>Feature sequence1 317 1138 gene locus_tag LOCUS_00010 317 1138 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015060.1 protein_id gnl|my_center|LOCUS_00010 1257 1874 gene locus_tag LOCUS_00020 1257 1874 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015059.1 protein_id gnl|my_center|LOCUS_00020 2060 3544 gene locus_tag LOCUS_00030 2060 3544 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015058.1 protein_id gnl|my_center|LOCUS_00030 3498 4472 gene locus_tag LOCUS_00040 gene holA 3498 4472 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015057.1 protein_id gnl|my_center|LOCUS_00040 4483 4884 gene locus_tag LOCUS_00050 4483 4884 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567697.1 protein_id gnl|my_center|LOCUS_00050 4874 5512 gene locus_tag LOCUS_00060 4874 5512 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015055.1 protein_id gnl|my_center|LOCUS_00060 5824 5561 gene locus_tag LOCUS_00070 gene rpsT 5824 5561 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859343.1 protein_id gnl|my_center|LOCUS_00070 6542 5985 gene locus_tag LOCUS_00080 6542 5985 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859345.1 protein_id gnl|my_center|LOCUS_00080 6803 6549 gene locus_tag LOCUS_00090 6803 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6806 8653 gene locus_tag LOCUS_00100 gene lepA 6806 8653 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015054.1 protein_id gnl|my_center|LOCUS_00100 8851 9180 gene locus_tag LOCUS_00110 8851 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9182 9790 gene locus_tag LOCUS_00120 9182 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00120 11221 10301 gene locus_tag LOCUS_00130 11221 10301 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217633758.1 protein_id gnl|my_center|LOCUS_00130 14007 11218 gene locus_tag LOCUS_00140 14007 11218 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_00140 14801 14142 gene locus_tag LOCUS_00150 14801 14142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15644 14838 gene locus_tag LOCUS_00160 15644 14838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229131.1 protein_id gnl|my_center|LOCUS_00160 16588 15650 gene locus_tag LOCUS_00170 16588 15650 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014308.1 protein_id gnl|my_center|LOCUS_00170 17988 16585 gene locus_tag LOCUS_00180 17988 16585 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014309.1 protein_id gnl|my_center|LOCUS_00180 18298 18089 gene locus_tag LOCUS_00190 18298 18089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18322 19878 gene locus_tag LOCUS_00200 18322 19878 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 protein_id gnl|my_center|LOCUS_00200 20121 19864 gene locus_tag LOCUS_00210 20121 19864 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013354.1 protein_id gnl|my_center|LOCUS_00210 21746 20133 gene locus_tag LOCUS_00220 21746 20133 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208497.1 protein_id gnl|my_center|LOCUS_00220 21914 21756 gene locus_tag LOCUS_00230 21914 21756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776783.1 protein_id gnl|my_center|LOCUS_00230 23699 22311 gene locus_tag LOCUS_00240 23699 22311 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804206.1 protein_id gnl|my_center|LOCUS_00240 24343 23696 gene locus_tag LOCUS_00250 24343 23696 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728103.1 protein_id gnl|my_center|LOCUS_00250 24362 25576 gene locus_tag LOCUS_00260 24362 25576 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480161.1 protein_id gnl|my_center|LOCUS_00260 25590 25718 gene locus_tag LOCUS_00270 25590 25718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27157 25715 gene locus_tag LOCUS_00280 27157 25715 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015040.1 protein_id gnl|my_center|LOCUS_00280 27975 27154 gene locus_tag LOCUS_00290 27975 27154 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015039.1 protein_id gnl|my_center|LOCUS_00290 28926 27979 gene locus_tag LOCUS_00300 28926 27979 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015038.1 protein_id gnl|my_center|LOCUS_00300 30459 28933 gene locus_tag LOCUS_00310 30459 28933 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015037.1 protein_id gnl|my_center|LOCUS_00310 30615 31307 gene locus_tag LOCUS_00320 30615 31307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00320 31208 32440 gene locus_tag LOCUS_00330 31208 32440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00330 33371 32418 gene locus_tag LOCUS_00340 33371 32418 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015031.1 protein_id gnl|my_center|LOCUS_00340 34685 33381 gene locus_tag LOCUS_00350 gene brnQ 34685 33381 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015030.1 protein_id gnl|my_center|LOCUS_00350 35896 34766 gene locus_tag LOCUS_00360 35896 34766 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015029.1 protein_id gnl|my_center|LOCUS_00360 37699 35915 gene locus_tag LOCUS_00370 37699 35915 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015020.1 protein_id gnl|my_center|LOCUS_00370 37875 38390 gene locus_tag LOCUS_00380 37875 38390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015028.1 protein_id gnl|my_center|LOCUS_00380 38570 39727 gene locus_tag LOCUS_00390 38570 39727 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564999.1 protein_id gnl|my_center|LOCUS_00390 40121 40567 gene locus_tag LOCUS_00400 40121 40567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 40568 42055 gene locus_tag LOCUS_00410 40568 42055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015026.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00410 42188 42739 gene locus_tag LOCUS_00420 gene idi 42188 42739 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948619.1 protein_id gnl|my_center|LOCUS_00420 43925 42726 gene locus_tag LOCUS_00430 43925 42726 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015022.1 protein_id gnl|my_center|LOCUS_00430 43954 45933 gene locus_tag LOCUS_00440 43954 45933 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015021.1 protein_id gnl|my_center|LOCUS_00440 45933 46133 gene locus_tag LOCUS_00450 45933 46133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 48448 46280 gene locus_tag LOCUS_00460 gene malQ 48448 46280 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015019.1 protein_id gnl|my_center|LOCUS_00460 48545 50374 gene locus_tag LOCUS_00470 48545 50374 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859440.1 protein_id gnl|my_center|LOCUS_00470 50450 53701 gene locus_tag LOCUS_00480 50450 53701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 53840 54511 gene locus_tag LOCUS_00490 53840 54511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859444.1 protein_id gnl|my_center|LOCUS_00490 54501 55634 gene locus_tag LOCUS_00500 gene hemW 54501 55634 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015017.1 protein_id gnl|my_center|LOCUS_00500 55674 56711 gene locus_tag LOCUS_00510 gene hrcA 55674 56711 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859450.1 protein_id gnl|my_center|LOCUS_00510 56785 57912 gene locus_tag LOCUS_00520 gene dnaJ 56785 57912 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015015.1 protein_id gnl|my_center|LOCUS_00520 57914 58672 gene locus_tag LOCUS_00530 57914 58672 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015014.1 protein_id gnl|my_center|LOCUS_00530 58720 59688 gene locus_tag LOCUS_00540 58720 59688 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015013.1 protein_id gnl|my_center|LOCUS_00540 59689 60279 gene locus_tag LOCUS_00550 gene ybeY 59689 60279 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015012.1 protein_id gnl|my_center|LOCUS_00550 60276 61604 gene locus_tag LOCUS_00560 60276 61604 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859459.1 protein_id gnl|my_center|LOCUS_00560 61615 62466 gene locus_tag LOCUS_00570 gene pdxY 61615 62466 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_00570 62518 63435 gene locus_tag LOCUS_00580 gene era 62518 63435 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015011.1 protein_id gnl|my_center|LOCUS_00580 63435 64163 gene locus_tag LOCUS_00590 gene recO 63435 64163 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859464.1 protein_id gnl|my_center|LOCUS_00590 64183 64920 gene locus_tag LOCUS_00600 64183 64920 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015010.1 protein_id gnl|my_center|LOCUS_00600 64917 65990 gene locus_tag LOCUS_00610 64917 65990 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015009.1 protein_id gnl|my_center|LOCUS_00610 66425 65997 gene locus_tag LOCUS_00620 66425 65997 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015007.1 protein_id gnl|my_center|LOCUS_00620 66979 66602 gene locus_tag LOCUS_00630 66979 66602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 68446 67097 gene locus_tag LOCUS_00640 68446 67097 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 protein_id gnl|my_center|LOCUS_00640 68743 70128 gene locus_tag LOCUS_00650 68743 70128 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857047.1 protein_id gnl|my_center|LOCUS_00650 70154 70681 gene locus_tag LOCUS_00660 70154 70681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 70666 71085 gene locus_tag LOCUS_00670 70666 71085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 73085 71082 gene locus_tag LOCUS_00680 73085 71082 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015004.1 protein_id gnl|my_center|LOCUS_00680 73232 73846 gene locus_tag LOCUS_00690 73232 73846 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857039.1 protein_id gnl|my_center|LOCUS_00690 73853 75124 gene locus_tag LOCUS_00700 73853 75124 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015002.1 protein_id gnl|my_center|LOCUS_00700 75353 75114 gene locus_tag LOCUS_00710 75353 75114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 75774 75343 gene locus_tag LOCUS_00720 75774 75343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 75847 77733 gene locus_tag LOCUS_00730 gene glmS 75847 77733 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015000.1 protein_id gnl|my_center|LOCUS_00730 77744 79642 gene locus_tag LOCUS_00740 gene dnaG 77744 79642 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857029.1 protein_id gnl|my_center|LOCUS_00740 80248 79691 gene locus_tag LOCUS_00750 gene thiX 80248 79691 CDS product thiamine biosynthesis protein ThiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015045.1 protein_id gnl|my_center|LOCUS_00750 80582 80340 gene locus_tag LOCUS_00760 80582 80340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014998.1 protein_id gnl|my_center|LOCUS_00760 80787 80713 gene locus_tag LOCUS_t00010 80787 80713 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 80966 81039 gene locus_tag LOCUS_t00020 80966 81039 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 81051 81878 gene locus_tag LOCUS_00770 81051 81878 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013417.1 protein_id gnl|my_center|LOCUS_00770 81875 82696 gene locus_tag LOCUS_00780 81875 82696 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857011.1 protein_id gnl|my_center|LOCUS_00780 82866 83162 gene locus_tag LOCUS_00790 82866 83162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 83968 83159 gene locus_tag LOCUS_00800 83968 83159 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859582.1 protein_id gnl|my_center|LOCUS_00800 84292 84005 gene locus_tag LOCUS_00810 84292 84005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 84422 85324 gene locus_tag LOCUS_00820 84422 85324 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856999.1 protein_id gnl|my_center|LOCUS_00820 86498 85269 gene locus_tag LOCUS_00830 gene aftC 86498 85269 CDS product arabinofuranan 3-O-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014737.1 protein_id gnl|my_center|LOCUS_00830 86681 88927 gene locus_tag LOCUS_00840 86681 88927 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104325.1 protein_id gnl|my_center|LOCUS_00840 89519 88956 gene locus_tag LOCUS_00850 89519 88956 CDS product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225779.1 protein_id gnl|my_center|LOCUS_00850 92449 89714 gene locus_tag LOCUS_00860 gene aceE 92449 89714 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014985.1 protein_id gnl|my_center|LOCUS_00860 92670 93107 gene locus_tag LOCUS_00870 92670 93107 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859595.1 protein_id gnl|my_center|LOCUS_00870 93198 93271 gene locus_tag LOCUS_t00030 93198 93271 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 93337 94239 gene locus_tag LOCUS_00880 93337 94239 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729726.1 protein_id gnl|my_center|LOCUS_00880 95102 94233 gene locus_tag LOCUS_00890 95102 94233 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856984.1 protein_id gnl|my_center|LOCUS_00890 