnl|my_center|LOCUS_16330 213948 210916 gene locus_tag LOCUS_16340 213948 210916 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964365.1 protein_id gnl|my_center|LOCUS_16340 214437 214943 gene locus_tag LOCUS_16350 214437 214943 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964366.1 protein_id gnl|my_center|LOCUS_16350 215057 217000 gene locus_tag LOCUS_16360 215057 217000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 217166 217663 gene locus_tag LOCUS_16370 217166 217663 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047967.1 protein_id gnl|my_center|LOCUS_16370 217686 218525 gene locus_tag LOCUS_16380 217686 218525 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964943.1 protein_id gnl|my_center|LOCUS_16380 221471 218808 gene locus_tag LOCUS_16390 221471 218808 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_16390 222147 221611 gene locus_tag LOCUS_16400 222147 221611 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_16400 222684 222148 gene locus_tag LOCUS_16410 222684 222148 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_16410 223199 223621 gene locus_tag LOCUS_16420 223199 223621 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964367.1 protein_id gnl|my_center|LOCUS_16420 225870 223960 gene locus_tag LOCUS_16430 225870 223960 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964368.1 protein_id gnl|my_center|LOCUS_16430 226320 226748 gene locus_tag LOCUS_16440 226320 226748 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964369.1 protein_id gnl|my_center|LOCUS_16440 226781 227806 gene locus_tag LOCUS_16450 226781 227806 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948281.1 protein_id gnl|my_center|LOCUS_16450 228468 227851 gene locus_tag LOCUS_16460 228468 227851 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048167.1 protein_id gnl|my_center|LOCUS_16460 228770 231103 gene locus_tag LOCUS_16470 228770 231103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 231747 232679 gene locus_tag LOCUS_16480 231747 232679 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_16480 232985 234478 gene locus_tag LOCUS_16490 232985 234478 CDS product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099547.1 protein_id gnl|my_center|LOCUS_16490 234471 235307 gene locus_tag LOCUS_16500 234471 235307 CDS product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099548.1 protein_id gnl|my_center|LOCUS_16500 235418 237217 gene locus_tag LOCUS_16510 gene pepF 235418 237217 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003348.1 protein_id gnl|my_center|LOCUS_16510 237623 237781 gene locus_tag LOCUS_16520 237623 237781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 239610 238273 gene locus_tag LOCUS_16530 239610 238273 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948975.1 protein_id gnl|my_center|LOCUS_16530 240496 241248 gene locus_tag LOCUS_16540 gene surE 240496 241248 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948033.1 protein_id gnl|my_center|LOCUS_16540 241501 242361 gene locus_tag LOCUS_16550 241501 242361 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964909.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence13 285 85 gene locus_tag LOCUS_16560 285 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 706 302 gene locus_tag LOCUS_16570 gene tnpA 706 302 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439244.1 protein_id gnl|my_center|LOCUS_16570 906 706 gene locus_tag LOCUS_16580 906 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1280 1104 gene locus_tag LOCUS_16590 1280 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 1699 1376 gene locus_tag LOCUS_16600 1699 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 3460 2321 gene locus_tag LOCUS_16610 3460 2321 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949044.1 protein_id gnl|my_center|LOCUS_16610 5017 3734 gene locus_tag LOCUS_16620 gene uraA 5017 3734 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949042.1 protein_id gnl|my_center|LOCUS_16620 5648 5112 gene locus_tag LOCUS_16630 gene pyrR 5648 5112 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965412.1 protein_id gnl|my_center|LOCUS_16630 6744 5827 gene locus_tag LOCUS_16640 6744 5827 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_16640 7191 6745 gene locus_tag LOCUS_16650 gene lspA 7191 6745 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358651.1 protein_id gnl|my_center|LOCUS_16650 7941 7336 gene locus_tag LOCUS_16660 7941 7336 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949040.1 protein_id gnl|my_center|LOCUS_16660 8856 8050 gene locus_tag LOCUS_16670 gene aroF 8856 8050 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358658.1 protein_id gnl|my_center|LOCUS_16670 9560 8868 gene locus_tag LOCUS_16680 9560 8868 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965416.1 protein_id gnl|my_center|LOCUS_16680 10307 9684 gene locus_tag LOCUS_16690 10307 9684 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965417.1 protein_id gnl|my_center|LOCUS_16690 11095 10322 gene locus_tag LOCUS_16700 11095 10322 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358628.1 protein_id gnl|my_center|LOCUS_16700 11376 11116 gene locus_tag LOCUS_16710 11376 11116 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358762.1 protein_id gnl|my_center|LOCUS_16710 11896 11447 gene locus_tag LOCUS_16720 11896 11447 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965419.1 protein_id gnl|my_center|LOCUS_16720 12570 11911 gene locus_tag LOCUS_16730 12570 11911 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965420.1 protein_id gnl|my_center|LOCUS_16730 13438 12725 gene locus_tag LOCUS_16740 13438 12725 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360696.1 protein_id gnl|my_center|LOCUS_16740 13789 13451 gene locus_tag LOCUS_16750 13789 13451 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358761.1 protein_id gnl|my_center|LOCUS_16750 14519 13800 gene locus_tag LOCUS_16760 14519 13800 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358811.1 protein_id gnl|my_center|LOCUS_16760 15377 14565 gene locus_tag LOCUS_16770 15377 14565 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949038.1 protein_id gnl|my_center|LOCUS_16770 16733 15621 gene locus_tag LOCUS_16780 gene spoVE 16733 15621 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_16780 17706 16753 gene locus_tag LOCUS_16790 gene mraY 17706 16753 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_16790 19247 17703 gene locus_tag LOCUS_16800 19247 17703 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_16800 20693 19248 gene locus_tag LOCUS_16810 20693 19248 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_16810 23145 20956 gene locus_tag LOCUS_16820 23145 20956 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949034.1 protein_id gnl|my_center|LOCUS_16820 23704 23219 gene locus_tag LOCUS_16830 23704 23219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 24664 23732 gene locus_tag LOCUS_16840 gene rsmH 24664 23732 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_16840 25157 24729 gene locus_tag LOCUS_16850 gene mraZ 25157 24729 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965432.1 protein_id gnl|my_center|LOCUS_16850 25466 26563 gene locus_tag LOCUS_16860 gene ychF 25466 26563 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949032.1 protein_id gnl|my_center|LOCUS_16860 28927 26633 gene locus_tag LOCUS_16870 28927 26633 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949023.1 protein_id gnl|my_center|LOCUS_16870 29178 29612 gene locus_tag LOCUS_16880 29178 29612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358659.1 protein_id gnl|my_center|LOCUS_16880 32477 29874 gene locus_tag LOCUS_16890 32477 29874 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986942.1 protein_id gnl|my_center|LOCUS_16890 32708 34351 gene locus_tag LOCUS_16900 32708 34351 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_16900 35468 34683 gene locus_tag LOCUS_16910 35468 34683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 35633 36763 gene locus_tag LOCUS_16920 35633 36763 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476549.1 protein_id gnl|my_center|LOCUS_16920 38060 37263 gene locus_tag LOCUS_16930 38060 37263 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359153.1 protein_id gnl|my_center|LOCUS_16930 38868 38086 gene locus_tag LOCUS_16940 38868 38086 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986945.1 protein_id gnl|my_center|LOCUS_16940 39029 38865 gene locus_tag LOCUS_16950 39029 38865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 39586 39065 gene locus_tag LOCUS_16960 39586 39065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965441.1 protein_id gnl|my_center|LOCUS_16960 40339 39611 gene locus_tag LOCUS_16970 40339 39611 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965442.1 protein_id gnl|my_center|LOCUS_16970 40996 40352 gene locus_tag LOCUS_16980 40996 40352 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965443.1 protein_id gnl|my_center|LOCUS_16980 41872 41009 gene locus_tag LOCUS_16990 41872 41009 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965444.1 protein_id gnl|my_center|LOCUS_16990 43149 41866 gene locus_tag LOCUS_17000 gene flhF 43149 41866 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 protein_id gnl|my_center|LOCUS_17000 45212 43149 gene locus_tag LOCUS_17010 gene flhA 45212 43149 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359159.1 protein_id gnl|my_center|LOCUS_17010 47063 45231 gene locus_tag LOCUS_17020 47063 45231 CDS product fused FliR family export protein/FlhB family type III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986950.1 protein_id gnl|my_center|LOCUS_17020 47344 47075 gene locus_tag LOCUS_17030 gene fliQ 47344 47075 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359192.1 protein_id gnl|my_center|LOCUS_17030 48185 47355 gene locus_tag LOCUS_17040 gene fliP 48185 47355 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359303.1 protein_id gnl|my_center|LOCUS_17040 48573 48169 gene locus_tag LOCUS_17050 gene fliO 48573 48169 CDS product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986951.1 protein_id gnl|my_center|LOCUS_17050 49043 48585 gene locus_tag LOCUS_17060 49043 48585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 49774 49040 gene locus_tag LOCUS_17070 49774 49040 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986952.1 protein_id gnl|my_center|LOCUS_17070 50579 49767 gene locus_tag LOCUS_17080 50579 49767 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986953.1 protein_id gnl|my_center|LOCUS_17080 50782 50591 gene locus_tag LOCUS_17090 50782 50591 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359200.1 protein_id gnl|my_center|LOCUS_17090 51927 50950 gene locus_tag LOCUS_17100 51927 50950 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986954.1 protein_id gnl|my_center|LOCUS_17100 52465 52043 gene locus_tag LOCUS_17110 52465 52043 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965454.1 protein_id gnl|my_center|LOCUS_17110 53247 52504 gene locus_tag LOCUS_17120 53247 52504 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986956.1 protein_id gnl|my_center|LOCUS_17120 54818 53295 gene locus_tag LOCUS_17130 54818 53295 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986957.1 protein_id gnl|my_center|LOCUS_17130 55270 54824 gene locus_tag LOCUS_17140 gene fliJ 55270 54824 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986958.1 protein_id gnl|my_center|LOCUS_17140 56651 55344 gene locus_tag LOCUS_17150 gene fliI 56651 55344 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047906.1 protein_id gnl|my_center|LOCUS_17150 57420 56674 gene locus_tag LOCUS_17160 57420 56674 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965459.1 protein_id gnl|my_center|LOCUS_17160 58420 57404 gene locus_tag LOCUS_17170 gene fliG 58420 57404 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359190.1 protein_id gnl|my_center|LOCUS_17170 59980 58424 gene locus_tag LOCUS_17180 gene fliF 59980 58424 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986960.1 protein_id gnl|my_center|LOCUS_17180 60295 59996 gene locus_tag LOCUS_17190 gene fliE 60295 59996 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986961.1 protein_id gnl|my_center|LOCUS_17190 60741 60307 gene locus_tag LOCUS_17200 gene flgC 60741 60307 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986962.1 protein_id gnl|my_center|LOCUS_17200 61152 60748 gene locus_tag LOCUS_17210 gene flgB 61152 60748 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361361.1 protein_id gnl|my_center|LOCUS_17210 62474 61632 gene locus_tag LOCUS_17220 62474 61632 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986963.1 protein_id gnl|my_center|LOCUS_17220 62684 64768 gene locus_tag LOCUS_17230 62684 64768 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948168.1 protein_id gnl|my_center|LOCUS_17230 65321 64890 gene locus_tag LOCUS_17240 65321 64890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 65711 65574 gene locus_tag LOCUS_17250 65711 65574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 66094 65843 gene locus_tag LOCUS_17260 66094 65843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 66275 66096 gene locus_tag LOCUS_17270 66275 66096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 66706 66380 gene locus_tag LOCUS_17280 66706 66380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 67216 66845 gene locus_tag LOCUS_17290 67216 66845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 67817 67431 gene locus_tag LOCUS_17300 67817 67431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 68914 68192 gene locus_tag LOCUS_17310 68914 68192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 69330 69193 gene locus_tag LOCUS_17320 69330 69193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 71327 69861 gene locus_tag LOCUS_17330 71327 69861 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_17330 72309 72881 gene locus_tag LOCUS_17340 72309 72881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17340 74136 73090 gene locus_tag LOCUS_17350 74136 73090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 75227 74130 gene locus_tag LOCUS_17360 gene per 75227 74130 CDS product GDP-perosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918896.1 protein_id gnl|my_center|LOCUS_17360 76315 75332 gene locus_tag LOCUS_17370 76315 75332 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432947.1 protein_id gnl|my_center|LOCUS_17370 76474 76340 gene locus_tag LOCUS_17380 76474 76340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 77657 76653 gene locus_tag LOCUS_17390 77657 76653 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 protein_id gnl|my_center|LOCUS_17390 78974 77691 gene locus_tag LOCUS_17400 78974 77691 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208594.1 protein_id gnl|my_center|LOCUS_17400 80328 79000 gene locus_tag LOCUS_17410 gene rfbH 80328 79000 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_17410 81421 80330 gene locus_tag LOCUS_17420 gene rfbG 81421 80330 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167723.1 protein_id gnl|my_center|LOCUS_17420 82536 81538 gene locus_tag LOCUS_17430 82536 81538 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868717.1 protein_id gnl|my_center|LOCUS_17430 83112 82567 gene locus_tag LOCUS_17440 83112 82567 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167727.1 protein_id gnl|my_center|LOCUS_17440 83867 83094 gene locus_tag LOCUS_17450 gene rfbF 83867 83094 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_17450 85136 83901 gene locus_tag LOCUS_17460 85136 83901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 86196 85204 gene locus_tag LOCUS_17470 86196 85204 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600889.1 protein_id gnl|my_center|LOCUS_17470 87261 86230 gene locus_tag LOCUS_17480 87261 86230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 87969 87301 gene locus_tag LOCUS_17490 87969 87301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 89050 87956 gene locus_tag LOCUS_17500 89050 87956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 90039 89035 gene locus_tag LOCUS_17510 gene neuB 90039 89035 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_17510 91195 90044 gene locus_tag LOCUS_17520 gene neuC 91195 90044 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 protein_id gnl|my_center|LOCUS_17520 91895 91188 gene locus_tag LOCUS_17530 91895 91188 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_17530 92970 91888 gene locus_tag LOCUS_17540 92970 91888 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_17540 94829 93012 gene locus_tag LOCUS_17550 94829 93012 CDS product motility associated factor glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965494.1 protein_id gnl|my_center|LOCUS_17550 95102 94842 gene locus_tag LOCUS_17560 95102 94842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 95758 95297 gene locus_tag LOCUS_17570 95758 95297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 97089 96109 gene locus_tag LOCUS_17580 97089 96109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 97334 98347 gene locus_tag LOCUS_17590 97334 98347 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706213.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence14 586 771 gene locus_tag LOCUS_17600 586 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 788 1108 gene locus_tag LOCUS_17610 788 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17610 1066 1260 gene locus_tag LOCUS_17620 1066 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1475 2617 gene locus_tag LOCUS_17630 1475 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 2799 3668 gene locus_tag LOCUS_17640 2799 3668 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_17640 3974 4171 gene locus_tag LOCUS_17650 3974 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 4567 6336 gene locus_tag LOCUS_17660 gene thrS 4567 6336 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_17660 6619 6461 gene locus_tag LOCUS_17670 6619 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 6977 7894 gene locus_tag LOCUS_17680 6977 7894 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966649.1 protein_id gnl|my_center|LOCUS_17680 9305 8040 gene locus_tag LOCUS_17690 9305 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440269.1 protein_id gnl|my_center|LOCUS_17690 9804 9427 gene locus_tag LOCUS_17700 9804 9427 CDS product HsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986720.1 protein_id gnl|my_center|LOCUS_17700 10476 9940 gene locus_tag LOCUS_17710 10476 9940 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913614.1 protein_id gnl|my_center|LOCUS_17710 10802 12520 gene locus_tag LOCUS_17720 10802 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 12586 13911 gene locus_tag LOCUS_17730 12586 13911 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986425.1 protein_id gnl|my_center|LOCUS_17730 14004 14696 gene locus_tag LOCUS_17740 14004 14696 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949146.1 protein_id gnl|my_center|LOCUS_17740 14686 16149 gene locus_tag LOCUS_17750 14686 16149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 16142 17368 gene locus_tag LOCUS_17760 16142 17368 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17760 17431 17697 gene locus_tag LOCUS_17770 17431 17697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17770 18149 18430 gene locus_tag LOCUS_17780 18149 18430 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047972.1 protein_id gnl|my_center|LOCUS_17780 18545 19081 gene locus_tag LOCUS_17790 18545 19081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680759.1 protein_id gnl|my_center|LOCUS_17790 19167 20531 gene locus_tag LOCUS_17800 19167 20531 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_17800 20915 20619 gene locus_tag LOCUS_17810 20915 20619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 21072 21863 gene locus_tag LOCUS_17820 gene murI 21072 21863 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048400.1 protein_id gnl|my_center|LOCUS_17820 22001 22441 gene locus_tag LOCUS_17830 22001 22441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 22587 23102 gene locus_tag LOCUS_17840 22587 23102 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_17840 23156 23530 gene locus_tag LOCUS_17850 23156 23530 CDS product DUF3783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048398.1 protein_id gnl|my_center|LOCUS_17850 23672 24337 gene locus_tag LOCUS_17860 23672 24337 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048397.1 protein_id gnl|my_center|LOCUS_17860 24516 26315 gene locus_tag LOCUS_17870 24516 26315 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048396.1 protein_id gnl|my_center|LOCUS_17870 26346 27011 gene locus_tag LOCUS_17880 26346 27011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 28031 27093 gene locus_tag LOCUS_17890 28031 27093 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_17890 29317 28244 gene locus_tag LOCUS_17900 29317 28244 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359384.1 protein_id gnl|my_center|LOCUS_17900 29535 30611 gene locus_tag LOCUS_17910 29535 30611 CDS product head-tail adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048394.1 protein_id gnl|my_center|LOCUS_17910 30734 31663 gene locus_tag LOCUS_17920 30734 31663 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966513.1 protein_id gnl|my_center|LOCUS_17920 31821 32930 gene locus_tag LOCUS_17930 gene ugpC 31821 32930 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_17930 32944 33891 gene locus_tag LOCUS_17940 32944 33891 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966511.1 protein_id gnl|my_center|LOCUS_17940 35220 34291 gene locus_tag LOCUS_17950 35220 34291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 35417 36121 gene locus_tag LOCUS_17960 35417 36121 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966508.1 protein_id gnl|my_center|LOCUS_17960 37509 36334 gene locus_tag LOCUS_17970 37509 36334 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_17970 37856 39412 gene locus_tag LOCUS_17980 37856 39412 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966611.1 protein_id gnl|my_center|LOCUS_17980 40114 39596 gene locus_tag LOCUS_17990 40114 39596 CDS product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412258.1 protein_id gnl|my_center|LOCUS_17990 40440 40129 gene locus_tag LOCUS_18000 40440 40129 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184004.1 protein_id gnl|my_center|LOCUS_18000 41538 40681 gene locus_tag LOCUS_18010 41538 40681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 42098 42271 gene locus_tag LOCUS_18020 42098 42271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 42766 42347 gene locus_tag LOCUS_18030 42766 42347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966507.1 protein_id gnl|my_center|LOCUS_18030 43580 42927 gene locus_tag LOCUS_18040 43580 42927 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_18040 44241 43717 gene locus_tag LOCUS_18050 44241 43717 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391659.1 protein_id gnl|my_center|LOCUS_18050 45677 44331 gene locus_tag LOCUS_18060 45677 44331 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048389.1 protein_id gnl|my_center|LOCUS_18060 45920 45845 gene locus_tag LOCUS_t00250 45920 45845 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 46552 46232 gene locus_tag LOCUS_18070 46552 46232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966502.1 protein_id gnl|my_center|LOCUS_18070 47204 48580 gene locus_tag LOCUS_18080 47204 48580 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948760.1 protein_id gnl|my_center|LOCUS_18080 49118 48621 gene locus_tag LOCUS_18090 49118 48621 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948075.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18090 49446 49826 gene locus_tag LOCUS_18100 49446 49826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 49926 50153 gene locus_tag LOCUS_18110 49926 50153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 50202 50951 gene locus_tag LOCUS_18120 50202 50951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 52854 51067 gene locus_tag LOCUS_18130 52854 51067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582944.1 protein_id gnl|my_center|LOCUS_18130 54590 52854 gene locus_tag LOCUS_18140 54590 52854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582943.1 protein_id gnl|my_center|LOCUS_18140 54905 54726 gene locus_tag LOCUS_18150 54905 54726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 55249 55127 gene locus_tag LOCUS_18160 55249 55127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 56747 55368 gene locus_tag LOCUS_18170 gene murC 56747 55368 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_18170 57162 57983 gene locus_tag LOCUS_18180 gene purR 57162 57983 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966500.1 protein_id gnl|my_center|LOCUS_18180 58090 58410 gene locus_tag LOCUS_18190 58090 58410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 58579 59949 gene locus_tag LOCUS_18200 gene glmU 58579 59949 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966498.1 protein_id gnl|my_center|LOCUS_18200 60166 61137 gene locus_tag LOCUS_18210 60166 61137 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_18210 61529 62215 gene locus_tag LOCUS_18220 61529 62215 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_18220 62216 63628 gene locus_tag LOCUS_18230 62216 63628 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_18230 63670 64854 gene locus_tag LOCUS_18240 63670 64854 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048385.1 protein_id gnl|my_center|LOCUS_18240 65157 65720 gene locus_tag LOCUS_18250 gene pth 65157 65720 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_18250 65778 69299 gene locus_tag LOCUS_18260 gene mfd 65778 69299 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_18260 69395 70393 gene locus_tag LOCUS_18270 69395 70393 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519041.1 protein_id gnl|my_center|LOCUS_18270 70575 71126 gene locus_tag LOCUS_18280 gene spoVT 70575 71126 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359411.1 protein_id gnl|my_center|LOCUS_18280 71290 72828 gene locus_tag LOCUS_18290 71290 72828 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048381.1 protein_id gnl|my_center|LOCUS_18290 72850 74292 gene locus_tag LOCUS_18300 gene mazG 72850 74292 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966488.1 protein_id gnl|my_center|LOCUS_18300 74432 74707 gene locus_tag LOCUS_18310 74432 74707 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966487.1 protein_id gnl|my_center|LOCUS_18310 74815 75075 gene locus_tag LOCUS_18320 74815 75075 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966486.1 protein_id gnl|my_center|LOCUS_18320 75214 75507 gene locus_tag LOCUS_18330 gene yabP 75214 75507 CDS product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966485.1 protein_id gnl|my_center|LOCUS_18330 75515 75919 gene locus_tag LOCUS_18340 gene yabQ 75515 75919 CDS product spore cortex biosynthesis protein YabQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359440.1 protein_id gnl|my_center|LOCUS_18340 76013 76285 gene locus_tag LOCUS_18350 76013 76285 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359350.1 protein_id gnl|my_center|LOCUS_18350 76366 76779 gene locus_tag LOCUS_18360 76366 76779 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966482.1 protein_id gnl|my_center|LOCUS_18360 76964 77052 gene locus_tag LOCUS_t00260 76964 77052 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 77058 77133 gene locus_tag LOCUS_t00270 77058 77133 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 77139 77215 gene locus_tag LOCUS_t00280 77139 77215 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 77322 77397 gene locus_tag LOCUS_t00290 77322 77397 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 77491 77566 gene locus_tag LOCUS_t00300 77491 77566 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 77635 77723 gene locus_tag LOCUS_t00310 77635 77723 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 77729 77804 gene locus_tag LOCUS_t00320 77729 77804 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 77810 77886 gene locus_tag LOCUS_t00330 77810 77886 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 78215 80605 gene locus_tag LOCUS_18370 gene spoIIE 78215 80605 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048377.1 protein_id gnl|my_center|LOCUS_18370 80861 82246 gene locus_tag LOCUS_18380 gene tilS 80861 82246 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966480.1 protein_id gnl|my_center|LOCUS_18380 82249 82785 gene locus_tag LOCUS_18390 gene hpt 82249 82785 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_18390 82896 84734 gene locus_tag LOCUS_18400 gene ftsH 82896 84734 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence15 565 1380 gene locus_tag LOCUS_18410 565 1380 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454798.1 protein_id gnl|my_center|LOCUS_18410 2653 1454 gene locus_tag LOCUS_18420 2653 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948796.1 protein_id gnl|my_center|LOCUS_18420 2879 3793 gene locus_tag LOCUS_18430 2879 3793 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_18430 3790 4632 gene locus_tag LOCUS_18440 gene znuC 3790 4632 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705955.1 protein_id gnl|my_center|LOCUS_18440 4632 5474 gene locus_tag LOCUS_18450 4632 5474 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903855.1 protein_id gnl|my_center|LOCUS_18450 5826 5524 gene locus_tag LOCUS_18460 5826 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 5996 6154 gene locus_tag LOCUS_18470 5996 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 6230 6445 gene locus_tag LOCUS_18480 6230 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 6435 6629 gene locus_tag LOCUS_18490 6435 6629 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461361.1 protein_id gnl|my_center|LOCUS_18490 6720 7505 gene locus_tag LOCUS_18500 6720 7505 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 protein_id gnl|my_center|LOCUS_18500 7508 9169 gene locus_tag LOCUS_18510 7508 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948484.1 protein_id gnl|my_center|LOCUS_18510 9293 9499 gene locus_tag LOCUS_18520 9293 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 9580 9912 gene locus_tag LOCUS_18530 9580 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 10077 10733 gene locus_tag LOCUS_18540 10077 10733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18540 11500 10796 gene locus_tag LOCUS_18550 11500 10796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 11713 12156 gene locus_tag LOCUS_18560 11713 12156 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371299.1 protein_id gnl|my_center|LOCUS_18560 12408 12731 gene locus_tag LOCUS_18570 12408 12731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 12816 14243 gene locus_tag LOCUS_18580 gene amyS 12816 14243 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476408.1 protein_id gnl|my_center|LOCUS_18580 14273 14926 gene locus_tag LOCUS_18590 14273 14926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 15802 15098 gene locus_tag LOCUS_18600 15802 15098 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987068.1 protein_id gnl|my_center|LOCUS_18600 17373 15880 gene locus_tag LOCUS_18610 gene glpK 17373 15880 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_18610 17931 17566 gene locus_tag LOCUS_18620 17931 17566 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399582.1 protein_id gnl|my_center|LOCUS_18620 19197 17938 gene locus_tag LOCUS_18630 19197 17938 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_18630 20652 19213 gene locus_tag LOCUS_18640 20652 19213 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_18640 21069 21635 gene locus_tag LOCUS_18650 21069 21635 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361269.1 protein_id gnl|my_center|LOCUS_18650 21821 23110 gene locus_tag LOCUS_18660 21821 23110 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641774.1 protein_id gnl|my_center|LOCUS_18660 23337 24620 gene locus_tag LOCUS_18670 gene malE 23337 24620 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080109.1 protein_id gnl|my_center|LOCUS_18670 24677 25606 gene locus_tag LOCUS_18680 24677 25606 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226190.1 protein_id gnl|my_center|LOCUS_18680 25618 26472 gene locus_tag LOCUS_18690 25618 26472 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162661.1 protein_id gnl|my_center|LOCUS_18690 26726 26571 gene locus_tag LOCUS_18700 26726 26571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 26946 27428 gene locus_tag LOCUS_18710 26946 27428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 27558 28268 gene locus_tag LOCUS_18720 27558 28268 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_18720 28249 29643 gene locus_tag LOCUS_18730 28249 29643 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494796.1 protein_id gnl|my_center|LOCUS_18730 31043 29877 gene locus_tag LOCUS_18740 31043 29877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 31312 32481 gene locus_tag LOCUS_18750 31312 32481 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861386.1 protein_id gnl|my_center|LOCUS_18750 32665 33009 gene locus_tag LOCUS_18760 32665 33009 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423973.1 protein_id gnl|my_center|LOCUS_18760 33030 33473 gene locus_tag LOCUS_18770 33030 33473 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861387.1 protein_id gnl|my_center|LOCUS_18770 33512 34084 gene locus_tag LOCUS_18780 33512 34084 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724712.1 protein_id gnl|my_center|LOCUS_18780 34077 35486 gene locus_tag LOCUS_18790 34077 35486 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966007.1 protein_id gnl|my_center|LOCUS_18790 35707 37140 gene locus_tag LOCUS_18800 gene eutA 35707 37140 CDS product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861388.1 protein_id gnl|my_center|LOCUS_18800 37163 38527 gene locus_tag LOCUS_18810 37163 38527 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861389.1 protein_id gnl|my_center|LOCUS_18810 38546 39424 gene locus_tag LOCUS_18820 gene eutC 38546 39424 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732749.1 protein_id gnl|my_center|LOCUS_18820 39455 40108 gene locus_tag LOCUS_18830 gene eutL 39455 40108 CDS product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423987.1 protein_id gnl|my_center|LOCUS_18830 40123 40626 gene locus_tag LOCUS_18840 40123 40626 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357510.1 protein_id gnl|my_center|LOCUS_18840 40626 42092 gene locus_tag LOCUS_18850 40626 42092 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721578.1 protein_id gnl|my_center|LOCUS_18850 42140 42439 gene locus_tag LOCUS_18860 42140 42439 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357513.1 protein_id gnl|my_center|LOCUS_18860 42527 43282 gene locus_tag LOCUS_18870 42527 43282 CDS product ethanolamine corrinoid cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861391.1 protein_id gnl|my_center|LOCUS_18870 43316 43942 gene locus_tag LOCUS_18880 gene eutD 43316 43942 CDS product ethanolamine utilization phosphate acetyltransferase EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889877.1 protein_id gnl|my_center|LOCUS_18880 43970 44752 gene locus_tag LOCUS_18890 43970 44752 CDS product TIGR02536 family ethanolamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861392.1 protein_id gnl|my_center|LOCUS_18890 44859 45140 gene locus_tag LOCUS_18900 44859 45140 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868835.1 protein_id gnl|my_center|LOCUS_18900 45183 45725 gene locus_tag LOCUS_18910 45183 45725 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435395.1 protein_id gnl|my_center|LOCUS_18910 45805 46905 gene locus_tag LOCUS_18920 gene eutH 45805 46905 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897061.1 protein_id gnl|my_center|LOCUS_18920 46926 47378 gene locus_tag LOCUS_18930 46926 47378 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893336.1 protein_id gnl|my_center|LOCUS_18930 47643 47957 gene locus_tag LOCUS_18940 47643 47957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 48254 49081 gene locus_tag LOCUS_18950 48254 49081 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986485.1 protein_id gnl|my_center|LOCUS_18950 49109 49546 gene locus_tag LOCUS_18960 49109 49546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 49557 50291 gene locus_tag LOCUS_18970 49557 50291 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986483.1 protein_id gnl|my_center|LOCUS_18970 50260 50751 gene locus_tag LOCUS_18980 gene mog 50260 50751 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986482.1 protein_id gnl|my_center|LOCUS_18980 50860 52167 gene locus_tag LOCUS_18990 50860 52167 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965321.1 protein_id gnl|my_center|LOCUS_18990 52209 54116 gene locus_tag LOCUS_19000 52209 54116 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965320.1 protein_id gnl|my_center|LOCUS_19000 54128 55087 gene locus_tag LOCUS_19010 gene moaA 54128 55087 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986479.1 protein_id gnl|my_center|LOCUS_19010 55110 55589 gene locus_tag LOCUS_19020 gene moaC 55110 55589 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965292.1 protein_id gnl|my_center|LOCUS_19020 55589 56023 gene locus_tag LOCUS_19030 55589 56023 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986477.1 protein_id gnl|my_center|LOCUS_19030 56027 57907 gene locus_tag LOCUS_19040 56027 57907 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986476.1 protein_id gnl|my_center|LOCUS_19040 58194 59990 gene locus_tag LOCUS_19050 58194 59990 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986475.1 protein_id gnl|my_center|LOCUS_19050 60049 60273 gene locus_tag LOCUS_19060 60049 60273 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358284.1 protein_id gnl|my_center|LOCUS_19060 60343 60606 gene locus_tag LOCUS_19070 60343 60606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 60787 60668 gene locus_tag LOCUS_19080 60787 60668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 62334 60784 gene locus_tag LOCUS_19090 62334 60784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 62747 62382 gene locus_tag LOCUS_19100 gene nifU 62747 62382 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_19100 63026 63117 gene locus_tag LOCUS_t00340 63026 63117 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 63742 65781 gene locus_tag LOCUS_19110 63742 65781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:64141..64143,aa:Sec) note codon on position 134 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_19110 65797 66897 gene locus_tag LOCUS_19120 65797 66897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 66970 67587 gene locus_tag LOCUS_19130 66970 67587 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_19130 67844 69073 gene locus_tag LOCUS_19140 gene fliB 67844 69073 CDS product flagellin lysine-N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096963.1 protein_id gnl|my_center|LOCUS_19140 69404 71236 gene locus_tag LOCUS_19150 69404 71236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 72821 71361 gene locus_tag LOCUS_19160 72821 71361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 74185 73016 gene locus_tag LOCUS_19170 74185 73016 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021414170.1 protein_id gnl|my_center|LOCUS_19170 74462 74785 gene locus_tag LOCUS_19180 74462 74785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 74820 75104 gene locus_tag LOCUS_19190 74820 75104 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355819.1 protein_id gnl|my_center|LOCUS_19190 75127 77088 gene locus_tag LOCUS_19200 75127 77088 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948003.1 protein_id gnl|my_center|LOCUS_19200 77657 77163 gene locus_tag LOCUS_19210 77657 77163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 77937 79256 gene locus_tag LOCUS_19220 77937 79256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 79406 80911 gene locus_tag LOCUS_19230 gene zwf 79406 80911 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393785.1 protein_id gnl|my_center|LOCUS_19230 80923 81549 gene locus_tag LOCUS_19240 80923 81549 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393784.1 protein_id gnl|my_center|LOCUS_19240 81633 82058 gene locus_tag LOCUS_19250 81633 82058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 82048 82170 gene locus_tag LOCUS_19260 82048 82170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence16 398 231 gene locus_tag LOCUS_19270 398 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 618 427 gene locus_tag LOCUS_19280 618 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 1986 727 gene locus_tag LOCUS_19290 1986 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 3811 2201 gene locus_tag LOCUS_19300 3811 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 4668 3913 gene locus_tag LOCUS_19310 4668 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 6693 4831 gene locus_tag LOCUS_19320 6693 4831 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107726402.1 protein_id gnl|my_center|LOCUS_19320 7906 6719 gene locus_tag LOCUS_19330 7906 6719 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359867.1 protein_id gnl|my_center|LOCUS_19330 8049 8930 gene locus_tag LOCUS_19340 8049 8930 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086430.1 protein_id gnl|my_center|LOCUS_19340 9656 8946 gene locus_tag LOCUS_19350 9656 8946 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921816.1 protein_id gnl|my_center|LOCUS_19350 9861 10031 gene locus_tag LOCUS_19360 9861 10031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 9994 10212 gene locus_tag LOCUS_19370 9994 10212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 10896 10525 gene locus_tag LOCUS_19380 10896 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 11438 11151 gene locus_tag LOCUS_19390 11438 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 11427 11621 gene locus_tag LOCUS_19400 11427 11621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 12055 12564 gene locus_tag LOCUS_19410 12055 12564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 14688 12718 gene locus_tag LOCUS_19420 14688 12718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 16850 14748 gene locus_tag LOCUS_19430 16850 14748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 18663 17047 gene locus_tag LOCUS_19440 18663 17047 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_19440 19548 18667 gene locus_tag LOCUS_19450 19548 18667 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_19450 20529 19552 gene locus_tag LOCUS_19460 gene rmgP 20529 19552 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_19460 20859 23189 gene locus_tag LOCUS_19470 gene yesS 20859 23189 CDS product transcriptional regulator YesS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966769.1 protein_id gnl|my_center|LOCUS_19470 25322 23268 gene locus_tag LOCUS_19480 25322 23268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 26223 25369 gene locus_tag LOCUS_19490 26223 25369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369000.1 protein_id gnl|my_center|LOCUS_19490 27199 26492 gene locus_tag LOCUS_19500 27199 26492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 28316 27333 gene locus_tag LOCUS_19510 28316 27333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 29427 28375 gene locus_tag LOCUS_19520 29427 28375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 31796 29697 gene locus_tag LOCUS_19530 31796 29697 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259699.1 protein_id gnl|my_center|LOCUS_19530 31896 32669 gene locus_tag LOCUS_19540 31896 32669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 33127 32801 gene locus_tag LOCUS_19550 33127 32801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 33806 33357 gene locus_tag LOCUS_19560 33806 33357 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_19560 34232 35032 gene locus_tag LOCUS_19570 34232 35032 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_19570 36744 35308 gene locus_tag LOCUS_19580 36744 35308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 37061 38101 gene locus_tag LOCUS_19590 37061 38101 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762549.1 protein_id gnl|my_center|LOCUS_19590 40578 38158 gene locus_tag LOCUS_19600 40578 38158 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204437144.1 protein_id gnl|my_center|LOCUS_19600 41711 40602 gene locus_tag LOCUS_19610 41711 40602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 42928 41957 gene locus_tag LOCUS_19620 42928 41957 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803848.1 protein_id gnl|my_center|LOCUS_19620 44004 42949 gene locus_tag LOCUS_19630 44004 42949 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_19630 44744 44016 gene locus_tag LOCUS_19640 44744 44016 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_19640 45848 44757 gene locus_tag LOCUS_19650 45848 44757 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_19650 45973 46878 gene locus_tag LOCUS_19660 45973 46878 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964642.1 protein_id gnl|my_center|LOCUS_19660 47252 47049 gene locus_tag LOCUS_19670 47252 47049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 47523 47293 gene locus_tag LOCUS_19680 47523 47293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 47919 47683 gene locus_tag LOCUS_19690 47919 47683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 49471 48293 gene locus_tag LOCUS_19700 49471 48293 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391959.1 protein_id gnl|my_center|LOCUS_19700 50372 49578 gene locus_tag LOCUS_19710 50372 49578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 51887 50493 gene locus_tag LOCUS_19720 51887 50493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 53296 51884 gene locus_tag LOCUS_19730 53296 51884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 54173 53310 gene locus_tag LOCUS_19740 54173 53310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 55123 54173 gene locus_tag LOCUS_19750 55123 54173 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_19750 55442 56143 gene locus_tag LOCUS_19760 55442 56143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 58140 56818 gene locus_tag LOCUS_19770 58140 56818 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_19770 58454 58263 gene locus_tag LOCUS_19780 58454 58263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 59657 58668 gene locus_tag LOCUS_19790 59657 58668 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172178.1 protein_id gnl|my_center|LOCUS_19790 62112 59794 gene locus_tag LOCUS_19800 62112 59794 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_19800 62302 63198 gene locus_tag LOCUS_19810 62302 63198 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431317.1 protein_id gnl|my_center|LOCUS_19810 64109 63222 gene locus_tag LOCUS_19820 64109 63222 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964760.1 protein_id gnl|my_center|LOCUS_19820 64253 66427 gene locus_tag LOCUS_19830 64253 66427 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052488.1 protein_id gnl|my_center|LOCUS_19830 66876 66565 gene locus_tag LOCUS_19840 66876 66565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 67289 67143 gene locus_tag LOCUS_19850 67289 67143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 67942 67448 gene locus_tag LOCUS_19860 67942 67448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19860 69645 68050 gene locus_tag LOCUS_19870 69645 68050 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721734.1 protein_id gnl|my_center|LOCUS_19870 69838 70545 gene locus_tag LOCUS_19880 69838 70545 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989345.1 protein_id gnl|my_center|LOCUS_19880 71248 70709 gene locus_tag LOCUS_19890 71248 70709 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206871531.1 protein_id gnl|my_center|LOCUS_19890 71459 72439 gene locus_tag LOCUS_19900 71459 72439 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706213.1 protein_id gnl|my_center|LOCUS_19900 72534 73469 gene locus_tag LOCUS_19910 72534 73469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 74078 73878 gene locus_tag LOCUS_19920 74078 73878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 75003 75602 gene locus_tag LOCUS_19930 75003 75602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 75603 76577 gene locus_tag LOCUS_19940 75603 76577 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_19940 76564 77592 gene locus_tag LOCUS_19950 76564 77592 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003321939.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence17 414 1172 gene locus_tag LOCUS_19960 414 1172 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949043.1 protein_id gnl|my_center|LOCUS_19960 3324 1294 gene locus_tag LOCUS_19970 3324 1294 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387654.1 protein_id gnl|my_center|LOCUS_19970 3815 4828 gene locus_tag LOCUS_19980 3815 4828 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_19980 5026 4865 gene locus_tag LOCUS_19990 5026 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 5278 6267 gene locus_tag LOCUS_20000 5278 6267 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808446.1 protein_id gnl|my_center|LOCUS_20000 7007 7333 gene locus_tag LOCUS_20010 7007 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20010 7509 7784 gene locus_tag LOCUS_20020 7509 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20020 9659 8382 gene locus_tag LOCUS_20030 9659 8382 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392338.1 protein_id gnl|my_center|LOCUS_20030 11721 9727 gene locus_tag LOCUS_20040 gene tet 11721 9727 CDS product tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964757.1 protein_id gnl|my_center|LOCUS_20040 11925 14303 gene locus_tag LOCUS_20050 11925 14303 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_20050 14322 16685 gene locus_tag LOCUS_20060 14322 16685 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_20060 16727 17209 gene locus_tag LOCUS_20070 16727 17209 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048129.1 protein_id gnl|my_center|LOCUS_20070 17199 18212 gene locus_tag LOCUS_20080 17199 18212 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048128.1 protein_id gnl|my_center|LOCUS_20080 18358 19788 gene locus_tag LOCUS_20090 gene glnA 18358 19788 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_20090 19846 20742 gene locus_tag LOCUS_20100 19846 20742 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048127.1 protein_id gnl|my_center|LOCUS_20100 20759 22525 gene locus_tag LOCUS_20110 gene iorA 20759 22525 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869130.1 protein_id gnl|my_center|LOCUS_20110 22527 23102 gene locus_tag LOCUS_20120 22527 23102 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869131.1 protein_id gnl|my_center|LOCUS_20120 23342 24187 gene locus_tag LOCUS_20130 23342 24187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 25697 24207 gene locus_tag LOCUS_20140 25697 24207 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048125.1 protein_id gnl|my_center|LOCUS_20140 26051 27784 gene locus_tag LOCUS_20150 26051 27784 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_20150 27915 28985 gene locus_tag LOCUS_20160 27915 28985 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048122.1 protein_id gnl|my_center|LOCUS_20160 28985 29656 gene locus_tag LOCUS_20170 28985 29656 CDS product YveK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966325.1 protein_id gnl|my_center|LOCUS_20170 29669 30352 gene locus_tag LOCUS_20180 29669 30352 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 protein_id gnl|my_center|LOCUS_20180 30374 31150 gene locus_tag LOCUS_20190 30374 31150 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986982.1 protein_id gnl|my_center|LOCUS_20190 31196 32104 gene locus_tag LOCUS_20200 gene galU 31196 32104 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965632.1 protein_id gnl|my_center|LOCUS_20200 32425 34266 gene locus_tag LOCUS_20210 32425 34266 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 protein_id gnl|my_center|LOCUS_20210 34414 35730 gene locus_tag LOCUS_20220 34414 35730 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_20220 35827 36915 gene locus_tag LOCUS_20230 35827 36915 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_20230 36949 37689 gene locus_tag LOCUS_20240 36949 37689 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048115.1 protein_id gnl|my_center|LOCUS_20240 38051 39175 gene locus_tag LOCUS_20250 38051 39175 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_20250 39363 40706 gene locus_tag LOCUS_20260 39363 40706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 40762 42225 gene locus_tag LOCUS_20270 40762 42225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 42295 43326 gene locus_tag LOCUS_20280 42295 43326 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868699.1 protein_id gnl|my_center|LOCUS_20280 43362 44627 gene locus_tag LOCUS_20290 43362 44627 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048107.1 protein_id gnl|my_center|LOCUS_20290 44627 45757 gene locus_tag LOCUS_20300 44627 45757 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767224.1 protein_id gnl|my_center|LOCUS_20300 45991 46647 gene locus_tag LOCUS_20310 45991 46647 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048102.1 protein_id gnl|my_center|LOCUS_20310 46729 47448 gene locus_tag LOCUS_20320 46729 47448 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048101.1 protein_id gnl|my_center|LOCUS_20320 47594 48583 gene locus_tag LOCUS_20330 47594 48583 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048105.1 protein_id gnl|my_center|LOCUS_20330 48637 49176 gene locus_tag LOCUS_20340 48637 49176 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965608.1 protein_id gnl|my_center|LOCUS_20340 49372 50232 gene locus_tag LOCUS_20350 49372 50232 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693993.1 protein_id gnl|my_center|LOCUS_20350 50429 52183 gene locus_tag LOCUS_20360 50429 52183 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099504.1 protein_id gnl|my_center|LOCUS_20360 52381 52557 gene locus_tag LOCUS_20370 52381 52557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 52631 52873 gene locus_tag LOCUS_20380 52631 52873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 52870 54339 gene locus_tag LOCUS_20390 52870 54339 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055172.1 protein_id gnl|my_center|LOCUS_20390 54359 55471 gene locus_tag LOCUS_20400 54359 55471 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222163.1 protein_id gnl|my_center|LOCUS_20400 55468 56772 gene locus_tag LOCUS_20410 55468 56772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20410 56906 58705 gene locus_tag LOCUS_20420 56906 58705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 59016 60470 gene locus_tag LOCUS_20430 gene abfD 59016 60470 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_20430 60563 60850 gene locus_tag LOCUS_20440 60563 60850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 60850 61122 gene locus_tag LOCUS_20450 60850 61122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430736.1 protein_id gnl|my_center|LOCUS_20450 61140 62438 gene locus_tag LOCUS_20460 61140 62438 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454645.1 protein_id gnl|my_center|LOCUS_20460 62487 63860 gene locus_tag LOCUS_20470 62487 63860 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_20470 64318 64653 gene locus_tag LOCUS_20480 gene spoIIAA 64318 64653 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_20480 64667 65095 gene locus_tag LOCUS_20490 gene spoIIAB 64667 65095 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357714.1 protein_id gnl|my_center|LOCUS_20490 65106 65861 gene locus_tag LOCUS_20500 gene sigF 65106 65861 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403644.1 protein_id gnl|my_center|LOCUS_20500 66048 66500 gene locus_tag LOCUS_20510 gene spoVAC 66048 66500 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403642.1 protein_id gnl|my_center|LOCUS_20510 66507 67523 gene locus_tag LOCUS_20520 gene spoVAD 66507 67523 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403641.1 protein_id gnl|my_center|LOCUS_20520 67524 67883 gene locus_tag LOCUS_20530 gene spoVAE 67524 67883 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_20530 70431 67933 gene locus_tag LOCUS_20540 70431 67933 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048098.1 protein_id gnl|my_center|LOCUS_20540 70770 71306 gene locus_tag LOCUS_20550 gene yunB 70770 71306 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075141567.1 protein_id gnl|my_center|LOCUS_20550 71918 71394 gene locus_tag LOCUS_20560 gene hpt 71918 71394 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048096.1 protein_id gnl|my_center|LOCUS_20560 72038 73831 gene locus_tag LOCUS_20570 gene hflX 72038 73831 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048095.1 protein_id gnl|my_center|LOCUS_20570 73965 74465 gene locus_tag LOCUS_20580 73965 74465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence18 803 297 gene locus_tag LOCUS_20590 803 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948006.1 protein_id gnl|my_center|LOCUS_20590 1462 830 gene locus_tag LOCUS_20600 1462 830 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_20600 2408 1446 gene locus_tag LOCUS_20610 2408 1446 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948007.1 protein_id gnl|my_center|LOCUS_20610 2956 2408 gene locus_tag LOCUS_20620 2956 2408 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948008.1 protein_id gnl|my_center|LOCUS_20620 3273 4340 gene locus_tag LOCUS_20630 3273 4340 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963970.1 protein_id gnl|my_center|LOCUS_20630 5373 4426 gene locus_tag LOCUS_20640 gene fba 5373 4426 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948010.1 protein_id gnl|my_center|LOCUS_20640 5893 5513 gene locus_tag LOCUS_20650 5893 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 6516 5890 gene locus_tag LOCUS_20660 6516 5890 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_20660 6760 8418 gene locus_tag LOCUS_20670 6760 8418 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948012.1 protein_id gnl|my_center|LOCUS_20670 9139 9816 gene locus_tag LOCUS_20680 gene sdaAB 9139 9816 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963992.1 protein_id gnl|my_center|LOCUS_20680 9859 10734 gene locus_tag LOCUS_20690 gene sdaAA 9859 10734 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356262.1 protein_id gnl|my_center|LOCUS_20690 10870 11409 gene locus_tag LOCUS_20700 10870 11409 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_20700 11421 11675 gene locus_tag LOCUS_20710 11421 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 11695 12762 gene locus_tag LOCUS_20720 gene cax 11695 12762 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_20720 12864 13193 gene locus_tag LOCUS_20730 12864 13193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963994.1 protein_id gnl|my_center|LOCUS_20730 13732 13220 gene locus_tag LOCUS_20740 gene pssA 13732 13220 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356316.1 protein_id gnl|my_center|LOCUS_20740 13971 14399 gene locus_tag LOCUS_20750 13971 14399 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355850.1 protein_id gnl|my_center|LOCUS_20750 14504 15388 gene locus_tag LOCUS_20760 14504 15388 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356507.1 protein_id gnl|my_center|LOCUS_20760 15861 16115 gene locus_tag LOCUS_20770 15861 16115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 18195 16342 gene locus_tag LOCUS_20780 18195 16342 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948014.1 protein_id gnl|my_center|LOCUS_20780 18558 19820 gene locus_tag LOCUS_20790 18558 19820 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_20790 19986 20702 gene locus_tag LOCUS_20800 gene sleB 19986 20702 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398991.1 protein_id gnl|my_center|LOCUS_20800 21054 21560 gene locus_tag LOCUS_20810 21054 21560 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902394.1 protein_id gnl|my_center|LOCUS_20810 21553 22977 gene locus_tag LOCUS_20820 21553 22977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 24070 23030 gene locus_tag LOCUS_20830 24070 23030 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964009.1 protein_id gnl|my_center|LOCUS_20830 24260 25687 gene locus_tag LOCUS_20840 24260 25687 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986179.1 protein_id gnl|my_center|LOCUS_20840 26307 27248 gene locus_tag LOCUS_20850 26307 27248 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135810.1 protein_id gnl|my_center|LOCUS_20850 27250 28443 gene locus_tag LOCUS_20860 27250 28443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 28448 30805 gene locus_tag LOCUS_20870 28448 30805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 30927 31754 gene locus_tag LOCUS_20880 30927 31754 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964017.1 protein_id gnl|my_center|LOCUS_20880 32026 32334 gene locus_tag LOCUS_20890 32026 32334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 32388 32594 gene locus_tag LOCUS_20900 32388 32594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 32634 34238 gene locus_tag LOCUS_20910 32634 34238 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986522.1 protein_id gnl|my_center|LOCUS_20910 34384 34851 gene locus_tag LOCUS_20920 gene trmL 34384 34851 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356826.1 protein_id gnl|my_center|LOCUS_20920 34901 35041 gene locus_tag LOCUS_20930 34901 35041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 35790 36167 gene locus_tag LOCUS_20940 35790 36167 CDS product GrdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948883.1 protein_id gnl|my_center|LOCUS_20940 36213 37139 gene locus_tag LOCUS_20950 gene trxB 36213 37139 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948886.1 protein_id gnl|my_center|LOCUS_20950 37266 37595 gene locus_tag LOCUS_20960 37266 37595 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416870.1 protein_id gnl|my_center|LOCUS_20960 37671 38957 gene locus_tag LOCUS_20970 37671 38957 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948884.1 protein_id gnl|my_center|LOCUS_20970 39059 39529 gene locus_tag LOCUS_20980 gene grdA 39059 39529 CDS product glycine/sarcosine/betaine reductase complex selenoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084480923.1 transl_except (pos:39182..39184,aa:Sec) note codon on position 42 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_20980 39656 40963 gene locus_tag LOCUS_20990 gene grdB 39656 40963 CDS product glycine reductase complex selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084480926.1 transl_except (pos:40700..40702,aa:Sec) note codon on position 349 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_20990 41284 42816 gene locus_tag LOCUS_21000 gene grdC 41284 42816 CDS product glycine/sarcosine/betaine reductase complex component C subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897537.1 protein_id gnl|my_center|LOCUS_21000 42867 44030 gene locus_tag LOCUS_21010 gene grdD 42867 44030 CDS product glycine/sarcosine/betaine reductase complex component C subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430750.1 protein_id gnl|my_center|LOCUS_21010 44372 45484 gene locus_tag LOCUS_21020 44372 45484 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357021.1 protein_id gnl|my_center|LOCUS_21020 45632 47173 gene locus_tag LOCUS_21030 45632 47173 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948025.1 protein_id gnl|my_center|LOCUS_21030 47166 48272 gene locus_tag LOCUS_21040 47166 48272 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357224.1 protein_id gnl|my_center|LOCUS_21040 48265 49197 gene locus_tag LOCUS_21050 48265 49197 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356209.1 protein_id gnl|my_center|LOCUS_21050 49605 50981 gene locus_tag LOCUS_21060 gene rpoN 49605 50981 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170876203.1 protein_id gnl|my_center|LOCUS_21060 51129 52163 gene locus_tag LOCUS_21070 51129 52163 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399034.1 protein_id gnl|my_center|LOCUS_21070 52243 53250 gene locus_tag LOCUS_21080 gene gap 52243 53250 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360478.1 protein_id gnl|my_center|LOCUS_21080 53487 54683 gene locus_tag LOCUS_21090 53487 54683 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_21090 54824 55570 gene locus_tag LOCUS_21100 gene tpiA 54824 55570 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_21100 55642 57174 gene locus_tag LOCUS_21110 gene gpmI 55642 57174 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_21110 57324 58619 gene locus_tag LOCUS_21120 gene eno 57324 58619 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_21120 58747 58977 gene locus_tag LOCUS_21130 gene secG 58747 58977 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948031.1 protein_id gnl|my_center|LOCUS_21130 59222 59527 gene locus_tag LOCUS_21140 59222 59527 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357450.1 protein_id gnl|my_center|LOCUS_21140 59819 62086 gene locus_tag LOCUS_21150 gene pcrA 59819 62086 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357577.1 protein_id gnl|my_center|LOCUS_21150 62255 64252 gene locus_tag LOCUS_21160 gene ligA 62255 64252 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_21160 64555 64286 gene locus_tag LOCUS_21170 64555 64286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965956.1 protein_id gnl|my_center|LOCUS_21170 65066 66730 gene locus_tag LOCUS_21180 65066 66730 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048222.1 protein_id gnl|my_center|LOCUS_21180 67212 67024 gene locus_tag LOCUS_21190 67212 67024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 67935 67408 gene locus_tag LOCUS_21200 67935 67408 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949081.1 protein_id gnl|my_center|LOCUS_21200 68102 68614 gene locus_tag LOCUS_21210 68102 68614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 70340 68961 gene locus_tag LOCUS_21220 70340 68961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965954.1 protein_id gnl|my_center|LOCUS_21220 70434 71408 gene locus_tag LOCUS_21230 70434 71408 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_21230 71440 72036 gene locus_tag LOCUS_21240 71440 72036 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_21240 72075 72545 gene locus_tag LOCUS_21250 72075 72545 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357651.1 protein_id gnl|my_center|LOCUS_21250 72766 72841 gene locus_tag LOCUS_t00350 72766 72841 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 72861 72934 gene locus_tag LOCUS_t00360 72861 72934 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 72970 73046 gene locus_tag LOCUS_t00370 72970 73046 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 73051 73126 gene locus_tag LOCUS_t00380 73051 73126 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 73136 73210 gene locus_tag LOCUS_t00390 73136 73210 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence19 170 15 gene locus_tag LOCUS_21260 170 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 3080 378 gene locus_tag LOCUS_21270 3080 378 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964558.1 protein_id gnl|my_center|LOCUS_21270 3609 3274 gene locus_tag LOCUS_21280 3609 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 4020 3649 gene locus_tag LOCUS_21290 4020 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 4334 5803 gene locus_tag LOCUS_21300 4334 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 6073 6654 gene locus_tag LOCUS_21310 6073 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21310 6624 8741 gene locus_tag LOCUS_21320 6624 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21320 8821 9804 gene locus_tag LOCUS_21330 8821 9804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 10029 10913 gene locus_tag LOCUS_21340 10029 10913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 11215 10988 gene locus_tag LOCUS_21350 11215 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 11506 11327 gene locus_tag LOCUS_21360 11506 11327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21360 11718 13745 gene locus_tag LOCUS_21370 11718 13745 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861320.1 protein_id gnl|my_center|LOCUS_21370 13756 15099 gene locus_tag LOCUS_21380 13756 15099 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893260.1 protein_id gnl|my_center|LOCUS_21380 15388 16698 gene locus_tag LOCUS_21390 gene brnQ 15388 16698 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948514.1 protein_id gnl|my_center|LOCUS_21390 17059 18057 gene locus_tag LOCUS_21400 17059 18057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 19504 18305 gene locus_tag LOCUS_21410 19504 18305 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948040.1 protein_id gnl|my_center|LOCUS_21410 20946 19804 gene locus_tag LOCUS_21420 20946 19804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 21647 21111 gene locus_tag LOCUS_21430 21647 21111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 23364 21856 gene locus_tag LOCUS_21440 23364 21856 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963812.1 protein_id gnl|my_center|LOCUS_21440 23632 23423 gene locus_tag LOCUS_21450 23632 23423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 26486 23772 gene locus_tag LOCUS_21460 26486 23772 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963339.1 protein_id gnl|my_center|LOCUS_21460 27886 26630 gene locus_tag LOCUS_21470 27886 26630 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187945.1 protein_id gnl|my_center|LOCUS_21470 28180 29355 gene locus_tag LOCUS_21480 28180 29355 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966040.1 protein_id gnl|my_center|LOCUS_21480 30429 29524 gene locus_tag LOCUS_21490 gene thrB 30429 29524 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986279.1 protein_id gnl|my_center|LOCUS_21490 31011 30724 gene locus_tag LOCUS_21500 31011 30724 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357513.1 protein_id gnl|my_center|LOCUS_21500 31353 31033 gene locus_tag LOCUS_21510 31353 31033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 31964 31416 gene locus_tag LOCUS_21520 31964 31416 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815271.1 protein_id gnl|my_center|LOCUS_21520 33302 31977 gene locus_tag LOCUS_21530 33302 31977 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462297.1 protein_id gnl|my_center|LOCUS_21530 33630 33322 gene locus_tag LOCUS_21540 33630 33322 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815265.1 protein_id gnl|my_center|LOCUS_21540 34472 33630 gene locus_tag LOCUS_21550 gene eutJ 34472 33630 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815263.1 protein_id gnl|my_center|LOCUS_21550 34819 34538 gene locus_tag LOCUS_21560 34819 34538 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357513.1 protein_id gnl|my_center|LOCUS_21560 36375 34909 gene locus_tag LOCUS_21570 36375 34909 CDS product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945509.1 protein_id gnl|my_center|LOCUS_21570 37285 36389 gene locus_tag LOCUS_21580 gene eutC 37285 36389 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462272.1 protein_id gnl|my_center|LOCUS_21580 38664 37300 gene locus_tag LOCUS_21590 38664 37300 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462273.1 protein_id gnl|my_center|LOCUS_21590 39123 38677 gene locus_tag LOCUS_21600 39123 38677 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815261.1 protein_id gnl|my_center|LOCUS_21600 39467 39126 gene locus_tag LOCUS_21610 39467 39126 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815259.1 protein_id gnl|my_center|LOCUS_21610 39941 39489 gene locus_tag LOCUS_21620 39941 39489 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893336.1 protein_id gnl|my_center|LOCUS_21620 41089 39977 gene locus_tag LOCUS_21630 gene eutH 41089 39977 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721584.1 protein_id gnl|my_center|LOCUS_21630 41429 41148 gene locus_tag LOCUS_21640 41429 41148 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868835.1 protein_id gnl|my_center|LOCUS_21640 42291 41506 gene locus_tag LOCUS_21650 42291 41506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 42948 42292 gene locus_tag LOCUS_21660 gene eutD 42948 42292 CDS product ethanolamine utilization phosphate acetyltransferase EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889877.1 protein_id gnl|my_center|LOCUS_21660 43717 42962 gene locus_tag LOCUS_21670 43717 42962 CDS product ethanolamine corrinoid cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861391.1 protein_id gnl|my_center|LOCUS_21670 44101 43805 gene locus_tag LOCUS_21680 gene eutM 44101 43805 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423991.1 protein_id gnl|my_center|LOCUS_21680 45624 44161 gene locus_tag LOCUS_21690 45624 44161 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721578.1 protein_id gnl|my_center|LOCUS_21690 46115 45624 gene locus_tag LOCUS_21700 46115 45624 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989702.1 protein_id gnl|my_center|LOCUS_21700 46783 46130 gene locus_tag LOCUS_21710 gene eutL 46783 46130 CDS product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423987.1 protein_id gnl|my_center|LOCUS_21710 47692 46814 gene locus_tag LOCUS_21720 gene eutC 47692 46814 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732749.1 protein_id gnl|my_center|LOCUS_21720 49075 47711 gene locus_tag LOCUS_21730 49075 47711 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861389.1 protein_id gnl|my_center|LOCUS_21730 50530 49091 gene locus_tag LOCUS_21740 gene eutA 50530 49091 CDS product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861388.1 protein_id gnl|my_center|LOCUS_21740 52193 50784 gene locus_tag LOCUS_21750 52193 50784 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966007.1 protein_id gnl|my_center|LOCUS_21750 52758 52186 gene locus_tag LOCUS_21760 52758 52186 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724712.1 protein_id gnl|my_center|LOCUS_21760 54223 52997 gene locus_tag LOCUS_21770 54223 52997 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948355.1 protein_id gnl|my_center|LOCUS_21770 55141 54344 gene locus_tag LOCUS_21780 gene dapB 55141 54344 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948499.1 protein_id gnl|my_center|LOCUS_21780 55688 55353 gene locus_tag LOCUS_21790 55688 55353 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943224.1 protein_id gnl|my_center|LOCUS_21790 56001 57374 gene locus_tag LOCUS_21800 56001 57374 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808893.1 protein_id gnl|my_center|LOCUS_21800 58493 57492 gene locus_tag LOCUS_21810 58493 57492 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860719.1 protein_id gnl|my_center|LOCUS_21810 59540 58617 gene locus_tag LOCUS_21820 gene rbsK 59540 58617 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077610.1 protein_id gnl|my_center|LOCUS_21820 60571 59573 gene locus_tag LOCUS_21830 gene rbsC 60571 59573 CDS product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 protein_id gnl|my_center|LOCUS_21830 62072 60573 gene locus_tag LOCUS_21840 gene gguA 62072 60573 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_21840 63318 62164 gene locus_tag LOCUS_21850 63318 62164 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529214.1 protein_id gnl|my_center|LOCUS_21850 65471 63858 gene locus_tag LOCUS_21860 65471 63858 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_21860 66826 65777 gene locus_tag LOCUS_21870 66826 65777 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066908.1 protein_id gnl|my_center|LOCUS_21870 67693 66863 gene locus_tag LOCUS_21880 67693 66863 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_21880 69135 67777 gene locus_tag LOCUS_21890 69135 67777 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584098.1 protein_id gnl|my_center|LOCUS_21890 70463 69183 gene locus_tag LOCUS_21900 70463 69183 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722022.1 protein_id gnl|my_center|LOCUS_21900 70824 70537 gene locus_tag LOCUS_21910 70824 70537 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430711.1 protein_id gnl|my_center|LOCUS_21910 71324 70848 gene locus_tag LOCUS_21920 71324 70848 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642910.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence20 372 980 gene locus_tag LOCUS_21930 372 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1561 1148 gene locus_tag LOCUS_21940 1561 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 4735 1700 gene locus_tag LOCUS_21950 4735 1700 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966711.1 protein_id gnl|my_center|LOCUS_21950 6352 5078 gene locus_tag LOCUS_21960 gene larA 6352 5078 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948687.1 protein_id gnl|my_center|LOCUS_21960 7891 6368 gene locus_tag LOCUS_21970 7891 6368 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948686.1 protein_id gnl|my_center|LOCUS_21970 9400 8003 gene locus_tag LOCUS_21980 9400 8003 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948690.1 protein_id gnl|my_center|LOCUS_21980 10722 9514 gene locus_tag LOCUS_21990 10722 9514 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948689.1 protein_id gnl|my_center|LOCUS_21990 11528 10740 gene locus_tag LOCUS_22000 11528 10740 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948688.1 protein_id gnl|my_center|LOCUS_22000 12446 11748 gene locus_tag LOCUS_22010 12446 11748 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356424.1 protein_id gnl|my_center|LOCUS_22010 12999 13943 gene locus_tag LOCUS_22020 12999 13943 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947942.1 protein_id gnl|my_center|LOCUS_22020 15121 14090 gene locus_tag LOCUS_22030 15121 14090 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948341.1 protein_id gnl|my_center|LOCUS_22030 15963 15256 gene locus_tag LOCUS_22040 15963 15256 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948342.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22040 17384 16095 gene locus_tag LOCUS_22050 17384 16095 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948343.1 protein_id gnl|my_center|LOCUS_22050 17913 17644 gene locus_tag LOCUS_22060 17913 17644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 18235 19251 gene locus_tag LOCUS_22070 18235 19251 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949099.1 protein_id gnl|my_center|LOCUS_22070 19233 19991 gene locus_tag LOCUS_22080 19233 19991 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358645.1 protein_id gnl|my_center|LOCUS_22080 21693 20188 gene locus_tag LOCUS_22090 21693 20188 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_22090 22084 22515 gene locus_tag LOCUS_22100 gene queD 22084 22515 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949100.1 protein_id gnl|my_center|LOCUS_22100 22517 23182 gene locus_tag LOCUS_22110 gene queE 22517 23182 CDS product putative 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949101.1 protein_id gnl|my_center|LOCUS_22110 23187 23777 gene locus_tag LOCUS_22120 gene folE 23187 23777 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451708.1 protein_id gnl|my_center|LOCUS_22120 23795 24451 gene locus_tag LOCUS_22130 gene queC 23795 24451 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949102.1 protein_id gnl|my_center|LOCUS_22130 24865 24542 gene locus_tag LOCUS_22140 24865 24542 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356793.1 protein_id gnl|my_center|LOCUS_22140 25234 24992 gene locus_tag LOCUS_22150 25234 24992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 25833 25291 gene locus_tag LOCUS_22160 25833 25291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 26586 26008 gene locus_tag LOCUS_22170 26586 26008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966650.1 protein_id gnl|my_center|LOCUS_22170 26761 26952 gene locus_tag LOCUS_22180 26761 26952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 27938 27048 gene locus_tag LOCUS_22190 27938 27048 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458999.1 protein_id gnl|my_center|LOCUS_22190 28751 28083 gene locus_tag LOCUS_22200 28751 28083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 30230 29067 gene locus_tag LOCUS_22210 30230 29067 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_22210 30520 31230 gene locus_tag LOCUS_22220 30520 31230 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812980.1 protein_id gnl|my_center|LOCUS_22220 31371 33458 gene locus_tag LOCUS_22230 31371 33458 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987065.1 protein_id gnl|my_center|LOCUS_22230 33608 35035 gene locus_tag LOCUS_22240 33608 35035 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987064.1 protein_id gnl|my_center|LOCUS_22240 35860 35186 gene locus_tag LOCUS_22250 35860 35186 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836850.1 protein_id gnl|my_center|LOCUS_22250 36492 35962 gene locus_tag LOCUS_22260 36492 35962 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 protein_id gnl|my_center|LOCUS_22260 37419 39074 gene locus_tag LOCUS_22270 37419 39074 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_22270 39400 42009 gene locus_tag LOCUS_22280 39400 42009 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949094.1 protein_id gnl|my_center|LOCUS_22280 43126 42257 gene locus_tag LOCUS_22290 43126 42257 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_22290 43551 43883 gene locus_tag LOCUS_22300 gene cutA 43551 43883 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160780.1 protein_id gnl|my_center|LOCUS_22300 45884 44028 gene locus_tag LOCUS_22310 45884 44028 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_22310 47732 45945 gene locus_tag LOCUS_22320 47732 45945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_22320 48579 47767 gene locus_tag LOCUS_22330 48579 47767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 51630 48601 gene locus_tag LOCUS_22340 51630 48601 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142263.1 protein_id gnl|my_center|LOCUS_22340 51920 52819 gene locus_tag LOCUS_22350 51920 52819 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403172.1 protein_id gnl|my_center|LOCUS_22350 52948 53982 gene locus_tag LOCUS_22360 52948 53982 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871127.1 protein_id gnl|my_center|LOCUS_22360 54784 54053 gene locus_tag LOCUS_22370 54784 54053 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948026.1 protein_id gnl|my_center|LOCUS_22370 54965 56188 gene locus_tag LOCUS_22380 54965 56188 CDS product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948138.1 protein_id gnl|my_center|LOCUS_22380 57559 56288 gene locus_tag LOCUS_22390 gene nagZ 57559 56288 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_22390 58822 57692 gene locus_tag LOCUS_22400 58822 57692 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966542.1 protein_id gnl|my_center|LOCUS_22400 59611 58829 gene locus_tag LOCUS_22410 59611 58829 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966543.1 protein_id gnl|my_center|LOCUS_22410 60365 59613 gene locus_tag LOCUS_22420 60365 59613 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966544.1 protein_id gnl|my_center|LOCUS_22420 61027 60413 gene locus_tag LOCUS_22430 61027 60413 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966545.1 protein_id gnl|my_center|LOCUS_22430 61311 63854 gene locus_tag LOCUS_22440 61311 63854 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099839674.1 protein_id gnl|my_center|LOCUS_22440 66761 63954 gene locus_tag LOCUS_22450 66761 63954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 67047 66883 gene locus_tag LOCUS_22460 67047 66883 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026198.1 protein_id gnl|my_center|LOCUS_22460 >Feature sequence21 1847 159 gene locus_tag LOCUS_22470 1847 159 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_22470 2305 3522 gene locus_tag LOCUS_22480 2305 3522 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722878.1 protein_id gnl|my_center|LOCUS_22480 3491 4333 gene locus_tag LOCUS_22490 3491 4333 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722879.1 protein_id gnl|my_center|LOCUS_22490 4395 5297 gene locus_tag LOCUS_22500 4395 5297 CDS product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733788.1 protein_id gnl|my_center|LOCUS_22500 5546 6682 gene locus_tag LOCUS_22510 5546 6682 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966134.1 protein_id gnl|my_center|LOCUS_22510 6675 8252 gene locus_tag LOCUS_22520 6675 8252 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966133.1 protein_id gnl|my_center|LOCUS_22520 8448 9593 gene locus_tag LOCUS_22530 8448 9593 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966134.1 protein_id gnl|my_center|LOCUS_22530 9586 11166 gene locus_tag LOCUS_22540 9586 11166 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966133.1 protein_id gnl|my_center|LOCUS_22540 11749 11438 gene locus_tag LOCUS_22550 11749 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 12067 11834 gene locus_tag LOCUS_22560 12067 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 12339 12064 gene locus_tag LOCUS_22570 12339 12064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 13796 12552 gene locus_tag LOCUS_22580 13796 12552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 14504 14301 gene locus_tag LOCUS_22590 14504 14301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 15716 14631 gene locus_tag LOCUS_22600 15716 14631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 16955 15891 gene locus_tag LOCUS_22610 16955 15891 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966327.1 protein_id gnl|my_center|LOCUS_22610 18473 17055 gene locus_tag LOCUS_22620 18473 17055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 20356 18779 gene locus_tag LOCUS_22630 20356 18779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 22721 20538 gene locus_tag LOCUS_22640 22721 20538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 22939 25839 gene locus_tag LOCUS_22650 22939 25839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 26005 27069 gene locus_tag LOCUS_22660 26005 27069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 28662 27151 gene locus_tag LOCUS_22670 28662 27151 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 protein_id gnl|my_center|LOCUS_22670 30023 28731 gene locus_tag LOCUS_22680 30023 28731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 31207 30059 gene locus_tag LOCUS_22690 31207 30059 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476086.1 protein_id gnl|my_center|LOCUS_22690 32112 31204 gene locus_tag LOCUS_22700 32112 31204 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_22700 33307 32180 gene locus_tag LOCUS_22710 33307 32180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 34452 33343 gene locus_tag LOCUS_22720 34452 33343 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546788.1 protein_id gnl|my_center|LOCUS_22720 34963 34469 gene locus_tag LOCUS_22730 34963 34469 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 protein_id gnl|my_center|LOCUS_22730 35409 34960 gene locus_tag LOCUS_22740 35409 34960 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_22740 36550 35504 gene locus_tag LOCUS_22750 36550 35504 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966353.1 protein_id gnl|my_center|LOCUS_22750 37267 36599 gene locus_tag LOCUS_22760 37267 36599 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966354.1 protein_id gnl|my_center|LOCUS_22760 37880 37641 gene locus_tag LOCUS_22770 37880 37641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 38152 37877 gene locus_tag LOCUS_22780 38152 37877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 38644 38438 gene locus_tag LOCUS_22790 38644 38438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 40103 39048 gene locus_tag LOCUS_22800 40103 39048 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986984.1 protein_id gnl|my_center|LOCUS_22800 40998 40165 gene locus_tag LOCUS_22810 gene rfbD 40998 40165 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_22810 42415 41021 gene locus_tag LOCUS_22820 42415 41021 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936357.1 protein_id gnl|my_center|LOCUS_22820 44114 42600 gene locus_tag LOCUS_22830 44114 42600 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878099.1 protein_id gnl|my_center|LOCUS_22830 45361 44111 gene locus_tag LOCUS_22840 45361 44111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 46456 45398 gene locus_tag LOCUS_22850 46456 45398 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228262.1 protein_id gnl|my_center|LOCUS_22850 47522 46491 gene locus_tag LOCUS_22860 47522 46491 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 protein_id gnl|my_center|LOCUS_22860 48469 47519 gene locus_tag LOCUS_22870 48469 47519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931913.1 protein_id gnl|my_center|LOCUS_22870 49478 48495 gene locus_tag LOCUS_22880 49478 48495 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475870.1 protein_id gnl|my_center|LOCUS_22880 50677 49571 gene locus_tag LOCUS_22890 50677 49571 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225897.1 protein_id gnl|my_center|LOCUS_22890 52132 50702 gene locus_tag LOCUS_22900 52132 50702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 52700 54190 gene locus_tag LOCUS_22910 52700 54190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 55383 54289 gene locus_tag LOCUS_22920 55383 54289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 56597 55386 gene locus_tag LOCUS_22930 56597 55386 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241993.1 protein_id gnl|my_center|LOCUS_22930 57763 56594 gene locus_tag LOCUS_22940 57763 56594 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922115.1 protein_id gnl|my_center|LOCUS_22940 58456 57779 gene locus_tag LOCUS_22950 58456 57779 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 protein_id gnl|my_center|LOCUS_22950 59144 58491 gene locus_tag LOCUS_22960 59144 58491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 59722 59165 gene locus_tag LOCUS_22970 gene rfbC 59722 59165 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_22970 60100 59948 gene locus_tag LOCUS_22980 60100 59948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22980 61223 60315 gene locus_tag LOCUS_22990 gene rfbA 61223 60315 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965630.1 protein_id gnl|my_center|LOCUS_22990 61681 61812 gene locus_tag LOCUS_23000 61681 61812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 62058 62249 gene locus_tag LOCUS_23010 62058 62249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 62656 62315 gene locus_tag LOCUS_23020 62656 62315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 63803 63060 gene locus_tag LOCUS_23030 gene istB 63803 63060 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041219237.1 protein_id gnl|my_center|LOCUS_23030 65354 63807 gene locus_tag LOCUS_23040 gene istA 65354 63807 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015261158.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence22 599 1594 gene locus_tag LOCUS_23050 599 1594 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964544.1 protein_id gnl|my_center|LOCUS_23050 1870 2274 gene locus_tag LOCUS_23060 1870 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2455 3525 gene locus_tag LOCUS_23070 gene orr 2455 3525 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_23070 3589 4353 gene locus_tag LOCUS_23080 3589 4353 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966014.1 protein_id gnl|my_center|LOCUS_23080 4919 4482 gene locus_tag LOCUS_23090 4919 4482 CDS product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986404.1 protein_id gnl|my_center|LOCUS_23090 5073 5981 gene locus_tag LOCUS_23100 5073 5981 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986890.1 protein_id gnl|my_center|LOCUS_23100 7517 6168 gene locus_tag LOCUS_23110 7517 6168 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948141.1 protein_id gnl|my_center|LOCUS_23110 8956 7640 gene locus_tag LOCUS_23120 gene hisS 8956 7640 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966027.1 protein_id gnl|my_center|LOCUS_23120 9285 9725 gene locus_tag LOCUS_23130 9285 9725 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391911.1 protein_id gnl|my_center|LOCUS_23130 9718 10902 gene locus_tag LOCUS_23140 gene nifS 9718 10902 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_23140 10904 11332 gene locus_tag LOCUS_23150 gene nifU 10904 11332 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_23150 11343 12419 gene locus_tag LOCUS_23160 gene mnmA 11343 12419 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948825.1 protein_id gnl|my_center|LOCUS_23160 12652 13050 gene locus_tag LOCUS_23170 gene nifU 12652 13050 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_23170 13510 14016 gene locus_tag LOCUS_23180 13510 14016 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391902.1 protein_id gnl|my_center|LOCUS_23180 14003 15031 gene locus_tag LOCUS_23190 14003 15031 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440854.1 protein_id gnl|my_center|LOCUS_23190 15411 18056 gene locus_tag LOCUS_23200 gene alaS 15411 18056 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986885.1 protein_id gnl|my_center|LOCUS_23200 18239 18493 gene locus_tag LOCUS_23210 18239 18493 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_23210 18567 18986 gene locus_tag LOCUS_23220 gene ruvX 18567 18986 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_23220 19058 19315 gene locus_tag LOCUS_23230 19058 19315 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986884.1 protein_id gnl|my_center|LOCUS_23230 19470 19922 gene locus_tag LOCUS_23240 19470 19922 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385810.1 protein_id gnl|my_center|LOCUS_23240 20096 21919 gene locus_tag LOCUS_23250 gene typA 20096 21919 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_23250 21941 22939 gene locus_tag LOCUS_23260 gene mltG 21941 22939 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964992.1 protein_id gnl|my_center|LOCUS_23260 23029 23697 gene locus_tag LOCUS_23270 23029 23697 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986882.1 protein_id gnl|my_center|LOCUS_23270 23703 24926 gene locus_tag LOCUS_23280 23703 24926 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_23280 24926 25561 gene locus_tag LOCUS_23290 gene udk 24926 25561 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986880.1 protein_id gnl|my_center|LOCUS_23290 25622 27331 gene locus_tag LOCUS_23300 25622 27331 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986879.1 protein_id gnl|my_center|LOCUS_23300 27425 28153 gene locus_tag LOCUS_23310 gene sigK 27425 28153 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_23310 28243 29022 gene locus_tag LOCUS_23320 gene aroE 28243 29022 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986860.1 protein_id gnl|my_center|LOCUS_23320 29022 30077 gene locus_tag LOCUS_23330 29022 30077 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_23330 30450 31703 gene locus_tag LOCUS_23340 gene ftsA 30450 31703 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047886.1 protein_id gnl|my_center|LOCUS_23340 31719 32810 gene locus_tag LOCUS_23350 gene ftsZ 31719 32810 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_23350 33157 33963 gene locus_tag LOCUS_23360 gene spoIIGA 33157 33963 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986857.1 protein_id gnl|my_center|LOCUS_23360 34019 34726 gene locus_tag LOCUS_23370 gene sigE 34019 34726 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399432.1 protein_id gnl|my_center|LOCUS_23370 34802 35575 gene locus_tag LOCUS_23380 gene sigG 34802 35575 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_23380 35761 36021 gene locus_tag LOCUS_23390 35761 36021 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440893.1 protein_id gnl|my_center|LOCUS_23390 36155 36610 gene locus_tag LOCUS_23400 gene nrdR 36155 36610 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_23400 36687 37400 gene locus_tag LOCUS_23410 gene pgeF 36687 37400 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518935.1 protein_id gnl|my_center|LOCUS_23410 37429 38124 gene locus_tag LOCUS_23420 37429 38124 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_23420 38127 39836 gene locus_tag LOCUS_23430 38127 39836 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965008.1 protein_id gnl|my_center|LOCUS_23430 39984 40871 gene locus_tag LOCUS_23440 39984 40871 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106652674.1 protein_id gnl|my_center|LOCUS_23440 40942 41853 gene locus_tag LOCUS_23450 gene pstC 40942 41853 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965013.1 protein_id gnl|my_center|LOCUS_23450 41853 42740 gene locus_tag LOCUS_23460 gene pstA 41853 42740 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965014.1 protein_id gnl|my_center|LOCUS_23460 42753 43505 gene locus_tag LOCUS_23470 gene pstB 42753 43505 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965015.1 protein_id gnl|my_center|LOCUS_23470 43529 44185 gene locus_tag LOCUS_23480 gene phoU 43529 44185 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986850.1 protein_id gnl|my_center|LOCUS_23480 44264 45088 gene locus_tag LOCUS_23490 44264 45088 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079990.1 protein_id gnl|my_center|LOCUS_23490 45412 46749 gene locus_tag LOCUS_23500 45412 46749 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986849.1 protein_id gnl|my_center|LOCUS_23500 46749 48065 gene locus_tag LOCUS_23510 gene der 46749 48065 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965018.1 protein_id gnl|my_center|LOCUS_23510 48067 49059 gene locus_tag LOCUS_23520 48067 49059 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986847.1 protein_id gnl|my_center|LOCUS_23520 49196 50674 gene locus_tag LOCUS_23530 gene spoIVA 49196 50674 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_23530 50786 50861 gene locus_tag LOCUS_t00400 50786 50861 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 51226 61890 gene locus_tag LOCUS_23540 51226 61890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 62471 61992 gene locus_tag LOCUS_23550 62471 61992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence23 652 326 gene locus_tag LOCUS_23560 652 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23560 1155 2378 gene locus_tag LOCUS_23570 1155 2378 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387891.1 protein_id gnl|my_center|LOCUS_23570 3087 5003 gene locus_tag LOCUS_23580 3087 5003 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860642.1 protein_id gnl|my_center|LOCUS_23580 5024 5425 gene locus_tag LOCUS_23590 5024 5425 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463973.1 protein_id gnl|my_center|LOCUS_23590 5427 5702 gene locus_tag LOCUS_23600 5427 5702 