95595 95095 gene locus_tag LOCUS_00900 95595 95095 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856982.1 protein_id gnl|my_center|LOCUS_00900 96223 95579 gene locus_tag LOCUS_00910 96223 95579 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856980.1 protein_id gnl|my_center|LOCUS_00910 96254 97288 gene locus_tag LOCUS_00920 gene cobC 96254 97288 CDS product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005129968.1 protein_id gnl|my_center|LOCUS_00920 97291 98427 gene locus_tag LOCUS_00930 97291 98427 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014977.1 protein_id gnl|my_center|LOCUS_00930 98507 99223 gene locus_tag LOCUS_00940 98507 99223 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014976.1 protein_id gnl|my_center|LOCUS_00940 99223 100356 gene locus_tag LOCUS_00950 99223 100356 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859605.1 protein_id gnl|my_center|LOCUS_00950 101308 101679 gene locus_tag LOCUS_00960 101308 101679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 101686 102240 gene locus_tag LOCUS_00970 101686 102240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00970 104703 103471 gene locus_tag LOCUS_00980 104703 103471 CDS product galactokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856970.1 protein_id gnl|my_center|LOCUS_00980 104871 105062 gene locus_tag LOCUS_00990 104871 105062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 106646 105072 gene locus_tag LOCUS_01000 106646 105072 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856966.1 protein_id gnl|my_center|LOCUS_01000 106789 108129 gene locus_tag LOCUS_01010 106789 108129 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856962.1 protein_id gnl|my_center|LOCUS_01010 108180 111344 gene locus_tag LOCUS_01020 108180 111344 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014971.1 protein_id gnl|my_center|LOCUS_01020 111484 112131 gene locus_tag LOCUS_01030 111484 112131 CDS product heme oxygenase (biliverdin-producing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014970.1 protein_id gnl|my_center|LOCUS_01030 112218 112469 gene locus_tag LOCUS_01040 112218 112469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 113260 112466 gene locus_tag LOCUS_01050 113260 112466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 113430 114878 gene locus_tag LOCUS_01060 gene thrC 113430 114878 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014964.1 protein_id gnl|my_center|LOCUS_01060 114981 115127 gene locus_tag LOCUS_01070 114981 115127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 115158 115694 gene locus_tag LOCUS_01080 115158 115694 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859635.1 protein_id gnl|my_center|LOCUS_01080 116950 115691 gene locus_tag LOCUS_01090 116950 115691 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727019.1 protein_id gnl|my_center|LOCUS_01090 117655 116972 gene locus_tag LOCUS_01100 117655 116972 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975126.1 protein_id gnl|my_center|LOCUS_01100 117787 119139 gene locus_tag LOCUS_01110 117787 119139 CDS product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225704.1 protein_id gnl|my_center|LOCUS_01110 119252 119461 gene locus_tag LOCUS_01120 119252 119461 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855652.1 protein_id gnl|my_center|LOCUS_01120 119905 120777 gene locus_tag LOCUS_01130 119905 120777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 122268 120832 gene locus_tag LOCUS_01140 gene glnA 122268 120832 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014960.1 protein_id gnl|my_center|LOCUS_01140 122432 122938 gene locus_tag LOCUS_01150 122432 122938 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856936.1 protein_id gnl|my_center|LOCUS_01150 123757 122984 gene locus_tag LOCUS_01160 123757 122984 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859641.1 protein_id gnl|my_center|LOCUS_01160 124842 123820 gene locus_tag LOCUS_01170 gene lipA 124842 123820 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856634.1 protein_id gnl|my_center|LOCUS_01170 125713 124961 gene locus_tag LOCUS_01180 gene lipB 125713 124961 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856633.1 protein_id gnl|my_center|LOCUS_01180 127782 125830 gene locus_tag LOCUS_01190 gene sucB 127782 125830 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014958.1 protein_id gnl|my_center|LOCUS_01190 127908 128303 gene locus_tag LOCUS_01200 127908 128303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856631.1 protein_id gnl|my_center|LOCUS_01200 129869 128367 gene locus_tag LOCUS_01210 129869 128367 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856630.1 protein_id gnl|my_center|LOCUS_01210 129979 131085 gene locus_tag LOCUS_01220 129979 131085 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014956.1 protein_id gnl|my_center|LOCUS_01220 131986 131162 gene locus_tag LOCUS_01230 131986 131162 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014955.1 protein_id gnl|my_center|LOCUS_01230 133064 131994 gene locus_tag LOCUS_01240 gene cobT 133064 131994 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014954.1 protein_id gnl|my_center|LOCUS_01240 133662 133114 gene locus_tag LOCUS_01250 133662 133114 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856625.1 protein_id gnl|my_center|LOCUS_01250 134337 133663 gene locus_tag LOCUS_01260 134337 133663 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856624.1 protein_id gnl|my_center|LOCUS_01260 134556 134900 gene locus_tag LOCUS_01270 134556 134900 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856623.1 protein_id gnl|my_center|LOCUS_01270 136913 134991 gene locus_tag LOCUS_01280 gene asnB 136913 134991 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014952.1 protein_id gnl|my_center|LOCUS_01280 137340 138428 gene locus_tag LOCUS_01290 137340 138428 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014951.1 protein_id gnl|my_center|LOCUS_01290 138452 138883 gene locus_tag LOCUS_01300 138452 138883 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014950.1 protein_id gnl|my_center|LOCUS_01300 139448 140038 gene locus_tag LOCUS_01310 139448 140038 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014948.1 protein_id gnl|my_center|LOCUS_01310 140124 141017 gene locus_tag LOCUS_01320 140124 141017 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172768931.1 protein_id gnl|my_center|LOCUS_01320 141014 142234 gene locus_tag LOCUS_01330 141014 142234 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014946.1 protein_id gnl|my_center|LOCUS_01330 142231 143853 gene locus_tag LOCUS_01340 gene qcrB 142231 143853 CDS product cytochrome bc1 complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856609.1 protein_id gnl|my_center|LOCUS_01340 144635 145246 gene locus_tag LOCUS_01350 144635 145246 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014945.1 protein_id gnl|my_center|LOCUS_01350 145416 146429 gene locus_tag LOCUS_01360 145416 146429 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014944.1 protein_id gnl|my_center|LOCUS_01360 146492 147583 gene locus_tag LOCUS_01370 gene pimB 146492 147583 CDS product GDP-mannose-dependent monoacylated alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014943.1 protein_id gnl|my_center|LOCUS_01370 147714 148667 gene locus_tag LOCUS_01380 147714 148667 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014942.1 protein_id gnl|my_center|LOCUS_01380 148719 149444 gene locus_tag LOCUS_01390 148719 149444 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014941.1 protein_id gnl|my_center|LOCUS_01390 149511 150020 gene locus_tag LOCUS_01400 149511 150020 CDS product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856583.1 protein_id gnl|my_center|LOCUS_01400 150133 151521 gene locus_tag LOCUS_01410 150133 151521 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856581.1 protein_id gnl|my_center|LOCUS_01410 153781 151589 gene locus_tag LOCUS_01420 gene pknB 153781 151589 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014933.1 protein_id gnl|my_center|LOCUS_01420 153884 154252 gene locus_tag LOCUS_01430 153884 154252 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856558.1 protein_id gnl|my_center|LOCUS_01430 155740 154253 gene locus_tag LOCUS_01440 155740 154253 CDS product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856557.1 protein_id gnl|my_center|LOCUS_01440 156886 155762 gene locus_tag LOCUS_01450 gene idsA 156886 155762 CDS product geranylgeranyl pyrophosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856555.1 protein_id gnl|my_center|LOCUS_01450 157092 158075 gene locus_tag LOCUS_01460 gene metF 157092 158075 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014930.1 protein_id gnl|my_center|LOCUS_01460 158415 158224 gene locus_tag LOCUS_01470 158415 158224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 158843 159268 gene locus_tag LOCUS_01480 158843 159268 CDS product SAV_6107 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014929.1 protein_id gnl|my_center|LOCUS_01480 159389 159781 gene locus_tag LOCUS_01490 159389 159781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 161207 159999 gene locus_tag LOCUS_01500 161207 159999 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014066.1 protein_id gnl|my_center|LOCUS_01500 162017 162448 gene locus_tag LOCUS_01510 gene mraZ 162017 162448 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856549.1 protein_id gnl|my_center|LOCUS_01510 162631 163650 gene locus_tag LOCUS_01520 gene rsmH 162631 163650 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860361.1 protein_id gnl|my_center|LOCUS_01520 163707 164480 gene locus_tag LOCUS_01530 163707 164480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 164706 166535 gene locus_tag LOCUS_01540 164706 166535 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014926.1 protein_id gnl|my_center|LOCUS_01540 166643 168184 gene locus_tag LOCUS_01550 166643 168184 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856539.1 protein_id gnl|my_center|LOCUS_01550 168238 169728 gene locus_tag LOCUS_01560 168238 169728 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014925.1 protein_id gnl|my_center|LOCUS_01560 169736 170854 gene locus_tag LOCUS_01570 gene mraY 169736 170854 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014924.1 protein_id gnl|my_center|LOCUS_01570 170859 172301 gene locus_tag LOCUS_01580 gene murD 170859 172301 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014923.1 protein_id gnl|my_center|LOCUS_01580 172328 173836 gene locus_tag LOCUS_01590 172328 173836 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014922.1 protein_id gnl|my_center|LOCUS_01590 173838 174917 gene locus_tag LOCUS_01600 gene murG 173838 174917 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856529.1 protein_id gnl|my_center|LOCUS_01600 174935 176368 gene locus_tag LOCUS_01610 gene murC 174935 176368 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066569796.1 protein_id gnl|my_center|LOCUS_01610 176365 177021 gene locus_tag LOCUS_01620 gene ftsQ 176365 177021 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860375.1 protein_id gnl|my_center|LOCUS_01620 177413 178648 gene locus_tag LOCUS_01630 gene ftsZ 177413 178648 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014920.1 protein_id gnl|my_center|LOCUS_01630 178660 179388 gene locus_tag LOCUS_01640 gene pgeF 178660 179388 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014919.1 protein_id gnl|my_center|LOCUS_01640 179498 179947 gene locus_tag LOCUS_01650 179498 179947 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856516.1 protein_id gnl|my_center|LOCUS_01650 180144 180431 gene locus_tag LOCUS_01660 180144 180431 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014917.1 protein_id gnl|my_center|LOCUS_01660 180748 181773 gene locus_tag LOCUS_01670 180748 181773 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860384.1 protein_id gnl|my_center|LOCUS_01670 182171 185329 gene locus_tag LOCUS_01680 gene ileS 182171 185329 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014916.1 protein_id gnl|my_center|LOCUS_01680 185623 186810 gene locus_tag LOCUS_01690 185623 186810 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014912.1 protein_id gnl|my_center|LOCUS_01690 187752 186811 gene locus_tag LOCUS_01700 187752 186811 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860401.1 protein_id gnl|my_center|LOCUS_01700 187929 188549 gene locus_tag LOCUS_01710 187929 188549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860404.1 protein_id gnl|my_center|LOCUS_01710 189603 188638 gene locus_tag LOCUS_01720 189603 188638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014909.1 protein_id gnl|my_center|LOCUS_01720 189733 190188 gene locus_tag LOCUS_01730 gene lspA 189733 190188 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856491.1 protein_id gnl|my_center|LOCUS_01730 190185 191111 gene locus_tag LOCUS_01740 