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912476.1 protein_id gnl|my_center|LOCUS_23600 5762 7138 gene locus_tag LOCUS_23610 5762 7138 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681684.1 protein_id gnl|my_center|LOCUS_23610 7380 7772 gene locus_tag LOCUS_23620 7380 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 8250 9398 gene locus_tag LOCUS_23630 8250 9398 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861734.1 protein_id gnl|my_center|LOCUS_23630 9510 9737 gene locus_tag LOCUS_23640 9510 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 10473 10676 gene locus_tag LOCUS_23650 10473 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 11550 10678 gene locus_tag LOCUS_23660 11550 10678 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986891.1 protein_id gnl|my_center|LOCUS_23660 12008 13246 gene locus_tag LOCUS_23670 gene sstT 12008 13246 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_23670 13562 13831 gene locus_tag LOCUS_23680 13562 13831 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966918.1 protein_id gnl|my_center|LOCUS_23680 13850 16300 gene locus_tag LOCUS_23690 13850 16300 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_23690 16347 16559 gene locus_tag LOCUS_23700 16347 16559 CDS product copper ion binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461873.1 protein_id gnl|my_center|LOCUS_23700 17202 17810 gene locus_tag LOCUS_23710 17202 17810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 17896 18408 gene locus_tag LOCUS_23720 17896 18408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 20283 18517 gene locus_tag LOCUS_23730 20283 18517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 20620 21042 gene locus_tag LOCUS_23740 20620 21042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 21043 21900 gene locus_tag LOCUS_23750 21043 21900 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102119.1 protein_id gnl|my_center|LOCUS_23750 22226 22381 gene locus_tag LOCUS_23760 22226 22381 CDS product small, acid-soluble spore protein, alpha/beta type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357301.1 protein_id gnl|my_center|LOCUS_23760 22867 22526 gene locus_tag LOCUS_23770 22867 22526 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876396.1 protein_id gnl|my_center|LOCUS_23770 23234 25012 gene locus_tag LOCUS_23780 23234 25012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 25419 25589 gene locus_tag LOCUS_23790 25419 25589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 26035 25559 gene locus_tag LOCUS_23800 26035 25559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 26413 26180 gene locus_tag LOCUS_23810 26413 26180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 26741 28774 gene locus_tag LOCUS_23820 26741 28774 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292052.1 protein_id gnl|my_center|LOCUS_23820 29066 29227 gene locus_tag LOCUS_23830 29066 29227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 30046 30903 gene locus_tag LOCUS_23840 30046 30903 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234896.1 protein_id gnl|my_center|LOCUS_23840 30939 45629 gene locus_tag LOCUS_23850 30939 45629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 45648 52643 gene locus_tag LOCUS_23860 45648 52643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 52727 53437 gene locus_tag LOCUS_23870 gene mubP 52727 53437 CDS product mutanobactin A biosynthesis phosphopantetheinyl transferase MubP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267537.1 protein_id gnl|my_center|LOCUS_23870 53528 54244 gene locus_tag LOCUS_23880 53528 54244 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172947.1 protein_id gnl|my_center|LOCUS_23880 54306 55511 gene locus_tag LOCUS_23890 54306 55511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 55529 58816 gene locus_tag LOCUS_23900 55529 58816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 58886 59677 gene locus_tag LOCUS_23910 58886 59677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 59667 61010 gene locus_tag LOCUS_23920 59667 61010 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888369.1 protein_id gnl|my_center|LOCUS_23920 61169 61432 gene locus_tag LOCUS_23930 61169 61432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23930 61591 62022 gene locus_tag LOCUS_23940 61591 62022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 62064 62366 gene locus_tag LOCUS_23950 62064 62366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 62404 62778 gene locus_tag LOCUS_23960 62404 62778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23960 63241 64383 gene locus_tag LOCUS_23970 63241 64383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 64420 64716 gene locus_tag LOCUS_23980 64420 64716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 65076 65573 gene locus_tag LOCUS_23990 gene accB 65076 65573 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966835.1 protein_id gnl|my_center|LOCUS_23990 65666 67009 gene locus_tag LOCUS_24000 65666 67009 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_24000 67026 67928 gene locus_tag LOCUS_24010 gene accD 67026 67928 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_24010 67928 68776 gene locus_tag LOCUS_24020 67928 68776 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048421.1 protein_id gnl|my_center|LOCUS_24020 68809 69186 gene locus_tag LOCUS_24030 68809 69186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 69717 70763 gene locus_tag LOCUS_24040 69717 70763 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355505.1 protein_id gnl|my_center|LOCUS_24040 71073 70927 gene locus_tag LOCUS_24050 71073 70927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 72243 71272 gene locus_tag LOCUS_24060 72243 71272 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889546.1 protein_id gnl|my_center|LOCUS_24060 73560 72349 gene locus_tag LOCUS_24070 73560 72349 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889545.1 protein_id gnl|my_center|LOCUS_24070 74906 75982 gene locus_tag LOCUS_24080 74906 75982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 76077 78035 gene locus_tag LOCUS_24090 76077 78035 CDS product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440007.1 protein_id gnl|my_center|LOCUS_24090 78025 78471 gene locus_tag LOCUS_24100 78025 78471 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989459.1 protein_id gnl|my_center|LOCUS_24100 78483 79526 gene locus_tag LOCUS_24110 78483 79526 CDS product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209182.1 protein_id gnl|my_center|LOCUS_24110 79561 79869 gene locus_tag LOCUS_24120 79561 79869 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422575.1 protein_id gnl|my_center|LOCUS_24120 80324 81229 gene locus_tag LOCUS_24130 80324 81229 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963875.1 protein_id gnl|my_center|LOCUS_24130 81505 82557 gene locus_tag LOCUS_24140 81505 82557 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047739.1 protein_id gnl|my_center|LOCUS_24140 83324 82920 gene locus_tag LOCUS_24150 83324 82920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 83981 83469 gene locus_tag LOCUS_24160 83981 83469 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391840.1 protein_id gnl|my_center|LOCUS_24160 84214 84014 gene locus_tag LOCUS_24170 84214 84014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 84601 85257 gene locus_tag LOCUS_24180 84601 85257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24180 85271 86002 gene locus_tag LOCUS_24190 85271 86002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24190 86315 87187 gene locus_tag LOCUS_24200 86315 87187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24200 87231 87458 gene locus_tag LOCUS_24210 87231 87458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 87478 88011 gene locus_tag LOCUS_24220 87478 88011 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948455.1 protein_id gnl|my_center|LOCUS_24220 88095 88319 gene locus_tag LOCUS_24230 88095 88319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 88388 88624 gene locus_tag LOCUS_24240 88388 88624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 89007 88795 gene locus_tag LOCUS_24250 89007 88795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 89403 90278 gene locus_tag LOCUS_24260 89403 90278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 90401 90793 gene locus_tag LOCUS_24270 90401 90793 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963397.1 protein_id gnl|my_center|LOCUS_24270 91497 91078 gene locus_tag LOCUS_24280 91497 91078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24280 91698 91528 gene locus_tag LOCUS_24290 91698 91528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24290 92285 91815 gene locus_tag LOCUS_24300 92285 91815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24300 92590 92411 gene locus_tag LOCUS_24310 92590 92411 CDS product cysteine-rich KTR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012962334.1 protein_id gnl|my_center|LOCUS_24310 92964 92614 gene locus_tag LOCUS_24320 92964 92614 CDS product DUF1048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379381.1 protein_id gnl|my_center|LOCUS_24320 93321 92974 gene locus_tag LOCUS_24330 93321 92974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 93644 93318 gene locus_tag LOCUS_24340 93644 93318 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429484.1 protein_id gnl|my_center|LOCUS_24340 93935 94285 gene locus_tag LOCUS_24350 93935 94285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 94591 94950 gene locus_tag LOCUS_24360 94591 94950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 95538 95074 gene locus_tag LOCUS_24370 95538 95074 CDS product iron dependent repressor, metal binding and dimerization domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965904.1 protein_id gnl|my_center|LOCUS_24370 95736 97004 gene locus_tag LOCUS_24380 95736 97004 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890748.1 protein_id gnl|my_center|LOCUS_24380 97307 97930 gene locus_tag LOCUS_24390 97307 97930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 98615 98256 gene locus_tag LOCUS_24400 98615 98256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 99078 99836 gene locus_tag LOCUS_24410 99078 99836 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180345.1 protein_id gnl|my_center|LOCUS_24410 100318 100037 gene locus_tag LOCUS_24420 100318 100037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24420 100720 100872 gene locus_tag LOCUS_24430 100720 100872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 101170 100874 gene locus_tag LOCUS_24440 101170 100874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 101602 101787 gene locus_tag LOCUS_24450 101602 101787 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_24450 102134 102343 gene locus_tag LOCUS_24460 102134 102343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 102402 102812 gene locus_tag LOCUS_24470 102402 102812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 105033 103051 gene locus_tag LOCUS_24480 105033 103051 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_24480 106195 105377 gene locus_tag LOCUS_24490 106195 105377 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814219.1 protein_id gnl|my_center|LOCUS_24490 106488 107759 gene locus_tag LOCUS_24500 106488 107759 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379246.1 protein_id gnl|my_center|LOCUS_24500 109073 108903 gene locus_tag LOCUS_24510 109073 108903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 109491 109616 gene locus_tag LOCUS_24520 109491 109616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 110752 111003 gene locus_tag LOCUS_24530 110752 111003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 111377 111195 gene locus_tag LOCUS_24540 111377 111195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 111585 111424 gene locus_tag LOCUS_24550 111585 111424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 111988 112227 gene locus_tag LOCUS_24560 111988 112227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 112316 112630 gene locus_tag LOCUS_24570 112316 112630 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116400.1 protein_id gnl|my_center|LOCUS_24570 113621 112662 gene locus_tag LOCUS_24580 113621 112662 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836485.1 protein_id gnl|my_center|LOCUS_24580 114367 113636 gene locus_tag LOCUS_24590 114367 113636 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144450.1 protein_id gnl|my_center|LOCUS_24590 115026 114367 gene locus_tag LOCUS_24600 115026 114367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24600 115238 115104 gene locus_tag LOCUS_24610 115238 115104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 116206 115385 gene locus_tag LOCUS_24620 116206 115385 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836450.1 protein_id gnl|my_center|LOCUS_24620 118425 116416 gene locus_tag LOCUS_24630 118425 116416 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292052.1 protein_id gnl|my_center|LOCUS_24630 118786 119709 gene locus_tag LOCUS_24640 118786 119709 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767200.1 protein_id gnl|my_center|LOCUS_24640 119725 120069 gene locus_tag LOCUS_24650 119725 120069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 121138 120407 gene locus_tag LOCUS_24660 121138 120407 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_24660 121823 121143 gene locus_tag LOCUS_24670 121823 121143 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809541.1 protein_id gnl|my_center|LOCUS_24670 122708 121917 gene locus_tag LOCUS_24680 122708 121917 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823741.1 protein_id gnl|my_center|LOCUS_24680 122836 122705 gene locus_tag LOCUS_24690 122836 122705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 124156 123983 gene locus_tag LOCUS_24700 124156 123983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 124436 124678 gene locus_tag LOCUS_24710 124436 124678 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205227.1 protein_id gnl|my_center|LOCUS_24710 124668 125705 gene locus_tag LOCUS_24720 124668 125705 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_24720 125879 126136 gene locus_tag LOCUS_24730 125879 126136 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272532.1 protein_id gnl|my_center|LOCUS_24730 126138 126452 gene locus_tag LOCUS_24740 126138 126452 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817080.1 protein_id gnl|my_center|LOCUS_24740 126713 126877 gene locus_tag LOCUS_24750 126713 126877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964799.1 protein_id gnl|my_center|LOCUS_24750 126880 127137 gene locus_tag LOCUS_24760 126880 127137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 127684 127415 gene locus_tag LOCUS_24770 127684 127415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 128013 128627 gene locus_tag LOCUS_24780 128013 128627 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_24780 128624 129190 gene locus_tag LOCUS_24790 128624 129190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24790 129187 129429 gene locus_tag LOCUS_24800 129187 129429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 130577 129735 gene locus_tag LOCUS_24810 130577 129735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 130985 132388 gene locus_tag LOCUS_24820 130985 132388 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053435486.1 protein_id gnl|my_center|LOCUS_24820 132626 133000 gene locus_tag LOCUS_24830 132626 133000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 133267 133431 gene locus_tag LOCUS_24840 133267 133431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964799.1 protein_id gnl|my_center|LOCUS_24840 133830 133645 gene locus_tag LOCUS_24850 133830 133645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 133978 133856 gene locus_tag LOCUS_24860 133978 133856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 134723 134139 gene locus_tag LOCUS_24870 134723 134139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 135288 135629 gene locus_tag LOCUS_24880 135288 135629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 136075 136608 gene locus_tag LOCUS_24890 136075 136608 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948455.1 protein_id gnl|my_center|LOCUS_24890 136688 136912 gene locus_tag LOCUS_24900 136688 136912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 136982 137218 gene locus_tag LOCUS_24910 136982 137218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 137483 139663 gene locus_tag LOCUS_24920 137483 139663 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816115.1 protein_id gnl|my_center|LOCUS_24920 139665 140768 gene locus_tag LOCUS_24930 139665 140768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 141384 142706 gene locus_tag LOCUS_24940 141384 142706 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876134.1 protein_id gnl|my_center|LOCUS_24940 143485 145518 gene locus_tag LOCUS_24950 143485 145518 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 protein_id gnl|my_center|LOCUS_24950 145537 148116 gene locus_tag LOCUS_24960 145537 148116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 148131 149858 gene locus_tag LOCUS_24970 148131 149858 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727568.1 protein_id gnl|my_center|LOCUS_24970 149858 153253 gene locus_tag LOCUS_24980 149858 153253 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861850.1 protein_id gnl|my_center|LOCUS_24980 153256 155097 gene locus_tag LOCUS_24990 153256 155097 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861851.1 protein_id gnl|my_center|LOCUS_24990 155401 156864 gene locus_tag LOCUS_25000 155401 156864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 156839 159226 gene locus_tag LOCUS_25010 156839 159226 CDS product restriction endonuclease-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459237.1 protein_id gnl|my_center|LOCUS_25010 159446 160654 gene locus_tag LOCUS_25020 159446 160654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 160973 161194 gene locus_tag LOCUS_25030 160973 161194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 163883 161259 gene locus_tag LOCUS_25040 163883 161259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 164853 165119 gene locus_tag LOCUS_25050 164853 165119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 166874 165450 gene locus_tag LOCUS_25060 166874 165450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25060 168405 167026 gene locus_tag LOCUS_25070 168405 167026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 168982 168782 gene locus_tag LOCUS_25080 168982 168782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 169194 169445 gene locus_tag LOCUS_25090 169194 169445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 169486 169881 gene locus_tag LOCUS_25100 169486 169881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 170058 170801 gene locus_tag LOCUS_25110 170058 170801 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812594.1 protein_id gnl|my_center|LOCUS_25110 170917 172428 gene locus_tag LOCUS_25120 170917 172428 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_25120 172915 172598 gene locus_tag LOCUS_25130 172915 172598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 174640 172949 gene locus_tag LOCUS_25140 174640 172949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 175445 174747 gene locus_tag LOCUS_25150 175445 174747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 175629 175805 gene locus_tag LOCUS_25160 175629 175805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 176112 176534 gene locus_tag LOCUS_25170 176112 176534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25170 177022 177153 gene locus_tag LOCUS_25180 177022 177153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 177189 177599 gene locus_tag LOCUS_25190 177189 177599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 178189 178350 gene locus_tag LOCUS_25200 178189 178350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 178606 180015 gene locus_tag LOCUS_25210 178606 180015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 181045 180140 gene locus_tag LOCUS_25220 181045 180140 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987048.1 protein_id gnl|my_center|LOCUS_25220 181787 182002 gene locus_tag LOCUS_25230 181787 182002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25230 181971 182477 gene locus_tag LOCUS_25240 181971 182477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25240 183142 184464 gene locus_tag LOCUS_25250 183142 184464 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963649.1 protein_id gnl|my_center|LOCUS_25250 184731 184537 gene locus_tag LOCUS_25260 184731 184537 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943836.1 protein_id gnl|my_center|LOCUS_25260 185114 187252 gene locus_tag LOCUS_25270 185114 187252 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986653.1 protein_id gnl|my_center|LOCUS_25270 187275 187556 gene locus_tag LOCUS_25280 187275 187556 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004714840.1 protein_id gnl|my_center|LOCUS_25280 187607 188881 gene locus_tag LOCUS_25290 187607 188881 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681684.1 protein_id gnl|my_center|LOCUS_25290 188947 189783 gene locus_tag LOCUS_25300 188947 189783 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_25300 189776 190708 gene locus_tag LOCUS_25310 189776 190708 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_25310 190719 191063 gene locus_tag LOCUS_25320 190719 191063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 191370 191810 gene locus_tag LOCUS_25330 191370 191810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 191823 192296 gene locus_tag LOCUS_25340 191823 192296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 193566 192493 gene locus_tag LOCUS_25350 193566 192493 CDS product reductive dehalogenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889925.1 protein_id gnl|my_center|LOCUS_25350 194280 193654 gene locus_tag LOCUS_25360 194280 193654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25360 194719 194216 gene locus_tag LOCUS_25370 194719 194216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25370 195027 194848 gene locus_tag LOCUS_25380 195027 194848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25380 196711 195290 gene locus_tag LOCUS_25390 196711 195290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 196875 197615 gene locus_tag LOCUS_25400 196875 197615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 198889 197747 gene locus_tag LOCUS_25410 198889 197747 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583054.1 protein_id gnl|my_center|LOCUS_25410 199125 199865 gene locus_tag LOCUS_25420 199125 199865 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965976.1 protein_id gnl|my_center|LOCUS_25420 200482 200132 gene locus_tag LOCUS_25430 200482 200132 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909986.1 protein_id gnl|my_center|LOCUS_25430 202098 200536 gene locus_tag LOCUS_25440 gene lsrK 202098 200536 CDS product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018815.1 protein_id gnl|my_center|LOCUS_25440 203154 202213 gene locus_tag LOCUS_25450 203154 202213 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192701.1 protein_id gnl|my_center|LOCUS_25450 203586 205118 gene locus_tag LOCUS_25460 203586 205118 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432606.1 protein_id gnl|my_center|LOCUS_25460 205123 206139 gene locus_tag LOCUS_25470 205123 206139 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827505.1 protein_id gnl|my_center|LOCUS_25470 206142 207161 gene locus_tag LOCUS_25480 206142 207161 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878507.1 protein_id gnl|my_center|LOCUS_25480 207269 208366 gene locus_tag LOCUS_25490 gene lsrB 207269 208366 CDS product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823665.1 protein_id gnl|my_center|LOCUS_25490 208596 209480 gene locus_tag LOCUS_25500 gene lsrF 208596 209480 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933433.1 protein_id gnl|my_center|LOCUS_25500 209571 209723 gene locus_tag LOCUS_25510 209571 209723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25510 209771 210193 gene locus_tag LOCUS_25520 209771 210193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25520 210615 210397 gene locus_tag LOCUS_25530 210615 210397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 211189 211482 gene locus_tag LOCUS_25540 211189 211482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 211573 211725 gene locus_tag LOCUS_25550 211573 211725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 211768 212055 gene locus_tag LOCUS_25560 211768 212055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 212645 213376 gene locus_tag LOCUS_25570 212645 213376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 213481 214200 gene locus_tag LOCUS_25580 213481 214200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 214255 214836 gene locus_tag LOCUS_25590 214255 214836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 215357 217117 gene locus_tag LOCUS_25600 215357 217117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25600 217190 219535 gene locus_tag LOCUS_25610 217190 219535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25610 219674 219868 gene locus_tag LOCUS_25620 219674 219868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 219908 220594 gene locus_tag LOCUS_25630 219908 220594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 220686 221678 gene locus_tag LOCUS_25640 220686 221678 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476185.1 protein_id gnl|my_center|LOCUS_25640 221919 222260 gene locus_tag LOCUS_25650 221919 222260 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419063.1 protein_id gnl|my_center|LOCUS_25650 222253 222837 gene locus_tag LOCUS_25660 222253 222837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 223008 223418 gene locus_tag LOCUS_25670 223008 223418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 224500 223535 gene locus_tag LOCUS_25680 224500 223535 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016517.1 protein_id gnl|my_center|LOCUS_25680 224613 225374 gene locus_tag LOCUS_25690 224613 225374 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_25690 225904 226746 gene locus_tag LOCUS_25700 225904 226746 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814503.1 protein_id gnl|my_center|LOCUS_25700 226777 227505 gene locus_tag LOCUS_25710 226777 227505 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_25710 227576 228316 gene locus_tag LOCUS_25720 227576 228316 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459577.1 protein_id gnl|my_center|LOCUS_25720 228515 229036 gene locus_tag LOCUS_25730 228515 229036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 229333 231735 gene locus_tag LOCUS_25740 229333 231735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 232314 232613 gene locus_tag LOCUS_25750 232314 232613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 232666 233049 gene locus_tag LOCUS_25760 232666 233049 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_25760 233051 233743 gene locus_tag LOCUS_25770 233051 233743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 234120 234989 gene locus_tag LOCUS_25780 234120 234989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 235612 235773 gene locus_tag LOCUS_25790 235612 235773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 235956 237653 gene locus_tag LOCUS_25800 235956 237653 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_25800 238298 237741 gene locus_tag LOCUS_25810 238298 237741 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_25810 238598 239752 gene locus_tag LOCUS_25820 238598 239752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 239816 240154 gene locus_tag LOCUS_25830 239816 240154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 >Feature sequence24 171 280 gene locus_tag LOCUS_r00020 171 280 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 290 364 gene locus_tag LOCUS_t00410 290 364 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 400 511 gene locus_tag LOCUS_r00030 400 511 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 655 2448 gene locus_tag LOCUS_25840 655 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2451 3758 gene locus_tag LOCUS_25850 2451 3758 CDS product LlaJI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059984.1 protein_id gnl|my_center|LOCUS_25850 4051 3884 gene locus_tag LOCUS_25860 4051 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 4308 4039 gene locus_tag LOCUS_25870 4308 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 4684 5415 gene locus_tag LOCUS_25880 4684 5415 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920153.1 protein_id gnl|my_center|LOCUS_25880 5701 6777 gene locus_tag LOCUS_25890 5701 6777 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356041.1 protein_id gnl|my_center|LOCUS_25890 6820 8619 gene locus_tag LOCUS_25900 6820 8619 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_25900 8652 10016 gene locus_tag LOCUS_25910 8652 10016 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891344.1 protein_id gnl|my_center|LOCUS_25910 10312 12105 gene locus_tag LOCUS_25920 10312 12105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 12331 12657 gene locus_tag LOCUS_25930 12331 12657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 12848 13228 gene locus_tag LOCUS_25940 12848 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 13600 13403 gene locus_tag LOCUS_25950 13600 13403 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356423.1 protein_id gnl|my_center|LOCUS_25950 13869 14945 gene locus_tag LOCUS_25960 13869 14945 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963632.1 protein_id gnl|my_center|LOCUS_25960 15233 15403 gene locus_tag LOCUS_25970 15233 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 15481 16422 gene locus_tag LOCUS_25980 15481 16422 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_25980 16611 17516 gene locus_tag LOCUS_25990 gene murQ 16611 17516 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948949.1 protein_id gnl|my_center|LOCUS_25990 17534 18895 gene locus_tag LOCUS_26000 17534 18895 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948950.1 protein_id gnl|my_center|LOCUS_26000 18983 20062 gene locus_tag LOCUS_26010 18983 20062 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948951.1 protein_id gnl|my_center|LOCUS_26010 20095 20937 gene locus_tag LOCUS_26020 20095 20937 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948948.1 protein_id gnl|my_center|LOCUS_26020 21005 21694 gene locus_tag LOCUS_26030 21005 21694 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706813.1 protein_id gnl|my_center|LOCUS_26030 22694 23389 gene locus_tag LOCUS_26040 22694 23389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 23539 24078 gene locus_tag LOCUS_26050 23539 24078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 24693 24349 gene locus_tag LOCUS_26060 24693 24349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 25177 25413 gene locus_tag LOCUS_26070 25177 25413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26070 25427 25669 gene locus_tag LOCUS_26080 25427 25669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 27068 25677 gene locus_tag LOCUS_26090 27068 25677 CDS product IS4-like element ISDha5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808317.1 protein_id gnl|my_center|LOCUS_26090 28084 27377 gene locus_tag LOCUS_26100 28084 27377 CDS product DUF3169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698749.1 protein_id gnl|my_center|LOCUS_26100 28301 28059 gene locus_tag LOCUS_26110 28301 28059 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776166.1 protein_id gnl|my_center|LOCUS_26110 28401 28249 gene locus_tag LOCUS_26120 28401 28249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 28547 29209 gene locus_tag LOCUS_26130 28547 29209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 29272 29727 gene locus_tag LOCUS_26140 gene msrB 29272 29727 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964858.1 protein_id gnl|my_center|LOCUS_26140 29990 30565 gene locus_tag LOCUS_26150 29990 30565 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262803.1 protein_id gnl|my_center|LOCUS_26150 30691 31671 gene locus_tag LOCUS_26160 30691 31671 CDS product DUF5692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948196.1 protein_id gnl|my_center|LOCUS_26160 31796 33565 gene locus_tag LOCUS_26170 31796 33565 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_26170 33590 34261 gene locus_tag LOCUS_26180 gene hypB 33590 34261 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_26180 34296 36965 gene locus_tag LOCUS_26190 34296 36965 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948194.1 protein_id gnl|my_center|LOCUS_26190 37060 37401 gene locus_tag LOCUS_26200 37060 37401 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359645.1 protein_id gnl|my_center|LOCUS_26200 38400 37603 gene locus_tag LOCUS_26210 38400 37603 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966749.1 protein_id gnl|my_center|LOCUS_26210 38740 39156 gene locus_tag LOCUS_26220 38740 39156 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069435.1 protein_id gnl|my_center|LOCUS_26220 40229 39225 gene locus_tag LOCUS_26230 40229 39225 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_26230 41518 40232 gene locus_tag LOCUS_26240 41518 40232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 43143 43577 gene locus_tag LOCUS_26250 43143 43577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 43574 44971 gene locus_tag LOCUS_26260 43574 44971 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_26260 45274 45723 gene locus_tag LOCUS_26270 45274 45723 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964194.1 protein_id gnl|my_center|LOCUS_26270 45763 46695 gene locus_tag LOCUS_26280 45763 46695 CDS product N(5)-(carboxyethyl)ornithine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948261.1 protein_id gnl|my_center|LOCUS_26280 47404 49146 gene locus_tag LOCUS_26290 47404 49146 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434478.1 protein_id gnl|my_center|LOCUS_26290 49479 51437 gene locus_tag LOCUS_26300 49479 51437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 51880 52938 gene locus_tag LOCUS_26310 51880 52938 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963520.1 protein_id gnl|my_center|LOCUS_26310 53275 54726 gene locus_tag LOCUS_26320 53275 54726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 54766 55086 gene locus_tag LOCUS_26330 54766 55086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 55207 55761 gene locus_tag LOCUS_26340 55207 55761 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948547.1 protein_id gnl|my_center|LOCUS_26340 56196 55693 gene locus_tag LOCUS_26350 56196 55693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 56612 56860 gene locus_tag LOCUS_26360 56612 56860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26360 57648 56977 gene locus_tag LOCUS_26370 57648 56977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence25 154 399 gene locus_tag LOCUS_26380 154 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 567 2654 gene locus_tag LOCUS_26390 gene pbpC 567 2654 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227211.1 protein_id gnl|my_center|LOCUS_26390 2777 3550 gene locus_tag LOCUS_26400 2777 3550 CDS product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016390.1 protein_id gnl|my_center|LOCUS_26400 3562 4791 gene locus_tag LOCUS_26410 3562 4791 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234422.1 protein_id gnl|my_center|LOCUS_26410 4808 4975 gene locus_tag LOCUS_26420 4808 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 4975 5544 gene locus_tag LOCUS_26430 4975 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26430 5541 6575 gene locus_tag LOCUS_26440 5541 6575 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896290.1 protein_id gnl|my_center|LOCUS_26440 6636 8735 gene locus_tag LOCUS_26450 6636 8735 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_26450 8967 11003 gene locus_tag LOCUS_26460 8967 11003 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861581.1 protein_id gnl|my_center|LOCUS_26460 11848 11126 gene locus_tag LOCUS_26470 11848 11126 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048308.1 protein_id gnl|my_center|LOCUS_26470 12958 11930 gene locus_tag LOCUS_26480 12958 11930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 13653 13012 gene locus_tag LOCUS_26490 13653 13012 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964101.1 protein_id gnl|my_center|LOCUS_26490 14755 13808 gene locus_tag LOCUS_26500 14755 13808 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_26500 14915 14736 gene locus_tag LOCUS_26510 14915 14736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 15002 15169 gene locus_tag LOCUS_26520 15002 15169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 15343 16356 gene locus_tag LOCUS_26530 gene aroF 15343 16356 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_26530 16369 17220 gene locus_tag LOCUS_26540 16369 17220 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_26540 17222 18298 gene locus_tag LOCUS_26550 gene aroB 17222 18298 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893310.1 protein_id gnl|my_center|LOCUS_26550 18328 19650 gene locus_tag LOCUS_26560 gene aroA 18328 19650 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_26560 19631 20701 gene locus_tag LOCUS_26570 gene aroC 19631 20701 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_26570 20761 21876 gene locus_tag LOCUS_26580 gene pheA 20761 21876 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_26580 22098 22523 gene locus_tag LOCUS_26590 gene aroQ 22098 22523 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_26590 22583 23443 gene locus_tag LOCUS_26600 22583 23443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 24620 23487 gene locus_tag LOCUS_26610 24620 23487 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986515.1 protein_id gnl|my_center|LOCUS_26610 25729 24617 gene locus_tag LOCUS_26620 25729 24617 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986766.1 protein_id gnl|my_center|LOCUS_26620 27209 25722 gene locus_tag LOCUS_26630 27209 25722 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986513.1 protein_id gnl|my_center|LOCUS_26630 27726 27571 gene locus_tag LOCUS_26640 27726 27571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26640 28229 27771 gene locus_tag LOCUS_26650 28229 27771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26650 28616 28296 gene locus_tag LOCUS_26660 28616 28296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26660 29230 28880 gene locus_tag LOCUS_26670 29230 28880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 29870 29244 gene locus_tag LOCUS_26680 29870 29244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26680 30701 31261 gene locus_tag LOCUS_26690 gene cobU 30701 31261 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891982.1 protein_id gnl|my_center|LOCUS_26690 31339 32283 gene locus_tag LOCUS_26700 31339 32283 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948944.1 protein_id gnl|my_center|LOCUS_26700 32300 33352 gene locus_tag LOCUS_26710 32300 33352 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948945.1 protein_id gnl|my_center|LOCUS_26710 33353 34117 gene locus_tag LOCUS_26720 33353 34117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948946.1 protein_id gnl|my_center|LOCUS_26720 34293 34511 gene locus_tag LOCUS_26730 34293 34511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 34740 34871 gene locus_tag LOCUS_26740 34740 34871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 34834 35130 gene locus_tag LOCUS_26750 34834 35130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 35167 36138 gene locus_tag LOCUS_26760 35167 36138 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079950.1 protein_id gnl|my_center|LOCUS_26760 36287 36679 gene locus_tag LOCUS_26770 36287 36679 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963397.1 protein_id gnl|my_center|LOCUS_26770 37036 38304 gene locus_tag LOCUS_26780 37036 38304 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949109.1 protein_id gnl|my_center|LOCUS_26780 38304 38951 gene locus_tag LOCUS_26790 gene hisG 38304 38951 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964254.1 protein_id gnl|my_center|LOCUS_26790 38951 40243 gene locus_tag LOCUS_26800 gene hisD 38951 40243 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_26800 40243 41304 gene locus_tag LOCUS_26810 gene hisC 40243 41304 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889400.1 protein_id gnl|my_center|LOCUS_26810 41349 41939 gene locus_tag LOCUS_26820 gene hisB 41349 41939 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964256.1 protein_id gnl|my_center|LOCUS_26820 41953 42555 gene locus_tag LOCUS_26830 gene hisH 41953 42555 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949113.1 protein_id gnl|my_center|LOCUS_26830 42555 43286 gene locus_tag LOCUS_26840 gene hisA 42555 43286 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949114.1 protein_id gnl|my_center|LOCUS_26840 43276 44037 gene locus_tag LOCUS_26850 gene hisF 43276 44037 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949116.1 protein_id gnl|my_center|LOCUS_26850 44066 44410 gene locus_tag LOCUS_26860 gene hisI 44066 44410 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397763.1 protein_id gnl|my_center|LOCUS_26860 44452 44787 gene locus_tag LOCUS_26870 gene hisE 44452 44787 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949117.1 protein_id gnl|my_center|LOCUS_26870 45892 44882 gene locus_tag LOCUS_26880 45892 44882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 46265 48145 gene locus_tag LOCUS_26890 gene htpG 46265 48145 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986521.1 protein_id gnl|my_center|LOCUS_26890 48307 49071 gene locus_tag LOCUS_26900 gene aroD 48307 49071 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721277.1 protein_id gnl|my_center|LOCUS_26900 49130 49633 gene locus_tag LOCUS_26910 49130 49633 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964216.1 protein_id gnl|my_center|LOCUS_26910 49739 50521 gene locus_tag LOCUS_26920 49739 50521 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948820.1 protein_id gnl|my_center|LOCUS_26920 50928 50590 gene locus_tag LOCUS_26930 50928 50590 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966753.1 protein_id gnl|my_center|LOCUS_26930 51174 51458 gene locus_tag LOCUS_26940 51174 51458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 51525 52160 gene locus_tag LOCUS_26950 51525 52160 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048406.1 protein_id gnl|my_center|LOCUS_26950 52480 52253 gene locus_tag LOCUS_26960 52480 52253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 >Feature sequence26 312 875 gene locus_tag LOCUS_26970 312 875 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459533.1 protein_id gnl|my_center|LOCUS_26970 879 1616 gene locus_tag LOCUS_26980 879 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26980 1600 2241 gene locus_tag LOCUS_26990 1600 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 2211 2426 gene locus_tag LOCUS_27000 2211 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 2919 3488 gene locus_tag LOCUS_27010 2919 3488 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986737.1 protein_id gnl|my_center|LOCUS_27010 3793 4323 gene locus_tag LOCUS_27020 3793 4323 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948534.1 protein_id gnl|my_center|LOCUS_27020 4324 4473 gene locus_tag LOCUS_27030 4324 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 4535 4723 gene locus_tag LOCUS_27040 4535 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 4720 4857 gene locus_tag LOCUS_27050 4720 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 4991 5452 gene locus_tag LOCUS_27060 4991 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 5621 5869 gene locus_tag LOCUS_27070 5621 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 10415 6015 gene locus_tag LOCUS_27080 10415 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 11124 10408 gene locus_tag LOCUS_27090 11124 10408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 12753 11137 gene locus_tag LOCUS_27100 12753 11137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 13811 12804 gene locus_tag LOCUS_27110 13811 12804 CDS product DUF2220 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233576.1 protein_id gnl|my_center|LOCUS_27110 14028 14207 gene locus_tag LOCUS_27120 14028 14207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 14303 14545 gene locus_tag LOCUS_27130 14303 14545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 14926 15084 gene locus_tag LOCUS_27140 14926 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 15262 15396 gene locus_tag LOCUS_27150 15262 15396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 15408 15752 gene locus_tag LOCUS_27160 15408 15752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27160 15902 16144 gene locus_tag LOCUS_27170 15902 16144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 16703 16906 gene locus_tag LOCUS_27180 16703 16906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 17082 17732 gene locus_tag LOCUS_27190 17082 17732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 18163 18690 gene locus_tag LOCUS_27200 18163 18690 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108270.1 protein_id gnl|my_center|LOCUS_27200 18757 20739 gene locus_tag LOCUS_27210 18757 20739 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244290.1 protein_id gnl|my_center|LOCUS_27210 21629 21231 gene locus_tag LOCUS_27220 21629 21231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 21999 22181 gene locus_tag LOCUS_27230 21999 22181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 22234 23634 gene locus_tag LOCUS_27240 22234 23634 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012297.1 protein_id gnl|my_center|LOCUS_27240 23843 24703 gene locus_tag LOCUS_27250 23843 24703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 24748 25029 gene locus_tag LOCUS_27260 24748 25029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 25110 25661 gene locus_tag LOCUS_27270 25110 25661 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213632.1 protein_id gnl|my_center|LOCUS_27270 26126 27103 gene locus_tag LOCUS_27280 26126 27103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 27506 27123 gene locus_tag LOCUS_27290 27506 27123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 29602 27575 gene locus_tag LOCUS_27300 29602 27575 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439994.1 protein_id gnl|my_center|LOCUS_27300 29913 31274 gene locus_tag LOCUS_27310 29913 31274 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902956.1 protein_id gnl|my_center|LOCUS_27310 31308 33023 gene locus_tag LOCUS_27320 31308 33023 CDS product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384673.1 protein_id gnl|my_center|LOCUS_27320 34050 33415 gene locus_tag LOCUS_27330 34050 33415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 34612 34911 gene locus_tag LOCUS_27340 34612 34911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27340 35136 37220 gene locus_tag LOCUS_27350 35136 37220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861077.1 protein_id gnl|my_center|LOCUS_27350 37198 39438 gene locus_tag LOCUS_27360 37198 39438 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437942.1 protein_id gnl|my_center|LOCUS_27360 39425 40174 gene locus_tag LOCUS_27370 39425 40174 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428590.1 protein_id gnl|my_center|LOCUS_27370 40122 40325 gene locus_tag LOCUS_27380 40122 40325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 40450 40782 gene locus_tag LOCUS_27390 40450 40782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 40879 41562 gene locus_tag LOCUS_27400 40879 41562 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948485.1 protein_id gnl|my_center|LOCUS_27400 41684 42610 gene locus_tag LOCUS_27410 41684 42610 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948486.1 protein_id gnl|my_center|LOCUS_27410 42607 43383 gene locus_tag LOCUS_27420 42607 43383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 43417 44358 gene locus_tag LOCUS_27430 43417 44358 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964181.1 protein_id gnl|my_center|LOCUS_27430 45201 44521 gene locus_tag LOCUS_27440 45201 44521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 45458 45637 gene locus_tag LOCUS_27450 45458 45637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 45600 45980 gene locus_tag LOCUS_27460 45600 45980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 46398 46096 gene locus_tag LOCUS_27470 46398 46096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 46729 46364 gene locus_tag LOCUS_27480 46729 46364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 47567 47211 gene locus_tag LOCUS_27490 47567 47211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 47804 48025 gene locus_tag LOCUS_27500 47804 48025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 48255 48665 gene locus_tag LOCUS_27510 48255 48665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27510 48867 50063 gene locus_tag LOCUS_27520 48867 50063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 50417 51073 gene locus_tag LOCUS_27530 50417 51073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986597.