190185 191111 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856488.1 protein_id gnl|my_center|LOCUS_01740 191119 191664 gene locus_tag LOCUS_01750 191119 191664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014908.1 protein_id gnl|my_center|LOCUS_01750 192516 191638 gene locus_tag LOCUS_01760 gene rarD 192516 191638 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014902.1 protein_id gnl|my_center|LOCUS_01760 192711 196220 gene locus_tag LOCUS_01770 gene dnaE 192711 196220 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856475.1 protein_id gnl|my_center|LOCUS_01770 196263 197561 gene locus_tag LOCUS_01780 gene ilvA 196263 197561 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862033.1 protein_id gnl|my_center|LOCUS_01780 197585 198226 gene locus_tag LOCUS_01790 197585 198226 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014898.1 protein_id gnl|my_center|LOCUS_01790 198252 198482 gene locus_tag LOCUS_01800 198252 198482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862025.1 protein_id gnl|my_center|LOCUS_01800 198488 198865 gene locus_tag LOCUS_01810 198488 198865 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014897.1 protein_id gnl|my_center|LOCUS_01810 200147 199128 gene locus_tag LOCUS_01820 200147 199128 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856459.1 protein_id gnl|my_center|LOCUS_01820 200847 200230 gene locus_tag LOCUS_01830 200847 200230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 202328 200982 gene locus_tag LOCUS_01840 202328 200982 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856453.1 protein_id gnl|my_center|LOCUS_01840 204671 202464 gene locus_tag LOCUS_01850 gene glgX 204671 202464 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014885.1 protein_id gnl|my_center|LOCUS_01850 205346 204693 gene locus_tag LOCUS_01860 205346 204693 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014884.1 protein_id gnl|my_center|LOCUS_01860 205463 206125 gene locus_tag LOCUS_01870 205463 206125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014883.1 protein_id gnl|my_center|LOCUS_01870 206300 206860 gene locus_tag LOCUS_01880 206300 206860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 207919 206864 gene locus_tag LOCUS_01890 207919 206864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 208262 209593 gene locus_tag LOCUS_01900 gene hisD 208262 209593 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014881.1 protein_id gnl|my_center|LOCUS_01900 209632 210732 gene locus_tag LOCUS_01910 209632 210732 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014880.1 protein_id gnl|my_center|LOCUS_01910 210814 211422 gene locus_tag LOCUS_01920 gene hisB 210814 211422 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861983.1 protein_id gnl|my_center|LOCUS_01920 211425 211640 gene locus_tag LOCUS_01930 211425 211640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 211809 213221 gene locus_tag LOCUS_01940 211809 213221 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856421.1 protein_id gnl|my_center|LOCUS_01940 213288 213920 gene locus_tag LOCUS_01950 gene hisH 213288 213920 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014877.1 protein_id gnl|my_center|LOCUS_01950 214018 214746 gene locus_tag LOCUS_01960 gene priA 214018 214746 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856418.1 protein_id gnl|my_center|LOCUS_01960 214743 215528 gene locus_tag LOCUS_01970 214743 215528 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861968.1 protein_id gnl|my_center|LOCUS_01970 215619 216395 gene locus_tag LOCUS_01980 gene hisF 215619 216395 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856413.1 protein_id gnl|my_center|LOCUS_01980 216417 216767 gene locus_tag LOCUS_01990 gene hisI 216417 216767 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014876.1 protein_id gnl|my_center|LOCUS_01990 216841 217443 gene locus_tag LOCUS_02000 216841 217443 CDS product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014875.1 protein_id gnl|my_center|LOCUS_02000 217562 218368 gene locus_tag LOCUS_02010 gene trpC 217562 218368 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407990.1 protein_id gnl|my_center|LOCUS_02010 218439 219290 gene locus_tag LOCUS_02020 gene lgt 218439 219290 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014874.1 protein_id gnl|my_center|LOCUS_02020 219500 220921 gene locus_tag LOCUS_02030 gene pyk 219500 220921 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014873.1 protein_id gnl|my_center|LOCUS_02030 223416 220987 gene locus_tag LOCUS_02040 gene malP 223416 220987 CDS product maltodextrin phosphorylase MalP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858869.1 protein_id gnl|my_center|LOCUS_02040 224867 223539 gene locus_tag LOCUS_02050 224867 223539 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014868.1 protein_id gnl|my_center|LOCUS_02050 226203 224887 gene locus_tag LOCUS_02060 226203 224887 CDS product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014867.1 protein_id gnl|my_center|LOCUS_02060 226247 226675 gene locus_tag LOCUS_02070 226247 226675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856390.1 protein_id gnl|my_center|LOCUS_02070 227811 226645 gene locus_tag LOCUS_02080 227811 226645 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014866.1 protein_id gnl|my_center|LOCUS_02080 228227 229573 gene locus_tag LOCUS_02090 gene gdhA 228227 229573 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856385.1 protein_id gnl|my_center|LOCUS_02090 229890 231335 gene locus_tag LOCUS_02100 229890 231335 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013842.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02100 232386 231568 gene locus_tag LOCUS_02110 232386 231568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 232922 233290 gene locus_tag LOCUS_02120 gene rplN 232922 233290 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854312.1 protein_id gnl|my_center|LOCUS_02120 233293 233607 gene locus_tag LOCUS_02130 gene rplX 233293 233607 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854314.1 protein_id gnl|my_center|LOCUS_02130 233610 234161 gene locus_tag LOCUS_02140 gene rplE 233610 234161 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854317.1 protein_id gnl|my_center|LOCUS_02140 235677 234364 gene locus_tag LOCUS_02150 235677 234364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 236152 235931 gene locus_tag LOCUS_02160 236152 235931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 236136 236609 gene locus_tag LOCUS_02170 236136 236609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02170 236830 237552 gene locus_tag LOCUS_02180 236830 237552 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861943.1 protein_id gnl|my_center|LOCUS_02180 237593 238123 gene locus_tag LOCUS_02190 237593 238123 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861940.1 protein_id gnl|my_center|LOCUS_02190 238120 238869 gene locus_tag LOCUS_02200 gene rnc 238120 238869 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861938.1 protein_id gnl|my_center|LOCUS_02200 238887 239777 gene locus_tag LOCUS_02210 gene mutM 238887 239777 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014863.1 protein_id gnl|my_center|LOCUS_02210 239877 241343 gene locus_tag LOCUS_02220 239877 241343 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863416.1 protein_id gnl|my_center|LOCUS_02220 241343 241630 gene locus_tag LOCUS_02230 241343 241630 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856367.1 protein_id gnl|my_center|LOCUS_02230 241655 245140 gene locus_tag LOCUS_02240 gene smc 241655 245140 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014857.1 protein_id gnl|my_center|LOCUS_02240 245245 248805 gene locus_tag LOCUS_02250 245245 248805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014856.1 protein_id gnl|my_center|LOCUS_02250 248881 250431 gene locus_tag LOCUS_02260 gene ftsY 248881 250431 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029703265.1 protein_id gnl|my_center|LOCUS_02260 250534 251250 gene locus_tag LOCUS_02270 250534 251250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 251407 251745 gene locus_tag LOCUS_02280 gene glnK 251407 251745 CDS product P-II family nitrogen regulator GlnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014853.1 protein_id gnl|my_center|LOCUS_02280 251760 253910 gene locus_tag LOCUS_02290 251760 253910 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014852.1 protein_id gnl|my_center|LOCUS_02290 254019 255635 gene locus_tag LOCUS_02300 gene ffh 254019 255635 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014851.1 protein_id gnl|my_center|LOCUS_02300 255868 256341 gene locus_tag LOCUS_02310 255868 256341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 256470 256970 gene locus_tag LOCUS_02320 gene rimM 256470 256970 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014847.1 protein_id gnl|my_center|LOCUS_02320 256970 257848 gene locus_tag LOCUS_02330 gene trmD 256970 257848 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050816932.1 protein_id gnl|my_center|LOCUS_02330 257832 258200 gene locus_tag LOCUS_02340 257832 258200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014844.1 protein_id gnl|my_center|LOCUS_02340 258226 260502 gene locus_tag LOCUS_02350 258226 260502 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014841.1 protein_id gnl|my_center|LOCUS_02350 260676 261017 gene locus_tag LOCUS_02360 gene rplS 260676 261017 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014838.1 protein_id gnl|my_center|LOCUS_02360 261107 261901 gene locus_tag LOCUS_02370 gene lepB 261107 261901 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014836.1 protein_id gnl|my_center|LOCUS_02370 261898 262587 gene locus_tag LOCUS_02380 261898 262587 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034982719.1 protein_id gnl|my_center|LOCUS_02380 262600 262905 gene locus_tag LOCUS_02390 262600 262905 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857573.1 protein_id gnl|my_center|LOCUS_02390 263136 263504 gene locus_tag LOCUS_02400 263136 263504 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014835.1 protein_id gnl|my_center|LOCUS_02400 263491 265041 gene locus_tag LOCUS_02410 263491 265041 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014834.1 protein_id gnl|my_center|LOCUS_02410 265038 266189 gene locus_tag LOCUS_02420 gene dprA 265038 266189 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861752.1 protein_id gnl|my_center|LOCUS_02420 266456 267364 gene locus_tag LOCUS_02430 266456 267364 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857565.1 protein_id gnl|my_center|LOCUS_02430 267912 267379 gene locus_tag LOCUS_02440 267912 267379 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014832.1 protein_id gnl|my_center|LOCUS_02440 268279 269079 gene locus_tag LOCUS_02450 gene rpsB 268279 269079 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014831.1 protein_id gnl|my_center|LOCUS_02450 269360 270187 gene locus_tag LOCUS_02460 gene tsf 269360 270187 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014830.1 protein_id gnl|my_center|LOCUS_02460 270409 271140 gene locus_tag LOCUS_02470 gene pyrH 270409 271140 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284182.1 protein_id gnl|my_center|LOCUS_02470 271212 271769 gene locus_tag LOCUS_02480 gene frr 271212 271769 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014829.1 protein_id gnl|my_center|LOCUS_02480 271893 272771 gene locus_tag LOCUS_02490 271893 272771 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857552.1 protein_id gnl|my_center|LOCUS_02490 273217 272834 gene locus_tag LOCUS_02500 273217 272834 CDS product DUF1049 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031512220.1 protein_id gnl|my_center|LOCUS_02500 273441 274493 gene locus_tag LOCUS_02510 gene rlmN 273441 274493 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861738.1 protein_id gnl|my_center|LOCUS_02510 274993 274568 gene locus_tag LOCUS_02520 274993 274568 CDS product DUF2631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857542.1 protein_id gnl|my_center|LOCUS_02520 275339 276487 gene locus_tag LOCUS_02530 gene dxr 275339 276487 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014825.1 protein_id gnl|my_center|LOCUS_02530 276524 276754 gene locus_tag LOCUS_02540 276524 276754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 276796 277746 gene locus_tag LOCUS_02550 276796 277746 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02550 277852 279027 gene locus_tag LOCUS_02560 gene ispG 277852 279027 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456766.1 protein_id gnl|my_center|LOCUS_02560 279144 281000 gene locus_tag LOCUS_02570 279144 281000 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857527.1 protein_id gnl|my_center|LOCUS_02570 281047 281931 gene locus_tag LOCUS_02580 gene map 281047 281931 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172769613.1 protein_id gnl|my_center|LOCUS_02580 281994 283433 gene locus_tag LOCUS_02590 281994 283433 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093851.1 protein_id gnl|my_center|LOCUS_02590 284882 283491 gene locus_tag LOCUS_02600 gene mtr 284882 283491 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014816.1 protein_id gnl|my_center|LOCUS_02600 286370 287869 gene locus_tag LOCUS_02610 gene mqo 286370 287869 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014814.1 protein_id gnl|my_center|LOCUS_02610 288067 289152 gene locus_tag LOCUS_02620 288067 289152 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014810.1 protein_id gnl|my_center|LOCUS_02620 289232 289918 gene locus_tag LOCUS_02630 289232 289918 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857502.1 protein_id gnl|my_center|LOCUS_02630 290042 290662 gene locus_tag LOCUS_02640 gene cobO 290042 290662 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893997.1 protein_id gnl|my_center|LOCUS_02640 290656 292035 gene locus_tag LOCUS_02650 290656 292035 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899509.1 protein_id gnl|my_center|LOCUS_02650 292554 293678 gene locus_tag LOCUS_02660 292554 293678 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013819.1 protein_id gnl|my_center|LOCUS_02660 295028 293682 gene locus_tag LOCUS_02670 295028 293682 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728345.1 protein_id gnl|my_center|LOCUS_02670 295027 295851 gene locus_tag LOCUS_02680 gene cobA 295027 295851 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014811.1 protein_id gnl|my_center|LOCUS_02680 296617 295871 gene locus_tag LOCUS_02690 gene yaaA 296617 295871 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014808.1 protein_id gnl|my_center|LOCUS_02690 296649 298406 gene locus_tag LOCUS_02700 296649 298406 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857500.1 protein_id gnl|my_center|LOCUS_02700 299321 298485 gene locus_tag LOCUS_02710 299321 298485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 299445 299999 gene locus_tag LOCUS_02720 gene rimP 299445 299999 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014804.1 protein_id gnl|my_center|LOCUS_02720 299996 300994 gene locus_tag LOCUS_02730 gene nusA 299996 300994 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861701.1 protein_id gnl|my_center|LOCUS_02730 301254 301586 gene locus_tag LOCUS_02740 301254 301586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 301697 304558 gene locus_tag LOCUS_02750 301697 304558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 304698 305141 gene locus_tag LOCUS_02760 gene rbfA 304698 305141 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861694.1 protein_id gnl|my_center|LOCUS_02760 305134 306123 gene locus_tag LOCUS_02770 305134 306123 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014801.1 protein_id gnl|my_center|LOCUS_02770 306120 307439 gene locus_tag LOCUS_02780 306120 307439 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897397.1 protein_id gnl|my_center|LOCUS_02780 307486 308292 gene locus_tag LOCUS_02790 307486 308292 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857487.1 protein_id gnl|my_center|LOCUS_02790 308643 308981 gene locus_tag LOCUS_02800 308643 308981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 309880 308978 gene locus_tag LOCUS_02810 gene truB 309880 308978 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014799.1 protein_id gnl|my_center|LOCUS_02810 309912 310874 gene locus_tag LOCUS_02820 309912 310874 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014798.1 protein_id gnl|my_center|LOCUS_02820 310912 311871 gene locus_tag LOCUS_02830 310912 311871 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014797.1 protein_id gnl|my_center|LOCUS_02830 312043 312312 gene locus_tag LOCUS_02840 gene rpsO 312043 312312 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857482.1 protein_id gnl|my_center|LOCUS_02840 312504 314771 gene locus_tag LOCUS_02850 312504 314771 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014796.1 protein_id gnl|my_center|LOCUS_02850 314951 315697 gene locus_tag LOCUS_02860 gene dapB 314951 315697 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014794.1 protein_id gnl|my_center|LOCUS_02860 315697 316455 gene locus_tag LOCUS_02870 gene thyX 315697 316455 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014793.1 protein_id gnl|my_center|LOCUS_02870 316528 317442 gene locus_tag LOCUS_02880 gene dapA 316528 317442 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014792.1 protein_id gnl|my_center|LOCUS_02880 317445 319499 gene locus_tag LOCUS_02890 317445 319499 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014791.1 protein_id gnl|my_center|LOCUS_02890 319537 320250 gene locus_tag LOCUS_02900 319537 320250 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857475.1 protein_id gnl|my_center|LOCUS_02900 320719 323379 gene locus_tag LOCUS_02910 320719 323379 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857472.1 protein_id gnl|my_center|LOCUS_02910 323660 324667 gene locus_tag LOCUS_02920 323660 324667 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014789.1 protein_id gnl|my_center|LOCUS_02920 325052 324750 gene locus_tag LOCUS_02930 325052 324750 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857466.1 protein_id gnl|my_center|LOCUS_02930 325230 325003 gene locus_tag LOCUS_02940 325230 325003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 325232 325729 gene locus_tag LOCUS_02950 gene pgsA 325232 325729 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857464.1 protein_id gnl|my_center|LOCUS_02950 325722 326264 gene locus_tag LOCUS_02960 325722 326264 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014786.1 protein_id gnl|my_center|LOCUS_02960 326348 326674 gene locus_tag LOCUS_02970 326348 326674 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861658.1 protein_id gnl|my_center|LOCUS_02970 326805 327644 gene locus_tag LOCUS_02980 326805 327644 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857458.1 protein_id gnl|my_center|LOCUS_02980 328023 327700 gene locus_tag LOCUS_02990 328023 327700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 329003 328311 gene locus_tag LOCUS_03000 329003 328311 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014785.1 protein_id gnl|my_center|LOCUS_03000 329651 329067 gene locus_tag LOCUS_03010 gene bioY 329651 329067 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857452.1 protein_id gnl|my_center|LOCUS_03010 329738 329929 gene locus_tag LOCUS_03020 329738 329929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 330185 331303 gene locus_tag LOCUS_03030 gene recA 330185 331303 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857444.1 protein_id gnl|my_center|LOCUS_03030 331284 331922 gene locus_tag LOCUS_03040 gene recX 331284 331922 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857439.1 protein_id gnl|my_center|LOCUS_03040 331998 333629 gene locus_tag LOCUS_03050 gene miaB 331998 333629 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857429.1 protein_id gnl|my_center|LOCUS_03050 333679 334317 gene locus_tag LOCUS_03060 333679 334317 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861637.1 protein_id gnl|my_center|LOCUS_03060 335195 334326 gene locus_tag LOCUS_03070 335195 334326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 336867 335539 gene locus_tag LOCUS_03080 336867 335539 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014775.1 protein_id gnl|my_center|LOCUS_03080 337065 337760 gene locus_tag LOCUS_03090 337065 337760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014774.1 protein_id gnl|my_center|LOCUS_03090 337823 338731 gene locus_tag LOCUS_03100 gene miaA 337823 338731 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014773.1 protein_id gnl|my_center|LOCUS_03100 338728 339621 gene locus_tag LOCUS_03110 gene dapF 338728 339621 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014772.1 protein_id gnl|my_center|LOCUS_03110 340154 339630 gene locus_tag LOCUS_03120 340154 339630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 340984 340229 gene locus_tag LOCUS_03130 340984 340229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014770.1 protein_id gnl|my_center|LOCUS_03130 341130 342740 gene locus_tag LOCUS_03140 gene hflX 341130 342740 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857415.1 protein_id gnl|my_center|LOCUS_03140 342823 344109 gene locus_tag LOCUS_03150 342823 344109 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014768.1 protein_id gnl|my_center|LOCUS_03150 344836 344171 gene locus_tag LOCUS_03160 344836 344171 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975539.1 protein_id gnl|my_center|LOCUS_03160 346016 344895 gene locus_tag LOCUS_03170 346016 344895 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014504.1 protein_id gnl|my_center|LOCUS_03170 346447 346181 gene locus_tag LOCUS_03180 346447 346181 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857409.1 protein_id gnl|my_center|LOCUS_03180 347415 346945 gene locus_tag LOCUS_03190 347415 346945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03190 348020 347784 gene locus_tag LOCUS_03200 348020 347784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 348138 347929 gene locus_tag LOCUS_03210 348138 347929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03210 349756 348791 gene locus_tag LOCUS_03220 349756 348791 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014765.1 protein_id gnl|my_center|LOCUS_03220 350556 349753 gene locus_tag LOCUS_03230 350556 349753 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014761.1 protein_id gnl|my_center|LOCUS_03230 350824 352518 gene locus_tag LOCUS_03240 gene ptsP 350824 352518 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014763.1 protein_id gnl|my_center|LOCUS_03240 353388 352612 gene locus_tag LOCUS_03250 353388 352612 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014761.1 protein_id gnl|my_center|LOCUS_03250 354423 353710 gene locus_tag LOCUS_03260 gene lexA 354423 353710 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857389.1 protein_id gnl|my_center|LOCUS_03260 354763 355098 gene locus_tag LOCUS_03270 354763 355098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 355232 355651 gene locus_tag LOCUS_03280 gene nrdR 355232 355651 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857385.1 protein_id gnl|my_center|LOCUS_03280 359568 355714 gene locus_tag LOCUS_03290 gene hrpA 359568 355714 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014759.1 protein_id gnl|my_center|LOCUS_03290 359795 360760 gene locus_tag LOCUS_03300 359795 360760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 361754 360816 gene locus_tag LOCUS_03310 361754 360816 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014757.1 protein_id gnl|my_center|LOCUS_03310 361976 362572 gene locus_tag LOCUS_03320 361976 362572 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064030.1 protein_id gnl|my_center|LOCUS_03320 362575 363099 gene locus_tag LOCUS_03330 362575 363099 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064032.1 protein_id gnl|my_center|LOCUS_03330 365707 363173 gene locus_tag LOCUS_03340 365707 363173 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286432.1 protein_id gnl|my_center|LOCUS_03340 366681 365740 gene locus_tag LOCUS_03350 366681 365740 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859825.1 protein_id gnl|my_center|LOCUS_03350 366963 367976 gene locus_tag LOCUS_03360 366963 367976 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066566054.1 protein_id gnl|my_center|LOCUS_03360 369012 368026 gene locus_tag LOCUS_03370 gene galE 369012 368026 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014754.1 protein_id gnl|my_center|LOCUS_03370 369715 369035 gene locus_tag LOCUS_03380 369715 369035 CDS product iron dependent repressor, metal binding and dimerization domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014753.1 protein_id gnl|my_center|LOCUS_03380 370929 369940 gene locus_tag LOCUS_03390 370929 369940 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014752.1 protein_id gnl|my_center|LOCUS_03390 371306 371013 gene locus_tag LOCUS_03400 371306 371013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 372861 371461 gene locus_tag LOCUS_03410 372861 371461 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014751.1 protein_id gnl|my_center|LOCUS_03410 373527 373039 gene locus_tag LOCUS_03420 373527 373039 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014750.1 protein_id gnl|my_center|LOCUS_03420 373587 373826 gene locus_tag LOCUS_03430 373587 373826 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857359.1 protein_id gnl|my_center|LOCUS_03430 373826 375535 gene locus_tag LOCUS_03440 373826 375535 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859837.1 protein_id gnl|my_center|LOCUS_03440 375644 376117 gene locus_tag LOCUS_03450 375644 