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence27 420 1190 gene locus_tag LOCUS_27540 420 1190 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864434.1 protein_id gnl|my_center|LOCUS_27540 1172 2263 gene locus_tag LOCUS_27550 gene rfbG 1172 2263 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202465.1 protein_id gnl|my_center|LOCUS_27550 2276 3214 gene locus_tag LOCUS_27560 2276 3214 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561952.1 protein_id gnl|my_center|LOCUS_27560 3227 4987 gene locus_tag LOCUS_27570 3227 4987 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261041.1 protein_id gnl|my_center|LOCUS_27570 4968 6317 gene locus_tag LOCUS_27580 gene rfbH 4968 6317 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227240.1 protein_id gnl|my_center|LOCUS_27580 7897 6401 gene locus_tag LOCUS_27590 7897 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 9013 7943 gene locus_tag LOCUS_27600 9013 7943 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_27600 9254 10663 gene locus_tag LOCUS_27610 9254 10663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 10802 11098 gene locus_tag LOCUS_27620 10802 11098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 11178 11963 gene locus_tag LOCUS_27630 11178 11963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 12023 14044 gene locus_tag LOCUS_27640 12023 14044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 14047 15123 gene locus_tag LOCUS_27650 gene cap8G 14047 15123 CDS product type 8 capsular polysaccharide synthesis protein Cap8G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413171.1 protein_id gnl|my_center|LOCUS_27650 15138 16025 gene locus_tag LOCUS_27660 15138 16025 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202924.1 protein_id gnl|my_center|LOCUS_27660 16018 17034 gene locus_tag LOCUS_27670 16018 17034 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932614.1 protein_id gnl|my_center|LOCUS_27670 18881 17097 gene locus_tag LOCUS_27680 18881 17097 CDS product TPR domain-containing glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966580.1 protein_id gnl|my_center|LOCUS_27680 19275 20120 gene locus_tag LOCUS_27690 19275 20120 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389749.1 protein_id gnl|my_center|LOCUS_27690 20341 21288 gene locus_tag LOCUS_27700 gene rmgP 20341 21288 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_27700 21299 22180 gene locus_tag LOCUS_27710 21299 22180 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_27710 22315 23775 gene locus_tag LOCUS_27720 22315 23775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 23886 24089 gene locus_tag LOCUS_27730 23886 24089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 24035 24205 gene locus_tag LOCUS_27740 24035 24205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 24423 25622 gene locus_tag LOCUS_27750 24423 25622 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521514.1 protein_id gnl|my_center|LOCUS_27750 29181 25774 gene locus_tag LOCUS_27760 29181 25774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 29377 37455 gene locus_tag LOCUS_27770 29377 37455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 37596 38084 gene locus_tag LOCUS_27780 37596 38084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 38099 39004 gene locus_tag LOCUS_27790 38099 39004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361909.1 protein_id gnl|my_center|LOCUS_27790 39253 40734 gene locus_tag LOCUS_27800 gene cls 39253 40734 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243311.1 protein_id gnl|my_center|LOCUS_27800 40899 41450 gene locus_tag LOCUS_27810 40899 41450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 43145 41952 gene locus_tag LOCUS_27820 43145 41952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 43566 46286 gene locus_tag LOCUS_27830 43566 46286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 46419 46991 gene locus_tag LOCUS_27840 46419 46991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 47208 47543 gene locus_tag LOCUS_27850 47208 47543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 47540 47911 gene locus_tag LOCUS_27860 gene tnpB 47540 47911 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748777.1 protein_id gnl|my_center|LOCUS_27860 47990 49042 gene locus_tag LOCUS_27870 47990 49042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence28 548 733 gene locus_tag LOCUS_27880 548 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 1249 716 gene locus_tag LOCUS_27890 1249 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 2618 1374 gene locus_tag LOCUS_27900 gene ltrA 2618 1374 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024495.1 protein_id gnl|my_center|LOCUS_27900 3858 3127 gene locus_tag LOCUS_27910 3858 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 4488 4309 gene locus_tag LOCUS_27920 4488 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 5751 4618 gene locus_tag LOCUS_27930 5751 4618 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986549.1 protein_id gnl|my_center|LOCUS_27930 6067 6918 gene locus_tag LOCUS_27940 6067 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 8281 7166 gene locus_tag LOCUS_27950 8281 7166 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890698.1 protein_id gnl|my_center|LOCUS_27950 8852 8403 gene locus_tag LOCUS_27960 8852 8403 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980328.1 protein_id gnl|my_center|LOCUS_27960 9352 8882 gene locus_tag LOCUS_27970 9352 8882 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 protein_id gnl|my_center|LOCUS_27970 9937 10959 gene locus_tag LOCUS_27980 gene asnA 9937 10959 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_27980 11755 11051 gene locus_tag LOCUS_27990 11755 11051 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_27990 12217 11906 gene locus_tag LOCUS_28000 12217 11906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 12396 12695 gene locus_tag LOCUS_28010 12396 12695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810433.1 protein_id gnl|my_center|LOCUS_28010 12874 15402 gene locus_tag LOCUS_28020 12874 15402 CDS product YceG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964719.1 protein_id gnl|my_center|LOCUS_28020 16371 15544 gene locus_tag LOCUS_28030 16371 15544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 17044 16385 gene locus_tag LOCUS_28040 17044 16385 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434127.1 protein_id gnl|my_center|LOCUS_28040 17276 18067 gene locus_tag LOCUS_28050 17276 18067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 18234 19325 gene locus_tag LOCUS_28060 18234 19325 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_28060 19270 20646 gene locus_tag LOCUS_28070 19270 20646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 20711 21850 gene locus_tag LOCUS_28080 20711 21850 CDS product cysteine protease StiP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861280.1 protein_id gnl|my_center|LOCUS_28080 21875 22744 gene locus_tag LOCUS_28090 21875 22744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028306.1 protein_id gnl|my_center|LOCUS_28090 25610 22833 gene locus_tag LOCUS_28100 25610 22833 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893200.1 protein_id gnl|my_center|LOCUS_28100 26348 25743 gene locus_tag LOCUS_28110 26348 25743 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246350.1 protein_id gnl|my_center|LOCUS_28110 26992 26414 gene locus_tag LOCUS_28120 26992 26414 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241242.1 protein_id gnl|my_center|LOCUS_28120 27632 27051 gene locus_tag LOCUS_28130 27632 27051 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420269.1 protein_id gnl|my_center|LOCUS_28130 28143 29408 gene locus_tag LOCUS_28140 28143 29408 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963947.1 protein_id gnl|my_center|LOCUS_28140 29629 29778 gene locus_tag LOCUS_28150 29629 29778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 29936 30685 gene locus_tag LOCUS_28160 29936 30685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 30695 31186 gene locus_tag LOCUS_28170 30695 31186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 31215 31574 gene locus_tag LOCUS_28180 31215 31574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 33019 31802 gene locus_tag LOCUS_28190 gene mscY 33019 31802 CDS product small-conductance mechanosensitive channel protein MscY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245529.1 protein_id gnl|my_center|LOCUS_28190 33222 33599 gene locus_tag LOCUS_28200 33222 33599 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047976.1 protein_id gnl|my_center|LOCUS_28200 33672 34532 gene locus_tag LOCUS_28210 33672 34532 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047975.1 protein_id gnl|my_center|LOCUS_28210 34532 35200 gene locus_tag LOCUS_28220 34532 35200 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811452.1 protein_id gnl|my_center|LOCUS_28220 35226 35432 gene locus_tag LOCUS_28230 35226 35432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 35875 35462 gene locus_tag LOCUS_28240 35875 35462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 36705 36004 gene locus_tag LOCUS_28250 36705 36004 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439080.1 protein_id gnl|my_center|LOCUS_28250 38227 36674 gene locus_tag LOCUS_28260 38227 36674 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439079.1 protein_id gnl|my_center|LOCUS_28260 38796 38296 gene locus_tag LOCUS_28270 38796 38296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 40307 38772 gene locus_tag LOCUS_28280 40307 38772 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080375.1 protein_id gnl|my_center|LOCUS_28280 41078 40419 gene locus_tag LOCUS_28290 41078 40419 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774859.1 protein_id gnl|my_center|LOCUS_28290 41728 41075 gene locus_tag LOCUS_28300 41728 41075 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262971.1 protein_id gnl|my_center|LOCUS_28300 42115 42690 gene locus_tag LOCUS_28310 42115 42690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 42795 42720 gene locus_tag LOCUS_t00420 42795 42720 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 42916 42806 gene locus_tag LOCUS_r00040 42916 42806 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence29 817 218 gene locus_tag LOCUS_28320 gene aat 817 218 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_28320 1209 1508 gene locus_tag LOCUS_28330 1209 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 1719 2714 gene locus_tag LOCUS_28340 1719 2714 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248630.1 protein_id gnl|my_center|LOCUS_28340 2810 3583 gene locus_tag LOCUS_28350 2810 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357907.1 protein_id gnl|my_center|LOCUS_28350 3860 4459 gene locus_tag LOCUS_28360 gene ruvA 3860 4459 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965583.1 protein_id gnl|my_center|LOCUS_28360 4474 5541 gene locus_tag LOCUS_28370 gene ruvB 4474 5541 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965582.1 protein_id gnl|my_center|LOCUS_28370 5575 6600 gene locus_tag LOCUS_28380 gene queA 5575 6600 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_28380 6643 7773 gene locus_tag LOCUS_28390 gene tgt 6643 7773 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_28390 7907 8200 gene locus_tag LOCUS_28400 gene yajC 7907 8200 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919858.1 protein_id gnl|my_center|LOCUS_28400 8296 8664 gene locus_tag LOCUS_28410 8296 8664 CDS product TIGR04086 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965578.1 protein_id gnl|my_center|LOCUS_28410 8733 8870 gene locus_tag LOCUS_28420 gene scfA 8733 8870 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357718.1 protein_id gnl|my_center|LOCUS_28420 8931 10295 gene locus_tag LOCUS_28430 gene scfB 8931 10295 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965577.1 protein_id gnl|my_center|LOCUS_28430 10376 11614 gene locus_tag LOCUS_28440 gene secD 10376 11614 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048083.1 protein_id gnl|my_center|LOCUS_28440 11619 12485 gene locus_tag LOCUS_28450 gene secF 11619 12485 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048082.1 protein_id gnl|my_center|LOCUS_28450 12589 13470 gene locus_tag LOCUS_28460 12589 13470 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048081.1 protein_id gnl|my_center|LOCUS_28460 13611 14129 gene locus_tag LOCUS_28470 13611 14129 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965573.1 protein_id gnl|my_center|LOCUS_28470 14260 16449 gene locus_tag LOCUS_28480 14260 16449 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_28480 16486 16932 gene locus_tag LOCUS_28490 gene dtd 16486 16932 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048079.1 protein_id gnl|my_center|LOCUS_28490 16943 17551 gene locus_tag LOCUS_28500 16943 17551 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965570.1 protein_id gnl|my_center|LOCUS_28500 17607 19058 gene locus_tag LOCUS_28510 17607 19058 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048077.1 protein_id gnl|my_center|LOCUS_28510 19074 20327 gene locus_tag LOCUS_28520 gene hisS 19074 20327 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_28520 20366 22150 gene locus_tag LOCUS_28530 gene aspS 20366 22150 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965567.1 protein_id gnl|my_center|LOCUS_28530 22394 22681 gene locus_tag LOCUS_28540 22394 22681 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986911.1 protein_id gnl|my_center|LOCUS_28540 23384 22959 gene locus_tag LOCUS_28550 23384 22959 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986910.1 protein_id gnl|my_center|LOCUS_28550 24154 23381 gene locus_tag LOCUS_28560 24154 23381 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_28560 24539 25768 gene locus_tag LOCUS_28570 24539 25768 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986909.1 protein_id gnl|my_center|LOCUS_28570 25948 27342 gene locus_tag LOCUS_28580 25948 27342 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860810.1 protein_id gnl|my_center|LOCUS_28580 27595 27885 gene locus_tag LOCUS_28590 27595 27885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 27918 29333 gene locus_tag LOCUS_28600 gene ortB 27918 29333 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507361.1 protein_id gnl|my_center|LOCUS_28600 29381 29746 gene locus_tag LOCUS_28610 29381 29746 CDS product ornithine aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434665.1 protein_id gnl|my_center|LOCUS_28610 29746 31950 gene locus_tag LOCUS_28620 gene oraE 29746 31950 CDS product D-ornithine 4,5-aminomutase subunit OraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895465.1 protein_id gnl|my_center|LOCUS_28620 31976 33373 gene locus_tag LOCUS_28630 31976 33373 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_28630 33443 34498 gene locus_tag LOCUS_28640 gene ord 33443 34498 CDS product 2,4-diaminopentanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895461.1 protein_id gnl|my_center|LOCUS_28640 34501 35544 gene locus_tag LOCUS_28650 gene ord 34501 35544 CDS product 2,4-diaminopentanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895461.1 protein_id gnl|my_center|LOCUS_28650 36930 35554 gene locus_tag LOCUS_28660 36930 35554 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861729.1 protein_id gnl|my_center|LOCUS_28660 37338 37685 gene locus_tag LOCUS_28670 37338 37685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 38023 38505 gene locus_tag LOCUS_28680 38023 38505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 38589 39008 gene locus_tag LOCUS_28690 38589 39008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 39137 39379 gene locus_tag LOCUS_28700 39137 39379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 39759 40313 gene locus_tag LOCUS_28710 39759 40313 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235430.1 protein_id gnl|my_center|LOCUS_28710 40666 40472 gene locus_tag LOCUS_28720 40666 40472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence30 193 327 gene locus_tag LOCUS_28730 193 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 959 801 gene locus_tag LOCUS_28740 959 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 2654 975 gene locus_tag LOCUS_28750 gene ilvB 2654 975 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436643.1 protein_id gnl|my_center|LOCUS_28750 4370 2715 gene locus_tag LOCUS_28760 gene ilvD 4370 2715 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966447.1 protein_id gnl|my_center|LOCUS_28760 5374 4382 gene locus_tag LOCUS_28770 gene ilvC 5374 4382 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816729.1 protein_id gnl|my_center|LOCUS_28770 5620 5375 gene locus_tag LOCUS_28780 5620 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 6487 7131 gene locus_tag LOCUS_28790 6487 7131 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357697.1 protein_id gnl|my_center|LOCUS_28790 8816 7188 gene locus_tag LOCUS_28800 8816 7188 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011997001.1 protein_id gnl|my_center|LOCUS_28800 9947 9072 gene locus_tag LOCUS_28810 9947 9072 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047873.1 protein_id gnl|my_center|LOCUS_28810 10902 10228 gene locus_tag LOCUS_28820 10902 10228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963568.1 protein_id gnl|my_center|LOCUS_28820 12052 10895 gene locus_tag LOCUS_28830 12052 10895 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963567.1 protein_id gnl|my_center|LOCUS_28830 12383 12228 gene locus_tag LOCUS_28840 12383 12228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 12997 12629 gene locus_tag LOCUS_28850 12997 12629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 13902 13303 gene locus_tag LOCUS_28860 13902 13303 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246350.1 protein_id gnl|my_center|LOCUS_28860 14511 13933 gene locus_tag LOCUS_28870 14511 13933 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430302.1 protein_id gnl|my_center|LOCUS_28870 14817 15584 gene locus_tag LOCUS_28880 14817 15584 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_28880 15713 15898 gene locus_tag LOCUS_28890 15713 15898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 16064 16264 gene locus_tag LOCUS_28900 16064 16264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 16337 17941 gene locus_tag LOCUS_28910 16337 17941 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893877.1 protein_id gnl|my_center|LOCUS_28910 18086 19183 gene locus_tag LOCUS_28920 18086 19183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 19913 19197 gene locus_tag LOCUS_28930 19913 19197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048344.1 protein_id gnl|my_center|LOCUS_28930 20913 19975 gene locus_tag LOCUS_28940 20913 19975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 21210 22631 gene locus_tag LOCUS_28950 21210 22631 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048103.1 protein_id gnl|my_center|LOCUS_28950 23261 22887 gene locus_tag LOCUS_28960 23261 22887 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519099.1 protein_id gnl|my_center|LOCUS_28960 24472 23561 gene locus_tag LOCUS_28970 24472 23561 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890753.1 protein_id gnl|my_center|LOCUS_28970 25298 24492 gene locus_tag LOCUS_28980 25298 24492 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890752.1 protein_id gnl|my_center|LOCUS_28980 26312 25335 gene locus_tag LOCUS_28990 26312 25335 CDS product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890751.1 protein_id gnl|my_center|LOCUS_28990 26884 26411 gene locus_tag LOCUS_29000 26884 26411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 29954 27144 gene locus_tag LOCUS_29010 29954 27144 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989569.1 protein_id gnl|my_center|LOCUS_29010 30967 30170 gene locus_tag LOCUS_29020 30967 30170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_29020 31408 30992 gene locus_tag LOCUS_29030 31408 30992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 32530 31598 gene locus_tag LOCUS_29040 32530 31598 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_29040 33456 32530 gene locus_tag LOCUS_29050 33456 32530 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291304.1 protein_id gnl|my_center|LOCUS_29050 34558 33458 gene locus_tag LOCUS_29060 34558 33458 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159554.1 protein_id gnl|my_center|LOCUS_29060 35596 34628 gene locus_tag LOCUS_29070 35596 34628 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921892.1 protein_id gnl|my_center|LOCUS_29070 36537 35593 gene locus_tag LOCUS_29080 36537 35593 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534167.1 protein_id gnl|my_center|LOCUS_29080 38472 36619 gene locus_tag LOCUS_29090 38472 36619 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748873.1 protein_id gnl|my_center|LOCUS_29090 39299 38721 gene locus_tag LOCUS_29100 39299 38721 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963735.1 protein_id gnl|my_center|LOCUS_29100 40108 39299 gene locus_tag LOCUS_29110 40108 39299 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963514.1 protein_id gnl|my_center|LOCUS_29110 >Feature sequence31 273 7979 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atctacattccaatatggatagattaaaat 8438 8160 gene locus_tag LOCUS_29120 gene cas2 8438 8160 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903132.1 protein_id gnl|my_center|LOCUS_29120 9446 8454 gene locus_tag LOCUS_29130 gene cas1b 9446 8454 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896423.1 protein_id gnl|my_center|LOCUS_29130 9959 9465 gene locus_tag LOCUS_29140 gene cas4 9959 9465 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 protein_id gnl|my_center|LOCUS_29140 12196 9974 gene locus_tag LOCUS_29150 12196 9974 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016965.1 protein_id gnl|my_center|LOCUS_29150 13292 12207 gene locus_tag LOCUS_29160 gene cas5 13292 12207 CDS product CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779469.1 protein_id gnl|my_center|LOCUS_29160 14185 13295 gene locus_tag LOCUS_29170 gene cas7i 14185 13295 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016967.1 protein_id gnl|my_center|LOCUS_29170 15524 14175 gene locus_tag LOCUS_29180 gene cas8a1 15524 14175 CDS product type I CRISPR-associated protein Cas8a1/Csx8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016968.1 protein_id gnl|my_center|LOCUS_29180 16258 15521 gene locus_tag LOCUS_29190 gene cas6 16258 15521 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016969.1 protein_id gnl|my_center|LOCUS_29190 17407 16463 gene locus_tag LOCUS_29200 17407 16463 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861773.1 protein_id gnl|my_center|LOCUS_29200 22883 17580 gene locus_tag LOCUS_29210 22883 17580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 23965 22889 gene locus_tag LOCUS_29220 23965 22889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 25928 23958 gene locus_tag LOCUS_29230 25928 23958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 27513 25912 gene locus_tag LOCUS_29240 27513 25912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 30304 27893 gene locus_tag LOCUS_29250 30304 27893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 30649 30329 gene locus_tag LOCUS_29260 30649 30329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 33028 30947 gene locus_tag LOCUS_29270 33028 30947 CDS product DUF262 and DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203121.1 protein_id gnl|my_center|LOCUS_29270 33208 33519 gene locus_tag LOCUS_29280 33208 33519 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966108.1 protein_id gnl|my_center|LOCUS_29280 36062 33567 gene locus_tag LOCUS_29290 36062 33567 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966109.1 protein_id gnl|my_center|LOCUS_29290 36358 36155 gene locus_tag LOCUS_29300 36358 36155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 36812 36435 gene locus_tag LOCUS_29310 36812 36435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 37686 37516 gene locus_tag LOCUS_29320 37686 37516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 37979 37776 gene locus_tag LOCUS_29330 37979 37776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965216.1 protein_id gnl|my_center|LOCUS_29330 38146 37979 gene locus_tag LOCUS_29340 38146 37979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 38841 38380 gene locus_tag LOCUS_29350 38841 38380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 39324 39088 gene locus_tag LOCUS_29360 39324 39088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 >Feature sequence32 529 1173 gene locus_tag LOCUS_29370 529 1173 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355842.1 protein_id gnl|my_center|LOCUS_29370 1519 2331 gene locus_tag LOCUS_29380 1519 2331 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460480.1 protein_id gnl|my_center|LOCUS_29380 2341 3126 gene locus_tag LOCUS_29390 2341 3126 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460479.1 protein_id gnl|my_center|LOCUS_29390 3098 3832 gene locus_tag LOCUS_29400 3098 3832 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460478.1 protein_id gnl|my_center|LOCUS_29400 4516 4130 gene locus_tag LOCUS_29410 4516 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 5090 4737 gene locus_tag LOCUS_29420 5090 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 5782 6228 gene locus_tag LOCUS_29430 5782 6228 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909619.1 protein_id gnl|my_center|LOCUS_29430 6401 7000 gene locus_tag LOCUS_29440 6401 7000 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047745.1 protein_id gnl|my_center|LOCUS_29440 7378 7935 gene locus_tag LOCUS_29450 gene sigW 7378 7935 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_29450 7922 8149 gene locus_tag LOCUS_29460 7922 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 8172 8711 gene locus_tag LOCUS_29470 gene lepB 8172 8711 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460080.1 protein_id gnl|my_center|LOCUS_29470 8875 9279 gene locus_tag LOCUS_29480 8875 9279 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276560.1 protein_id gnl|my_center|LOCUS_29480 9296 10732 gene locus_tag LOCUS_29490 9296 10732 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809528.1 protein_id gnl|my_center|LOCUS_29490 11178 10822 gene locus_tag LOCUS_29500 11178 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 11529 12953 gene locus_tag LOCUS_29510 11529 12953 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_29510 13127 13981 gene locus_tag LOCUS_29520 13127 13981 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964664.1 protein_id gnl|my_center|LOCUS_29520 15213 14044 gene locus_tag LOCUS_29530 15213 14044 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296167.1 protein_id gnl|my_center|LOCUS_29530 16342 15200 gene locus_tag LOCUS_29540 16342 15200 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389793.1 protein_id gnl|my_center|LOCUS_29540 17288 16356 gene locus_tag LOCUS_29550 17288 16356 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057287.1 protein_id gnl|my_center|LOCUS_29550 17903 18574 gene locus_tag LOCUS_29560 17903 18574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 18571 19191 gene locus_tag LOCUS_29570 18571 19191 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666641.1 protein_id gnl|my_center|LOCUS_29570 19311 20588 gene locus_tag LOCUS_29580 19311 20588 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949002.1 protein_id gnl|my_center|LOCUS_29580 21888 20803 gene locus_tag LOCUS_29590 21888 20803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048179.1 protein_id gnl|my_center|LOCUS_29590 22996 21923 gene locus_tag LOCUS_29600 22996 21923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048178.1 protein_id gnl|my_center|LOCUS_29600 23210 24778 gene locus_tag LOCUS_29610 23210 24778 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966292.1 protein_id gnl|my_center|LOCUS_29610 26667 24865 gene locus_tag LOCUS_29620 gene ftsH 26667 24865 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_29620 26979 27617 gene locus_tag LOCUS_29630 26979 27617 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407773.1 protein_id gnl|my_center|LOCUS_29630 28568 29842 gene locus_tag LOCUS_29640 28568 29842 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431793.1 protein_id gnl|my_center|LOCUS_29640 30015 31166 gene locus_tag LOCUS_29650 30015 31166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 31794 32708 gene locus_tag LOCUS_29660 31794 32708 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_29660 32716 33552 gene locus_tag LOCUS_29670 32716 33552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 33719 34852 gene locus_tag LOCUS_29680 33719 34852 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222757.1 protein_id gnl|my_center|LOCUS_29680 34867 36006 gene locus_tag LOCUS_29690 34867 36006 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222757.1 protein_id gnl|my_center|LOCUS_29690 >Feature sequence33 408 575 gene locus_tag LOCUS_29700 408 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 551 1351 gene locus_tag LOCUS_29710 551 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 2075 1632 gene locus_tag LOCUS_29720 2075 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459654.1 protein_id gnl|my_center|LOCUS_29720 2274 2065 gene locus_tag LOCUS_29730 2274 2065 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816704.1 protein_id gnl|my_center|LOCUS_29730 3301 4221 gene locus_tag LOCUS_29740 3301 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 4529 5299 gene locus_tag LOCUS_29750 4529 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 7159 6143 gene locus_tag LOCUS_29760 7159 6143 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003321939.1 protein_id gnl|my_center|LOCUS_29760 8138 7146 gene locus_tag LOCUS_29770 8138 7146 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_29770 9351 8128 gene locus_tag LOCUS_29780 9351 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 9852 10037 gene locus_tag LOCUS_29790 9852 10037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 11937 10117 gene locus_tag LOCUS_29800 gene ltrA 11937 10117 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097733.1 protein_id gnl|my_center|LOCUS_29800 12202 11981 gene locus_tag LOCUS_29810 12202 11981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 12584 13330 gene locus_tag LOCUS_29820 12584 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 13747 14310 gene locus_tag LOCUS_29830 13747 14310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 14334 14465 gene locus_tag LOCUS_29840 14334 14465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 17193 17792 gene locus_tag LOCUS_29850 17193 17792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 18167 18676 gene locus_tag LOCUS_29860 18167 18676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 18993 20813 gene locus_tag LOCUS_29870 18993 20813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 20825 22855 gene locus_tag LOCUS_29880 20825 22855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 23241 24956 gene locus_tag LOCUS_29890 23241 24956 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987099.1 protein_id gnl|my_center|LOCUS_29890 25043 25936 gene locus_tag LOCUS_29900 25043 25936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 25964 26356 gene locus_tag LOCUS_29910 25964 26356 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963397.1 protein_id gnl|my_center|LOCUS_29910 26436 26618 gene locus_tag LOCUS_29920 26436 26618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 26761 27975 gene locus_tag LOCUS_29930 26761 27975 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_29930 29535 29792 gene locus_tag LOCUS_29940 29535 29792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 29902 30057 gene locus_tag LOCUS_29950 29902 30057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 30073 30261 gene locus_tag LOCUS_29960 30073 30261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 30289 30681 gene locus_tag LOCUS_29970 30289 30681 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963572.1 protein_id gnl|my_center|LOCUS_29970 31934 30678 gene locus_tag LOCUS_29980 31934 30678 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813072.1 protein_id gnl|my_center|LOCUS_29980 32413 31940 gene locus_tag LOCUS_29990 32413 31940 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020238.1 protein_id gnl|my_center|LOCUS_29990 >Feature sequence34 1375 80 gene locus_tag LOCUS_30000 1375 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 1643 1368 gene locus_tag LOCUS_30010 1643 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 2805 2212 gene locus_tag LOCUS_30020 2805 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30020 2867 3478 gene locus_tag LOCUS_30030 2867 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 3835 3599 gene locus_tag LOCUS_30040 3835 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 5150 4155 gene locus_tag LOCUS_30050 gene galE 5150 4155 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_30050 5331 5197 gene locus_tag LOCUS_30060 5331 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 6811 5414 gene locus_tag LOCUS_30070 6811 5414 CDS product cell wall-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948206.1 protein_id gnl|my_center|LOCUS_30070 8946 7075 gene locus_tag LOCUS_30080 8946 7075 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 protein_id gnl|my_center|LOCUS_30080 10215 9151 gene locus_tag LOCUS_30090 10215 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 11167 10286 gene locus_tag LOCUS_30100 11167 10286 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765273.1 protein_id gnl|my_center|LOCUS_30100 13202 12288 gene locus_tag LOCUS_30110 gene galU 13202 12288 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965632.1 protein_id gnl|my_center|LOCUS_30110 13974 13240 gene locus_tag LOCUS_30120 13974 13240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 15500 14322 gene locus_tag LOCUS_30130 15500 14322 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039964.1 protein_id gnl|my_center|LOCUS_30130 17023 15497 gene locus_tag LOCUS_30140 17023 15497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 18311 17124 gene locus_tag LOCUS_30150 18311 17124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 19363 18308 gene locus_tag LOCUS_30160 19363 18308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 20412 19360 gene locus_tag LOCUS_30170 20412 19360 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475870.1 protein_id gnl|my_center|LOCUS_30170 21688 20390 gene locus_tag LOCUS_30180 21688 20390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068362.1 protein_id gnl|my_center|LOCUS_30180 22884 21790 gene locus_tag LOCUS_30190 22884 21790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 24239 23001 gene locus_tag LOCUS_30200 24239 23001 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019809.1 protein_id gnl|my_center|LOCUS_30200 24842 24258 gene locus_tag LOCUS_30210 24842 24258 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218919404.1 protein_id gnl|my_center|LOCUS_30210 25861 24929 gene locus_tag LOCUS_30220 25861 24929 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410273.1 protein_id gnl|my_center|LOCUS_30220 26978 25896 gene locus_tag LOCUS_30230 gene gmd 26978 25896 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965479.1 protein_id gnl|my_center|LOCUS_30230 28097 27048 gene locus_tag LOCUS_30240 28097 27048 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966353.1 protein_id gnl|my_center|LOCUS_30240 28813 28145 gene locus_tag LOCUS_30250 28813 28145 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966354.1 protein_id gnl|my_center|LOCUS_30250 29321 29154 gene locus_tag LOCUS_30260 29321 29154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 30554 29718 gene locus_tag LOCUS_30270 30554 29718 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_30270 31976 30723 gene locus_tag LOCUS_30280 31976 30723 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048107.1 protein_id gnl|my_center|LOCUS_30280 33424 32039 gene locus_tag LOCUS_30290 33424 32039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 34530 33481 gene locus_tag LOCUS_30300 34530 33481 CDS product ribitol-5-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645041.1 protein_id gnl|my_center|LOCUS_30300 35240 34530 gene locus_tag LOCUS_30310 35240 34530 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721503.1 protein_id gnl|my_center|LOCUS_30310 36334 35240 gene locus_tag LOCUS_30320 36334 35240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 37690 36353 gene locus_tag LOCUS_30330 37690 36353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 38784 37732 gene locus_tag LOCUS_30340 gene rfbB 38784 37732 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965629.1 protein_id gnl|my_center|LOCUS_30340 39356 38787 gene locus_tag LOCUS_30350 gene rfbC 39356 38787 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_30350 40310 39375 gene locus_tag LOCUS_30360 gene rfbA 40310 39375 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965630.1 protein_id gnl|my_center|LOCUS_30360 40952 40353 gene locus_tag LOCUS_30370 40952 40353 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601187.1 protein_id gnl|my_center|LOCUS_30370 42232 41108 gene locus_tag LOCUS_30380 42232 41108 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083056.1 protein_id gnl|my_center|LOCUS_30380 43363 42305 gene locus_tag LOCUS_30390 43363 42305 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966353.1 protein_id gnl|my_center|LOCUS_30390 44570 43416 gene locus_tag LOCUS_30400 44570 43416 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355946.1 protein_id gnl|my_center|LOCUS_30400 45621 44611 gene locus_tag LOCUS_30410 45621 44611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 46794 45628 gene locus_tag LOCUS_30420 46794 45628 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_30420 47744 46893 gene locus_tag LOCUS_30430 47744 46893 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112142.1 protein_id gnl|my_center|LOCUS_30430 48518 47895 gene locus_tag LOCUS_30440 gene cap8M 48518 47895 CDS product type 8 capsular polysaccharide synthesis protein Cap8M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825098.1 protein_id gnl|my_center|LOCUS_30440 49125 49910 gene locus_tag LOCUS_30450 49125 49910 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964972.1 protein_id gnl|my_center|LOCUS_30450 50658 50194 gene locus_tag LOCUS_30460 50658 50194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 51038 50769 gene locus_tag LOCUS_30470 51038 50769 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986717.1 protein_id gnl|my_center|LOCUS_30470 55167 51550 gene locus_tag LOCUS_30480 55167 51550 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948228.1 protein_id gnl|my_center|LOCUS_30480 56404 55154 gene locus_tag LOCUS_30490 56404 55154 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966024.1 protein_id gnl|my_center|LOCUS_30490 60585 56428 gene locus_tag LOCUS_30500 gene addA 60585 56428 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965560.1 protein_id gnl|my_center|LOCUS_30500 64364 60585 gene locus_tag LOCUS_30510 gene addB 64364 60585 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_30510 64649 66730 gene locus_tag LOCUS_30520 64649 66730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 68529 66805 gene locus_tag LOCUS_30530 68529 66805 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396540.1 protein_id gnl|my_center|LOCUS_30530 69753 68779 gene locus_tag LOCUS_30540 69753 68779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 70120 69845 gene locus_tag LOCUS_30550 70120 69845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 70437 70198 gene locus_tag LOCUS_30560 70437 70198 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356943.1 protein_id gnl|my_center|LOCUS_30560 71750 70779 gene locus_tag LOCUS_30570 71750 70779 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386790.1 protein_id gnl|my_center|LOCUS_30570 72310 73227 gene locus_tag LOCUS_30580 72310 73227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30580 73363 74274 gene locus_tag LOCUS_30590 73363 74274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 76012 74645 gene locus_tag LOCUS_30600 76012 74645 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948710.1 protein_id gnl|my_center|LOCUS_30600 76696 76016 gene locus_tag LOCUS_30610 76696 76016 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404711.1 protein_id gnl|my_center|LOCUS_30610 76939 77097 gene locus_tag LOCUS_30620 76939 77097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 77366 77548 gene locus_tag LOCUS_30630 77366 77548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 79986 77863 gene locus_tag LOCUS_30640 79986 77863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 80369 80611 gene locus_tag LOCUS_30650 80369 80611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 80661 81557 gene locus_tag LOCUS_30660 80661 81557 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987059.1 protein_id gnl|my_center|LOCUS_30660 81951 83888 gene locus_tag LOCUS_30670 gene thrS 81951 83888 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786086.1 protein_id gnl|my_center|LOCUS_30670 85680 84022 gene locus_tag LOCUS_30680 85680 84022 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_30680 86499 86317 gene locus_tag LOCUS_30690 86499 86317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 86780 86484 gene locus_tag LOCUS_30700 86780 86484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 87321 88028 gene locus_tag LOCUS_30710 87321 88028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 88423 88169 gene locus_tag LOCUS_30720 88423 88169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 89310 89468 gene locus_tag LOCUS_30730 89310 89468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 89470 89658 gene locus_tag LOCUS_30740 89470 89658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 89767 90765 gene locus_tag LOCUS_30750 gene rsgA 89767 90765 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073045.1 protein_id gnl|my_center|LOCUS_30750 91311 90919 gene locus_tag LOCUS_30760 91311 90919 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723377.1 protein_id gnl|my_center|LOCUS_30760 92220 91423 gene locus_tag LOCUS_30770 92220 91423 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373267.1 protein_id gnl|my_center|LOCUS_30770 93201 92440 gene locus_tag LOCUS_30780 93201 92440 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963440.1 protein_id gnl|my_center|LOCUS_30780 94255 93263 gene locus_tag LOCUS_30790 gene yidA 94255 93263 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963948.1 protein_id gnl|my_center|LOCUS_30790 94443 94961 gene locus_tag LOCUS_30800 94443 94961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 95023 95916 gene locus_tag LOCUS_30810 gene rfbD 95023 95916 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582730.1 protein_id gnl|my_center|LOCUS_30810 95879 96496 gene locus_tag LOCUS_30820 95879 96496 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048325.1 protein_id gnl|my_center|LOCUS_30820 97403 96693 gene locus_tag LOCUS_30830 97403 96693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30830 97878 97375 gene locus_tag LOCUS_30840 97878 97375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30840 97986 99272 gene locus_tag LOCUS_30850 97986 99272 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_30850 100557 99355 gene locus_tag LOCUS_30860 100557 99355 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_30860 100938 100777 gene locus_tag LOCUS_30870 100938 100777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 102674 100992 gene locus_tag LOCUS_30880 102674 100992 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948911.1 protein_id gnl|my_center|LOCUS_30880 103637 103392 gene locus_tag LOCUS_30890 103637 103392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 105791 104109 gene locus_tag LOCUS_30900 105791 104109 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948911.1 protein_id gnl|my_center|LOCUS_30900 106001 105804 gene locus_tag LOCUS_30910 106001 105804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 107387 106308 gene locus_tag LOCUS_30920 107387 106308 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963632.1 protein_id gnl|my_center|LOCUS_30920 107921 107787 gene locus_tag LOCUS_30930 107921 107787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30930 109415 107943 gene locus_tag LOCUS_30940 109415 107943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 109801 109457 gene locus_tag LOCUS_30950 109801 109457 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890787.1 protein_id gnl|my_center|LOCUS_30950 110301 109873 gene locus_tag LOCUS_30960 110301 109873 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948464.1 protein_id gnl|my_center|LOCUS_30960 111238 110546 gene locus_tag LOCUS_30970 111238 110546 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461616.1 protein_id gnl|my_center|LOCUS_30970 111771 111235 gene locus_tag LOCUS_30980 111771 111235 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306390.1 protein_id gnl|my_center|LOCUS_30980 112165 111938 gene locus_tag LOCUS_30990 112165 111938 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_30990 113292 112276 gene locus_tag LOCUS_31000 113292 112276 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 protein_id gnl|my_center|LOCUS_31000 113743 113384 gene locus_tag LOCUS_31010 113743 113384 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462035.1 protein_id gnl|my_center|LOCUS_31010 113982 114230 gene locus_tag LOCUS_31020 113982 114230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 115013 114285 gene locus_tag LOCUS_31030 115013 114285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964091.1 protein_id gnl|my_center|LOCUS_31030 115813 115019 gene locus_tag LOCUS_31040 115813 115019 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964090.1 protein_id gnl|my_center|LOCUS_31040 116681 116097 gene locus_tag LOCUS_31050 gene rubY 116681 116097 CDS product rubrerythrin RubY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965865.1 protein_id gnl|my_center|LOCUS_31050 118445 116916 gene locus_tag LOCUS_31060 118445 116916 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436996.1 protein_id gnl|my_center|LOCUS_31060 119652 118837 gene locus_tag LOCUS_31070 119652 118837 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948751.1 protein_id gnl|my_center|LOCUS_31070 120323 119679 gene locus_tag LOCUS_31080 120323 119679 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964303.1 protein_id gnl|my_center|LOCUS_31080 121365 120373 gene locus_tag LOCUS_31090 121365 120373 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964302.1 protein_id gnl|my_center|LOCUS_31090 122021 121899 gene locus_tag LOCUS_31100 122021 121899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 122630 122130 gene locus_tag LOCUS_31110 122630 122130 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990112.1 protein_id gnl|my_center|LOCUS_31110 122934 123929 gene locus_tag LOCUS_31120 122934 123929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 124805 124200 gene locus_tag LOCUS_31130 124805 124200 CDS product phosphoserine phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859193.1 protein_id gnl|my_center|LOCUS_31130 125381 124857 gene locus_tag LOCUS_31140 125381 124857 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422477.1 protein_id gnl|my_center|LOCUS_31140 126173 125649 gene locus_tag LOCUS_31150 126173 125649 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965776.1 protein_id gnl|my_center|LOCUS_31150 126889 126329 gene locus_tag LOCUS_31160 126889 126329 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861137.1 protein_id gnl|my_center|LOCUS_31160 127441 126917 gene locus_tag LOCUS_31170 127441 126917 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259199.1 protein_id gnl|my_center|LOCUS_31170 127690 128910 gene locus_tag LOCUS_31180 127690 128910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 129143 130003 gene locus_tag LOCUS_31190 129143 130003 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356230.1 protein_id gnl|my_center|LOCUS_31190 130397 130143 gene locus_tag LOCUS_31200 130397 130143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 133292 131466 gene locus_tag LOCUS_31210 gene glmS 133292 131466 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_31210 135492 134143 gene locus_tag LOCUS_31220 gene glmM 135492 134143 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_31220 136135 135911 gene locus_tag LOCUS_31230 136135 135911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 136489 136235 gene locus_tag LOCUS_31240 136489 136235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 136926 136513 gene locus_tag LOCUS_31250 136926 136513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966282.1 protein_id gnl|my_center|LOCUS_31250 137343 136975 gene locus_tag LOCUS_31260 137343 136975 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 protein_id gnl|my_center|LOCUS_31260 138247 137513 gene locus_tag LOCUS_31270 138247 137513 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890721.1 protein_id gnl|my_center|LOCUS_31270 138885 138265 gene locus_tag LOCUS_31280 138885 138265 CDS product YhbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890722.1 protein_id gnl|my_center|LOCUS_31280 139978 139448 gene locus_tag LOCUS_31290 139978 139448 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_31290 140729 139980 