376117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 378030 376450 gene locus_tag LOCUS_03460 378030 376450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 378290 378093 gene locus_tag LOCUS_03470 378290 378093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 379184 378423 gene locus_tag LOCUS_03480 gene ppgK 379184 378423 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014747.1 protein_id gnl|my_center|LOCUS_03480 379336 380220 gene locus_tag LOCUS_03490 379336 380220 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014746.1 protein_id gnl|my_center|LOCUS_03490 380413 380706 gene locus_tag LOCUS_03500 380413 380706 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857344.1 protein_id gnl|my_center|LOCUS_03500 381254 380742 gene locus_tag LOCUS_03510 381254 380742 CDS product DUF3093 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859852.1 protein_id gnl|my_center|LOCUS_03510 381397 381855 gene locus_tag LOCUS_03520 gene dut 381397 381855 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014744.1 protein_id gnl|my_center|LOCUS_03520 381914 382651 gene locus_tag LOCUS_03530 381914 382651 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014743.1 protein_id gnl|my_center|LOCUS_03530 382951 384213 gene locus_tag LOCUS_03540 382951 384213 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014742.1 protein_id gnl|my_center|LOCUS_03540 384425 386332 gene locus_tag LOCUS_03550 gene dxs 384425 386332 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014741.1 protein_id gnl|my_center|LOCUS_03550 387616 386393 gene locus_tag LOCUS_03560 387616 386393 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014740.1 protein_id gnl|my_center|LOCUS_03560 388216 387635 gene locus_tag LOCUS_03570 388216 387635 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014739.1 protein_id gnl|my_center|LOCUS_03570 388402 389106 gene locus_tag LOCUS_03580 388402 389106 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014738.1 protein_id gnl|my_center|LOCUS_03580 389595 389185 gene locus_tag LOCUS_03590 gene msrB 389595 389185 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857328.1 protein_id gnl|my_center|LOCUS_03590 390450 389653 gene locus_tag LOCUS_03600 390450 389653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 390577 390504 gene locus_tag LOCUS_t00040 390577 390504 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 390682 390610 gene locus_tag LOCUS_t00050 390682 390610 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 390760 390689 gene locus_tag LOCUS_t00060 390760 390689 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 390871 390798 gene locus_tag LOCUS_t00070 390871 390798 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 390976 390904 gene locus_tag LOCUS_t00080 390976 390904 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 391066 390993 gene locus_tag LOCUS_t00090 391066 390993 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 391354 391426 gene locus_tag LOCUS_t00100 391354 391426 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 391634 392278 gene locus_tag LOCUS_03610 391634 392278 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855865.1 protein_id gnl|my_center|LOCUS_03610 392285 392899 gene locus_tag LOCUS_03620 392285 392899 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014526.1 protein_id gnl|my_center|LOCUS_03620 392942 394213 gene locus_tag LOCUS_03630 392942 394213 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859878.1 protein_id gnl|my_center|LOCUS_03630 394402 396465 gene locus_tag LOCUS_03640 gene thrS 394402 396465 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855874.1 protein_id gnl|my_center|LOCUS_03640 396649 397233 gene locus_tag LOCUS_03650 396649 397233 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511750.1 protein_id gnl|my_center|LOCUS_03650 397226 397879 gene locus_tag LOCUS_03660 397226 397879 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859882.1 protein_id gnl|my_center|LOCUS_03660 397906 398847 gene locus_tag LOCUS_03670 397906 398847 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014523.1 protein_id gnl|my_center|LOCUS_03670 398865 399965 gene locus_tag LOCUS_03680 398865 399965 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859886.1 protein_id gnl|my_center|LOCUS_03680 399977 400438 gene locus_tag LOCUS_03690 399977 400438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855892.1 protein_id gnl|my_center|LOCUS_03690 401634 400435 gene locus_tag LOCUS_03700 gene bioF 401634 400435 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_03700 402359 401634 gene locus_tag LOCUS_03710 402359 401634 CDS product 6-carboxyhexanoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051345777.1 protein_id gnl|my_center|LOCUS_03710 402535 402843 gene locus_tag LOCUS_03720 402535 402843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 402755 402961 gene locus_tag LOCUS_03730 402755 402961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03730 403177 403890 gene locus_tag LOCUS_03740 403177 403890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03740 404091 404564 gene locus_tag LOCUS_03750 404091 404564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03750 405509 405045 gene locus_tag LOCUS_03760 405509 405045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 406268 407242 gene locus_tag LOCUS_03770 406268 407242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 407502 407272 gene locus_tag LOCUS_03780 407502 407272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 407629 407811 gene locus_tag LOCUS_03790 407629 407811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 407832 408002 gene locus_tag LOCUS_03800 407832 408002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 408757 409992 gene locus_tag LOCUS_03810 408757 409992 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878198.1 protein_id gnl|my_center|LOCUS_03810 409956 410315 gene locus_tag LOCUS_03820 409956 410315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03820 410802 411665 gene locus_tag LOCUS_03830 410802 411665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 411658 412041 gene locus_tag LOCUS_03840 411658 412041 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525193.1 protein_id gnl|my_center|LOCUS_03840 412028 412264 gene locus_tag LOCUS_03850 412028 412264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 412511 412284 gene locus_tag LOCUS_03860 412511 412284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03860 412653 412444 gene locus_tag LOCUS_03870 412653 412444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03870 414043 412604 gene locus_tag LOCUS_03880 414043 412604 CDS product IS30-like element ISMsm8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728521.1 protein_id gnl|my_center|LOCUS_03880 414473 414120 gene locus_tag LOCUS_03890 414473 414120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03890 415007 415249 gene locus_tag LOCUS_03900 415007 415249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 416362 415148 gene locus_tag LOCUS_03910 416362 415148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 416593 417447 gene locus_tag LOCUS_03920 416593 417447 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014521.1 protein_id gnl|my_center|LOCUS_03920 417685 418437 gene locus_tag LOCUS_03930 417685 418437 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014520.1 protein_id gnl|my_center|LOCUS_03930 419151 419762 gene locus_tag LOCUS_03940 gene ruvA 419151 419762 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859897.1 protein_id gnl|my_center|LOCUS_03940 419780 420868 gene locus_tag LOCUS_03950 gene ruvB 419780 420868 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855899.1 protein_id gnl|my_center|LOCUS_03950 420998 421165 gene locus_tag LOCUS_03960 420998 421165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 421396 423174 gene locus_tag LOCUS_03970 gene secD 421396 423174 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855902.1 protein_id gnl|my_center|LOCUS_03970 423175 424287 gene locus_tag LOCUS_03980 gene secF 423175 424287 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014516.1 protein_id gnl|my_center|LOCUS_03980 424491 426107 gene locus_tag LOCUS_03990 424491 426107 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014515.1 protein_id gnl|my_center|LOCUS_03990 426163 426717 gene locus_tag LOCUS_04000 426163 426717 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014514.1 protein_id gnl|my_center|LOCUS_04000 426869 429055 gene locus_tag LOCUS_04010 426869 429055 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855910.1 protein_id gnl|my_center|LOCUS_04010 429804 429604 gene locus_tag LOCUS_04020 429804 429604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 430142 429855 gene locus_tag LOCUS_04030 430142 429855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 431141 430299 gene locus_tag LOCUS_04040 431141 430299 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014511.1 protein_id gnl|my_center|LOCUS_04040 431285 431782 gene locus_tag LOCUS_04050 gene tpx 431285 431782 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858595.1 protein_id gnl|my_center|LOCUS_04050 431792 432448 gene locus_tag LOCUS_04060 431792 432448 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014510.1 protein_id gnl|my_center|LOCUS_04060 432489 433760 gene locus_tag LOCUS_04070 gene hisS 432489 433760 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014509.1 protein_id gnl|my_center|LOCUS_04070 435220 433832 gene locus_tag LOCUS_04080 435220 433832 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014507.1 protein_id gnl|my_center|LOCUS_04080 436018 436752 gene locus_tag LOCUS_04090 436018 436752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855924.1 protein_id gnl|my_center|LOCUS_04090 436771 438792 gene locus_tag LOCUS_04100 436771 438792 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014501.1 protein_id gnl|my_center|LOCUS_04100 438856 439860 gene locus_tag LOCUS_04110 438856 439860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04110 439867 441525 gene locus_tag LOCUS_04120 439867 441525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04120 442490 441606 gene locus_tag LOCUS_04130 442490 441606 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014499.1 protein_id gnl|my_center|LOCUS_04130 442718 444517 gene locus_tag LOCUS_04140 gene aspS 442718 444517 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014498.1 protein_id gnl|my_center|LOCUS_04140 444643 445902 gene locus_tag LOCUS_04150 444643 445902 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014497.1 protein_id gnl|my_center|LOCUS_04150 445939 447297 gene locus_tag LOCUS_04160 445939 447297 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855936.1 protein_id gnl|my_center|LOCUS_04160 447423 450125 gene locus_tag LOCUS_04170 gene alaS 447423 450125 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014496.1 protein_id gnl|my_center|LOCUS_04170 450391 450906 gene locus_tag LOCUS_04180 gene ruvX 450391 450906 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014495.1 protein_id gnl|my_center|LOCUS_04180 451019 452167 gene locus_tag LOCUS_04190 gene mltG 451019 452167 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014494.1 protein_id gnl|my_center|LOCUS_04190 452478 453131 gene locus_tag LOCUS_04200 452478 453131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 453773 454933 gene locus_tag LOCUS_04210 gene aroC 453773 454933 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855968.1 protein_id gnl|my_center|LOCUS_04210 454941 455489 gene locus_tag LOCUS_04220 454941 455489 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855969.1 protein_id gnl|my_center|LOCUS_04220 455536 456615 gene locus_tag LOCUS_04230 gene aroB 455536 456615 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014486.1 protein_id gnl|my_center|LOCUS_04230 456616 457056 gene locus_tag LOCUS_04240 gene aroQ 456616 457056 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907768.1 protein_id gnl|my_center|LOCUS_04240 457083 458180 gene locus_tag LOCUS_04250 457083 458180 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014485.1 protein_id gnl|my_center|LOCUS_04250 458282 458845 gene locus_tag LOCUS_04260 gene efp 458282 458845 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855973.1 protein_id gnl|my_center|LOCUS_04260 458848 459462 gene locus_tag LOCUS_04270 458848 459462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 459925 459515 gene locus_tag LOCUS_04280 459925 459515 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014482.1 protein_id gnl|my_center|LOCUS_04280 460362 459925 gene locus_tag LOCUS_04290 460362 459925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 460970 460368 gene locus_tag LOCUS_04300 460970 460368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 461994 462566 gene locus_tag LOCUS_04310 gene pyrR 461994 462566 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862208.1 