gene locus_tag LOCUS_31300 140729 139980 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_31300 141799 140729 gene locus_tag LOCUS_31310 141799 140729 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_31310 142028 141819 gene locus_tag LOCUS_31320 142028 141819 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357528.1 protein_id gnl|my_center|LOCUS_31320 142823 142161 gene locus_tag LOCUS_31330 142823 142161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_31330 144059 142989 gene locus_tag LOCUS_31340 gene buk 144059 142989 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_31340 145065 144157 gene locus_tag LOCUS_31350 gene ptb 145065 144157 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_31350 146186 145101 gene locus_tag LOCUS_31360 gene buk 146186 145101 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048335.1 protein_id gnl|my_center|LOCUS_31360 147917 146319 gene locus_tag LOCUS_31370 147917 146319 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_31370 149154 147907 gene locus_tag LOCUS_31380 149154 147907 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048337.1 protein_id gnl|my_center|LOCUS_31380 149972 149124 gene locus_tag LOCUS_31390 gene cdaA 149972 149124 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360232.1 protein_id gnl|my_center|LOCUS_31390 150236 151255 gene locus_tag LOCUS_31400 150236 151255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 151412 151978 gene locus_tag LOCUS_31410 151412 151978 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966362.1 protein_id gnl|my_center|LOCUS_31410 152911 152042 gene locus_tag LOCUS_31420 152911 152042 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357673.1 protein_id gnl|my_center|LOCUS_31420 153326 153009 gene locus_tag LOCUS_31430 gene trxA 153326 153009 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357302.1 protein_id gnl|my_center|LOCUS_31430 154790 153531 gene locus_tag LOCUS_31440 154790 153531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966365.1 protein_id gnl|my_center|LOCUS_31440 156352 155309 gene locus_tag LOCUS_31450 156352 155309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 156909 156352 gene locus_tag LOCUS_31460 156909 156352 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861377.1 protein_id gnl|my_center|LOCUS_31460 158353 157466 gene locus_tag LOCUS_31470 gene citG 158353 157466 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154857.1 protein_id gnl|my_center|LOCUS_31470 158855 158343 gene locus_tag LOCUS_31480 gene citX 158855 158343 CDS product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254390.1 protein_id gnl|my_center|LOCUS_31480 159905 158862 gene locus_tag LOCUS_31490 gene citC 159905 158862 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878104.1 protein_id gnl|my_center|LOCUS_31490 161600 160062 gene locus_tag LOCUS_31500 gene citF 161600 160062 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272879.1 protein_id gnl|my_center|LOCUS_31500 162522 161650 gene locus_tag LOCUS_31510 162522 161650 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869093.1 protein_id gnl|my_center|LOCUS_31510 162798 162535 gene locus_tag LOCUS_31520 gene citD 162798 162535 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017111.1 protein_id gnl|my_center|LOCUS_31520 163388 162831 gene locus_tag LOCUS_31530 163388 162831 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_31530 164251 163409 gene locus_tag LOCUS_31540 164251 163409 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_31540 165586 164345 gene locus_tag LOCUS_31550 165586 164345 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680089.1 protein_id gnl|my_center|LOCUS_31550 167095 165638 gene locus_tag LOCUS_31560 167095 165638 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680091.1 protein_id gnl|my_center|LOCUS_31560 168508 167114 gene locus_tag LOCUS_31570 gene glmL 168508 167114 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682340.1 protein_id gnl|my_center|LOCUS_31570 168942 168520 gene locus_tag LOCUS_31580 gene glmS 168942 168520 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670492.1 protein_id gnl|my_center|LOCUS_31580 169975 168992 gene locus_tag LOCUS_31590 169975 168992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 170248 170445 gene locus_tag LOCUS_31600 170248 170445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 171288 170566 gene locus_tag LOCUS_31610 gene cwlD 171288 170566 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048347.1 protein_id gnl|my_center|LOCUS_31610 173046 171433 gene locus_tag LOCUS_31620 173046 171433 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_31620 173705 173313 gene locus_tag LOCUS_31630 gene rpsI 173705 173313 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_31630 174170 173730 gene locus_tag LOCUS_31640 gene rplM 174170 173730 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003494906.1 protein_id gnl|my_center|LOCUS_31640 175069 174335 gene locus_tag LOCUS_31650 gene truA 175069 174335 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048349.1 protein_id gnl|my_center|LOCUS_31650 175909 175109 gene locus_tag LOCUS_31660 175909 175109 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_31660 176840 175986 gene locus_tag LOCUS_31670 176840 175986 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_31670 177670 176825 gene locus_tag LOCUS_31680 177670 176825 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_31680 178092 177751 gene locus_tag LOCUS_31690 gene rplQ 178092 177751 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_31690 179052 178105 gene locus_tag LOCUS_31700 179052 178105 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357472.1 protein_id gnl|my_center|LOCUS_31700 179737 179117 gene locus_tag LOCUS_31710 gene rpsD 179737 179117 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357283.1 protein_id gnl|my_center|LOCUS_31710 180181 179789 gene locus_tag LOCUS_31720 gene rpsK 180181 179789 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966387.1 protein_id gnl|my_center|LOCUS_31720 180565 180197 gene locus_tag LOCUS_31730 gene rpsM 180565 180197 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_31730 181050 180832 gene locus_tag LOCUS_31740 gene infA 181050 180832 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_31740 181339 181058 gene locus_tag LOCUS_31750 181339 181058 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966390.1 protein_id gnl|my_center|LOCUS_31750 182100 181354 gene locus_tag LOCUS_31760 gene map 182100 181354 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_31760 182750 182097 gene locus_tag LOCUS_31770 182750 182097 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357697.1 protein_id gnl|my_center|LOCUS_31770 184052 182772 gene locus_tag LOCUS_31780 gene secY 184052 182772 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357569.1 protein_id gnl|my_center|LOCUS_31780 184493 184053 gene locus_tag LOCUS_31790 gene rplO 184493 184053 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_31790 184690 184511 gene locus_tag LOCUS_31800 gene rpmD 184690 184511 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357637.1 protein_id gnl|my_center|LOCUS_31800 185200 184703 gene locus_tag LOCUS_31810 gene rpsE 185200 184703 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_31810 185580 185218 gene locus_tag LOCUS_31820 gene rplR 185580 185218 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357434.1 protein_id gnl|my_center|LOCUS_31820 186140 185601 gene locus_tag LOCUS_31830 gene rplF 186140 185601 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966397.1 protein_id gnl|my_center|LOCUS_31830 186739 186341 gene locus_tag LOCUS_31840 gene rpsH 186739 186341 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966398.1 protein_id gnl|my_center|LOCUS_31840 186957 186772 gene locus_tag LOCUS_31850 186957 186772 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966399.1 protein_id gnl|my_center|LOCUS_31850 187515 186973 gene locus_tag LOCUS_31860 gene rplE 187515 186973 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_31860 187861 187538 gene locus_tag LOCUS_31870 gene rplX 187861 187538 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357467.1 protein_id gnl|my_center|LOCUS_31870 188247 187879 gene locus_tag LOCUS_31880 gene rplN 188247 187879 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_31880 188538 188284 gene locus_tag LOCUS_31890 gene rpsQ 188538 188284 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_31890 188772 188560 gene locus_tag LOCUS_31900 gene rpmC 188772 188560 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357691.1 protein_id gnl|my_center|LOCUS_31900 189205 188762 gene locus_tag LOCUS_31910 gene rplP 189205 188762 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_31910 189896 189231 gene locus_tag LOCUS_31920 gene rpsC 189896 189231 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966406.1 protein_id gnl|my_center|LOCUS_31920 190248 189913 gene locus_tag LOCUS_31930 gene rplV 190248 189913 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966407.1 protein_id gnl|my_center|LOCUS_31930 190552 190271 gene locus_tag LOCUS_31940 gene rpsS 190552 190271 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357326.1 protein_id gnl|my_center|LOCUS_31940 191432 190599 gene locus_tag LOCUS_31950 gene rplB 191432 190599 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_31950 191782 191489 gene locus_tag LOCUS_31960 gene rplW 191782 191489 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_31960 192402 191782 gene locus_tag LOCUS_31970 gene rplD 192402 191782 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_31970 193056 192427 gene locus_tag LOCUS_31980 gene rplC 193056 192427 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_31980 193485 193177 gene locus_tag LOCUS_31990 gene rpsJ 193485 193177 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966413.1 protein_id gnl|my_center|LOCUS_31990 195087 193894 gene locus_tag LOCUS_32000 gene tuf 195087 193894 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357263.1 protein_id gnl|my_center|LOCUS_32000 197286 195220 gene locus_tag LOCUS_32010 gene fusA 197286 195220 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966416.1 protein_id gnl|my_center|LOCUS_32010 197832 197362 gene locus_tag LOCUS_32020 gene rpsG 197832 197362 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966417.1 protein_id gnl|my_center|LOCUS_32020 198350 197970 gene locus_tag LOCUS_32030 gene rpsL 198350 197970 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966418.1 protein_id gnl|my_center|LOCUS_32030 198709 198467 gene locus_tag LOCUS_32040 198709 198467 CDS product 50S ribosomal protein L7ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048355.1 protein_id gnl|my_center|LOCUS_32040 202362 198829 gene locus_tag LOCUS_32050 gene rpoC 202362 198829 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 protein_id gnl|my_center|LOCUS_32050 206096 202383 gene locus_tag LOCUS_32060 gene rpoB 206096 202383 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966421.1 protein_id gnl|my_center|LOCUS_32060 206721 206362 gene locus_tag LOCUS_32070 gene rplL 206721 206362 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966422.1 protein_id gnl|my_center|LOCUS_32070 207360 206860 gene locus_tag LOCUS_32080 gene rplJ 207360 206860 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966423.1 protein_id gnl|my_center|LOCUS_32080 208261 207572 gene locus_tag LOCUS_32090 gene rplA 208261 207572 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966424.1 protein_id gnl|my_center|LOCUS_32090 208745 208320 gene locus_tag LOCUS_32100 gene rplK 208745 208320 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_32100 209322 208801 gene locus_tag LOCUS_32110 gene nusG 209322 208801 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_32110 209582 209358 gene locus_tag LOCUS_32120 gene secE 209582 209358 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357558.1 protein_id gnl|my_center|LOCUS_32120 209771 209622 gene locus_tag LOCUS_32130 gene rpmG 209771 209622 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_32130 211218 210025 gene locus_tag LOCUS_32140 gene tuf 211218 210025 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357263.1 protein_id gnl|my_center|LOCUS_32140 211374 211299 gene locus_tag LOCUS_t00430 211374 211299 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 211458 211384 gene locus_tag LOCUS_t00440 211458 211384 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 212170 211529 gene locus_tag LOCUS_32150 gene sigH 212170 211529 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357363.1 protein_id gnl|my_center|LOCUS_32150 212755 212246 gene locus_tag LOCUS_32160 212755 212246 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394990.1 protein_id gnl|my_center|LOCUS_32160 213861 212764 gene locus_tag LOCUS_32170 213861 212764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 214688 213885 gene locus_tag LOCUS_32180 gene thyX 214688 213885 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099542.1 protein_id gnl|my_center|LOCUS_32180 215113 214691 gene locus_tag LOCUS_32190 215113 214691 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357282.1 protein_id gnl|my_center|LOCUS_32190 216848 215136 gene locus_tag LOCUS_32200 216848 215136 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966455.1 protein_id gnl|my_center|LOCUS_32200 217726 217034 gene locus_tag LOCUS_32210 gene ispD 217726 217034 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048363.1 protein_id gnl|my_center|LOCUS_32210 218858 217752 gene locus_tag LOCUS_32220 218858 217752 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048364.1 protein_id gnl|my_center|LOCUS_32220 219449 218976 gene locus_tag LOCUS_32230 219449 218976 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529179.1 protein_id gnl|my_center|LOCUS_32230 219596 220000 gene locus_tag LOCUS_32240 219596 220000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048365.1 protein_id gnl|my_center|LOCUS_32240 221101 220037 gene locus_tag LOCUS_32250 gene disA 221101 220037 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393302.1 protein_id gnl|my_center|LOCUS_32250 221315 221193 gene locus_tag LOCUS_32260 221315 221193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 223929 221494 gene locus_tag LOCUS_32270 223929 221494 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048366.1 protein_id gnl|my_center|LOCUS_32270 225452 224202 gene locus_tag LOCUS_32280 225452 224202 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948284.1 protein_id gnl|my_center|LOCUS_32280 226018 225794 gene locus_tag LOCUS_32290 226018 225794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 226217 225981 gene locus_tag LOCUS_32300 226217 225981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966470.1 protein_id gnl|my_center|LOCUS_32300 <226988 226412 gene locus_tag LOCUS_32310 <226988 226412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966780.1:group II intron reverse transcriptase/maturase >Feature sequence35 269 1354 gene locus_tag LOCUS_32320 269 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 1510 1983 gene locus_tag LOCUS_32330 1510 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 2130 2516 gene locus_tag LOCUS_32340 2130 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 2539 3285 gene locus_tag LOCUS_32350 2539 3285 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965767.1 protein_id gnl|my_center|LOCUS_32350 3376 4041 gene locus_tag LOCUS_32360 3376 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 4248 5018 gene locus_tag LOCUS_32370 4248 5018 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614984.1 protein_id gnl|my_center|LOCUS_32370 5097 5636 gene locus_tag LOCUS_32380 5097 5636 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272442.1 protein_id gnl|my_center|LOCUS_32380 5736 6320 gene locus_tag LOCUS_32390 5736 6320 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_32390 6370 6795 gene locus_tag LOCUS_32400 6370 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 6883 7227 gene locus_tag LOCUS_32410 6883 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 7554 8120 gene locus_tag LOCUS_32420 7554 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 8138 8875 gene locus_tag LOCUS_32430 8138 8875 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762140.1 protein_id gnl|my_center|LOCUS_32430 8938 9657 gene locus_tag LOCUS_32440 8938 9657 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357656.1 protein_id gnl|my_center|LOCUS_32440 10071 10847 gene locus_tag LOCUS_32450 10071 10847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 10934 11644 gene locus_tag LOCUS_32460 10934 11644 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358908.1 protein_id gnl|my_center|LOCUS_32460 11712 12227 gene locus_tag LOCUS_32470 11712 12227 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103131.1 protein_id gnl|my_center|LOCUS_32470 12262 12843 gene locus_tag LOCUS_32480 12262 12843 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948225.1 protein_id gnl|my_center|LOCUS_32480 13000 13482 gene locus_tag LOCUS_32490 13000 13482 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003305140.1 protein_id gnl|my_center|LOCUS_32490 13590 14627 gene locus_tag LOCUS_32500 13590 14627 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987066.1 protein_id gnl|my_center|LOCUS_32500 14890 15834 gene locus_tag LOCUS_32510 14890 15834 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681076.1 protein_id gnl|my_center|LOCUS_32510 16089 16565 gene locus_tag LOCUS_32520 16089 16565 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861860.1 protein_id gnl|my_center|LOCUS_32520 16577 17137 gene locus_tag LOCUS_32530 16577 17137 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461583.1 protein_id gnl|my_center|LOCUS_32530 17389 18480 gene locus_tag LOCUS_32540 gene xerD 17389 18480 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700300.1 protein_id gnl|my_center|LOCUS_32540 18470 19933 gene locus_tag LOCUS_32550 18470 19933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 19896 21458 gene locus_tag LOCUS_32560 19896 21458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 21442 21843 gene locus_tag LOCUS_32570 21442 21843 CDS product DUF6262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410574.1 protein_id gnl|my_center|LOCUS_32570 21945 22127 gene locus_tag LOCUS_32580 21945 22127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 22226 22414 gene locus_tag LOCUS_32590 22226 22414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 22491 23045 gene locus_tag LOCUS_32600 22491 23045 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049681146.1 protein_id gnl|my_center|LOCUS_32600 23189 24016 gene locus_tag LOCUS_32610 23189 24016 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925959.1 protein_id gnl|my_center|LOCUS_32610 24062 25066 gene locus_tag LOCUS_32620 24062 25066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 25107 25727 gene locus_tag LOCUS_32630 25107 25727 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948614.1 protein_id gnl|my_center|LOCUS_32630 25750 26310 gene locus_tag LOCUS_32640 25750 26310 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965775.1 protein_id gnl|my_center|LOCUS_32640 26361 26975 gene locus_tag LOCUS_32650 26361 26975 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966112.1 protein_id gnl|my_center|LOCUS_32650 27167 27727 gene locus_tag LOCUS_32660 27167 27727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 27864 28832 gene locus_tag LOCUS_32670 gene glcK 27864 28832 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_32670 28855 29466 gene locus_tag LOCUS_32680 28855 29466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 29564 30139 gene locus_tag LOCUS_32690 29564 30139 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948585.1 protein_id gnl|my_center|LOCUS_32690 30234 30746 gene locus_tag LOCUS_32700 30234 30746 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617516.1 protein_id gnl|my_center|LOCUS_32700 30827 31030 gene locus_tag LOCUS_32710 30827 31030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 31033 31980 gene locus_tag LOCUS_32720 31033 31980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145860136.1 protein_id gnl|my_center|LOCUS_32720 32035 32595 gene locus_tag LOCUS_32730 32035 32595 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691249.1 protein_id gnl|my_center|LOCUS_32730 >Feature sequence36 351 460 gene locus_tag LOCUS_r00050 351 460 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 832 757 gene locus_tag LOCUS_t00450 832 757 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1501 956 gene locus_tag LOCUS_32740 1501 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 1749 3041 gene locus_tag LOCUS_32750 1749 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 4003 3260 gene locus_tag LOCUS_32760 4003 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 4192 5466 gene locus_tag LOCUS_32770 4192 5466 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 protein_id gnl|my_center|LOCUS_32770 5546 6424 gene locus_tag LOCUS_32780 5546 6424 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_32780 6424 7269 gene locus_tag LOCUS_32790 6424 7269 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_32790 7319 9610 gene locus_tag LOCUS_32800 7319 9610 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861838.1 protein_id gnl|my_center|LOCUS_32800 9874 11037 gene locus_tag LOCUS_32810 9874 11037 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_32810 11145 11948 gene locus_tag LOCUS_32820 11145 11948 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359375.1 protein_id gnl|my_center|LOCUS_32820 12294 13421 gene locus_tag LOCUS_32830 12294 13421 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966134.1 protein_id gnl|my_center|LOCUS_32830 13421 15013 gene locus_tag LOCUS_32840 13421 15013 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966133.1 protein_id gnl|my_center|LOCUS_32840 16970 15108 gene locus_tag LOCUS_32850 16970 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 17357 17758 gene locus_tag LOCUS_32860 17357 17758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 17979 19592 gene locus_tag LOCUS_32870 17979 19592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 19628 21391 gene locus_tag LOCUS_32880 19628 21391 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_32880 21408 22385 gene locus_tag LOCUS_32890 21408 22385 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_32890 22406 23461 gene locus_tag LOCUS_32900 gene mglB 22406 23461 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036947.1 protein_id gnl|my_center|LOCUS_32900 23601 24638 gene locus_tag LOCUS_32910 gene mglB 23601 24638 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881084.1 protein_id gnl|my_center|LOCUS_32910 24767 26284 gene locus_tag LOCUS_32920 gene mglA 24767 26284 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903113.1 protein_id gnl|my_center|LOCUS_32920 26301 27311 gene locus_tag LOCUS_32930 gene mglC 26301 27311 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707760.1 protein_id gnl|my_center|LOCUS_32930 27537 28229 gene locus_tag LOCUS_32940 27537 28229 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_32940 28252 29253 gene locus_tag LOCUS_32950 28252 29253 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_32950 30251 30427 gene locus_tag LOCUS_32960 30251 30427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 30690 31895 gene locus_tag LOCUS_32970 30690 31895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 32315 32527 gene locus_tag LOCUS_32980 32315 32527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence37 294 551 gene locus_tag LOCUS_32990 294 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 535 1191 gene locus_tag LOCUS_33000 535 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 1175 2182 gene locus_tag LOCUS_33010 1175 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 2146 3111 gene locus_tag LOCUS_33020 2146 3111 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731130.1 protein_id gnl|my_center|LOCUS_33020 3156 4469 gene locus_tag LOCUS_33030 3156 4469 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_33030 5459 4512 gene locus_tag LOCUS_33040 5459 4512 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256411.1 protein_id gnl|my_center|LOCUS_33040 5559 6251 gene locus_tag LOCUS_33050 5559 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 6984 6370 gene locus_tag LOCUS_33060 6984 6370 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760815.1 protein_id gnl|my_center|LOCUS_33060 7232 7558 gene locus_tag LOCUS_33070 7232 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 8331 7633 gene locus_tag LOCUS_33080 gene yeiL 8331 7633 CDS product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949096.1 protein_id gnl|my_center|LOCUS_33080 8523 8948 gene locus_tag LOCUS_33090 8523 8948 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282269.1 protein_id gnl|my_center|LOCUS_33090 8960 9403 gene locus_tag LOCUS_33100 8960 9403 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967631.1 protein_id gnl|my_center|LOCUS_33100 9555 10757 gene locus_tag LOCUS_33110 9555 10757 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948530.1 protein_id gnl|my_center|LOCUS_33110 10882 12066 gene locus_tag LOCUS_33120 10882 12066 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948531.1 protein_id gnl|my_center|LOCUS_33120 12092 13213 gene locus_tag LOCUS_33130 12092 13213 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948532.1 protein_id gnl|my_center|LOCUS_33130 14148 14351 gene locus_tag LOCUS_33140 14148 14351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 14411 14665 gene locus_tag LOCUS_33150 14411 14665 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948437.1 protein_id gnl|my_center|LOCUS_33150 14702 15190 gene locus_tag LOCUS_33160 14702 15190 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890795.1 protein_id gnl|my_center|LOCUS_33160 15468 16748 gene locus_tag LOCUS_33170 15468 16748 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_33170 17459 16851 gene locus_tag LOCUS_33180 gene lexA 17459 16851 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965137.1 protein_id gnl|my_center|LOCUS_33180 17699 18232 gene locus_tag LOCUS_33190 17699 18232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986376.1 protein_id gnl|my_center|LOCUS_33190 19322 18333 gene locus_tag LOCUS_33200 19322 18333 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_33200 20990 19560 gene locus_tag LOCUS_33210 gene purB 20990 19560 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_33210 21238 21444 gene locus_tag LOCUS_33220 21238 21444 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986779.1 protein_id gnl|my_center|LOCUS_33220 21876 21544 gene locus_tag LOCUS_33230 21876 21544 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349502.1 protein_id gnl|my_center|LOCUS_33230 22656 22015 gene locus_tag LOCUS_33240 22656 22015 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428771.1 protein_id gnl|my_center|LOCUS_33240 23515 22706 gene locus_tag LOCUS_33250 23515 22706 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296401.1 protein_id gnl|my_center|LOCUS_33250 24122 23529 gene locus_tag LOCUS_33260 24122 23529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 24391 24272 gene locus_tag LOCUS_33270 24391 24272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33270 25032 24505 gene locus_tag LOCUS_33280 gene dcd 25032 24505 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_33280 26265 25123 gene locus_tag LOCUS_33290 26265 25123 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048415.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33290 26529 26266 gene locus_tag LOCUS_33300 26529 26266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33300 27310 26558 gene locus_tag LOCUS_33310 27310 26558 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065023.1 protein_id gnl|my_center|LOCUS_33310 >Feature sequence38 1972 1769 gene locus_tag LOCUS_33320 1972 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 3198 2176 gene locus_tag LOCUS_33330 3198 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 4593 3577 gene locus_tag LOCUS_33340 4593 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 5987 5019 gene locus_tag LOCUS_33350 5987 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 7729 6203 gene locus_tag LOCUS_33360 7729 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 8088 7822 gene locus_tag LOCUS_33370 8088 7822 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965649.1 protein_id gnl|my_center|LOCUS_33370 9804 8194 gene locus_tag LOCUS_33380 9804 8194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048132.1 protein_id gnl|my_center|LOCUS_33380 10046 10831 gene locus_tag LOCUS_33390 gene csxA 10046 10831 CDS product exosporium protein CsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357706.1 protein_id gnl|my_center|LOCUS_33390 11089 11592 gene locus_tag LOCUS_33400 11089 11592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 12824 11679 gene locus_tag LOCUS_33410 12824 11679 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965651.1 protein_id gnl|my_center|LOCUS_33410 13981 13034 gene locus_tag LOCUS_33420 gene asrC 13981 13034 CDS product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948643.1 protein_id gnl|my_center|LOCUS_33420 14786 13995 gene locus_tag LOCUS_33430 gene asrB 14786 13995 CDS product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948642.1 protein_id gnl|my_center|LOCUS_33430 15794 14787 gene locus_tag LOCUS_33440 gene asrA 15794 14787 CDS product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948641.1 protein_id gnl|my_center|LOCUS_33440 16622 15936 gene locus_tag LOCUS_33450 16622 15936 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986193.1 protein_id gnl|my_center|LOCUS_33450 17511 16747 gene locus_tag LOCUS_33460 17511 16747 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948640.1 protein_id gnl|my_center|LOCUS_33460 19573 17927 gene locus_tag LOCUS_33470 gene hcp 19573 17927 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941334.1 protein_id gnl|my_center|LOCUS_33470 19944 19783 gene locus_tag LOCUS_33480 19944 19783 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966805.1 protein_id gnl|my_center|LOCUS_33480 20795 20082 gene locus_tag LOCUS_33490 gene ric 20795 20082 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948383.1 protein_id gnl|my_center|LOCUS_33490 22049 20817 gene locus_tag LOCUS_33500 22049 20817 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948382.1 protein_id gnl|my_center|LOCUS_33500 22269 22979 gene locus_tag LOCUS_33510 22269 22979 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948381.1 protein_id gnl|my_center|LOCUS_33510 23271 23561 gene locus_tag LOCUS_33520 23271 23561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33520 23617 23889 gene locus_tag LOCUS_33530 23617 23889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 >Feature sequence39 1559 357 gene locus_tag LOCUS_33540 gene megL 1559 357 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_33540 3461 1890 gene locus_tag LOCUS_33550 3461 1890 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947911.1 protein_id gnl|my_center|LOCUS_33550 4019 3609 gene locus_tag LOCUS_33560 4019 3609 CDS product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093444.1 protein_id gnl|my_center|LOCUS_33560 5602 4043 gene locus_tag LOCUS_33570 5602 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 5832 5623 gene locus_tag LOCUS_33580 5832 5623 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359683.1 protein_id gnl|my_center|LOCUS_33580 6379 5885 gene locus_tag LOCUS_33590 6379 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 6653 7237 gene locus_tag LOCUS_33600 6653 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 8500 7358 gene locus_tag LOCUS_33610 gene thiI 8500 7358 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966254.1 protein_id gnl|my_center|LOCUS_33610 9761 8619 gene locus_tag LOCUS_33620 9761 8619 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966255.1 protein_id gnl|my_center|LOCUS_33620 10030 11112 gene locus_tag LOCUS_33630 10030 11112 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965908.1 protein_id gnl|my_center|LOCUS_33630 11205 12104 gene locus_tag LOCUS_33640 11205 12104 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439388.1 protein_id gnl|my_center|LOCUS_33640 12779 12183 gene locus_tag LOCUS_33650 12779 12183 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_33650 14713 12800 gene locus_tag LOCUS_33660 14713 12800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 14960 16303 gene locus_tag LOCUS_33670 14960 16303 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989199.1 protein_id gnl|my_center|LOCUS_33670 16423 16899 gene locus_tag LOCUS_33680 16423 16899 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966935.1 protein_id gnl|my_center|LOCUS_33680 17728 16997 gene locus_tag LOCUS_33690 gene nagB 17728 16997 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987104.1 protein_id gnl|my_center|LOCUS_33690 18945 17761 gene locus_tag LOCUS_33700 gene nagA 18945 17761 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987105.1 protein_id gnl|my_center|LOCUS_33700 19870 18995 gene locus_tag LOCUS_33710 gene murQ 19870 18995 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948949.1 protein_id gnl|my_center|LOCUS_33710 20763 20032 gene locus_tag LOCUS_33720 20763 20032 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987106.1 protein_id gnl|my_center|LOCUS_33720 23196 21058 gene locus_tag LOCUS_33730 23196 21058 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459352.1 protein_id gnl|my_center|LOCUS_33730 23625 23263 gene locus_tag LOCUS_33740 23625 23263 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_33740 23884 24795 gene locus_tag LOCUS_33750 23884 24795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 >Feature sequence40 1926 1033 gene locus_tag LOCUS_33760 1926 1033 CDS product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385747.1 protein_id gnl|my_center|LOCUS_33760 2608 2692 gene locus_tag LOCUS_t00460 2608 2692 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3133 2756 gene locus_tag LOCUS_33770 3133 2756 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359335.1 protein_id gnl|my_center|LOCUS_33770 4269 3364 gene locus_tag LOCUS_33780 4269 3364 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965128.1 protein_id gnl|my_center|LOCUS_33780 4749 4477 gene locus_tag LOCUS_33790 4749 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 5024 5578 gene locus_tag LOCUS_33800 5024 5578 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023565.1 protein_id gnl|my_center|LOCUS_33800 6803 5664 gene locus_tag LOCUS_33810 6803 5664 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949066.1 protein_id gnl|my_center|LOCUS_33810 7685 7032 gene locus_tag LOCUS_33820 7685 7032 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963951.1 protein_id gnl|my_center|LOCUS_33820 8990 7998 gene locus_tag LOCUS_33830 8990 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 10064 9411 gene locus_tag LOCUS_33840 10064 9411 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964964.1 protein_id gnl|my_center|LOCUS_33840 10467 11123 gene locus_tag LOCUS_33850 10467 11123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 11244 11420 gene locus_tag LOCUS_33860 11244 11420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 12552 11437 gene locus_tag LOCUS_33870 12552 11437 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582490.1 protein_id gnl|my_center|LOCUS_33870 12817 12939 gene locus_tag LOCUS_33880 12817 12939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 13367 13633 gene locus_tag LOCUS_33890 13367 13633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 13988 13686 gene locus_tag LOCUS_33900 13988 13686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 15450 14947 gene locus_tag LOCUS_33910 15450 14947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 16410 15490 gene locus_tag LOCUS_33920 gene argC 16410 15490 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965686.1 protein_id gnl|my_center|LOCUS_33920 16684 17532 gene locus_tag LOCUS_33930 gene argB 16684 17532 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965685.1 protein_id gnl|my_center|LOCUS_33930 17514 18686 gene locus_tag LOCUS_33940 17514 18686 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965684.1 protein_id gnl|my_center|LOCUS_33940 18730 19860 gene locus_tag LOCUS_33950 18730 19860 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582490.1 protein_id gnl|my_center|LOCUS_33950 23171 19965 gene locus_tag LOCUS_33960 gene carB 23171 19965 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_33960 24219 23158 gene locus_tag LOCUS_33970 gene carA 24219 23158 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_33970 >Feature sequence41 863 651 gene locus_tag LOCUS_33980 863 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33980 1634 903 gene locus_tag LOCUS_33990 1634 903 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722821.1 protein_id gnl|my_center|LOCUS_33990 2375 1704 gene locus_tag LOCUS_34000 2375 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 3577 2720 gene locus_tag LOCUS_34010 3577 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 5592 4240 gene locus_tag LOCUS_34020 gene rlmD 5592 4240 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021134739.1 protein_id gnl|my_center|LOCUS_34020 6008 5607 gene locus_tag LOCUS_34030 6008 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 6302 7057 gene locus_tag LOCUS_34040 6302 7057 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813026.1 protein_id gnl|my_center|LOCUS_34040 7396 7151 gene locus_tag LOCUS_34050 7396 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 7988 7722 gene locus_tag LOCUS_34060 7988 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 9652 8402 gene locus_tag LOCUS_34070 gene purD 9652 8402 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964705.1 protein_id gnl|my_center|LOCUS_34070 11168 9666 gene locus_tag LOCUS_34080 gene purH 11168 9666 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385254.1 protein_id gnl|my_center|LOCUS_34080 11831 11223 gene locus_tag LOCUS_34090 gene purN 11831 11223 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047940.1 protein_id gnl|my_center|LOCUS_34090 12817 11819 gene locus_tag LOCUS_34100 gene purM 12817 11819 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964702.1 protein_id gnl|my_center|LOCUS_34100 14260 12827 gene locus_tag LOCUS_34110 gene purF 14260 12827 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_34110 15040 14333 gene locus_tag LOCUS_34120 15040 14333 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_34120 15559 15080 gene locus_tag LOCUS_34130 gene purE 15559 15080 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357851.1 protein_id gnl|my_center|LOCUS_34130 19901 16092 gene locus_tag LOCUS_34140 19901 16092 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_34140 21476 20133 gene locus_tag LOCUS_34150 21476 20133 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948912.1 protein_id gnl|my_center|LOCUS_34150 22427 22296 gene locus_tag LOCUS_34160 22427 22296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 22901 22518 gene locus_tag LOCUS_34170 22901 22518 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476321.1 protein_id gnl|my_center|LOCUS_34170 23140 22898 gene locus_tag LOCUS_34180 23140 22898 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115145.1 protein_id gnl|my_center|LOCUS_34180 >Feature sequence42 <1 631 gene locus_tag LOCUS_34190 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003429883.1:glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit 618 3824 gene locus_tag LOCUS_34200 gene carB 618 3824 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_34200 4112 4903 gene locus_tag LOCUS_34210 4112 4903 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963702.1 protein_id gnl|my_center|LOCUS_34210 4924 5571 gene locus_tag LOCUS_34220 4924 5571 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966882.1 protein_id gnl|my_center|LOCUS_34220 5587 6318 gene locus_tag LOCUS_34230 5587 6318 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165842655.1 protein_id gnl|my_center|LOCUS_34230 6380 7594 gene locus_tag LOCUS_34240 6380 7594 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986966.1 protein_id gnl|my_center|LOCUS_34240 7628 8950 gene locus_tag LOCUS_34250 gene argH 7628 8950 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986965.1 protein_id gnl|my_center|LOCUS_34250 9931 9071 gene locus_tag LOCUS_34260 gene rfbD 9931 9071 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582730.1 protein_id gnl|my_center|LOCUS_34260 11068 10058 gene locus_tag LOCUS_34270 11068 10058 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949049.1 protein_id gnl|my_center|LOCUS_34270 11205 11504 gene locus_tag LOCUS_34280 11205 11504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 11831 12013 gene locus_tag LOCUS_34290 11831 12013 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_34290 12183 12257 gene locus_tag LOCUS_t00470 12183 12257 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12276 12350 gene locus_tag LOCUS_t00480 12276 12350 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12672 15935 gene locus_tag LOCUS_34300 12672 15935 CDS product SNF2 helicase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986302.1 protein_id gnl|my_center|LOCUS_34300 16881 16057 gene locus_tag LOCUS_34310 16881 16057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 17180 18658 gene locus_tag LOCUS_34320 17180 18658 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015880.1 protein_id gnl|my_center|LOCUS_34320 18911 18789 gene locus_tag LOCUS_34330 18911 18789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 19056 19973 gene locus_tag LOCUS_34340 19056 19973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 20218 22248 gene locus_tag LOCUS_34350 20218 22248 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948292.1 protein_id gnl|my_center|LOCUS_34350 >Feature sequence43 447 944 gene locus_tag LOCUS_34360 447 944 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966286.1 protein_id gnl|my_center|LOCUS_34360 1645 1010 gene locus_tag LOCUS_34370 1645 1010 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948933.1 protein_id gnl|my_center|LOCUS_34370 2286 2426 gene locus_tag LOCUS_34380 2286 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 3003 2500 gene locus_tag LOCUS_34390 3003 2500 CDS product tryptophan transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966880.1 protein_id gnl|my_center|LOCUS_34390 4319 3549 gene locus_tag LOCUS_34400 4319 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 4628 5779 gene locus_tag LOCUS_34410 4628 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 5859 6278 gene locus_tag LOCUS_34420 5859 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 6450 7136 gene locus_tag LOCUS_34430 6450 7136 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_34430 7282 8280 gene locus_tag LOCUS_34440 7282 8280 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211618.1 protein_id gnl|my_center|LOCUS_34440 9304 8342 gene locus_tag LOCUS_34450 gene uvsE 9304 8342 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961166.1 protein_id gnl|my_center|LOCUS_34450 9814 10035 gene locus_tag LOCUS_34460 9814 10035 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986552.1 protein_id gnl|my_center|LOCUS_34460 10474 13056 gene locus_tag LOCUS_34470 gene adhE 10474 13056 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948126.1 protein_id gnl|my_center|LOCUS_34470 14776 13364 gene locus_tag LOCUS_34480 14776 13364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 15521 14838 gene locus_tag LOCUS_34490 15521 14838 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272297.1 protein_id gnl|my_center|LOCUS_34490 16202 15741 gene locus_tag LOCUS_34500 16202 15741 CDS product DUF4342 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392139.1 protein_id gnl|my_center|LOCUS_34500 16424 17485 gene locus_tag LOCUS_34510 16424 17485 CDS product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966118.1 protein_id gnl|my_center|LOCUS_34510 17624 18874 gene locus_tag LOCUS_34520 17624 18874 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693828.1 protein_id gnl|my_center|LOCUS_34520 18916 20058 gene locus_tag LOCUS_34530 18916 20058 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986710.1 protein_id gnl|my_center|LOCUS_34530 20778 20209 gene locus_tag LOCUS_34540 20778 20209 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263635.1 protein_id gnl|my_center|LOCUS_34540 21145 21525 gene locus_tag LOCUS_34550 21145 21525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 >Feature sequence44 1068 814 gene locus_tag LOCUS_34560 1068 814 CDS product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963456.1 protein_id gnl|my_center|LOCUS_34560 1446 1168 gene locus_tag LOCUS_34570 1446 1168 CDS product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400110.1 protein_id gnl|my_center|LOCUS_34570 2105 1509 gene locus_tag LOCUS_34580 gene recR 2105 1509 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_34580 2486 2148 gene locus_tag LOCUS_34590 2486 2148 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_34590 4319 2703 gene locus_tag LOCUS_34600 gene dnaX 4319 2703 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394606.1 protein_id gnl|my_center|LOCUS_34600 4513 4758 gene locus_tag LOCUS_34610 4513 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 4850 4761 gene locus_tag LOCUS_t00490 4850 4761 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5750 4986 gene locus_tag LOCUS_34620 gene lgt 5750 4986 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048192.1 protein_id gnl|my_center|LOCUS_34620 7670 5961 gene locus_tag LOCUS_34630 gene ptsP 7670 5961 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_34630 8031 7765 gene locus_tag LOCUS_34640 8031 7765 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362134.1 protein_id gnl|my_center|LOCUS_34640 9595 8201 gene locus_tag LOCUS_34650 9595 8201 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963557.1 protein_id gnl|my_center|LOCUS_34650 10100 9654 gene locus_tag LOCUS_34660 10100 9654 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963556.1 protein_id gnl|my_center|LOCUS_34660 11068 10133 gene locus_tag LOCUS_34670 gene pfkB 11068 10133 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963555.1 protein_id gnl|my_center|LOCUS_34670 11841 11065 gene locus_tag LOCUS_34680 11841 11065 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963554.1 protein_id gnl|my_center|LOCUS_34680 12350 12132 gene locus_tag LOCUS_34690 12350 12132 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963988.1 protein_id gnl|my_center|LOCUS_34690 12811 12371 gene locus_tag LOCUS_34700 12811 12371 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963450.1 protein_id gnl|my_center|LOCUS_34700 13073 12997 gene locus_tag LOCUS_t00500 13073 12997 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13285 14673 gene locus_tag LOCUS_34710 13285 14673 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922320.1 protein_id gnl|my_center|LOCUS_34710 14807 15121 gene locus_tag LOCUS_34720 14807 15121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947910.1 protein_id gnl|my_center|LOCUS_34720 15192 16793 gene locus_tag LOCUS_34730 15192 16793 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947909.1 protein_id gnl|my_center|LOCUS_34730 16831 17715 gene locus_tag LOCUS_34740 16831 17715 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947908.1 protein_id gnl|my_center|LOCUS_34740 19895 17736 gene locus_tag LOCUS_34750 19895 17736 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964908.1 protein_id gnl|my_center|LOCUS_34750 20240 20407 gene locus_tag LOCUS_34760 20240 20407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 >Feature sequence45 2571 832 gene locus_tag LOCUS_34770 2571 832 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986453.1 protein_id gnl|my_center|LOCUS_34770 2798 3628 gene locus_tag LOCUS_34780 gene dapF 2798 3628 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986452.1 protein_id gnl|my_center|LOCUS_34780 3751 5505 gene locus_tag LOCUS_34790 3751 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 5580 6776 gene locus_tag LOCUS_34800 5580 6776 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986448.1 protein_id gnl|my_center|LOCUS_34800 6819 7262 gene locus_tag LOCUS_34810 6819 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358853.1 protein_id gnl|my_center|LOCUS_34810 7243 7692 gene locus_tag LOCUS_34820 7243 7692 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965401.1 protein_id gnl|my_center|LOCUS_34820 7686 8144 gene locus_tag LOCUS_34830 7686 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 8134 8556 gene locus_tag LOCUS_34840 8134 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 8630 9451 gene locus_tag LOCUS_34850 8630 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965398.1 protein_id gnl|my_center|LOCUS_34850 9458 9904 gene locus_tag LOCUS_34860 9458 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 9907 10311 gene locus_tag LOCUS_34870 9907 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 10680 11240 gene locus_tag LOCUS_34880 gene efp 10680 11240 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_34880 11403 12323 gene locus_tag LOCUS_34890 gene spoIIIAA 11403 12323 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358945.1 protein_id gnl|my_center|LOCUS_34890 12325 12843 gene locus_tag LOCUS_34900 gene spoIIIAB 12325 