protein_id gnl|my_center|LOCUS_04310 462566 463507 gene locus_tag LOCUS_04320 462566 463507 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862210.1 protein_id gnl|my_center|LOCUS_04320 463532 464878 gene locus_tag LOCUS_04330 463532 464878 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014479.1 protein_id gnl|my_center|LOCUS_04330 465034 466173 gene locus_tag LOCUS_04340 gene carA 465034 466173 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014478.1 protein_id gnl|my_center|LOCUS_04340 466194 469550 gene locus_tag LOCUS_04350 gene carB 466194 469550 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862217.1 protein_id gnl|my_center|LOCUS_04350 469547 470395 gene locus_tag LOCUS_04360 gene pyrF 469547 470395 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014477.1 protein_id gnl|my_center|LOCUS_04360 470744 471067 gene locus_tag LOCUS_04370 gene mihF 470744 471067 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_04370 471071 471646 gene locus_tag LOCUS_04380 gene gmk 471071 471646 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855988.1 protein_id gnl|my_center|LOCUS_04380 471720 471998 gene locus_tag LOCUS_04390 gene rpoZ 471720 471998 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855993.1 protein_id gnl|my_center|LOCUS_04390 472100 473344 gene locus_tag LOCUS_04400 gene coaBC 472100 473344 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014475.1 protein_id gnl|my_center|LOCUS_04400 473485 474717 gene locus_tag LOCUS_04410 gene metK 473485 474717 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856000.1 protein_id gnl|my_center|LOCUS_04410 475937 476122 gene locus_tag LOCUS_04420 475937 476122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 476236 476763 gene locus_tag LOCUS_04430 476236 476763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 476843 477352 gene locus_tag LOCUS_04440 gene def 476843 477352 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856004.1 protein_id gnl|my_center|LOCUS_04440 477389 478324 gene locus_tag LOCUS_04450 gene fmt 477389 478324 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862229.1 protein_id gnl|my_center|LOCUS_04450 478321 479778 gene locus_tag LOCUS_04460 478321 479778 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014473.1 protein_id gnl|my_center|LOCUS_04460 479832 480506 gene locus_tag LOCUS_04470 gene rpe 479832 480506 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014472.1 protein_id gnl|my_center|LOCUS_04470 480517 481605 gene locus_tag LOCUS_04480 gene ribD 480517 481605 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014471.1 protein_id gnl|my_center|LOCUS_04480 481663 482271 gene locus_tag LOCUS_04490 481663 482271 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014470.1 protein_id gnl|my_center|LOCUS_04490 482386 483624 gene locus_tag LOCUS_04500 482386 483624 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856016.1 protein_id gnl|my_center|LOCUS_04500 483625 484092 gene locus_tag LOCUS_04510 gene ribH 483625 484092 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856018.1 protein_id gnl|my_center|LOCUS_04510 484231 484791 gene locus_tag LOCUS_04520 484231 484791 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014469.1 protein_id gnl|my_center|LOCUS_04520 485407 486864 gene locus_tag LOCUS_04530 485407 486864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 486870 487769 gene locus_tag LOCUS_04540 gene rapZ 486870 487769 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856023.1 protein_id gnl|my_center|LOCUS_04540 487788 488759 gene locus_tag LOCUS_04550 gene yvcK 487788 488759 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014467.1 protein_id gnl|my_center|LOCUS_04550 488853 489839 gene locus_tag LOCUS_04560 gene whiA 488853 489839 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862248.1 protein_id gnl|my_center|LOCUS_04560 490212 491216 gene locus_tag LOCUS_04570 gene gap 490212 491216 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862250.1 protein_id gnl|my_center|LOCUS_04570 491347 492564 gene locus_tag LOCUS_04580 gene pgk 491347 492564 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862252.1 protein_id gnl|my_center|LOCUS_04580 492676 493458 gene locus_tag LOCUS_04590 gene tpiA 492676 493458 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014466.1 protein_id gnl|my_center|LOCUS_04590 493632 493865 gene locus_tag LOCUS_04600 gene secG 493632 493865 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014464.1 protein_id gnl|my_center|LOCUS_04600 494649 493933 gene locus_tag LOCUS_04610 gene pgl 494649 493933 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862263.1 protein_id gnl|my_center|LOCUS_04610 495634 494675 gene locus_tag LOCUS_04620 495634 494675 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014458.1 protein_id gnl|my_center|LOCUS_04620 497308 495659 gene locus_tag LOCUS_04630 gene zwf 497308 495659 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856051.1 protein_id gnl|my_center|LOCUS_04630 498452 497370 gene locus_tag LOCUS_04640 gene tal 498452 497370 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856053.1 protein_id gnl|my_center|LOCUS_04640 500678 498576 gene locus_tag LOCUS_04650 gene tkt 500678 498576 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856055.1 protein_id gnl|my_center|LOCUS_04650 501041 501988 gene locus_tag LOCUS_04660 501041 501988 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271337.1 protein_id gnl|my_center|LOCUS_04660 502963 502106 gene locus_tag LOCUS_04670 502963 502106 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014452.1 protein_id gnl|my_center|LOCUS_04670 503922 503125 gene locus_tag LOCUS_04680 503922 503125 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014451.1 protein_id gnl|my_center|LOCUS_04680 504701 503925 gene locus_tag LOCUS_04690 504701 503925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014450.1 protein_id gnl|my_center|LOCUS_04690 506084 504903 gene locus_tag LOCUS_04700 506084 504903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04700 506077 506307 gene locus_tag LOCUS_04710 506077 506307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 507239 507955 gene locus_tag LOCUS_04720 507239 507955 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862282.1 protein_id gnl|my_center|LOCUS_04720 507952 509406 gene locus_tag LOCUS_04730 gene sufB 507952 509406 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862284.1 protein_id gnl|my_center|LOCUS_04730 509409 510584 gene locus_tag LOCUS_04740 gene sufD 509409 510584 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014448.1 protein_id gnl|my_center|LOCUS_04740 510613 511371 gene locus_tag LOCUS_04750 gene sufC 510613 511371 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856078.1 protein_id gnl|my_center|LOCUS_04750 511371 512651 gene locus_tag LOCUS_04760 511371 512651 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014447.1 protein_id gnl|my_center|LOCUS_04760 512655 513104 gene locus_tag LOCUS_04770 512655 513104 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856080.1 protein_id gnl|my_center|LOCUS_04770 513101 513529 gene locus_tag LOCUS_04780 513101 513529 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856083.1 protein_id gnl|my_center|LOCUS_04780 513626 515257 gene locus_tag LOCUS_04790 513626 515257 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014443.1 protein_id gnl|my_center|LOCUS_04790 516952 515588 gene locus_tag LOCUS_04800 516952 515588 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856096.1 protein_id gnl|my_center|LOCUS_04800 517238 516969 gene locus_tag LOCUS_04810 517238 516969 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856097.1 protein_id gnl|my_center|LOCUS_04810 518055 517327 gene locus_tag LOCUS_04820 518055 517327 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014437.1 protein_id gnl|my_center|LOCUS_04820 518653 518081 gene locus_tag LOCUS_04830 gene acnR 518653 518081 CDS product TetR/AcrR family transcriptional regulator AcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856101.1 protein_id gnl|my_center|LOCUS_04830 521567 518763 gene locus_tag LOCUS_04840 gene can 521567 518763 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170844367.1 protein_id gnl|my_center|LOCUS_04840 522330 524048 gene locus_tag LOCUS_04850 522330 524048 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014435.1 protein_id gnl|my_center|LOCUS_04850 524140 525273 gene locus_tag LOCUS_04860 524140 525273 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014434.1 protein_id gnl|my_center|LOCUS_04860 526067 526909 gene locus_tag LOCUS_04870 526067 526909 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014432.1 protein_id gnl|my_center|LOCUS_04870 526931 527410 gene locus_tag LOCUS_04880 526931 527410 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862316.1 protein_id gnl|my_center|LOCUS_04880 527407 528531 gene locus_tag LOCUS_04890 527407 528531 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014431.1 protein_id gnl|my_center|LOCUS_04890 529202 528636 gene locus_tag LOCUS_04900 529202 528636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014430.1 protein_id gnl|my_center|LOCUS_04900 530214 532025 gene locus_tag LOCUS_04910 gene mutA 530214 532025 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111265.1 protein_id gnl|my_center|LOCUS_04910 532028 534235 gene locus_tag LOCUS_04920 gene scpA 532028 534235 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014427.1 protein_id gnl|my_center|LOCUS_04920 534322 535425 gene locus_tag LOCUS_04930 gene meaB 534322 535425 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014426.1 protein_id gnl|my_center|LOCUS_04930 536602 536309 gene locus_tag LOCUS_04940 536602 536309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04940 537555 538937 gene locus_tag LOCUS_04950 537555 538937 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114145401.1 protein_id gnl|my_center|LOCUS_04950 539138 539052 gene locus_tag LOCUS_t00110 539138 539052 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 539331 539870 gene locus_tag LOCUS_04960 539331 539870 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856119.1 protein_id gnl|my_center|LOCUS_04960 539857 540120 gene locus_tag LOCUS_04970 539857 540120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 541406 540291 gene locus_tag LOCUS_04980 541406 540291 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014420.1 protein_id gnl|my_center|LOCUS_04980 542496 541447 gene locus_tag LOCUS_04990 542496 541447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 542673 543476 gene locus_tag LOCUS_05000 542673 543476 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856127.1 protein_id gnl|my_center|LOCUS_05000 543522 544766 gene locus_tag LOCUS_05010 gene mshC 543522 544766 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856128.1 protein_id gnl|my_center|LOCUS_05010 544767 545162 gene locus_tag LOCUS_05020 544767 545162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856129.1 protein_id gnl|my_center|LOCUS_05020 545316 548840 gene locus_tag LOCUS_05030 gene metH 545316 548840 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014411.1 protein_id gnl|my_center|LOCUS_05030 548884 549579 gene locus_tag LOCUS_05040 548884 549579 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014410.1 protein_id gnl|my_center|LOCUS_05040 549598 549861 gene locus_tag LOCUS_05050 549598 549861 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897259.1 protein_id gnl|my_center|LOCUS_05050 549943 550788 gene locus_tag LOCUS_05060 gene hisG 549943 550788 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856149.1 protein_id gnl|my_center|LOCUS_05060 551149 552456 gene locus_tag LOCUS_05070 551149 552456 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368669.1 protein_id gnl|my_center|LOCUS_05070 552731 554305 gene locus_tag LOCUS_05080 gene aspA 552731 554305 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014409.1 protein_id gnl|my_center|LOCUS_05080 554442 556094 gene locus_tag LOCUS_05090 554442 556094 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776500.1 protein_id gnl|my_center|LOCUS_05090 556422 556168 gene locus_tag LOCUS_05100 556422 556168 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856157.1 protein_id gnl|my_center|LOCUS_05100 557382 556516 gene locus_tag LOCUS_05110 557382 556516 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856159.1 protein_id gnl|my_center|LOCUS_05110 557490 558842 gene locus_tag LOCUS_05120 557490 558842 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285177.1 protein_id gnl|my_center|LOCUS_05120 558849 559685 gene locus_tag LOCUS_05130 558849 559685 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860005.1 protein_id gnl|my_center|LOCUS_05130 559782 561311 gene locus_tag LOCUS_05140 gene arc 559782 561311 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265753.1 protein_id gnl|my_center|LOCUS_05140 561308 562834 gene locus_tag LOCUS_05150 gene dop 561308 562834 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014405.1 protein_id gnl|my_center|LOCUS_05150 562892 563086 gene locus_tag LOCUS_05160 562892 563086 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856167.1 protein_id gnl|my_center|LOCUS_05160 563091 564530 gene locus_tag LOCUS_05170 gene pafA 563091 564530 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066565680.1 protein_id gnl|my_center|LOCUS_05170 564555 565532 gene locus_tag LOCUS_05180 564555 565532 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014403.1 protein_id gnl|my_center|LOCUS_05180 565636 566556 gene locus_tag LOCUS_05190 565636 566556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 566591 566857 gene locus_tag LOCUS_05200 gene tatA 566591 566857 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014401.1 protein_id gnl|my_center|LOCUS_05200 566930 568024 gene locus_tag LOCUS_05210 gene tatC 566930 568024 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856179.1 protein_id gnl|my_center|LOCUS_05210 568580 568110 gene locus_tag LOCUS_05220 568580 568110 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854647.1 protein_id gnl|my_center|LOCUS_05220 568680 571472 gene locus_tag LOCUS_05230 568680 571472 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014399.1 protein_id gnl|my_center|LOCUS_05230 571523 572662 gene locus_tag LOCUS_05240 571523 572662 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014398.1 protein_id gnl|my_center|LOCUS_05240 572671 573435 gene locus_tag LOCUS_05250 572671 573435 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014397.1 protein_id gnl|my_center|LOCUS_05250 573458 574738 gene locus_tag LOCUS_05260 573458 574738 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729388.1 protein_id gnl|my_center|LOCUS_05260 574765 575538 gene locus_tag LOCUS_05270 gene cobM 574765 575538 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895328.1 protein_id gnl|my_center|LOCUS_05270 575526 576257 gene locus_tag LOCUS_05280 575526 576257 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877850.1 protein_id gnl|my_center|LOCUS_05280 577835 576339 gene locus_tag LOCUS_05290 577835 576339 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086498.1 protein_id gnl|my_center|LOCUS_05290 578482 577832 gene locus_tag LOCUS_05300 578482 577832 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_05300 579654 578479 gene locus_tag LOCUS_05310 gene cobG 579654 578479 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900454.1 protein_id gnl|my_center|LOCUS_05310 580038 583664 gene locus_tag LOCUS_05320 gene cobN 580038 583664 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729378.1 protein_id gnl|my_center|LOCUS_05320 583704 584234 gene locus_tag LOCUS_05330 583704 584234 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014393.1 protein_id gnl|my_center|LOCUS_05330 584508 585797 gene locus_tag LOCUS_05340 gene lnt 584508 585797 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014392.1 protein_id gnl|my_center|LOCUS_05340 585829 586632 gene locus_tag LOCUS_05350 585829 586632 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856192.1 protein_id gnl|my_center|LOCUS_05350 587099 586710 gene locus_tag LOCUS_05360 587099 586710 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863735.1 protein_id gnl|my_center|LOCUS_05360 587352 587693 gene locus_tag LOCUS_05370 587352 587693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467698.1 protein_id gnl|my_center|LOCUS_05370 587707 588405 gene locus_tag LOCUS_05380 587707 588405 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863737.1 protein_id gnl|my_center|LOCUS_05380 589980 589012 gene locus_tag LOCUS_05390 589980 589012 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859383.1 protein_id gnl|my_center|LOCUS_05390 590383 590904 gene locus_tag LOCUS_05400 590383 590904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05400 590901 591521 gene locus_tag LOCUS_05410 590901 591521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05410 591774 592028 gene locus_tag LOCUS_05420 591774 592028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05420 592071 592400 gene locus_tag LOCUS_05430 592071 592400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05430 593710 592415 gene locus_tag LOCUS_05440 593710 592415 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014384.1 protein_id gnl|my_center|LOCUS_05440 593887 595251 gene locus_tag LOCUS_05450 593887 595251 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863745.1 protein_id gnl|my_center|LOCUS_05450 595933 595328 gene locus_tag LOCUS_05460 595933 595328 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856229.1 protein_id gnl|my_center|LOCUS_05460 595964 597064 gene locus_tag LOCUS_05470 gene corA 595964 597064 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730286.1 protein_id gnl|my_center|LOCUS_05470 597555 597061 gene locus_tag LOCUS_05480 597555 597061 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014373.1 protein_id gnl|my_center|LOCUS_05480 597628 599082 gene locus_tag LOCUS_05490 gene gndA 597628 599082 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856232.1 protein_id gnl|my_center|LOCUS_05490 599186 600544 gene locus_tag LOCUS_05500 599186 600544 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856236.1 protein_id gnl|my_center|LOCUS_05500 600569 601963 gene locus_tag LOCUS_05510 600569 601963 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014371.1 protein_id gnl|my_center|LOCUS_05510 601960 603012 gene locus_tag LOCUS_05520 601960 603012 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014370.1 protein_id gnl|my_center|LOCUS_05520 603009 603887 gene locus_tag LOCUS_05530 603009 603887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309556.1 protein_id gnl|my_center|LOCUS_05530 603919 605331 gene locus_tag LOCUS_05540 603919 605331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014368.1 protein_id gnl|my_center|LOCUS_05540 605967 605407 gene locus_tag LOCUS_05550 605967 605407 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856248.1 protein_id gnl|my_center|LOCUS_05550 606706 606119 gene locus_tag LOCUS_05560 606706 606119 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863762.1 protein_id gnl|my_center|LOCUS_05560 607499 606729 gene locus_tag LOCUS_05570 607499 606729 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856252.1 protein_id gnl|my_center|LOCUS_05570 608008 607577 gene locus_tag LOCUS_05580 608008 607577 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856253.1 protein_id gnl|my_center|LOCUS_05580 610469 608175 gene locus_tag LOCUS_05590 gene secA2 610469 608175 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014367.1 protein_id gnl|my_center|LOCUS_05590 610738 611925 gene locus_tag LOCUS_05600 610738 611925 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856255.1 protein_id gnl|my_center|LOCUS_05600 612577 612503 gene locus_tag LOCUS_t00120 612577 612503 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 613665 612682 gene locus_tag LOCUS_05610 613665 612682 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014014.1 protein_id gnl|my_center|LOCUS_05610 613658 613843 gene locus_tag LOCUS_05620 613658 613843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 614312 614935 gene locus_tag LOCUS_05630 614312 614935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 616351 614966 gene locus_tag LOCUS_05640 616351 614966 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074061.1 protein_id gnl|my_center|LOCUS_05640 618226 616583 gene locus_tag LOCUS_05650 gene der 618226 616583 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173328343.1 protein_id gnl|my_center|LOCUS_05650 618948 618223 gene locus_tag LOCUS_05660 gene cmk 618948 618223 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396322.1 protein_id gnl|my_center|LOCUS_05660 619915 618950 gene locus_tag LOCUS_05670 619915 618950 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856268.1 protein_id gnl|my_center|LOCUS_05670 620573 620019 gene locus_tag LOCUS_05680 gene scpB 620573 620019 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856269.1 protein_id gnl|my_center|LOCUS_05680 622166 620592 gene locus_tag LOCUS_05690 622166 620592 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014364.1 protein_id gnl|my_center|LOCUS_05690 622951 622283 gene locus_tag LOCUS_05700 gene bioD 622951 622283 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015244.1 protein_id gnl|my_center|LOCUS_05700 624277 622964 gene locus_tag LOCUS_05710 624277 622964 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015243.1 protein_id gnl|my_center|LOCUS_05710 624406 624825 gene locus_tag LOCUS_05720 624406 624825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05720 624921 625832 gene locus_tag LOCUS_05730 624921 625832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05730 626483 625833 gene locus_tag LOCUS_05740 gene bioD 626483 625833 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015244.1 protein_id gnl|my_center|LOCUS_05740 627371 626553 gene locus_tag LOCUS_05750 627371 626553 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856272.1 protein_id gnl|my_center|LOCUS_05750 628283 627414 gene locus_tag LOCUS_05760 628283 627414 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014352.1 protein_id gnl|my_center|LOCUS_05760 629410 628475 gene locus_tag LOCUS_05770 gene xerD 629410 628475 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014350.1 protein_id gnl|my_center|LOCUS_05770 630051 629413 gene locus_tag LOCUS_05780 630051 629413 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014349.1 protein_id gnl|my_center|LOCUS_05780 631023 630073 gene locus_tag LOCUS_05790 631023 630073 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014348.1 protein_id gnl|my_center|LOCUS_05790 632241 631048 gene locus_tag LOCUS_05800 gene steA 632241 631048 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014347.1 protein_id gnl|my_center|LOCUS_05800 634106 632352 gene locus_tag LOCUS_05810 gene recN 634106 632352 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014346.1 protein_id gnl|my_center|LOCUS_05810 635161 634223 gene locus_tag LOCUS_05820 635161 634223 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856294.1 protein_id gnl|my_center|LOCUS_05820 635982 635161 gene locus_tag LOCUS_05830 635982 635161 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856296.1 protein_id gnl|my_center|LOCUS_05830 637187 636192 gene locus_tag LOCUS_05840 637187 636192 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014344.1 protein_id gnl|my_center|LOCUS_05840 638301 637225 gene locus_tag LOCUS_05850 638301 637225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014343.1 protein_id gnl|my_center|LOCUS_05850 638516 638404 gene locus_tag LOCUS_r00010 638516 638404 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 641742 638681 gene locus_tag LOCUS_r00020 641742 638681 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 643632 642116 gene locus_tag LOCUS_r00030 643632 642116 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 645517 644255 gene locus_tag LOCUS_05860 gene tyrS 645517 644255 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014341.1 protein_id gnl|my_center|LOCUS_05860 645713 645531 gene locus_tag LOCUS_05870 645713 645531 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861608.1 protein_id gnl|my_center|LOCUS_05870 647240 645807 gene locus_tag LOCUS_05880 gene argH 647240 645807 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014337.1 protein_id gnl|my_center|LOCUS_05880 648439 647240 gene locus_tag LOCUS_05890 648439 647240 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858678.1 protein_id gnl|my_center|LOCUS_05890 649088 648597 gene locus_tag LOCUS_05900 649088 648597 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858683.1 protein_id gnl|my_center|LOCUS_05900 650154 649195 gene locus_tag LOCUS_05910 gene argF 650154 649195 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014335.1 protein_id gnl|my_center|LOCUS_05910 651424 650183 gene locus_tag LOCUS_05920 651424 650183 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014334.1 protein_id gnl|my_center|LOCUS_05920 652349 651417 gene locus_tag LOCUS_05930 gene argB 652349 651417 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858695.1 protein_id gnl|my_center|LOCUS_05930 653600 652386 gene locus_tag LOCUS_05940 gene argJ 653600 652386 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014333.1 protein_id gnl|my_center|LOCUS_05940 654550 653621 gene locus_tag LOCUS_05950 gene argC 654550 653621 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858698.1 protein_id gnl|my_center|LOCUS_05950 657301 654791 gene locus_tag LOCUS_05960 gene pheT 657301 654791 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014330.1 protein_id gnl|my_center|LOCUS_05960 658398 657343 gene locus_tag LOCUS_05970 gene pheS 658398 657343 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897202.1 