12843 CDS product stage III sporulation protein SpoIIIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965392.1 protein_id gnl|my_center|LOCUS_34900 12860 13057 gene locus_tag LOCUS_34910 gene spoIIIAC 12860 13057 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965391.1 protein_id gnl|my_center|LOCUS_34910 13117 13500 gene locus_tag LOCUS_34920 gene spoIIIAD 13117 13500 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359080.1 protein_id gnl|my_center|LOCUS_34920 13510 14658 gene locus_tag LOCUS_34930 gene spoIIIAE 13510 14658 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358911.1 protein_id gnl|my_center|LOCUS_34930 14713 15306 gene locus_tag LOCUS_34940 gene spoIIIAF 14713 15306 CDS product stage III sporulation protein AF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359093.1 protein_id gnl|my_center|LOCUS_34940 15369 16013 gene locus_tag LOCUS_34950 gene spoIIIAG 15369 16013 CDS product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358958.1 protein_id gnl|my_center|LOCUS_34950 16066 16569 gene locus_tag LOCUS_34960 16066 16569 CDS product SpoIIIAH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965386.1 protein_id gnl|my_center|LOCUS_34960 16651 17040 gene locus_tag LOCUS_34970 16651 17040 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358935.1 protein_id gnl|my_center|LOCUS_34970 17126 17521 gene locus_tag LOCUS_34980 gene nusB 17126 17521 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_34980 17694 18542 gene locus_tag LOCUS_34990 17694 18542 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965383.1 protein_id gnl|my_center|LOCUS_34990 18532 19737 gene locus_tag LOCUS_35000 gene xseA 18532 19737 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_35000 19737 19970 gene locus_tag LOCUS_35010 19737 19970 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986443.1 protein_id gnl|my_center|LOCUS_35010 20015 20884 gene locus_tag LOCUS_35020 20015 20884 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986442.1 protein_id gnl|my_center|LOCUS_35020 21037 22899 gene locus_tag LOCUS_35030 gene dxs 21037 22899 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_35030 22935 23747 gene locus_tag LOCUS_35040 22935 23747 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_35040 23808 24689 gene locus_tag LOCUS_35050 23808 24689 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965375.1 protein_id gnl|my_center|LOCUS_35050 24658 25110 gene locus_tag LOCUS_35060 24658 25110 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_35060 25122 26810 gene locus_tag LOCUS_35070 gene recN 25122 26810 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986438.1 protein_id gnl|my_center|LOCUS_35070 27131 28354 gene locus_tag LOCUS_35080 gene spoIVB 27131 28354 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_35080 28550 29368 gene locus_tag LOCUS_35090 gene spo0A 28550 29368 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 protein_id gnl|my_center|LOCUS_35090 29614 30264 gene locus_tag LOCUS_35100 gene spoIIM 29614 30264 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358910.1 protein_id gnl|my_center|LOCUS_35100 30261 30488 gene locus_tag LOCUS_35110 30261 30488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 30534 31412 gene locus_tag LOCUS_35120 gene xerD 30534 31412 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986427.1 protein_id gnl|my_center|LOCUS_35120 31615 32796 gene locus_tag LOCUS_35130 31615 32796 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965363.1 protein_id gnl|my_center|LOCUS_35130 33030 33770 gene locus_tag LOCUS_35140 33030 33770 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965361.1 protein_id gnl|my_center|LOCUS_35140 33772 34359 gene locus_tag LOCUS_35150 gene scpB 33772 34359 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_35150 35032 34613 gene locus_tag LOCUS_35160 gene ytfJ 35032 34613 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402813.1 protein_id gnl|my_center|LOCUS_35160 35615 35025 gene locus_tag LOCUS_35170 35615 35025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 35746 36876 gene locus_tag LOCUS_35180 35746 36876 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047683.1 protein_id gnl|my_center|LOCUS_35180 38714 37122 gene locus_tag LOCUS_35190 38714 37122 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965259.1 protein_id gnl|my_center|LOCUS_35190 38948 39100 gene locus_tag LOCUS_35200 38948 39100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 39370 41694 gene locus_tag LOCUS_35210 39370 41694 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_35210 42169 41750 gene locus_tag LOCUS_35220 42169 41750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 42541 43503 gene locus_tag LOCUS_35230 42541 43503 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986740.1 protein_id gnl|my_center|LOCUS_35230 43500 44777 gene locus_tag LOCUS_35240 43500 44777 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392338.1 protein_id gnl|my_center|LOCUS_35240 45119 46219 gene locus_tag LOCUS_35250 45119 46219 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_35250 46242 47165 gene locus_tag LOCUS_35260 46242 47165 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_35260 47309 48157 gene locus_tag LOCUS_35270 47309 48157 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924049.1 protein_id gnl|my_center|LOCUS_35270 48978 48214 gene locus_tag LOCUS_35280 48978 48214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 49442 49657 gene locus_tag LOCUS_35290 49442 49657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 50141 50632 gene locus_tag LOCUS_35300 50141 50632 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003488680.1 protein_id gnl|my_center|LOCUS_35300 50967 51167 gene locus_tag LOCUS_35310 50967 51167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 51496 52491 gene locus_tag LOCUS_35320 51496 52491 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965021.1 protein_id gnl|my_center|LOCUS_35320 52753 54117 gene locus_tag LOCUS_35330 52753 54117 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897252.1 protein_id gnl|my_center|LOCUS_35330 54261 55415 gene locus_tag LOCUS_35340 54261 55415 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965022.1 protein_id gnl|my_center|LOCUS_35340 55625 56503 gene locus_tag LOCUS_35350 55625 56503 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_35350 56518 56790 gene locus_tag LOCUS_35360 56518 56790 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_35360 56790 57401 gene locus_tag LOCUS_35370 gene gmk 56790 57401 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388624.1 protein_id gnl|my_center|LOCUS_35370 57394 57612 gene locus_tag LOCUS_35380 gene rpoZ 57394 57612 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388622.1 protein_id gnl|my_center|LOCUS_35380 57614 58804 gene locus_tag LOCUS_35390 gene coaBC 57614 58804 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047883.1 protein_id gnl|my_center|LOCUS_35390 58853 61054 gene locus_tag LOCUS_35400 gene priA 58853 61054 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_35400 61190 61642 gene locus_tag LOCUS_35410 gene def 61190 61642 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_35410 61644 62573 gene locus_tag LOCUS_35420 gene fmt 61644 62573 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388615.1 protein_id gnl|my_center|LOCUS_35420 62589 63266 gene locus_tag LOCUS_35430 62589 63266 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047881.1 protein_id gnl|my_center|LOCUS_35430 63295 64626 gene locus_tag LOCUS_35440 gene rsmB 63295 64626 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440956.1 protein_id gnl|my_center|LOCUS_35440 64636 65682 gene locus_tag LOCUS_35450 gene rlmN 64636 65682 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_35450 65685 66431 gene locus_tag LOCUS_35460 65685 66431 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034581407.1 protein_id gnl|my_center|LOCUS_35460 66406 68334 gene locus_tag LOCUS_35470 gene pknB 66406 68334 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_35470 68409 69278 gene locus_tag LOCUS_35480 gene rsgA 68409 69278 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986840.1 protein_id gnl|my_center|LOCUS_35480 69275 69925 gene locus_tag LOCUS_35490 gene rpe 69275 69925 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986839.1 protein_id gnl|my_center|LOCUS_35490 69927 70562 gene locus_tag LOCUS_35500 69927 70562 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986838.1 protein_id gnl|my_center|LOCUS_35500 70692 70862 gene locus_tag LOCUS_35510 70692 70862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 71226 71035 gene locus_tag LOCUS_35520 gene rpmB 71226 71035 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965040.1 protein_id gnl|my_center|LOCUS_35520 71423 71773 gene locus_tag LOCUS_35530 71423 71773 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395974.1 protein_id gnl|my_center|LOCUS_35530 71787 73430 gene locus_tag LOCUS_35540 71787 73430 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_35540 73535 75607 gene locus_tag LOCUS_35550 gene recG 73535 75607 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965043.1 protein_id gnl|my_center|LOCUS_35550 75683 76246 gene locus_tag LOCUS_35560 gene rsmD 75683 76246 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986836.1 protein_id gnl|my_center|LOCUS_35560 76287 76769 gene locus_tag LOCUS_35570 gene coaD 76287 76769 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 protein_id gnl|my_center|LOCUS_35570 76781 77305 gene locus_tag LOCUS_35580 76781 77305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388465.1 protein_id gnl|my_center|LOCUS_35580 78457 77288 gene locus_tag LOCUS_35590 gene ylbJ 78457 77288 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986835.1 protein_id gnl|my_center|LOCUS_35590 79793 78570 gene locus_tag LOCUS_35600 79793 78570 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388463.1 protein_id gnl|my_center|LOCUS_35600 80067 81068 gene locus_tag LOCUS_35610 gene pta 80067 81068 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_35610 81119 82312 gene locus_tag LOCUS_35620 81119 82312 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_35620 82520 83020 gene locus_tag LOCUS_35630 82520 83020 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214224.1 protein_id gnl|my_center|LOCUS_35630 83033 83218 gene locus_tag LOCUS_35640 gene rpmF 83033 83218 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965052.1 protein_id gnl|my_center|LOCUS_35640 83380 84405 gene locus_tag LOCUS_35650 gene plsX 83380 84405 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047867.1 protein_id gnl|my_center|LOCUS_35650 84447 84677 gene locus_tag LOCUS_35660 gene acpP 84447 84677 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_35660 84886 85587 gene locus_tag LOCUS_35670 gene rnc 84886 85587 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440969.1 protein_id gnl|my_center|LOCUS_35670 85580 86671 gene locus_tag LOCUS_35680 85580 86671 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965056.1 protein_id gnl|my_center|LOCUS_35680 86736 86996 gene locus_tag LOCUS_35690 86736 86996 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965057.1 protein_id gnl|my_center|LOCUS_35690 87262 90816 gene locus_tag LOCUS_35700 gene smc 87262 90816 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_35700 90834 91745 gene locus_tag LOCUS_35710 gene ftsY 90834 91745 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393780.1 protein_id gnl|my_center|LOCUS_35710 91856 92203 gene locus_tag LOCUS_35720 91856 92203 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393779.1 protein_id gnl|my_center|LOCUS_35720 92214 93563 gene locus_tag LOCUS_35730 gene ffh 92214 93563 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362591.1 protein_id gnl|my_center|LOCUS_35730 93606 93848 gene locus_tag LOCUS_35740 gene rpsP 93606 93848 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_35740 93883 94110 gene locus_tag LOCUS_35750 93883 94110 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_35750 94226 94717 gene locus_tag LOCUS_35760 gene rimM 94226 94717 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_35760 94705 95430 gene locus_tag LOCUS_35770 gene trmD 94705 95430 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384686.1 protein_id gnl|my_center|LOCUS_35770 95667 96014 gene locus_tag LOCUS_35780 gene rplS 95667 96014 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_35780 96125 96973 gene locus_tag LOCUS_35790 gene ylqF 96125 96973 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047861.1 protein_id gnl|my_center|LOCUS_35790 97133 97957 gene locus_tag LOCUS_35800 97133 97957 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965069.1 protein_id gnl|my_center|LOCUS_35800 98396 98028 gene locus_tag LOCUS_35810 98396 98028 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_35810 98795 100318 gene locus_tag LOCUS_35820 98795 100318 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965072.1 protein_id gnl|my_center|LOCUS_35820 100354 101436 gene locus_tag LOCUS_35830 gene dprA 100354 101436 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047859.1 protein_id gnl|my_center|LOCUS_35830 101484 103583 gene locus_tag LOCUS_35840 gene topA 101484 103583 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_35840 103823 104596 gene locus_tag LOCUS_35850 gene codY 103823 104596 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362579.1 protein_id gnl|my_center|LOCUS_35850 104889 105590 gene locus_tag LOCUS_35860 gene rpsB 104889 105590 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965093.1 protein_id gnl|my_center|LOCUS_35860 105729 106649 gene locus_tag LOCUS_35870 gene tsf 105729 106649 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384678.1 protein_id gnl|my_center|LOCUS_35870 106721 107449 gene locus_tag LOCUS_35880 gene pyrH 106721 107449 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965095.1 protein_id gnl|my_center|LOCUS_35880 107465 108022 gene locus_tag LOCUS_35890 gene frr 107465 108022 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986799.1 protein_id gnl|my_center|LOCUS_35890 108104 108871 gene locus_tag LOCUS_35900 108104 108871 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_35900 108882 109688 gene locus_tag LOCUS_35910 108882 109688 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_35910 110161 111321 gene locus_tag LOCUS_35920 gene dxr 110161 111321 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986796.1 protein_id gnl|my_center|LOCUS_35920 111336 112367 gene locus_tag LOCUS_35930 gene rseP 111336 112367 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384669.1 protein_id gnl|my_center|LOCUS_35930 112380 113438 gene locus_tag LOCUS_35940 gene ispG 112380 113438 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986795.1 protein_id gnl|my_center|LOCUS_35940 113463 117806 gene locus_tag LOCUS_35950 113463 117806 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_35950 118010 118471 gene locus_tag LOCUS_35960 gene rimP 118010 118471 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986793.1 protein_id gnl|my_center|LOCUS_35960 118485 119591 gene locus_tag LOCUS_35970 gene nusA 118485 119591 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965105.1 protein_id gnl|my_center|LOCUS_35970 119603 119890 gene locus_tag LOCUS_35980 119603 119890 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_35980 119880 120272 gene locus_tag LOCUS_35990 119880 120272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 120296 122371 gene locus_tag LOCUS_36000 gene infB 120296 122371 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965108.1 protein_id gnl|my_center|LOCUS_36000 122392 122829 gene locus_tag LOCUS_36010 gene rbfA 122392 122829 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_36010 122789 123781 gene locus_tag LOCUS_36020 122789 123781 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986790.1 protein_id gnl|my_center|LOCUS_36020 123778 124647 gene locus_tag LOCUS_36030 gene truB 123778 124647 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965111.1 protein_id gnl|my_center|LOCUS_36030 124660 125583 gene locus_tag LOCUS_36040 124660 125583 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986788.1 protein_id gnl|my_center|LOCUS_36040 125716 125979 gene locus_tag LOCUS_36050 gene rpsO 125716 125979 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_36050 126099 128210 gene locus_tag LOCUS_36060 126099 128210 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986787.1 protein_id gnl|my_center|LOCUS_36060 128305 129579 gene locus_tag LOCUS_36070 128305 129579 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986786.1 protein_id gnl|my_center|LOCUS_36070 129717 129992 gene locus_tag LOCUS_36080 129717 129992 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362551.1 protein_id gnl|my_center|LOCUS_36080 130008 131198 gene locus_tag LOCUS_36090 gene dapG 130008 131198 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986785.1 protein_id gnl|my_center|LOCUS_36090 131256 131963 gene locus_tag LOCUS_36100 131256 131963 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388341.1 protein_id gnl|my_center|LOCUS_36100 132140 134470 gene locus_tag LOCUS_36110 132140 134470 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965118.1 protein_id gnl|my_center|LOCUS_36110 134659 135996 gene locus_tag LOCUS_36120 gene rimO 134659 135996 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965119.1 protein_id gnl|my_center|LOCUS_36120 135980 136540 gene locus_tag LOCUS_36130 gene pgsA 135980 136540 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_36130 136747 137814 gene locus_tag LOCUS_36140 gene recA 136747 137814 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_36140 138172 139728 gene locus_tag LOCUS_36150 gene rny 138172 139728 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 protein_id gnl|my_center|LOCUS_36150 139848 140108 gene locus_tag LOCUS_36160 139848 140108 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362540.1 protein_id gnl|my_center|LOCUS_36160 140313 141503 gene locus_tag LOCUS_36170 140313 141503 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986780.1 protein_id gnl|my_center|LOCUS_36170 141605 141865 gene locus_tag LOCUS_36180 141605 141865 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362134.1 protein_id gnl|my_center|LOCUS_36180 142012 142989 gene locus_tag LOCUS_36190 gene xerC 142012 142989 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_36190 143418 144662 gene locus_tag LOCUS_36200 143418 144662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 144810 145445 gene locus_tag LOCUS_36210 144810 145445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 145485 146252 gene locus_tag LOCUS_36220 145485 146252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870951.1 protein_id gnl|my_center|LOCUS_36220 146418 146747 gene locus_tag LOCUS_36230 146418 146747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 146875 147354 gene locus_tag LOCUS_36240 gene msrA 146875 147354 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986464.1 protein_id gnl|my_center|LOCUS_36240 147517 149505 gene locus_tag LOCUS_36250 147517 149505 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986282.1 protein_id gnl|my_center|LOCUS_36250 149845 150321 gene locus_tag LOCUS_36260 149845 150321 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_36260 150314 150583 gene locus_tag LOCUS_36270 150314 150583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 150580 150900 gene locus_tag LOCUS_36280 150580 150900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 150887 151126 gene locus_tag LOCUS_36290 150887 151126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36290 151123 151845 gene locus_tag LOCUS_36300 151123 151845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 151848 152210 gene locus_tag LOCUS_36310 151848 152210 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902377.1 protein_id gnl|my_center|LOCUS_36310 152212 153684 gene locus_tag LOCUS_36320 152212 153684 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_36320 153700 155145 gene locus_tag LOCUS_36330 153700 155145 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_36330 155163 157172 gene locus_tag LOCUS_36340 155163 157172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 158392 157292 gene locus_tag LOCUS_36350 158392 157292 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459186.1 protein_id gnl|my_center|LOCUS_36350 158717 159427 gene locus_tag LOCUS_36360 158717 159427 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986387.1 protein_id gnl|my_center|LOCUS_36360 159641 160519 gene locus_tag LOCUS_36370 159641 160519 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_36370 160696 162048 gene locus_tag LOCUS_36380 gene gdhA 160696 162048 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_36380 162244 163470 gene locus_tag LOCUS_36390 162244 163470 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986386.1 protein_id gnl|my_center|LOCUS_36390 163608 164270 gene locus_tag LOCUS_36400 gene cmk 163608 164270 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965153.1 protein_id gnl|my_center|LOCUS_36400 164304 165179 gene locus_tag LOCUS_36410 164304 165179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 165334 166392 gene locus_tag LOCUS_36420 165334 166392 CDS product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986383.1 protein_id gnl|my_center|LOCUS_36420 166504 167373 gene locus_tag LOCUS_36430 166504 167373 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986382.1 protein_id gnl|my_center|LOCUS_36430 168613 167417 gene locus_tag LOCUS_36440 168613 167417 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358889.1 protein_id gnl|my_center|LOCUS_36440 168800 168642 gene locus_tag LOCUS_36450 168800 168642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 169095 170420 gene locus_tag LOCUS_36460 gene miaB 169095 170420 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_36460 170451 173171 gene locus_tag LOCUS_36470 gene mutS 170451 173171 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_36470 173254 175197 gene locus_tag LOCUS_36480 gene mutL 173254 175197 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965141.1 protein_id gnl|my_center|LOCUS_36480 175212 176150 gene locus_tag LOCUS_36490 gene miaA 175212 176150 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_36490 176233 176481 gene locus_tag LOCUS_36500 gene hfq 176233 176481 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965139.1 protein_id gnl|my_center|LOCUS_36500 176975 176589 gene locus_tag LOCUS_36510 176975 176589 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_36510 177186 177608 gene locus_tag LOCUS_36520 177186 177608 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 protein_id gnl|my_center|LOCUS_36520 177932 178462 gene locus_tag LOCUS_36530 gene sigY 177932 178462 CDS product RNA polymerase sigma factor SigY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243678.1 protein_id gnl|my_center|LOCUS_36530 178463 178870 gene locus_tag LOCUS_36540 178463 178870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 178870 179088 gene locus_tag LOCUS_36550 178870 179088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 179300 179506 gene locus_tag LOCUS_36560 179300 179506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 179499 180434 gene locus_tag LOCUS_36570 179499 180434 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582702.1 protein_id gnl|my_center|LOCUS_36570 180421 181176 gene locus_tag LOCUS_36580 180421 181176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 181319 181465 gene locus_tag LOCUS_36590 181319 181465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 181772 182839 gene locus_tag LOCUS_36600 181772 182839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 182878 184050 gene locus_tag LOCUS_36610 182878 184050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 184187 186748 gene locus_tag LOCUS_36620 184187 186748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 186781 187755 gene locus_tag LOCUS_36630 186781 187755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 187772 189541 gene locus_tag LOCUS_36640 187772 189541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 189602 193006 gene locus_tag LOCUS_36650 189602 193006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 193122 195467 gene locus_tag LOCUS_36660 193122 195467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 195487 196758 gene locus_tag LOCUS_36670 195487 196758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 196841 197479 gene locus_tag LOCUS_36680 196841 197479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 197523 198806 gene locus_tag LOCUS_36690 197523 198806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 198808 200559 gene locus_tag LOCUS_36700 198808 200559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 200590 201321 gene locus_tag LOCUS_36710 200590 201321 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_36710 205004 201441 gene locus_tag LOCUS_36720 205004 201441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 205172 206107 gene locus_tag LOCUS_36730 205172 206107 CDS product DUF4003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948490.1 protein_id gnl|my_center|LOCUS_36730 207050 206226 gene locus_tag LOCUS_36740 gene pdaA 207050 206226 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966291.1 protein_id gnl|my_center|LOCUS_36740 207279 208781 gene locus_tag LOCUS_36750 207279 208781 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948597.1 protein_id gnl|my_center|LOCUS_36750 208838 209380 gene locus_tag LOCUS_36760 gene yfcE 208838 209380 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_36760 210678 209440 gene locus_tag LOCUS_36770 210678 209440 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966040.1 protein_id gnl|my_center|LOCUS_36770 211649 210846 gene locus_tag LOCUS_36780 211649 210846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948868.1 protein_id gnl|my_center|LOCUS_36780 212088 212945 gene locus_tag LOCUS_36790 212088 212945 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966558.1 protein_id gnl|my_center|LOCUS_36790 213123 213284 gene locus_tag LOCUS_36800 213123 213284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 >Feature sequence46 555 334 gene locus_tag LOCUS_36810 555 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 1227 814 gene locus_tag LOCUS_36820 1227 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 1637 2638 gene locus_tag LOCUS_36830 1637 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 3673 2606 gene locus_tag LOCUS_36840 3673 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 4181 3744 gene locus_tag LOCUS_36850 4181 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36850 4699 4499 gene locus_tag LOCUS_36860 4699 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 5023 4947 gene locus_tag LOCUS_t00510 5023 4947 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5602 5075 gene locus_tag LOCUS_36870 5602 5075 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459818.1 protein_id gnl|my_center|LOCUS_36870 5850 5760 gene locus_tag LOCUS_t00520 5850 5760 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5972 5882 gene locus_tag LOCUS_t00530 5972 5882 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6184 6094 gene locus_tag LOCUS_t00540 6184 6094 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6304 6214 gene locus_tag LOCUS_t00550 6304 6214 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7753 6470 gene locus_tag LOCUS_36880 gene serS 7753 6470 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947906.1 protein_id gnl|my_center|LOCUS_36880 8465 8205 gene locus_tag LOCUS_36890 8465 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 9879 8482 gene locus_tag LOCUS_36900 9879 8482 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947905.1 protein_id gnl|my_center|LOCUS_36900 12190 9971 gene locus_tag LOCUS_36910 12190 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 15172 12452 gene locus_tag LOCUS_36920 15172 12452 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963339.1 protein_id gnl|my_center|LOCUS_36920 16332 15169 gene locus_tag LOCUS_36930 16332 15169 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986024.1 protein_id gnl|my_center|LOCUS_36930 16896 16381 gene locus_tag LOCUS_36940 16896 16381 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947901.1 protein_id gnl|my_center|LOCUS_36940 17577 17065 gene locus_tag LOCUS_36950 17577 17065 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963337.1 protein_id gnl|my_center|LOCUS_36950 17792 17717 gene locus_tag LOCUS_t00560 17792 17717 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 17874 17798 gene locus_tag LOCUS_t00570 17874 17798 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17998 17887 gene locus_tag LOCUS_r00060 17998 17887 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence47 1182 454 gene locus_tag LOCUS_36960 1182 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 2864 1590 gene locus_tag LOCUS_36970 2864 1590 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948368.1 protein_id gnl|my_center|LOCUS_36970 3304 4173 gene locus_tag LOCUS_36980 3304 4173 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986300.1 protein_id gnl|my_center|LOCUS_36980 4404 5339 gene locus_tag LOCUS_36990 4404 5339 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987089.1 protein_id gnl|my_center|LOCUS_36990 5355 6467 gene locus_tag LOCUS_37000 5355 6467 CDS product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987088.1 protein_id gnl|my_center|LOCUS_37000 8215 6551 gene locus_tag LOCUS_37010 8215 6551 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948911.1 protein_id gnl|my_center|LOCUS_37010 8398 8697 gene locus_tag LOCUS_37020 8398 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 9010 9456 gene locus_tag LOCUS_37030 9010 9456 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461668.1 protein_id gnl|my_center|LOCUS_37030 9606 9457 gene locus_tag LOCUS_37040 9606 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 9953 9738 gene locus_tag LOCUS_37050 9953 9738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 11622 10552 gene locus_tag LOCUS_37060 11622 10552 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519041.1 protein_id gnl|my_center|LOCUS_37060 11948 11778 gene locus_tag LOCUS_37070 11948 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 12622 12041 gene locus_tag LOCUS_37080 12622 12041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 13682 12942 gene locus_tag LOCUS_37090 13682 12942 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965592.1 protein_id gnl|my_center|LOCUS_37090 14521 13880 gene locus_tag LOCUS_37100 14521 13880 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357796.1 protein_id gnl|my_center|LOCUS_37100 15245 14586 gene locus_tag LOCUS_37110 15245 14586 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048091.1 protein_id gnl|my_center|LOCUS_37110 16684 15278 gene locus_tag LOCUS_37120 16684 15278 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965594.1 protein_id gnl|my_center|LOCUS_37120 17607 16711 gene locus_tag LOCUS_37130 17607 16711 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965595.1 protein_id gnl|my_center|LOCUS_37130 17878 17657 gene locus_tag LOCUS_37140 17878 17657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 >Feature sequence48 561 412 gene locus_tag LOCUS_37150 561 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 2018 639 gene locus_tag LOCUS_37160 gene murD 2018 639 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966471.1 protein_id gnl|my_center|LOCUS_37160 3654 2254 gene locus_tag LOCUS_37170 3654 2254 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_37170 4077 4003 gene locus_tag LOCUS_t00580 4077 4003 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5763 4246 gene locus_tag LOCUS_37180 gene lysS 5763 4246 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048371.1 protein_id gnl|my_center|LOCUS_37180 6398 5916 gene locus_tag LOCUS_37190 gene greA 6398 5916 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_37190 7483 6665 gene locus_tag LOCUS_37200 7483 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048373.1 protein_id gnl|my_center|LOCUS_37200 8539 7562 gene locus_tag LOCUS_37210 gene dusB 8539 7562 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048374.1 protein_id gnl|my_center|LOCUS_37210 9330 8551 gene locus_tag LOCUS_37220 9330 8551 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359441.1 protein_id gnl|my_center|LOCUS_37220 10752 9613 gene locus_tag LOCUS_37230 10752 9613 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_37230 11183 10773 gene locus_tag LOCUS_37240 11183 10773 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_37240 11584 11207 gene locus_tag LOCUS_37250 11584 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 13088 11598 gene locus_tag LOCUS_37260 13088 11598 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978571.1 protein_id gnl|my_center|LOCUS_37260 13507 13328 gene locus_tag LOCUS_37270 13507 13328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37270 13716 13546 gene locus_tag LOCUS_37280 13716 13546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37280 >Feature sequence49 779 570 gene locus_tag LOCUS_37290 779 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 676 906 gene locus_tag LOCUS_37300 676 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 1133 939 gene locus_tag LOCUS_37310 1133 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 1063 1863 gene locus_tag LOCUS_37320 1063 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 3178 2261 gene locus_tag LOCUS_37330 3178 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 5180 3375 gene locus_tag LOCUS_37340 5180 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 7276 5216 gene locus_tag LOCUS_37350 7276 5216 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272794.1 protein_id gnl|my_center|LOCUS_37350 7792 7328 gene locus_tag LOCUS_37360 7792 7328 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949080.1 protein_id gnl|my_center|LOCUS_37360 8314 7886 gene locus_tag LOCUS_37370 8314 7886 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965761.1 protein_id gnl|my_center|LOCUS_37370 9626 8304 gene locus_tag LOCUS_37380 9626 8304 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012297.1 protein_id gnl|my_center|LOCUS_37380 10154 9714 gene locus_tag LOCUS_37390 10154 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 10520 10179 gene locus_tag LOCUS_37400 10520 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 >Feature sequence50 903 1607 gene locus_tag LOCUS_37410 903 1607 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337279.1 protein_id gnl|my_center|LOCUS_37410 1837 1753 gene locus_tag LOCUS_t00590 1837 1753 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2237 2812 gene locus_tag LOCUS_37420 2237 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 3124 4368 gene locus_tag LOCUS_37430 gene sstT 3124 4368 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_37430 4719 5612 gene locus_tag LOCUS_37440 4719 5612 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964712.1 protein_id gnl|my_center|LOCUS_37440 5831 7699 gene locus_tag LOCUS_37450 5831 7699 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37450 7805 8263 gene locus_tag LOCUS_37460 7805 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37460 8464 9501 gene locus_tag LOCUS_37470 8464 9501 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_37470 9559 9936 gene locus_tag LOCUS_37480 9559 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 >Feature sequence51 620 459 gene locus_tag LOCUS_37490 620 459 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_37490 1742 732 gene locus_tag LOCUS_37500 gene splB 1742 732 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879610.1 protein_id gnl|my_center|LOCUS_37500 2103 1870 gene locus_tag LOCUS_37510 2103 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 2712 2221 gene locus_tag LOCUS_37520 2712 2221 CDS product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361191.1 protein_id gnl|my_center|LOCUS_37520 4505 2754 gene locus_tag LOCUS_37530 4505 2754 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771340.1 protein_id gnl|my_center|LOCUS_37530 5322 4531 gene locus_tag LOCUS_37540 5322 4531 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949132.1 protein_id gnl|my_center|LOCUS_37540 6228 5368 gene locus_tag LOCUS_37550 gene rlmA 6228 5368 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460128.1 protein_id gnl|my_center|LOCUS_37550 7273 6233 gene locus_tag LOCUS_37560 7273 6233 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965727.1 protein_id gnl|my_center|LOCUS_37560 7498 7758 gene locus_tag LOCUS_37570 7498 7758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 8616 8311 gene locus_tag LOCUS_37580 8616 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 >Feature sequence52 182 343 gene locus_tag LOCUS_37590 182 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 1392 985 gene locus_tag LOCUS_37600 1392 985 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244837.1 protein_id gnl|my_center|LOCUS_37600 2297 1455 gene locus_tag LOCUS_37610 2297 1455 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184072.1 protein_id gnl|my_center|LOCUS_37610 3052 2375 gene locus_tag LOCUS_37620 3052 2375 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476538.1 protein_id gnl|my_center|LOCUS_37620 3814 3200 gene locus_tag LOCUS_37630 3814 3200 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965824.1 protein_id gnl|my_center|LOCUS_37630 4310 3831 gene locus_tag LOCUS_37640 4310 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 4567 4349 gene locus_tag LOCUS_37650 4567 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 5513 4752 gene locus_tag LOCUS_37660 5513 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 5712 5581 gene locus_tag LOCUS_37670 5712 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 6377 6228 gene locus_tag LOCUS_37680 6377 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 6661 6449 gene locus_tag LOCUS_37690 6661 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 7050 6793 gene locus_tag LOCUS_37700 7050 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 7527 7093 gene locus_tag LOCUS_37710 7527 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 8301 7852 gene locus_tag LOCUS_37720 8301 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 >Feature sequence53 721 320 gene locus_tag LOCUS_37730 721 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 1277 744 gene locus_tag LOCUS_37740 1277 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 2037 1279 gene locus_tag LOCUS_37750 2037 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 2995 2018 gene locus_tag LOCUS_37760 2995 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 4333 3323 gene locus_tag LOCUS_37770 4333 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356452.1 protein_id gnl|my_center|LOCUS_37770 5359 4352 gene locus_tag LOCUS_37780 5359 4352 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948238.1 protein_id gnl|my_center|LOCUS_37780 6203 5742 gene locus_tag LOCUS_37790 6203 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37790 6456 6226 gene locus_tag LOCUS_37800 6456 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 <7710 6612 gene locus_tag LOCUS_37810 <7710 6612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965615.1:O-antigen ligase >Feature sequence54 457 711 gene locus_tag LOCUS_37820 457 711 CDS product CBO2463/CBO2479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393252.1 protein_id gnl|my_center|LOCUS_37820 711 1436 gene locus_tag LOCUS_37830 gene prdB 711 1436 CDS product D-proline reductase (dithiol) protein PrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861888.1 transl_except (pos:1161..1163,aa:Sec) note codon on position 151 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_37830 1509 2273 gene locus_tag LOCUS_37840 gene prdD 1509 2273 CDS product proline reductase cluster protein PrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047874.1 protein_id gnl|my_center|LOCUS_37840 2374 2847 gene locus_tag LOCUS_37850 2374 2847 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393249.1 protein_id gnl|my_center|LOCUS_37850 2851 3855 gene locus_tag LOCUS_37860 2851 3855 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393245.1 protein_id gnl|my_center|LOCUS_37860 4130 5011 gene locus_tag LOCUS_37870 4130 5011 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047873.1 protein_id gnl|my_center|LOCUS_37870 5407 6711 gene locus_tag LOCUS_37880 gene prdC 5407 6711 CDS product proline reductase-associated electron transfer protein PrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047877.1 protein_id gnl|my_center|LOCUS_37880 >Feature sequence55 443 583 gene locus_tag LOCUS_37890 443 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 1733 657 gene locus_tag LOCUS_37900 1733 657 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_37900 2419 1736 gene locus_tag LOCUS_37910 gene modB 2419 1736 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888685.1 protein_id gnl|my_center|LOCUS_37910 3276 2461 gene locus_tag LOCUS_37920 gene modA 3276 2461 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860975.1 protein_id gnl|my_center|LOCUS_37920 4412 3447 gene locus_tag LOCUS_37930 4412 3447 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963575.1 protein_id gnl|my_center|LOCUS_37930 5424 4453 gene locus_tag LOCUS_37940 5424 4453 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398871.1 protein_id gnl|my_center|LOCUS_37940 6429 6151 gene locus_tag LOCUS_37950 6429 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 6799 6416 gene locus_tag LOCUS_37960 6799 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 >Feature sequence56 <1 1350 gene locus_tag LOCUS_37970 <1 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047876.1:D-proline reductase (dithiol) proprotein PrdA 1360 1614 gene locus_tag LOCUS_37980 1360 1614 CDS product CBO2463/CBO2479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393252.1 protein_id gnl|my_center|LOCUS_37980 1614 2339 gene locus_tag LOCUS_37990 gene prdB 1614 2339 CDS product D-proline reductase (dithiol) protein PrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861888.1 transl_except (pos:2064..2066,aa:Sec) note codon on position 151 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_37990 2528 3532 gene locus_tag LOCUS_38000 2528 3532 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393245.1 protein_id gnl|my_center|LOCUS_38000 3583 4458 gene locus_tag LOCUS_38010 3583 4458 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451047.1 protein_id gnl|my_center|LOCUS_38010 5986 4631 gene locus_tag LOCUS_38020 5986 4631 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947998.1 protein_id gnl|my_center|LOCUS_38020 6182 8344 gene locus_tag LOCUS_38030 6182 8344 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 protein_id gnl|my_center|LOCUS_38030 8604 9242 gene locus_tag LOCUS_38040 8604 9242 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948000.1 protein_id gnl|my_center|LOCUS_38040 9761 9312 gene locus_tag LOCUS_38050 gene rimI 9761 9312 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966125.1 protein_id gnl|my_center|LOCUS_38050 10467 9754 gene locus_tag LOCUS_38060 gene tsaB 10467 9754 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048262.1 protein_id gnl|my_center|LOCUS_38060 10922 10464 gene locus_tag LOCUS_38070 gene tsaE 10922 10464 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966123.1 protein_id gnl|my_center|LOCUS_38070 11106 11726 gene locus_tag LOCUS_38080 11106 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 11859 11934 gene locus_tag LOCUS_t00600 11859 11934 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 11961 12036 gene locus_tag LOCUS_t00610 11961 12036 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 12180 13160 gene locus_tag LOCUS_38090 12180 13160 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399676.1 protein_id gnl|my_center|LOCUS_38090 13848 14759 gene locus_tag LOCUS_38100 gene cysK 13848 14759 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948015.1 protein_id gnl|my_center|LOCUS_38100 14795 15379 gene locus_tag LOCUS_38110 gene cysE 14795 15379 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948016.1 protein_id gnl|my_center|LOCUS_38110 15393 16385 gene locus_tag LOCUS_38120 gene queG 15393 16385 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948017.1 protein_id gnl|my_center|LOCUS_38120 16425 17132 gene locus_tag LOCUS_38130 16425 17132 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948018.1 protein_id gnl|my_center|LOCUS_38130 17435 18628 gene locus_tag LOCUS_38140 17435 18628 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095906.1 protein_id gnl|my_center|LOCUS_38140 18730 19689 gene locus_tag LOCUS_38150 18730 19689 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723125.1 protein_id gnl|my_center|LOCUS_38150 19830 20459 gene locus_tag LOCUS_38160 gene nth 19830 20459 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_38160 21042 20554 gene locus_tag LOCUS_38170 21042 20554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 21764 21162 gene locus_tag LOCUS_38180 21764 21162 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949128.1 protein_id gnl|my_center|LOCUS_38180 21963 22553 gene locus_tag LOCUS_38190 21963 22553 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949129.1 protein_id gnl|my_center|LOCUS_38190 22747 23973 gene locus_tag LOCUS_38200 gene pepT 22747 23973 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_38200 24221 25633 gene locus_tag LOCUS_38210 24221 25633 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965728.1 protein_id gnl|my_center|LOCUS_38210 27736 25736 gene locus_tag LOCUS_38220 27736 25736 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948262.1 protein_id gnl|my_center|LOCUS_38220 29655 27991 gene locus_tag LOCUS_38230 gene sulP 29655 27991 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_38230 30024 31034 gene locus_tag LOCUS_38240 30024 31034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 31303 31872 gene locus_tag LOCUS_38250 31303 31872 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948220.1 protein_id gnl|my_center|LOCUS_38250 31883 32758 gene locus_tag LOCUS_38260 31883 32758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 33072 34013 gene locus_tag LOCUS_38270 33072 34013 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416574.1 protein_id gnl|my_center|LOCUS_38270 34668 34057 gene locus_tag LOCUS_38280 34668 34057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 34919 36538 gene locus_tag LOCUS_38290 gene glgP 34919 36538 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964175.1 protein_id gnl|my_center|LOCUS_38290 36763 36957 gene locus_tag LOCUS_38300 36763 36957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 38036 37008 gene locus_tag LOCUS_38310 38036 37008 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989632.1 protein_id gnl|my_center|LOCUS_38310 38943 38305 gene locus_tag LOCUS_38320 38943 38305 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964218.1 protein_id gnl|my_center|LOCUS_38320 39329 40351 gene locus_tag LOCUS_38330 gene tsaD 39329 40351 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_38330 41462 40356 gene locus_tag LOCUS_38340 41462 40356 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359094.1 protein_id gnl|my_center|LOCUS_38340 41862 42329 gene locus_tag LOCUS_38350 41862 42329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 42571 43680 gene locus_tag LOCUS_38360 42571 43680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 44013 43831 gene locus_tag LOCUS_38370 44013 43831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 43958 44233 gene locus_tag LOCUS_38380 43958 44233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 44352 44603 gene locus_tag LOCUS_38390 44352 44603 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965739.1 protein_id gnl|my_center|LOCUS_38390 44921 45862 gene locus_tag LOCUS_38400 44921 45862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 46324 46704 gene locus_tag LOCUS_38410 46324 46704 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_38410 46813 47637 gene locus_tag LOCUS_38420 46813 47637 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_38420 47694 48347 gene locus_tag LOCUS_38430 gene ctfA 47694 48347 CDS product butyrate--acetoacetate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890847.1 protein_id gnl|my_center|LOCUS_38430 48349 49014 gene locus_tag LOCUS_38440 gene ctfB 48349 49014 CDS product butyrate--acetoacetate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890848.1 protein_id gnl|my_center|LOCUS_38440 49027 50064 gene locus_tag LOCUS_38450 gene kdd 49027 50064 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_38450 50206 51459 gene locus_tag LOCUS_38460 gene ablA 50206 51459 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_38460 51461 52504 gene locus_tag LOCUS_38470 51461 52504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367345.1 protein_id gnl|my_center|LOCUS_38470 52506 53987 gene locus_tag LOCUS_38480 52506 53987 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015882.1 protein_id gnl|my_center|LOCUS_38480 53977 55578 gene locus_tag LOCUS_38490 53977 55578 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_38490 55578 56366 gene locus_tag LOCUS_38500 55578 56366 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_38500 56762 58033 gene locus_tag LOCUS_38510 56762 58033 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948973.1 protein_id gnl|my_center|LOCUS_38510 60521 58596 gene locus_tag LOCUS_38520 60521 58596 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_38520 60874 61512 gene locus_tag LOCUS_38530 60874 61512 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966000.1 protein_id gnl|my_center|LOCUS_38530 61712 62491 gene locus_tag LOCUS_38540 61712 62491 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_38540 62573 63712 gene locus_tag LOCUS_38550 62573 63712 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965998.1 protein_id gnl|my_center|LOCUS_38550 63726 64508 gene locus_tag LOCUS_38560 63726 64508 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965997.1 protein_id gnl|my_center|LOCUS_38560 64523 65533 gene locus_tag LOCUS_38570 64523 65533 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965996.1 protein_id gnl|my_center|LOCUS_38570 65655 66503 gene locus_tag LOCUS_38580 65655 66503 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_38580 66866 68032 gene locus_tag LOCUS_38590 66866 68032 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_38590 68550 69422 gene locus_tag LOCUS_38600 68550 69422 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048249.1 protein_id gnl|my_center|LOCUS_38600 69422 70804 gene locus_tag LOCUS_38610 gene gltA 69422 70804 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_38610 71084 71497 gene locus_tag LOCUS_38620 71084 71497 CDS product C-GCAxxG-C-C family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890718.1 protein_id gnl|my_center|LOCUS_38620 71517 72398 gene locus_tag LOCUS_38630 71517 72398 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_38630 72485 73198 gene locus_tag LOCUS_38640 72485 73198 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048245.1 protein_id gnl|my_center|LOCUS_38640 73772 73236 gene locus_tag LOCUS_38650 73772 73236 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437518.1 protein_id gnl|my_center|LOCUS_38650 74223 74510 gene locus_tag LOCUS_38660 74223 74510 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_38660 74586 76211 gene locus_tag LOCUS_38670 gene groL 74586 76211 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357641.1 protein_id gnl|my_center|LOCUS_38670 76691 78145 gene locus_tag LOCUS_38680 gene guaB 76691 78145 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_38680 78320 79852 gene locus_tag LOCUS_38690 gene guaA 78320 79852 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_38690 80810 81010 gene locus_tag LOCUS_38700 80810 81010 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867752.1 protein_id gnl|my_center|LOCUS_38700 81013 81456 gene locus_tag LOCUS_38710 81013 81456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 81510 82220 gene locus_tag LOCUS_38720 81510 82220 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021134.1 protein_id gnl|my_center|LOCUS_38720 82213 83820 gene locus_tag LOCUS_38730 82213 83820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990774.1 protein_id gnl|my_center|LOCUS_38730 85214 83934 gene locus_tag LOCUS_38740 85214 83934 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966034.1 protein_id gnl|my_center|LOCUS_38740 85625 86974 gene locus_tag LOCUS_38750 85625 86974 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048231.1 protein_id gnl|my_center|LOCUS_38750 86993 87433 gene locus_tag LOCUS_38760 86993 87433 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048230.1 protein_id gnl|my_center|LOCUS_38760 87733 87554 gene locus_tag LOCUS_38770 87733 87554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 88018 90024 gene locus_tag LOCUS_38780 88018 90024 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357582.1 protein_id gnl|my_center|LOCUS_38780 90169 90885 gene locus_tag LOCUS_38790 90169 90885 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048228.1 protein_id gnl|my_center|LOCUS_38790 91408 93597 gene locus_tag LOCUS_38800 gene rnr 91408 93597 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_38800 93774 94241 gene locus_tag LOCUS_38810 gene smpB 93774 94241 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_38810 94460 94812 gene locus_tag LOCUS_tm00010 94460 94812 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 96308 94770 gene locus_tag LOCUS_38820 96308 94770 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_38820 97207 96752 gene locus_tag LOCUS_38830 97207 96752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 97418 97627 gene locus_tag LOCUS_38840 97418 97627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 97628 97759 gene locus_tag LOCUS_38850 97628 97759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 98181 99062 gene locus_tag LOCUS_38860 98181 99062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 99350 100270 gene locus_tag LOCUS_38870 99350 100270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 100521 101195 gene locus_tag LOCUS_38880 100521 101195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 101455 101646 gene locus_tag LOCUS_38890 101455 101646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 101652 102938 gene locus_tag LOCUS_38900 101652 102938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 103004 103927 gene locus_tag LOCUS_38910 103004 103927 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948766.1 protein_id gnl|my_center|LOCUS_38910 104103 104276 gene locus_tag LOCUS_38920 104103 104276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 104727 105386 gene locus_tag LOCUS_38930 104727 105386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 106186 105692 gene locus_tag LOCUS_38940 106186 105692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 106617 107195 gene locus_tag LOCUS_38950 106617 107195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 108875 107868 gene locus_tag LOCUS_38960 108875 107868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 109418 113488 gene locus_tag LOCUS_38970 109418 113488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 113504 115894 gene locus_tag LOCUS_38980 113504 115894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 115898 120055 gene locus_tag LOCUS_38990 115898 120055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 120068 122329 gene locus_tag LOCUS_39000 120068 122329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 122342 123778 gene locus_tag LOCUS_39010 122342 123778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 123778 123981 gene locus_tag LOCUS_39020 123778 123981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 124228 124860 gene locus_tag LOCUS_39030 124228 124860 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023352.1 protein_id gnl|my_center|LOCUS_39030 126198 127103 gene locus_tag LOCUS_39040 126198 127103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 127577 128587 gene locus_tag LOCUS_39050 127577 128587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 128756 129676 gene locus_tag LOCUS_39060 128756 129676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 130307 131098 gene locus_tag LOCUS_39070 130307 131098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 131826 131545 gene locus_tag LOCUS_39080 131826 131545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 133190 132213 gene locus_tag LOCUS_39090 133190 132213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 134902 133571 gene locus_tag LOCUS_39100 134902 133571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 135550 135071 gene locus_tag LOCUS_39110 135550 135071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 135873 135571 gene locus_tag LOCUS_39120 135873 135571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 136213 135917 gene locus_tag LOCUS_39130 136213 135917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 136621 136944 gene locus_tag LOCUS_39140 136621 136944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 137037 137258 gene locus_tag LOCUS_39150 137037 137258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 137311 137442 gene locus_tag LOCUS_39160 137311 137442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 138133 137879 gene locus_tag LOCUS_39170 138133 137879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 139084 138146 gene locus_tag LOCUS_39180 gene ligD 139084 138146 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392997.1 protein_id gnl|my_center|LOCUS_39180 139902 139084 gene locus_tag LOCUS_39190 139902 139084 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813277.1 protein_id gnl|my_center|LOCUS_39190 140110 141366 gene locus_tag LOCUS_39200 140110 141366 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461660.1 protein_id gnl|my_center|LOCUS_39200 141389 141652 gene locus_tag LOCUS_39210 141389 141652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 141668 141823 gene locus_tag LOCUS_39220 141668 141823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 141926 142315 gene locus_tag LOCUS_39230 141926 142315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 142497 142862 gene locus_tag LOCUS_39240 142497 142862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 143107 143877 gene locus_tag LOCUS_39250 143107 143877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 144207 144482 gene locus_tag LOCUS_39260 144207 144482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 144674 145606 gene locus_tag LOCUS_39270 144674 145606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 145860 145660 gene locus_tag LOCUS_39280 145860 145660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 145772 146035 gene locus_tag LOCUS_39290 145772 146035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 147360 146428 gene locus_tag LOCUS_39300 147360 146428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 148585 147953 gene locus_tag LOCUS_39310 148585 147953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 149283 149924 gene locus_tag LOCUS_39320 149283 149924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 149999 150328 gene locus_tag LOCUS_39330 149999 150328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 150631 151302 gene locus_tag LOCUS_39340 150631 151302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 151370 151777 gene locus_tag LOCUS_39350 151370 151777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 152222 152368 gene locus_tag LOCUS_39360 152222 152368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 152695 153948 gene locus_tag LOCUS_39370 152695 153948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 155491 156111 gene locus_tag LOCUS_39380 155491 156111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 156171 157367 gene locus_tag LOCUS_39390 156171 157367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 157641 159080 gene locus_tag LOCUS_39400 157641 159080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 159091 159654 gene locus_tag LOCUS_39410 159091 159654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 160017 160361 gene locus_tag LOCUS_39420 160017 160361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 160665 160928 gene locus_tag LOCUS_39430 160665 160928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 161066 161707 gene locus_tag LOCUS_39440 161066 161707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39440 161717 162148 gene locus_tag LOCUS_39450 161717 162148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39450 162715 162945 gene locus_tag LOCUS_39460 162715 162945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 163059 163871 gene locus_tag LOCUS_39470 163059 163871 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242564.1 protein_id gnl|my_center|LOCUS_39470 163944 164345 gene locus_tag LOCUS_39480 163944 164345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 164507 164662 gene locus_tag LOCUS_39490 164507 164662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 165523 166410 gene locus_tag LOCUS_39500 165523 166410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 166791 166606 gene locus_tag LOCUS_39510 166791 166606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 166985 167833 gene locus_tag LOCUS_39520 166985 167833 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963850.1 protein_id gnl|my_center|LOCUS_39520 167897 168421 gene locus_tag LOCUS_39530 167897 168421 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518846.1 protein_id gnl|my_center|LOCUS_39530 168696 170444 gene locus_tag LOCUS_39540 168696 170444 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_39540 171137 172012 gene locus_tag LOCUS_39550 171137 172012 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670448.1 protein_id gnl|my_center|LOCUS_39550 172181 174466 gene locus_tag LOCUS_39560 gene hypF 172181 174466 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964128.1 protein_id gnl|my_center|LOCUS_39560 174551 174892 gene locus_tag LOCUS_39570 gene hypA 174551 174892 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_39570 174896 175564 gene locus_tag LOCUS_39580 gene hypB 174896 175564 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_39580 175619 175846 gene locus_tag LOCUS_39590 175619 175846 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964126.1 protein_id gnl|my_center|LOCUS_39590 175830 176921 gene locus_tag LOCUS_39600 gene hypD 175830 176921 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964129.1 protein_id gnl|my_center|LOCUS_39600 177002 178009 gene locus_tag LOCUS_39610 gene hypE 177002 178009 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964127.1 protein_id gnl|my_center|LOCUS_39610 178147 178977 gene locus_tag LOCUS_39620 178147 178977 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986405.1 protein_id gnl|my_center|LOCUS_39620 179046 180446 gene locus_tag LOCUS_39630 179046 180446 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359027.1 protein_id gnl|my_center|LOCUS_39630 180544 181221 gene locus_tag LOCUS_39640 gene hypB 180544 181221 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_39640 181267 181701 gene locus_tag LOCUS_39650 181267 181701 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890827.1 protein_id gnl|my_center|LOCUS_39650 181927 183447 gene locus_tag LOCUS_39660 181927 183447 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888725.1 protein_id gnl|my_center|LOCUS_39660 184562 183627 gene locus_tag LOCUS_39670 gene eamA 184562 183627 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032711577.1 protein_id gnl|my_center|LOCUS_39670 184822 185007 gene locus_tag LOCUS_39680 184822 185007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 185043 185432 gene locus_tag LOCUS_39690 185043 185432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 185800 186054 gene locus_tag LOCUS_39700 185800 186054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 186260 186871 gene locus_tag LOCUS_39710 186260 186871 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948039.1 protein_id gnl|my_center|LOCUS_39710 186837 187148 gene locus_tag LOCUS_39720 186837 187148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 187162 187572 gene locus_tag LOCUS_39730 187162 187572 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774977.1 protein_id gnl|my_center|LOCUS_39730 188782 187745 gene locus_tag LOCUS_39740 188782 187745 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987084.1 protein_id gnl|my_center|LOCUS_39740 189508 190113 gene locus_tag LOCUS_39750 189508 190113 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940801.1 protein_id gnl|my_center|LOCUS_39750 190150 191529 gene locus_tag LOCUS_39760 gene radA 190150 191529 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293096.1 protein_id gnl|my_center|LOCUS_39760 192554 191673 gene locus_tag LOCUS_39770 192554 191673 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986559.1 protein_id gnl|my_center|LOCUS_39770 192851 193945 gene locus_tag LOCUS_39780 192851 193945 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_39780 194628 194002 gene locus_tag LOCUS_39790 194628 194002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 195322 194630 gene locus_tag LOCUS_39800 195322 194630 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018010902.1 protein_id gnl|my_center|LOCUS_39800 196271 195327 gene locus_tag LOCUS_39810 196271 195327 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283968.1 protein_id gnl|my_center|LOCUS_39810 196666 198585 gene locus_tag LOCUS_39820 196666 198585 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861201.1 protein_id gnl|my_center|LOCUS_39820 198575 198925 gene locus_tag LOCUS_39830 198575 198925 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889198.1 protein_id gnl|my_center|LOCUS_39830 199122 198970 gene locus_tag LOCUS_39840 199122 198970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 199681 199451 gene locus_tag LOCUS_39850 199681 199451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 200363 200569 gene locus_tag LOCUS_39860 200363 200569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 200556 200906 gene locus_tag LOCUS_39870 200556 200906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 200973 201134 gene locus_tag LOCUS_39880 200973 201134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 201210 201668 gene locus_tag LOCUS_39890 201210 201668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 201768 202181 gene locus_tag LOCUS_39900 201768 202181 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358712.1 protein_id gnl|my_center|LOCUS_39900 202633 204540 gene locus_tag LOCUS_39910 202633 204540 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987113.1 protein_id gnl|my_center|LOCUS_39910 204596 205795 gene locus_tag LOCUS_39920 204596 205795 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_39920 206083 208359 gene locus_tag LOCUS_39930 206083 208359 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_39930 208414 208986 gene locus_tag LOCUS_39940 208414 208986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39940 209278 210234 gene locus_tag LOCUS_39950 209278 210234 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257041.1 protein_id gnl|my_center|LOCUS_39950 210254 211495 gene locus_tag LOCUS_39960 210254 211495 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257040.1 protein_id gnl|my_center|LOCUS_39960 211506 211724 gene locus_tag LOCUS_39970 211506 211724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39970 >Feature sequence57 920 681 gene locus_tag LOCUS_39980 920 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 1144 917 gene locus_tag LOCUS_39990 1144 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 1301 1783 gene locus_tag LOCUS_40000 1301 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 1780 2115 gene locus_tag LOCUS_40010 1780 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 2243 2896 gene locus_tag LOCUS_40020 2243 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 3665 2862 gene locus_tag LOCUS_40030 3665 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 4232 3711 gene locus_tag LOCUS_40040 4232 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 4644 4907 gene locus_tag LOCUS_40050 4644 4907 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966916.1 protein_id gnl|my_center|LOCUS_40050 5154 5855 gene locus_tag LOCUS_40060 5154 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 5839 6534 gene locus_tag LOCUS_40070 5839 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 >Feature sequence58 1405 215 gene locus_tag LOCUS_40080 gene brnQ 1405 215 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964918.1 protein_id gnl|my_center|LOCUS_40080 1932 2324 gene locus_tag LOCUS_40090 gene mecI 1932 2324 CDS product mecA-type methicillin resistance repressor MecI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369214.1 protein_id gnl|my_center|LOCUS_40090 2308 4212 gene locus_tag LOCUS_40100 2308 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 4977 5513 gene locus_tag LOCUS_40110 4977 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 >Feature sequence59 312 1211 gene locus_tag LOCUS_40120 gene rfbA 312 1211 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965630.1 protein_id gnl|my_center|LOCUS_40120 1296 2324 gene locus_tag LOCUS_40130 gene rfbB 1296 2324 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965629.1 protein_id gnl|my_center|LOCUS_40130 2338 3171 gene locus_tag LOCUS_40140 gene rfbD 2338 3171 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_40140 3884 3525 gene locus_tag LOCUS_40150 3884 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 4180 3872 gene locus_tag LOCUS_40160 4180 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 4594 4737 gene locus_tag LOCUS_40170 4594 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 4749 5198 gene locus_tag LOCUS_40180 4749 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 >Feature sequence60 262 1191 gene locus_tag LOCUS_40190 262 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 1438 1307 gene locus_tag LOCUS_40200 1438 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 2638 1523 gene locus_tag LOCUS_40210 2638 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 3256 3579 gene locus_tag LOCUS_40220 3256 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 >Feature sequence61 372 1067 gene locus_tag LOCUS_40230 372 1067 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404330.1 protein_id gnl|my_center|LOCUS_40230 1119 1373 gene locus_tag LOCUS_40240 1119 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 1639 3981 gene locus_tag LOCUS_40250 1639 3981 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303731.1 protein_id gnl|my_center|LOCUS_40250 >Feature sequence62 86 919 gene locus_tag LOCUS_40260 86 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 1564 1719 gene locus_tag LOCUS_40270 1564 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 1794 2579 gene locus_tag LOCUS_40280 1794 2579 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333519.1 protein_id gnl|my_center|LOCUS_40280 3664 2969 gene locus_tag LOCUS_40290 3664 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 >Feature sequence63 506 189 gene locus_tag LOCUS_40300 506 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 1339 536 gene locus_tag LOCUS_40310 1339 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 2591 1332 gene locus_tag LOCUS_40320 2591 1332 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_40320 >Feature sequence64 314 424 gene locus_tag LOCUS_r00070 314 424 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 433 507 gene locus_tag LOCUS_t00620 433 507 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 821 2899 gene locus_tag LOCUS_40330 gene fusA 821 2899 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048368.1 protein_id gnl|my_center|LOCUS_40330 >Feature sequence65 985 755 gene locus_tag LOCUS_40340 985 755 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966062.1 protein_id gnl|my_center|LOCUS_40340 1307 2362 gene locus_tag LOCUS_40350 gene hydE 1307 2362 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964939.1 protein_id gnl|my_center|LOCUS_40350 2555 3190 gene locus_tag LOCUS_40360 2555 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 >Feature sequence66 138 2108 gene locus_tag LOCUS_40370 138 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 2506 3126 gene locus_tag LOCUS_40380 2506 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 >Feature sequence67 267 3390 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attttaatctatccatattggaatgtagat 3635 4078 gene locus_tag LOCUS_40390 3635 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 4082 5452 gene locus_tag LOCUS_40400 4082 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 5456 5890 gene locus_tag LOCUS_40410 5456 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 5978 6241 gene locus_tag LOCUS_40420 5978 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 6715 6939 gene locus_tag LOCUS_40430 6715 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 7010 7246 gene locus_tag LOCUS_40440 7010 7246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 7311 7853 gene locus_tag LOCUS_40450 7311 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 8261 8488 gene locus_tag LOCUS_40460 8261 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 8485 8619 gene locus_tag LOCUS_40470 8485 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 8756 8995 gene locus_tag LOCUS_40480 8756 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 9364 9798 gene locus_tag LOCUS_40490 9364 9798 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962808.1 protein_id gnl|my_center|LOCUS_40490 9800 10102 gene locus_tag LOCUS_40500 9800 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 11216 11665 gene locus_tag LOCUS_40510 11216 11665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 11793 12209 gene locus_tag LOCUS_40520 11793 12209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 12260 12406 gene locus_tag LOCUS_40530 12260 12406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 12514 12831 gene locus_tag LOCUS_40540 12514 12831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 12971 13612 gene locus_tag LOCUS_40550 12971 13612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 13838 14845 gene locus_tag LOCUS_40560 13838 14845 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964264.1 protein_id gnl|my_center|LOCUS_40560 15378 15695 gene locus_tag LOCUS_40570 15378 15695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 16842 15886 gene locus_tag LOCUS_40580 16842 15886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40580 17306 16839 gene locus_tag LOCUS_40590 17306 16839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 17632 17844 gene locus_tag LOCUS_40600 17632 17844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 17994 18434 gene locus_tag LOCUS_40610 17994 18434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 19099 19326 gene locus_tag LOCUS_40620 19099 19326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 19339 19533 gene locus_tag LOCUS_40630 19339 19533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 19509 20540 gene locus_tag LOCUS_40640 19509 20540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 20965 22008 gene locus_tag LOCUS_40650 20965 22008 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_40650 22296 22604 gene locus_tag LOCUS_40660 22296 22604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40660 22747 23037 gene locus_tag LOCUS_40670 22747 23037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40670 23257 23577 gene locus_tag LOCUS_40680 23257 23577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 23584 23751 gene locus_tag LOCUS_40690 23584 23751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 23828 24145 gene locus_tag LOCUS_40700 23828 24145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 24218 24643 gene locus_tag LOCUS_40710 24218 24643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 24766 25908 gene locus_tag LOCUS_40720 24766 25908 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461029.1 protein_id gnl|my_center|LOCUS_40720 26681 27466 gene locus_tag LOCUS_40730 26681 27466 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015659.1 protein_id gnl|my_center|LOCUS_40730 27488 28426 gene locus_tag LOCUS_40740 27488 28426 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015658.1 protein_id gnl|my_center|LOCUS_40740 28468 29901 gene locus_tag LOCUS_40750 28468 29901 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903800.1 protein_id gnl|my_center|LOCUS_40750 29953 31095 gene locus_tag LOCUS_40760 29953 31095 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_40760 31706 31446 gene locus_tag LOCUS_40770 31706 31446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 32099 31950 gene locus_tag LOCUS_40780 32099 31950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 32254 32439 gene locus_tag LOCUS_40790 32254 32439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 32378 32602 gene locus_tag LOCUS_40800 32378 32602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 32673 32909 gene locus_tag LOCUS_40810 32673 32909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 32974 33537 gene locus_tag LOCUS_40820 32974 33537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 33999 33652 gene locus_tag LOCUS_40830 33999 33652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 34483 34743 gene locus_tag LOCUS_40840 34483 34743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 34833 35318 gene locus_tag LOCUS_40850 34833 35318 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948455.1 protein_id gnl|my_center|LOCUS_40850 35646 36455 gene locus_tag LOCUS_40860 35646 36455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 36879 37103 gene locus_tag LOCUS_40870 36879 37103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 37179 37415 gene locus_tag LOCUS_40880 37179 37415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 37709 38533 gene locus_tag LOCUS_40890 37709 38533 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021030.1 protein_id gnl|my_center|LOCUS_40890 38681 39094 gene locus_tag LOCUS_40900 38681 39094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 39141 39521 gene locus_tag LOCUS_40910 39141 39521 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048271.1 protein_id gnl|my_center|LOCUS_40910 39920 40363 gene locus_tag LOCUS_40920 39920 40363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 40535 41026 gene locus_tag LOCUS_40930 40535 41026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 41333 41488 gene locus_tag LOCUS_40940 41333 41488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 41497 41829 gene locus_tag LOCUS_40950 41497 41829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 42190 43872 gene locus_tag LOCUS_40960 42190 43872 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002424949.1 protein_id gnl|my_center|LOCUS_40960 44086 46620 gene locus_tag LOCUS_40970 44086 46620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 46635 48056 gene locus_tag LOCUS_40980 46635 48056 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_40980 48071 48862 gene locus_tag LOCUS_40990 48071 48862 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_40990 48965 49639 gene locus_tag LOCUS_41000 48965 49639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 49636 50832 gene locus_tag LOCUS_41010 49636 50832 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902657.1 protein_id gnl|my_center|LOCUS_41010 50835 51167 gene locus_tag LOCUS_41020 50835 51167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 51294 52745 gene locus_tag LOCUS_41030 51294 52745 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250163.1 protein_id gnl|my_center|LOCUS_41030 53104 54228 gene locus_tag LOCUS_41040 53104 54228 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436120.1 protein_id gnl|my_center|LOCUS_41040 55488 54568 gene locus_tag LOCUS_41050 55488 54568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 55714 55959 gene locus_tag LOCUS_41060 55714 55959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 55959 56153 gene locus_tag LOCUS_41070 55959 56153 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113289.1 protein_id gnl|my_center|LOCUS_41070 57218 56436 gene locus_tag LOCUS_41080 57218 56436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41080 57508 58041 gene locus_tag LOCUS_41090 57508 58041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 58264 58560 gene locus_tag LOCUS_41100 58264 58560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 58753 59037 gene locus_tag LOCUS_41110 58753 59037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41110 59031 59963 gene locus_tag LOCUS_41120 59031 59963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 59956 60216 gene locus_tag LOCUS_41130 59956 60216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 61025 60447 gene locus_tag LOCUS_41140 61025 60447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 62614 61112 gene locus_tag LOCUS_41150 62614 61112 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814147.1 protein_id gnl|my_center|LOCUS_41150 62829 64370 gene locus_tag LOCUS_41160 62829 64370 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814148.1 protein_id gnl|my_center|LOCUS_41160 64386 66515 gene locus_tag LOCUS_41170 64386 66515 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_41170 66786 66586 gene locus_tag LOCUS_41180 66786 66586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 67093 67692 gene locus_tag LOCUS_41190 67093 67692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 68352 67858 gene locus_tag LOCUS_41200 68352 67858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 70101 68623 gene locus_tag LOCUS_41210 70101 68623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 70649 72037 gene locus_tag LOCUS_41220 70649 72037 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_41220 72060 72770 gene locus_tag LOCUS_41230 gene phnF 72060 72770 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194085.1 protein_id gnl|my_center|LOCUS_41230 72928 73350 gene locus_tag LOCUS_41240 72928 73350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 73365 73958 gene locus_tag LOCUS_41250 gene phnH 73365 73958 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861994.1 protein_id gnl|my_center|LOCUS_41250 73963 75084 gene locus_tag LOCUS_41260 73963 75084 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104083.1 protein_id gnl|my_center|LOCUS_41260 75068 75943 gene locus_tag LOCUS_41270 75068 75943 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435861.1 protein_id gnl|my_center|LOCUS_41270 75951 76796 gene locus_tag LOCUS_41280 75951 76796 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435860.1 protein_id gnl|my_center|LOCUS_41280 76832 78010 gene locus_tag LOCUS_41290 76832 78010 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435857.1 protein_id gnl|my_center|LOCUS_41290 78013 78636 gene locus_tag LOCUS_41300 78013 78636 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970705.1 protein_id gnl|my_center|LOCUS_41300 78641 79336 gene locus_tag LOCUS_41310 78641 79336 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892101.1 protein_id gnl|my_center|LOCUS_41310 79333 80166 gene locus_tag LOCUS_41320 79333 80166 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_41320 80284 81330 gene locus_tag LOCUS_41330 80284 81330 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258842.1 protein_id gnl|my_center|LOCUS_41330 81360 82124 gene locus_tag LOCUS_41340 gene phnC 81360 82124 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258841.1 protein_id gnl|my_center|LOCUS_41340 82143 82928 gene locus_tag LOCUS_41350 gene phnE 82143 82928 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258840.1 protein_id gnl|my_center|LOCUS_41350 82928 83791 gene locus_tag LOCUS_41360 82928 83791 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258839.1 protein_id gnl|my_center|LOCUS_41360 84140 84334 gene locus_tag LOCUS_41370 84140 84334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 84327 84563 gene locus_tag LOCUS_41380 84327 84563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 86195 84846 gene locus_tag LOCUS_41390 86195 84846 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948975.1 protein_id gnl|my_center|LOCUS_41390 86391 88070 gene locus_tag LOCUS_41400 86391 88070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 88335 89138 gene locus_tag LOCUS_41410 88335 89138 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360578.1 protein_id gnl|my_center|LOCUS_41410 89228 91879 gene locus_tag LOCUS_41420 gene cphA 89228 91879 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947968.1 protein_id gnl|my_center|LOCUS_41420 92324 92983 gene locus_tag LOCUS_41430 92324 92983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 93048 94433 gene locus_tag LOCUS_41440 93048 94433 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068650.1 protein_id gnl|my_center|LOCUS_41440 94472 95398 gene locus_tag LOCUS_41450 94472 95398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 95399 96850 gene locus_tag LOCUS_41460 95399 96850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 98163 96973 gene locus_tag LOCUS_41470 98163 96973 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263500.1 protein_id gnl|my_center|LOCUS_41470 98632 98760 gene locus_tag LOCUS_41480 98632 98760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 99050 99229 gene locus_tag LOCUS_41490 99050 99229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 99278 99694 gene locus_tag LOCUS_41500 gene crcB 99278 99694 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964894.1 protein_id gnl|my_center|LOCUS_41500 99725 100078 gene locus_tag LOCUS_41510 gene crcB 99725 100078 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964895.1 protein_id gnl|my_center|LOCUS_41510 101260 100286 gene locus_tag LOCUS_41520 101260 100286 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_41520 101636 102409 gene locus_tag LOCUS_41530 gene sigG 101636 102409 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_41530 102859 103671 gene locus_tag LOCUS_41540 gene spo0A 102859 103671 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 protein_id gnl|my_center|LOCUS_41540 103802 104506 gene locus_tag LOCUS_41550 gene sigK 103802 104506 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_41550 104874 105287 gene locus_tag LOCUS_41560 104874 105287 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267583.1 protein_id gnl|my_center|LOCUS_41560 105287 105970 gene locus_tag LOCUS_41570 105287 105970 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015758443.1 protein_id gnl|my_center|LOCUS_41570 105990 106694 gene locus_tag LOCUS_41580 105990 106694 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476584.1 protein_id gnl|my_center|LOCUS_41580 106788 107414 gene locus_tag LOCUS_41590 106788 107414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 107405 108517 gene locus_tag LOCUS_41600 107405 108517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 108872 109600 gene locus_tag LOCUS_41610 gene sigK 108872 109600 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_41610 109868 110053 gene locus_tag LOCUS_41620 109868 110053 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_41620 110505 110149 gene locus_tag LOCUS_41630 110505 110149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41630 110882 110583 gene locus_tag LOCUS_41640 110882 110583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41640 111287 111733 gene locus_tag LOCUS_41650 111287 111733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 111785 112024 gene locus_tag LOCUS_41660 111785 112024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 112316 113452 gene locus_tag LOCUS_41670 112316 113452 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963632.1 protein_id gnl|my_center|LOCUS_41670 113748 115568 gene locus_tag LOCUS_41680 113748 115568 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964862.1 protein_id gnl|my_center|LOCUS_41680 115654 116367 gene locus_tag LOCUS_41690 115654 116367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 116445 116660 gene locus_tag LOCUS_41700 116445 116660 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358680.1 protein_id gnl|my_center|LOCUS_41700 116686 118929 gene locus_tag LOCUS_41710 116686 118929 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_41710 119241 120377 gene locus_tag LOCUS_41720 119241 120377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 120633 121247 gene locus_tag LOCUS_41730 120633 121247 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964891.1 protein_id gnl|my_center|LOCUS_41730 122049 121672 gene locus_tag LOCUS_41740 122049 121672 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948844.1 protein_id gnl|my_center|LOCUS_41740 123378 122446 gene locus_tag LOCUS_41750 123378 122446 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970438.1 protein_id gnl|my_center|LOCUS_41750 123963 125333 gene locus_tag LOCUS_41760 123963 125333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 125451 126320 gene locus_tag LOCUS_41770 125451 126320 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256994.1 protein_id gnl|my_center|LOCUS_41770 126388 128157 gene locus_tag LOCUS_41780 126388 128157 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_41780 128197 128598 gene locus_tag LOCUS_41790 128197 128598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 128635 129477 gene locus_tag LOCUS_41800 128635 129477 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584077.1 protein_id gnl|my_center|LOCUS_41800 129499 130530 gene locus_tag LOCUS_41810 129499 130530 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767698.1 protein_id gnl|my_center|LOCUS_41810 130989 133184 gene locus_tag LOCUS_41820 130989 133184 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261819.1 protein_id gnl|my_center|LOCUS_41820 133586 135541 gene locus_tag LOCUS_41830 133586 135541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 135752 136234 gene locus_tag LOCUS_41840 135752 136234 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876564.1 protein_id gnl|my_center|LOCUS_41840 136540 136743 gene locus_tag LOCUS_41850 136540 136743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 136949 137101 gene locus_tag LOCUS_41860 136949 137101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 138289 137432 gene locus_tag LOCUS_41870 138289 137432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 138614 139855 gene locus_tag LOCUS_41880 138614 139855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41880 139883 140332 gene locus_tag LOCUS_41890 139883 140332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41890 141419 140547 gene locus_tag LOCUS_41900 141419 140547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 142158 141463 gene locus_tag LOCUS_41910 142158 141463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 142356 142682 gene locus_tag LOCUS_41920 142356 142682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 142767 143036 gene locus_tag LOCUS_41930 142767 143036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 143900 143160 gene locus_tag LOCUS_41940 143900 143160 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890403.1 protein_id gnl|my_center|LOCUS_41940 145308 144043 gene locus_tag LOCUS_41950 145308 144043 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896806.1 protein_id gnl|my_center|LOCUS_41950 146383 145556 gene locus_tag LOCUS_41960 gene xdhB 146383 145556 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948906.1 protein_id gnl|my_center|LOCUS_41960 146850 146377 gene locus_tag LOCUS_41970 146850 146377 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_41970 149022 146905 gene locus_tag LOCUS_41980 149022 146905 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869185.1 protein_id gnl|my_center|LOCUS_41980 150198 149272 gene locus_tag LOCUS_41990 150198 149272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 151162 151542 gene locus_tag LOCUS_42000 151162 151542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 151745 152230 gene locus_tag LOCUS_42010 151745 152230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 152409 152639 gene locus_tag LOCUS_42020 152409 152639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 152905 153318 gene locus_tag LOCUS_42030 152905 153318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 153487 153729 gene locus_tag LOCUS_42040 153487 153729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 153961 154491 gene locus_tag LOCUS_42050 153961 154491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42050 154693 155316 gene locus_tag LOCUS_42060 154693 155316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 155495 155665 gene locus_tag LOCUS_42070 155495 155665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 156450 156169 gene locus_tag LOCUS_42080 156450 156169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 156670 156969 gene locus_tag LOCUS_42090 156670 156969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 157319 158191 gene locus_tag LOCUS_42100 157319 158191 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243667.1 protein_id gnl|my_center|LOCUS_42100 158513 159364 gene locus_tag LOCUS_42110 158513 159364 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947933.1 protein_id gnl|my_center|LOCUS_42110 159535 160350 gene locus_tag LOCUS_42120 159535 160350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 160624 160797 gene locus_tag LOCUS_42130 160624 160797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 161289 161645 gene locus_tag LOCUS_42140 161289 161645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 161722 161994 gene locus_tag LOCUS_42150 161722 161994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 162333 162115 gene locus_tag LOCUS_42160 162333 162115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 162809 163195 gene locus_tag LOCUS_42170 162809 163195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42170 163188 164225 gene locus_tag LOCUS_42180 163188 164225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 164732 164478 gene locus_tag LOCUS_42190 164732 164478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 166158 165052 gene locus_tag LOCUS_42200 166158 165052 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963632.1 protein_id gnl|my_center|LOCUS_42200 166733 168154 gene locus_tag LOCUS_42210 166733 168154 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_42210 168838 168263 gene locus_tag LOCUS_42220 168838 168263 CDS product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920199.1 protein_id gnl|my_center|LOCUS_42220 169155 168838 gene locus_tag LOCUS_42230 169155 168838 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045612791.1 protein_id gnl|my_center|LOCUS_42230 169481 169987 gene locus_tag LOCUS_42240 169481 169987 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964859.1 protein_id gnl|my_center|LOCUS_42240 170190 171110 gene locus_tag LOCUS_42250 170190 171110 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109315.1 protein_id gnl|my_center|LOCUS_42250 171320 171583 gene locus_tag LOCUS_42260 171320 171583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272630.1 protein_id gnl|my_center|LOCUS_42260 171899 172066 gene locus_tag LOCUS_42270 171899 172066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 172047 172622 gene locus_tag LOCUS_42280 172047 172622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42280 173032 173217 gene locus_tag LOCUS_42290 173032 173217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 174290 173415 gene locus_tag LOCUS_42300 174290 173415 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982011.1 protein_id gnl|my_center|LOCUS_42300 174674 176860 gene locus_tag LOCUS_42310 174674 176860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 177432 177037 gene locus_tag LOCUS_42320 177432 177037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 177632 178012 gene locus_tag LOCUS_42330 177632 178012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 178024 178545 gene locus_tag LOCUS_42340 178024 178545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 178652 179488 gene locus_tag LOCUS_42350 178652 179488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 179615 181423 gene locus_tag LOCUS_42360 gene pepF 179615 181423 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077571.1 protein_id gnl|my_center|LOCUS_42360 181623 182951 gene locus_tag LOCUS_42370 181623 182951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 183099 183530 gene locus_tag LOCUS_42380 183099 183530 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964877.1 protein_id gnl|my_center|LOCUS_42380 183557 184036 gene locus_tag LOCUS_42390 183557 184036 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905907.1 protein_id gnl|my_center|LOCUS_42390 184121 184651 gene locus_tag LOCUS_42400 184121 184651 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964879.1 protein_id gnl|my_center|LOCUS_42400 185179 185901 gene locus_tag LOCUS_42410 185179 185901 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460538.1 protein_id gnl|my_center|LOCUS_42410 185958 186614 gene locus_tag LOCUS_42420 gene ydjY 185958 186614 CDS product lipoprotein YdjY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939216.1 protein_id gnl|my_center|LOCUS_42420 186634 187029 gene locus_tag LOCUS_42430 186634 187029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 187124 187825 gene locus_tag LOCUS_42440 187124 187825 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272454.1 protein_id gnl|my_center|LOCUS_42440 187907 189115 gene locus_tag LOCUS_42450 187907 189115 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948768.1 protein_id gnl|my_center|LOCUS_42450 189105 189971 gene locus_tag LOCUS_42460 189105 189971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 189971 190750 gene locus_tag LOCUS_42470 189971 190750 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269123.1 protein_id gnl|my_center|LOCUS_42470 190766 191533 gene locus_tag LOCUS_42480 190766 191533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 192754 191951 gene locus_tag LOCUS_42490 192754 191951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 193412 193257 gene locus_tag LOCUS_42500 193412 193257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 193705 193538 gene locus_tag LOCUS_42510 193705 193538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 194081 193929 gene locus_tag LOCUS_42520 194081 193929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 194107 194310 gene locus_tag LOCUS_42530 194107 194310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 194415 197378 gene locus_tag LOCUS_42540 194415 197378 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373571.1 protein_id gnl|my_center|LOCUS_42540 >Feature sequence68 610 371 gene locus_tag LOCUS_42550 610 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 2628 2044 gene locus_tag LOCUS_42560 2628 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 >Feature sequence69 1250 195 gene locus_tag LOCUS_42570 1250 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 1761 1405 gene locus_tag LOCUS_42580 gene tnpB 1761 1405 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_42580 2075 1755 gene locus_tag LOCUS_42590 2075 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 2680 2339 gene locus_tag LOCUS_42600 2680 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 >Feature sequence70 934 149 gene locus_tag LOCUS_42610 934 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42610 1257 976 gene locus_tag LOCUS_42620 1257 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42620 1392 1631 gene locus_tag LOCUS_42630 1392 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 1982 2473 gene locus_tag LOCUS_42640 1982 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947922.1 protein_id gnl|my_center|LOCUS_42640 >Feature sequence71 563 763 gene locus_tag LOCUS_42650 563 763 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356423.1 protein_id gnl|my_center|LOCUS_42650 1482 1006 gene locus_tag LOCUS_42660 gene greA 1482 1006 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003488762.1 protein_id gnl|my_center|LOCUS_42660 >Feature sequence72 940 1710 gene locus_tag LOCUS_42670 940 1710 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967090.1 protein_id gnl|my_center|LOCUS_42670 >Feature sequence73 294 403 gene locus_tag LOCUS_r00080 294 403 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 413 487 gene locus_tag LOCUS_t00630 413 487 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 521 631 gene locus_tag LOCUS_r00090 521 631 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 644 720 gene locus_tag LOCUS_t00640 644 720 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 726 801 gene locus_tag LOCUS_t00650 726 801 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1063 1530 gene locus_tag LOCUS_42680 1063 1530 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_42680 >Feature sequence74 >Feature sequence75 347 456 gene locus_tag LOCUS_r00100 347 456 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 467 542 gene locus_tag LOCUS_t00660 467 542 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 744 1487 gene locus_tag LOCUS_42690 744 1487 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359517.1 protein_id gnl|my_center|LOCUS_42690 >Feature sequence76 684 1439 gene locus_tag LOCUS_42700 684 1439 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_42700 1604 1495 gene locus_tag LOCUS_r00110 1604 1495 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence77 408 1712 gene locus_tag LOCUS_42710 408 1712 CDS product IS110-like element ISDha10 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461193.1 protein_id gnl|my_center|LOCUS_42710 >Feature sequence78 401 222 gene locus_tag LOCUS_42720 401 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 585 445 gene locus_tag LOCUS_42730 585 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 5163 748 gene locus_tag LOCUS_42740 5163 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101579182.1 protein_id gnl|my_center|LOCUS_42740 5873 5163 gene locus_tag LOCUS_42750 5873 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 7410 5875 gene locus_tag LOCUS_42760 7410 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 8557 7424 gene locus_tag LOCUS_42770 8557 7424 CDS product DUF2220 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233576.1 protein_id gnl|my_center|LOCUS_42770 8780 10201 gene locus_tag LOCUS_42780 gene pyk 8780 10201 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_42780 10942 10298 gene locus_tag LOCUS_42790 10942 10298 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434300.1 protein_id gnl|my_center|LOCUS_42790 11214 10969 gene locus_tag LOCUS_42800 11214 10969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 11646 11443 gene locus_tag LOCUS_42810 11646 11443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 12212 12511 gene locus_tag LOCUS_42820 12212 12511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42820 12508 12978 gene locus_tag LOCUS_42830 12508 12978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42830 14343 13030 gene locus_tag LOCUS_42840 14343 13030 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_42840 15536 14448 gene locus_tag LOCUS_42850 15536 14448 CDS product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948932.1 protein_id gnl|my_center|LOCUS_42850 15928 15548 gene locus_tag LOCUS_42860 15928 15548 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_42860 16395 15949 gene locus_tag LOCUS_42870 16395 15949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 16550 16419 gene locus_tag LOCUS_42880 16550 16419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 17467 16913 gene locus_tag LOCUS_42890 17467 16913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 18300 17470 gene locus_tag LOCUS_42900 18300 17470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 22369 18431 gene locus_tag LOCUS_42910 22369 18431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 24446 22791 gene locus_tag LOCUS_42920 24446 22791 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084107.1 protein_id gnl|my_center|LOCUS_42920 25527 24769 gene locus_tag LOCUS_42930 25527 24769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 25844 25662 gene locus_tag LOCUS_42940 25844 25662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 26940 26092 gene locus_tag LOCUS_42950 26940 26092 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027363870.1 protein_id gnl|my_center|LOCUS_42950 27955 27176 gene locus_tag LOCUS_42960 gene kduD 27955 27176 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482916.1 protein_id gnl|my_center|LOCUS_42960 28093 29667 gene locus_tag LOCUS_42970 28093 29667 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890805.1 protein_id gnl|my_center|LOCUS_42970 29870 31807 gene locus_tag LOCUS_42980 29870 31807 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964362.1 protein_id gnl|my_center|LOCUS_42980 31861 32655 gene locus_tag LOCUS_42990 31861 32655 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583729.1 protein_id gnl|my_center|LOCUS_42990 33000 32731 gene locus_tag LOCUS_43000 33000 32731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 33383 34840 gene locus_tag LOCUS_43010 33383 34840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 34912 36105 gene locus_tag LOCUS_43020 34912 36105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 36241 36107 gene locus_tag LOCUS_43030 36241 36107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 36758 36441 gene locus_tag LOCUS_43040 36758 36441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43040 39072 36904 gene locus_tag LOCUS_43050 39072 36904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 39453 39295 gene locus_tag LOCUS_43060 39453 39295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 40082 40213 gene locus_tag LOCUS_43070 40082 40213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 40776 40315 gene locus_tag LOCUS_43080 40776 40315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 41083 40937 gene locus_tag LOCUS_43090 41083 40937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 42370 41582 gene locus_tag LOCUS_43100 42370 41582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43100 42693 42412 gene locus_tag LOCUS_43110 42693 42412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43110 42822 42950 gene locus_tag LOCUS_43120 42822 42950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 44158 43259 gene locus_tag LOCUS_43130 44158 43259 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948331.1 protein_id gnl|my_center|LOCUS_43130 45150 44542 gene locus_tag LOCUS_43140 45150 44542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 46926 45256 gene locus_tag LOCUS_43150 46926 45256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 47833 47366 gene locus_tag LOCUS_43160 47833 47366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43160 48810 47872 gene locus_tag LOCUS_43170 48810 47872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43170 49379 49116 gene locus_tag LOCUS_43180 49379 49116 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_43180 49621 49367 gene locus_tag LOCUS_43190 49621 49367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 50248 49856 gene locus_tag LOCUS_43200 50248 49856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43200 51567 50572 gene locus_tag LOCUS_43210 51567 50572 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948306.1 protein_id gnl|my_center|LOCUS_43210 53721 51901 gene locus_tag LOCUS_43220 gene ltrA 53721 51901 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097733.1 protein_id gnl|my_center|LOCUS_43220 55497 55027 gene locus_tag LOCUS_43230 55497 55027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 55694 55500 gene locus_tag LOCUS_43240 55694 55500 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948471.1 protein_id gnl|my_center|LOCUS_43240 56404 56742 gene locus_tag LOCUS_43250 56404 56742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 56902 57804 gene locus_tag LOCUS_43260 56902 57804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 58648 58361 gene locus_tag LOCUS_43270 58648 58361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 58990 59592 gene locus_tag LOCUS_43280 58990 59592 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023352.1 protein_id gnl|my_center|LOCUS_43280 60288 60551 gene locus_tag LOCUS_43290 60288 60551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 60860 60723 gene locus_tag LOCUS_43300 60860 60723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 61597 60881 gene locus_tag LOCUS_43310 61597 60881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 61955 64810 gene locus_tag LOCUS_43320 61955 64810 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480405.1 protein_id gnl|my_center|LOCUS_43320 64895 65029 gene locus_tag LOCUS_43330 64895 65029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 65060 65608 gene locus_tag LOCUS_43340 65060 65608 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884084.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43340 66098 65925 gene locus_tag LOCUS_43350 66098 65925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 67774 66167 gene locus_tag LOCUS_43360 67774 66167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 68531 67758 gene locus_tag LOCUS_43370 gene soj 68531 67758 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_43370 70802 68565 gene locus_tag LOCUS_43380 70802 68565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 71186 70815 gene locus_tag LOCUS_43390 71186 70815 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939351.1 protein_id gnl|my_center|LOCUS_43390 72027 71203 gene locus_tag LOCUS_43400 72027 71203 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440146.1 protein_id gnl|my_center|LOCUS_43400 73883 72024 gene locus_tag LOCUS_43410 73883 72024 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545728.1 protein_id gnl|my_center|LOCUS_43410 75336 73876 gene locus_tag LOCUS_43420 75336 73876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 75765 75355 gene locus_tag LOCUS_43430 75765 75355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 76880 75801 gene locus_tag LOCUS_43440 76880 75801 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868672.1 protein_id gnl|my_center|LOCUS_43440 78467 76992 gene locus_tag LOCUS_43450 78467 76992 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390075.1 protein_id gnl|my_center|LOCUS_43450 80432 78486 gene locus_tag LOCUS_43460 80432 78486 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390074.1 protein_id gnl|my_center|LOCUS_43460 80732 80484 gene locus_tag LOCUS_43470 80732 80484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 81145 80786 gene locus_tag LOCUS_43480 81145 80786 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870063.1 protein_id gnl|my_center|LOCUS_43480 81819 81427 gene locus_tag LOCUS_43490 81819 81427 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948264.1 protein_id gnl|my_center|LOCUS_43490 82430 82702 gene locus_tag LOCUS_43500 82430 82702 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816285.1 protein_id gnl|my_center|LOCUS_43500 82963 83574 gene locus_tag LOCUS_43510 82963 83574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43510 83692 84672 gene locus_tag LOCUS_43520 83692 84672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 84728 84931 gene locus_tag LOCUS_43530 84728 84931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 84928 85380 gene locus_tag LOCUS_43540 84928 85380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 87457 85769 gene locus_tag LOCUS_43550 87457 85769 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_43550 87687 87842 gene locus_tag LOCUS_43560 87687 87842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 88149 87961 gene locus_tag LOCUS_43570 88149 87961 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966884.1 protein_id gnl|my_center|LOCUS_43570 88342 88178 gene locus_tag LOCUS_43580 88342 88178 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_43580 89411 88365 gene locus_tag LOCUS_43590 89411 88365 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948785.1 protein_id gnl|my_center|LOCUS_43590 90890 89676 gene locus_tag LOCUS_43600 90890 89676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43600 91229 91041 gene locus_tag LOCUS_43610 91229 91041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 92695 91424 gene locus_tag LOCUS_43620 92695 91424 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948851.1 protein_id gnl|my_center|LOCUS_43620 94534 92969 gene locus_tag LOCUS_43630 94534 92969 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949063.1 protein_id gnl|my_center|LOCUS_43630 98198 94770 gene locus_tag LOCUS_43640 98198 94770 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048255.1 protein_id gnl|my_center|LOCUS_43640 98975 98409 gene locus_tag LOCUS_43650 98975 98409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963930.1 protein_id gnl|my_center|LOCUS_43650 99758 99054 gene locus_tag LOCUS_43660 99758 99054 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963931.1 protein_id gnl|my_center|LOCUS_43660 100104 99751 gene locus_tag LOCUS_43670 100104 99751 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963932.1 protein_id gnl|my_center|LOCUS_43670 102053 100620 gene locus_tag LOCUS_43680 102053 100620 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_43680 103288 102113 gene locus_tag LOCUS_43690 gene iadA 103288 102113 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048339.1 protein_id gnl|my_center|LOCUS_43690 105131 103440 gene locus_tag LOCUS_43700 105131 103440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 106030 105179 gene locus_tag LOCUS_43710 gene xdhB 106030 105179 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948906.1 protein_id gnl|my_center|LOCUS_43710 108658 106298 gene locus_tag LOCUS_43720 108658 106298 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987122.1 protein_id gnl|my_center|LOCUS_43720 109193 108651 gene locus_tag LOCUS_43730 109193 108651 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_43730 110055 109195 gene locus_tag LOCUS_43740 110055 109195 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869168.1 protein_id gnl|my_center|LOCUS_43740 111475 110207 gene locus_tag LOCUS_43750 111475 110207 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897793.1 protein_id gnl|my_center|LOCUS_43750 111962 111660 gene locus_tag LOCUS_43760 111962 111660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 113396 111987 gene locus_tag LOCUS_43770 113396 111987 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_43770 113617 113411 gene locus_tag LOCUS_43780 113617 113411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 114093 114398 gene locus_tag LOCUS_43790 114093 114398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 114415 115041 gene locus_tag LOCUS_43800 114415 115041 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948543.1 protein_id gnl|my_center|LOCUS_43800 116552 115242 gene locus_tag LOCUS_43810 gene hydA 116552 115242 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979132.1 protein_id gnl|my_center|LOCUS_43810 117841 116582 gene locus_tag LOCUS_43820 gene dpaL 117841 116582 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047950.1 protein_id gnl|my_center|LOCUS_43820 119162 118140 gene locus_tag LOCUS_43830 119162 118140 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 protein_id gnl|my_center|LOCUS_43830 120001 119192 gene locus_tag LOCUS_43840 120001 119192 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386049.1 protein_id gnl|my_center|LOCUS_43840 120815 120006 gene locus_tag LOCUS_43850 gene yqeB 120815 120006 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047954.1 protein_id gnl|my_center|LOCUS_43850 121404 120808 gene locus_tag LOCUS_43860 gene mocA 121404 120808 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047953.1 protein_id gnl|my_center|LOCUS_43860 122484 121750 gene locus_tag LOCUS_43870 gene yqeC 122484 121750 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047952.1 protein_id gnl|my_center|LOCUS_43870 125176 122618 gene locus_tag LOCUS_43880 gene xdh 125176 122618 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 protein_id gnl|my_center|LOCUS_43880 128220 125218 gene locus_tag LOCUS_43890 gene ygfK 128220 125218 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387142.1 protein_id gnl|my_center|LOCUS_43890 129571 128240 gene locus_tag LOCUS_43900 gene ssnA 129571 128240 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861868.1 protein_id gnl|my_center|LOCUS_43900 129890 131101 gene locus_tag LOCUS_43910 gene dpaL 129890 131101 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819571.1 protein_id gnl|my_center|LOCUS_43910 131151 132461 gene locus_tag LOCUS_43920 131151 132461 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362247.1 protein_id gnl|my_center|LOCUS_43920 132698 133891 gene locus_tag LOCUS_43930 gene ygeW 132698 133891 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_43930 133988 134917 gene locus_tag LOCUS_43940 gene arcC 133988 134917 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680441.1 protein_id gnl|my_center|LOCUS_43940 134968 136320 gene locus_tag LOCUS_43950 134968 136320 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356594.1 protein_id gnl|my_center|LOCUS_43950 137783 136422 gene locus_tag LOCUS_43960 137783 136422 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897252.1 protein_id gnl|my_center|LOCUS_43960 138790 138074 gene locus_tag LOCUS_43970 138790 138074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 138963 138790 gene locus_tag LOCUS_43980 138963 138790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 140412 139054 gene locus_tag LOCUS_43990 140412 139054 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868917.1 protein_id gnl|my_center|LOCUS_43990 142504 140780 gene locus_tag LOCUS_44000 gene ade 142504 140780 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_44000 142801 143442 gene locus_tag LOCUS_44010 142801 143442 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_44010 143472 144863 gene locus_tag LOCUS_44020 143472 144863 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_44020 145898 144921 gene locus_tag LOCUS_44030 145898 144921 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_44030 146759 146112 gene locus_tag LOCUS_44040 146759 146112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 147606 146896 gene locus_tag LOCUS_44050 147606 146896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679004.1 protein_id gnl|my_center|LOCUS_44050 148075 148566 gene locus_tag LOCUS_44060 148075 148566 CDS product YfcE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357334.1 protein_id gnl|my_center|LOCUS_44060 148678 149535 gene locus_tag LOCUS_44070 148678 149535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 149954 149742 gene locus_tag LOCUS_44080 149954 149742 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966916.1 protein_id gnl|my_center|LOCUS_44080 151944 150199 gene locus_tag LOCUS_44090 151944 150199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 152550 152017 gene locus_tag LOCUS_44100 152550 152017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 153832 152564 gene locus_tag LOCUS_44110 153832 152564 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459114.1 protein_id gnl|my_center|LOCUS_44110 154757 154110 gene locus_tag LOCUS_44120 154757 154110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272208.1 protein_id gnl|my_center|LOCUS_44120 155344 155826 gene locus_tag LOCUS_44130 gene nuoE 155344 155826 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986413.1 protein_id gnl|my_center|LOCUS_44130 155867 157762 gene locus_tag LOCUS_44140 155867 157762 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986412.1 protein_id gnl|my_center|LOCUS_44140 157812 159548 gene locus_tag LOCUS_44150 157812 159548 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986411.1 protein_id gnl|my_center|LOCUS_44150 160768 159587 gene locus_tag LOCUS_44160 160768 159587 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_44160 162479 160761 gene locus_tag LOCUS_44170 162479 160761 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_44170 162726 162472 gene locus_tag LOCUS_44180 162726 162472 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_44180 164217 163027 gene locus_tag LOCUS_44190 gene hydF 164217 163027 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925073.1 protein_id gnl|my_center|LOCUS_44190 164915 164670 gene locus_tag LOCUS_44200 164915 164670 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_44200 165262 166029 gene locus_tag LOCUS_44210 165262 166029 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987079.1 protein_id gnl|my_center|LOCUS_44210 166620 166102 gene locus_tag LOCUS_44220 gene pssA 166620 166102 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356316.1 protein_id gnl|my_center|LOCUS_44220 167955 166777 gene locus_tag LOCUS_44230 167955 166777 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_44230 168156 167974 gene locus_tag LOCUS_44240 168156 167974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 170081 168345 gene locus_tag LOCUS_44250 170081 168345 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048183.1 protein_id gnl|my_center|LOCUS_44250 171525 170317 gene locus_tag LOCUS_44260 gene gltS 171525 170317 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_44260 173060 171849 gene locus_tag LOCUS_44270 gene gltS 173060 171849 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_44270 174121 173246 gene locus_tag LOCUS_44280 174121 173246 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948342.1 protein_id gnl|my_center|LOCUS_44280 175362 174124 gene locus_tag LOCUS_44290 175362 174124 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948343.1 protein_id gnl|my_center|LOCUS_44290 177404 175716 gene locus_tag LOCUS_44300 177404 175716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 178623 177478 gene locus_tag LOCUS_44310 178623 177478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 179271 178882 gene locus_tag LOCUS_44320 gene dhaM 179271 178882 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017697966.1 protein_id gnl|my_center|LOCUS_44320 179925 179275 gene locus_tag LOCUS_44330 gene dhaL 179925 179275 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166473.1 protein_id gnl|my_center|LOCUS_44330 180984 179986 gene locus_tag LOCUS_44340 gene dhaK 180984 179986 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166915.1 protein_id gnl|my_center|LOCUS_44340 182765 181248 gene locus_tag LOCUS_44350 182765 181248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 184621 183419 gene locus_tag LOCUS_44360 184621 183419 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439456.1 protein_id gnl|my_center|LOCUS_44360 185687 184869 gene locus_tag LOCUS_44370 185687 184869 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257038.1 protein_id gnl|my_center|LOCUS_44370 >Feature sequence79 48 1481 gene locus_tag LOCUS_44380 48 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 >Feature sequence80 147 1529 gene locus_tag LOCUS_44390 147 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 >Feature sequence81 1434 532 gene locus_tag LOCUS_44400 1434 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 >Feature sequence82 5 1231 gene locus_tag LOCUS_44410 5 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 >Feature sequence83 >Feature sequence84 902 826 gene locus_tag LOCUS_t00670 902 826 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1023 914 gene locus_tag LOCUS_r00120 1023 914 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence85 659 583 gene locus_tag LOCUS_t00680 659 583 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 740 665 gene locus_tag LOCUS_t00690 740 665 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence86 135 1 gene locus_tag LOCUS_44420 135 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 >Feature sequence87 >Feature sequence88 141 67 gene locus_tag LOCUS_t00700 141 67 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 226 151 gene locus_tag LOCUS_t00710 226 151 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 307 231 gene locus_tag LOCUS_t00720 307 231 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 411 338 gene locus_tag LOCUS_t00730 411 338 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 506 431 gene locus_tag LOCUS_t00740 506 431 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 594 519 gene locus_tag LOCUS_t00750 594 519 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 675 599 gene locus_tag LOCUS_t00760 675 599 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 818 744 gene locus_tag LOCUS_t00770 818 744 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence89 1436 279 gene locus_tag LOCUS_44430 1436 279 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947923.1 protein_id gnl|my_center|LOCUS_44430 1719 1931 gene locus_tag LOCUS_44440 1719 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 1910 3358 gene locus_tag LOCUS_44450 1910 3358 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947924.1 protein_id gnl|my_center|LOCUS_44450 3410 4030 gene locus_tag LOCUS_44460 gene tmk 3410 4030 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_44460 4044 4373 gene locus_tag LOCUS_44470 4044 4373 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963622.1 protein_id gnl|my_center|LOCUS_44470 4431 5375 gene locus_tag LOCUS_44480 4431 5375 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404855.1 protein_id gnl|my_center|LOCUS_44480 5377 6294 gene locus_tag LOCUS_44490 5377 6294 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_44490 6305 6508 gene locus_tag LOCUS_44500 6305 6508 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947926.1 protein_id gnl|my_center|LOCUS_44500 6683 6940 gene locus_tag LOCUS_44510 6683 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 7139 7807 gene locus_tag LOCUS_44520 7139 7807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 8522 7866 gene locus_tag LOCUS_44530 8522 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 8724 9467 gene locus_tag LOCUS_44540 8724 9467 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947927.1 protein_id gnl|my_center|LOCUS_44540 9665 10507 gene locus_tag LOCUS_44550 gene rsmI 9665 10507 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947928.1 protein_id gnl|my_center|LOCUS_44550 10820 11920 gene locus_tag LOCUS_44560 10820 11920 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963632.1 protein_id gnl|my_center|LOCUS_44560 12326 12081 gene locus_tag LOCUS_44570 12326 12081 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966909.1 protein_id gnl|my_center|LOCUS_44570 13000 13644 gene locus_tag LOCUS_44580 gene fsa 13000 13644 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356970.1 protein_id gnl|my_center|LOCUS_44580 14655 14011 gene locus_tag LOCUS_44590 14655 14011 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963636.1 protein_id gnl|my_center|LOCUS_44590 14957 15547 gene locus_tag LOCUS_44600 14957 15547 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356642.1 protein_id gnl|my_center|LOCUS_44600 16262 17206 gene locus_tag LOCUS_44610 gene arcC 16262 17206 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986908.1 protein_id gnl|my_center|LOCUS_44610 17235 18443 gene locus_tag LOCUS_44620 gene arcA 17235 18443 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947930.1 protein_id gnl|my_center|LOCUS_44620 18486 19484 gene locus_tag LOCUS_44630 gene argF 18486 19484 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986907.1 protein_id gnl|my_center|LOCUS_44630 19715 19921 gene locus_tag LOCUS_44640 19715 19921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 20202 22115 gene locus_tag LOCUS_44650 20202 22115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 22650 22183 gene locus_tag LOCUS_44660 gene ispF 22650 22183 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_44660 24107 23322 gene locus_tag LOCUS_44670 gene rluF 24107 23322 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419811.1 protein_id gnl|my_center|LOCUS_44670 24423 25583 gene locus_tag LOCUS_44680 24423 25583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 26208 25636 gene locus_tag LOCUS_44690 26208 25636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 26337 27692 gene locus_tag LOCUS_44700 26337 27692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 27926 29485 gene locus_tag LOCUS_44710 27926 29485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 31251 29797 gene locus_tag LOCUS_44720 gene cls 31251 29797 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571549.1 protein_id gnl|my_center|LOCUS_44720 31470 33008 gene locus_tag LOCUS_44730 31470 33008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 33104 33841 gene locus_tag LOCUS_44740 gene truA 33104 33841 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430279.1 protein_id gnl|my_center|LOCUS_44740 34179 33994 gene locus_tag LOCUS_44750 34179 33994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 35061 34204 gene locus_tag LOCUS_44760 35061 34204 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_44760 35272 35847 gene locus_tag LOCUS_44770 35272 35847 CDS product spore maturation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356382.1 protein_id gnl|my_center|LOCUS_44770 35899 36435 gene locus_tag LOCUS_44780 35899 36435 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963792.1 protein_id gnl|my_center|LOCUS_44780 36663 37388 gene locus_tag LOCUS_44790 36663 37388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570194.1 protein_id gnl|my_center|LOCUS_44790 37381 39045 gene locus_tag LOCUS_44800 37381 39045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963592.1 protein_id gnl|my_center|LOCUS_44800 39514 41454 gene locus_tag LOCUS_44810 gene metG 39514 41454 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_44810 41699 43216 gene locus_tag LOCUS_44820 41699 43216 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947940.1 protein_id gnl|my_center|LOCUS_44820 43305 44081 gene locus_tag LOCUS_44830 43305 44081 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_44830 44364 45404 gene locus_tag LOCUS_44840 44364 45404 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947942.1 protein_id gnl|my_center|LOCUS_44840 45574 46161 gene locus_tag LOCUS_44850 gene rnmV 45574 46161 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356126.1 protein_id gnl|my_center|LOCUS_44850 46142 46978 gene locus_tag LOCUS_44860 gene rsmA 46142 46978 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966268.1 protein_id gnl|my_center|LOCUS_44860 47056 48207 gene locus_tag LOCUS_44870 47056 48207 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947944.1 protein_id gnl|my_center|LOCUS_44870 48319 48903 gene locus_tag LOCUS_44880 48319 48903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966266.1 protein_id gnl|my_center|LOCUS_44880 49124 49957 gene locus_tag LOCUS_44890 49124 49957 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356174.1 protein_id gnl|my_center|LOCUS_44890 50251 50072 gene locus_tag LOCUS_44900 50251 50072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 50661 50461 gene locus_tag LOCUS_44910 50661 50461 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419624.1 protein_id gnl|my_center|LOCUS_44910 51219 51596 gene locus_tag LOCUS_44920 51219 51596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 52131 53834 gene locus_tag LOCUS_44930 gene ltrA 52131 53834 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235893157.1 protein_id gnl|my_center|LOCUS_44930 53984 54415 gene locus_tag LOCUS_44940 53984 54415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 55140 57044 gene locus_tag LOCUS_44950 gene ltrA 55140 57044 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002335621.1 protein_id gnl|my_center|LOCUS_44950 57183 58442 gene locus_tag LOCUS_44960 57183 58442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 58519 59019 gene locus_tag LOCUS_44970 gene nrdG 58519 59019 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393280.1 protein_id gnl|my_center|LOCUS_44970 59852 59217 gene locus_tag LOCUS_44980 59852 59217 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963804.1 protein_id gnl|my_center|LOCUS_44980 60193 61974 gene locus_tag LOCUS_44990 60193 61974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 63947 62052 gene locus_tag LOCUS_45000 63947 62052 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048401.1 protein_id gnl|my_center|LOCUS_45000 64909 68010 gene locus_tag LOCUS_45010 gene ileS 64909 68010 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_45010 68239 69237 gene locus_tag LOCUS_45020 68239 69237 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356351.1 protein_id gnl|my_center|LOCUS_45020 69411 73490 gene locus_tag LOCUS_45030 69411 73490 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966317.1 protein_id gnl|my_center|LOCUS_45030 73681 74073 gene locus_tag LOCUS_45040 73681 74073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 76296 74197 gene locus_tag LOCUS_45050 76296 74197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 76711 77778 gene locus_tag LOCUS_45060 76711 77778 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947956.1 protein_id gnl|my_center|LOCUS_45060 78816 77842 gene locus_tag LOCUS_45070 78816 77842 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015945.1 protein_id gnl|my_center|LOCUS_45070 79232 80074 gene locus_tag LOCUS_45080 79232 80074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 80437 81837 gene locus_tag LOCUS_45090 80437 81837 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_45090 81873 83807 gene locus_tag LOCUS_45100 81873 83807 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_45100 83812 84816 gene locus_tag LOCUS_45110 83812 84816 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127350626.1 protein_id gnl|my_center|LOCUS_45110 85025 85705 gene locus_tag LOCUS_45120 85025 85705 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700716.1 protein_id gnl|my_center|LOCUS_45120 86043 85723 gene locus_tag LOCUS_45130 86043 85723 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422812.1 protein_id gnl|my_center|LOCUS_45130 86936 87079 gene locus_tag LOCUS_45140 86936 87079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 87907 87125 gene locus_tag LOCUS_45150 87907 87125 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986754.1 protein_id gnl|my_center|LOCUS_45150 88088 88651 gene locus_tag LOCUS_45160 88088 88651 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870396.1 protein_id gnl|my_center|LOCUS_45160 88773 90941 gene locus_tag LOCUS_45170 88773 90941 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462224.1 protein_id gnl|my_center|LOCUS_45170 91073 91861 gene locus_tag LOCUS_45180 91073 91861 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285969.1 protein_id gnl|my_center|LOCUS_45180 92217 92999 gene locus_tag LOCUS_45190 92217 92999 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362954.1 protein_id gnl|my_center|LOCUS_45190 93237 93863 gene locus_tag LOCUS_45200 gene safA 93237 93863 CDS product SafA/ExsA family spore coat assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986322.1 protein_id gnl|my_center|LOCUS_45200 94065 94526 gene locus_tag LOCUS_45210 94065 94526 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965770.1 protein_id gnl|my_center|LOCUS_45210 94607 95449 gene locus_tag LOCUS_45220 94607 95449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 96004 95732 gene locus_tag LOCUS_45230 96004 95732 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965971.1 protein_id gnl|my_center|LOCUS_45230 96238 96029 gene locus_tag LOCUS_45240 96238 96029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965970.1 protein_id gnl|my_center|LOCUS_45240 96515 97546 gene locus_tag LOCUS_45250 96515 97546 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966297.1 protein_id gnl|my_center|LOCUS_45250 97551 98540 gene locus_tag LOCUS_45260 97551 98540 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966298.1 protein_id gnl|my_center|LOCUS_45260 98609 99793 gene locus_tag LOCUS_45270 98609 99793 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724023.1 protein_id gnl|my_center|LOCUS_45270 99867 99942 gene locus_tag LOCUS_t00780 99867 99942 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 100111 101340 gene locus_tag LOCUS_45280 gene larC 100111 101340 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964092.1 protein_id gnl|my_center|LOCUS_45280 101393 102139 gene locus_tag LOCUS_45290 gene larB 101393 102139 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_45290 103516 102386 gene locus_tag LOCUS_45300 103516 102386 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966194.1 protein_id gnl|my_center|LOCUS_45300 103701 104711 gene locus_tag LOCUS_45310 103701 104711 CDS product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966193.1 protein_id gnl|my_center|LOCUS_45310 104716 104940 gene locus_tag LOCUS_45320 104716 104940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 105012 105776 gene locus_tag LOCUS_45330 105012 105776 CDS product spore coat protein CotS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947963.1 protein_id gnl|my_center|LOCUS_45330 105863 106918 gene locus_tag LOCUS_45340 105863 106918 CDS product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947964.1 protein_id gnl|my_center|LOCUS_45340 108169 107042 gene locus_tag LOCUS_45350 108169 107042 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355946.1 protein_id gnl|my_center|LOCUS_45350 108313 109317 gene locus_tag LOCUS_45360 108313 109317 CDS product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947965.1 protein_id gnl|my_center|LOCUS_45360 109479 110402 gene locus_tag LOCUS_45370 gene yabG 109479 110402 CDS product sporulation peptidase YabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947966.1 protein_id gnl|my_center|LOCUS_45370 110702 110947 gene locus_tag LOCUS_45380 110702 110947 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966187.1 protein_id gnl|my_center|LOCUS_45380 111238 112800 gene locus_tag LOCUS_45390 111238 112800 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947967.1 protein_id gnl|my_center|LOCUS_45390 113124 113966 gene locus_tag LOCUS_45400 gene ispE 113124 113966 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947969.1 protein_id gnl|my_center|LOCUS_45400 114145 114336 gene locus_tag LOCUS_45410 114145 114336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 114434 115894 gene locus_tag LOCUS_45420 114434 115894 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947970.1 protein_id gnl|my_center|LOCUS_45420 115925 117052 gene locus_tag LOCUS_45430 115925 117052 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947971.1 protein_id gnl|my_center|LOCUS_45430 117042 118217 gene locus_tag LOCUS_45440 117042 118217 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947972.1 protein_id gnl|my_center|LOCUS_45440 118279 118908 gene locus_tag LOCUS_45450 gene spoIIR 118279 118908 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947973.1 protein_id gnl|my_center|LOCUS_45450 118955 120325 gene locus_tag LOCUS_45460 gene ypeB 118955 120325 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947975.1 protein_id gnl|my_center|LOCUS_45460 120606 121637 gene locus_tag LOCUS_45470 120606 121637 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_45470 121725 122708 gene locus_tag LOCUS_45480 121725 122708 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947976.1 protein_id gnl|my_center|LOCUS_45480 122723 123145 gene locus_tag LOCUS_45490 122723 123145 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356154.1 protein_id gnl|my_center|LOCUS_45490 123584 125188 gene locus_tag LOCUS_45500 123584 125188 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_45500 125425 125769 gene locus_tag LOCUS_45510 125425 125769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405025.1 protein_id gnl|my_center|LOCUS_45510 126307 127776 gene locus_tag LOCUS_45520 gene rho 126307 127776 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947979.1 protein_id gnl|my_center|LOCUS_45520 128057 127830 gene locus_tag LOCUS_45530 gene rpmE 128057 127830 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355803.1 protein_id gnl|my_center|LOCUS_45530 128231 128815 gene locus_tag LOCUS_45540 128231 128815 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966171.1 protein_id gnl|my_center|LOCUS_45540 128822 129727 gene locus_tag LOCUS_45550 128822 129727 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_45550 129733 130617 gene locus_tag LOCUS_45560 gene prmC 129733 130617 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966169.1 protein_id gnl|my_center|LOCUS_45560 130808 131890 gene locus_tag LOCUS_45570 gene prfA 130808 131890 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966168.1 protein_id gnl|my_center|LOCUS_45570 131925 132518 gene locus_tag LOCUS_45580 131925 132518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966167.1 protein_id gnl|my_center|LOCUS_45580 132632 133360 gene locus_tag LOCUS_45590 132632 133360 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388218.1 protein_id gnl|my_center|LOCUS_45590 133387 134433 gene locus_tag LOCUS_45600 133387 134433 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947984.1 protein_id gnl|my_center|LOCUS_45600 134531 134737 gene locus_tag LOCUS_45610 134531 134737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 134808 135257 gene locus_tag LOCUS_45620 gene rpiB 134808 135257 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_45620 135284 135913 gene locus_tag LOCUS_45630 gene upp 135284 135913 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966163.1 protein_id gnl|my_center|LOCUS_45630 136546 136001 gene locus_tag LOCUS_45640 136546 136001 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_45640 137498 136803 gene locus_tag LOCUS_45650 137498 136803 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357915.1 protein_id gnl|my_center|LOCUS_45650 137692 138420 gene locus_tag LOCUS_45660 137692 138420 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047978.1 protein_id gnl|my_center|LOCUS_45660 138668 139156 gene locus_tag LOCUS_45670 138668 139156 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355957.1 protein_id gnl|my_center|LOCUS_45670 139256 140284 gene locus_tag LOCUS_45680 139256 140284 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_45680 140339 141469 gene locus_tag LOCUS_45690 gene wecB 140339 141469 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947987.1 protein_id gnl|my_center|LOCUS_45690 142165 142539 gene locus_tag LOCUS_45700 142165 142539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 142544 143224 gene locus_tag LOCUS_45710 142544 143224 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 protein_id gnl|my_center|LOCUS_45710 143252 143500 gene locus_tag LOCUS_45720 143252 143500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 143579 144061 gene locus_tag LOCUS_45730 143579 144061 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966153.1 protein_id gnl|my_center|LOCUS_45730 144063 144596 gene locus_tag LOCUS_45740 144063 144596 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947988.1 protein_id gnl|my_center|LOCUS_45740 144613 146130 gene locus_tag LOCUS_45750 gene atpA 144613 146130 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356056.1 protein_id gnl|my_center|LOCUS_45750 146225 147076 gene locus_tag LOCUS_45760 gene atpG 146225 147076 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387835.1 protein_id gnl|my_center|LOCUS_45760 147170 148567 gene locus_tag LOCUS_45770 gene atpD 147170 148567 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161587876.1 protein_id gnl|my_center|LOCUS_45770 148590 149009 gene locus_tag LOCUS_45780 148590 149009 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966148.1 protein_id gnl|my_center|LOCUS_45780 149285 150004 gene locus_tag LOCUS_45790 149285 150004 CDS product YwmB family TATA-box binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966147.1 protein_id gnl|my_center|LOCUS_45790 150032 151297 gene locus_tag LOCUS_45800 gene murA 150032 151297 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947989.1 protein_id gnl|my_center|LOCUS_45800 151493 152551 gene locus_tag LOCUS_45810 gene spoIID 151493 152551 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947990.1 protein_id gnl|my_center|LOCUS_45810 152784 153563 gene locus_tag LOCUS_45820 152784 153563 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360546.1 protein_id gnl|my_center|LOCUS_45820 153684 153938 gene locus_tag LOCUS_45830 gene spoIIID 153684 153938 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966143.1 protein_id gnl|my_center|LOCUS_45830 154067 155101 gene locus_tag LOCUS_45840 154067 155101 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_45840 155803 155249 gene locus_tag LOCUS_45850 gene yyaC 155803 155249 CDS product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966141.1 protein_id gnl|my_center|LOCUS_45850 155957 156625 gene locus_tag LOCUS_45860 155957 156625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 156835 156909 gene locus_tag LOCUS_t00790 156835 156909 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 156915 156999 gene locus_tag LOCUS_t00800 156915 156999 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 157032 157107 gene locus_tag LOCUS_t00810 157032 157107 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 157139 157213 gene locus_tag LOCUS_t00820 157139 157213 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 157219 157303 gene locus_tag LOCUS_t00830 157219 157303 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 157599 158774 gene locus_tag LOCUS_45870 gene metK 157599 158774 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_45870 159062 161296 gene locus_tag LOCUS_45880 159062 161296 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_45880 161341 162369 gene locus_tag LOCUS_45890 161341 162369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947994.1 protein_id gnl|my_center|LOCUS_45890 162459 163022 gene locus_tag LOCUS_45900 162459 163022 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357235.1 protein_id gnl|my_center|LOCUS_45900 163567 164100 gene locus_tag LOCUS_45910 gene raiA 163567 164100 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_45910 164341 166842 gene locus_tag LOCUS_45920 gene secA 164341 166842 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947996.1 protein_id gnl|my_center|LOCUS_45920 167117 168100 gene locus_tag LOCUS_45930 gene prfB 167117 168100 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 protein_id gnl|my_center|LOCUS_45930 169211 168204 gene locus_tag LOCUS_45940 169211 168204 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 protein_id gnl|my_center|LOCUS_45940 169343 169552 gene locus_tag LOCUS_45950 169343 169552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 170161 169586 gene locus_tag LOCUS_45960 170161 169586 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_45960 170463 172160 gene locus_tag LOCUS_45970 170463 172160 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948199.1 protein_id gnl|my_center|LOCUS_45970 173162 172242 gene locus_tag LOCUS_45980 173162 172242 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 protein_id gnl|my_center|LOCUS_45980 174692 173256 gene locus_tag LOCUS_45990 gene proS 174692 173256 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 protein_id gnl|my_center|LOCUS_45990 175259 177055 gene locus_tag LOCUS_46000 175259 177055 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388461.1 protein_id gnl|my_center|LOCUS_46000 177334 178638 gene locus_tag LOCUS_46010 gene prdC 177334 178638 CDS product proline reductase-associated electron transfer protein PrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047877.1 protein_id gnl|my_center|LOCUS_46010 >Feature sequence90 505 396 gene locus_tag LOCUS_r00130 505 396 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence91 119 193 gene locus_tag LOCUS_t00840 119 193 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 262 338 gene locus_tag LOCUS_t00850 262 338 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 343 418 gene locus_tag LOCUS_t00860 343 418 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 431 506 gene locus_tag LOCUS_t00870 431 506 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 526 599 gene locus_tag LOCUS_t00880 526 599 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence92 171 280 gene locus_tag LOCUS_r00140 171 280 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8