protein_id gnl|my_center|LOCUS_05970 659347 658526 gene locus_tag LOCUS_05980 659347 658526 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858706.1 protein_id gnl|my_center|LOCUS_05980 659594 660139 gene locus_tag LOCUS_05990 659594 660139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 660772 660389 gene locus_tag LOCUS_06000 gene rplT 660772 660389 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858719.1 protein_id gnl|my_center|LOCUS_06000 661028 660834 gene locus_tag LOCUS_06010 gene rpmI 661028 660834 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858721.1 protein_id gnl|my_center|LOCUS_06010 661495 661058 gene locus_tag LOCUS_06020 gene infC 661495 661058 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014321.1 protein_id gnl|my_center|LOCUS_06020 664709 661848 gene locus_tag LOCUS_06030 gene uvrA 664709 661848 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014319.1 protein_id gnl|my_center|LOCUS_06030 664862 665509 gene locus_tag LOCUS_06040 664862 665509 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858732.1 protein_id gnl|my_center|LOCUS_06040 665694 666539 gene locus_tag LOCUS_06050 665694 666539 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014318.1 protein_id gnl|my_center|LOCUS_06050 666711 668975 gene locus_tag LOCUS_06060 666711 668975 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208400581.1 protein_id gnl|my_center|LOCUS_06060 669464 669024 gene locus_tag LOCUS_06070 669464 669024 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014315.1 protein_id gnl|my_center|LOCUS_06070 671796 669694 gene locus_tag LOCUS_06080 gene uvrB 671796 669694 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948572.1 protein_id gnl|my_center|LOCUS_06080 673072 671840 gene locus_tag LOCUS_06090 673072 671840 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_06090 673861 673259 gene locus_tag LOCUS_06100 gene coaE 673861 673259 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 protein_id gnl|my_center|LOCUS_06100 674033 673827 gene locus_tag LOCUS_06110 674033 673827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 674243 676273 gene locus_tag LOCUS_06120 674243 676273 CDS product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390207.1 protein_id gnl|my_center|LOCUS_06120 676385 677212 gene locus_tag LOCUS_06130 676385 677212 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363838.1 protein_id gnl|my_center|LOCUS_06130 677432 678844 gene locus_tag LOCUS_06140 gene dcuC 677432 678844 CDS product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052501.1 protein_id gnl|my_center|LOCUS_06140 680388 678928 gene locus_tag LOCUS_06150 gene rpsA 680388 678928 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014303.1 protein_id gnl|my_center|LOCUS_06150 680599 681366 gene locus_tag LOCUS_06160 680599 681366 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014302.1 protein_id gnl|my_center|LOCUS_06160 684115 681416 gene locus_tag LOCUS_06170 gene polA 684115 681416 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014298.1 protein_id gnl|my_center|LOCUS_06170 684187 684262 gene locus_tag LOCUS_t00130 684187 684262 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 684550 684735 gene locus_tag LOCUS_06180 684550 684735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 684737 685588 gene locus_tag LOCUS_06190 684737 685588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 685585 685851 gene locus_tag LOCUS_06200 685585 685851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 685996 686298 gene locus_tag LOCUS_06210 685996 686298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 686439 687464 gene locus_tag LOCUS_06220 686439 687464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 687686 688615 gene locus_tag LOCUS_06230 687686 688615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 688678 689193 gene locus_tag LOCUS_06240 688678 689193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 689212 689409 gene locus_tag LOCUS_06250 689212 689409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 689745 690023 gene locus_tag LOCUS_06260 689745 690023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 690020 690469 gene locus_tag LOCUS_06270 690020 690469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 690462 690629 gene locus_tag LOCUS_06280 690462 690629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 690660 690733 gene locus_tag LOCUS_t00140 690660 690733 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 691017 691373 gene locus_tag LOCUS_06290 691017 691373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 691375 691806 gene locus_tag LOCUS_06300 gene dut 691375 691806 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014744.1 protein_id gnl|my_center|LOCUS_06300 691808 692065 gene locus_tag LOCUS_06310 691808 692065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 692131 692643 gene locus_tag LOCUS_06320 692131 692643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 692708 693058 gene locus_tag LOCUS_06330 692708 693058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 693055 693219 gene locus_tag LOCUS_06340 693055 693219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 693288 693542 gene locus_tag LOCUS_06350 693288 693542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 693596 693793 gene locus_tag LOCUS_06360 693596 693793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 693921 694172 gene locus_tag LOCUS_06370 693921 694172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 694169 694543 gene locus_tag LOCUS_06380 694169 694543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 694530 695087 gene locus_tag LOCUS_06390 694530 695087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 695151 695492 gene locus_tag LOCUS_06400 695151 695492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 695493 696161 gene locus_tag LOCUS_06410 695493 696161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 696158 696316 gene locus_tag LOCUS_06420 696158 696316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 696313 696450 gene locus_tag LOCUS_06430 696313 696450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 696447 696638 gene locus_tag LOCUS_06440 696447 696638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 696701 697228 gene locus_tag LOCUS_06450 696701 697228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 697325 697513 gene locus_tag LOCUS_06460 697325 697513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 698193 697510 gene locus_tag LOCUS_06470 698193 697510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 698369 698196 gene locus_tag LOCUS_06480 698369 698196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 698292 698690 gene locus_tag LOCUS_06490 698292 698690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 699087 699938 gene locus_tag LOCUS_06500 699087 699938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 700023 700208 gene locus_tag LOCUS_06510 700023 700208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 700278 700613 gene locus_tag LOCUS_06520 700278 700613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 700708 701055 gene locus_tag LOCUS_06530 700708 701055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 701066 701782 gene locus_tag LOCUS_06540 gene thyX 701066 701782 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057143.1 protein_id gnl|my_center|LOCUS_06540 701782 702153 gene locus_tag LOCUS_06550 701782 702153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 702153 702422 gene locus_tag LOCUS_06560 702153 702422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 702688 704037 gene locus_tag LOCUS_06570 702688 704037 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 protein_id gnl|my_center|LOCUS_06570 704174 704248 gene locus_tag LOCUS_t00150 704174 704248 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 704268 704453 gene locus_tag LOCUS_06580 704268 704453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 704446 704580 gene locus_tag LOCUS_06590 704446 704580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 704577 704978 gene locus_tag LOCUS_06600 704577 704978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 705235 705639 gene locus_tag LOCUS_06610 705235 705639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 705740 706123 gene locus_tag LOCUS_06620 705740 706123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 706133 706372 gene locus_tag LOCUS_06630 706133 706372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 706443 706625 gene locus_tag LOCUS_06640 706443 706625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 706622 707416 gene locus_tag LOCUS_06650 706622 707416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 707829 707467 gene locus_tag LOCUS_06660 707829 707467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 708184 707813 gene locus_tag LOCUS_06670 708184 707813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 708618 708256 gene locus_tag LOCUS_06680 708618 708256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 710084 708621 gene locus_tag LOCUS_06690 710084 708621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 710954 710163 gene locus_tag LOCUS_06700 710954 710163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 711291 711049 gene locus_tag LOCUS_06710 711291 711049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 713253 711298 gene locus_tag LOCUS_06720 713253 711298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 714162 713272 gene locus_tag LOCUS_06730 714162 713272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 714574 714155 gene locus_tag LOCUS_06740 714574 714155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 716229 714574 gene locus_tag LOCUS_06750 716229 714574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 717104 716229 gene locus_tag LOCUS_06760 717104 716229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 721868 717105 gene locus_tag LOCUS_06770 721868 717105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 722722 722303 gene locus_tag LOCUS_06780 722722 722303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 723826 722870 gene locus_tag LOCUS_06790 723826 722870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 724295 723837 gene locus_tag LOCUS_06800 724295 723837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 724609 724292 gene locus_tag LOCUS_06810 724609 724292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 724989 724606 gene locus_tag LOCUS_06820 724989 724606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 725395 724982 gene locus_tag LOCUS_06830 725395 724982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 726620 725418 gene locus_tag LOCUS_06840 726620 725418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 727490 726636 gene locus_tag LOCUS_06850 727490 726636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 728883 727765 gene locus_tag LOCUS_06860 728883 727765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 730610 728880 gene locus_tag LOCUS_06870 730610 728880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 731900 730620 gene locus_tag LOCUS_06880 731900 730620 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_06880 732415 731897 gene locus_tag LOCUS_06890 732415 731897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 737053 732617 gene locus_tag LOCUS_06900 737053 732617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 737721 737146 gene locus_tag LOCUS_06910 737721 737146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 738402 737809 gene locus_tag LOCUS_06920 738402 737809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 740101 738737 gene locus_tag LOCUS_06930 740101 738737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 740368 740153 gene locus_tag LOCUS_06940 740368 740153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 740535 740945 gene locus_tag LOCUS_06950 740535 740945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 740976 742112 gene locus_tag LOCUS_06960 740976 742112 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110336.1 protein_id gnl|my_center|LOCUS_06960 742413 743345 gene locus_tag LOCUS_06970 742413 743345 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014292.1 protein_id gnl|my_center|LOCUS_06970 743415 744308 gene locus_tag LOCUS_06980 743415 744308 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014291.1 protein_id gnl|my_center|LOCUS_06980 744366 745310 gene locus_tag LOCUS_06990 744366 745310 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858824.1 protein_id gnl|my_center|LOCUS_06990 745314 746081 gene locus_tag LOCUS_07000 745314 746081 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858826.1 protein_id gnl|my_center|LOCUS_07000 747129 746650 gene locus_tag LOCUS_07010 gene coaD 747129 746650 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858828.1 protein_id gnl|my_center|LOCUS_07010 747715 747137 gene locus_tag LOCUS_07020 gene rsmD 747715 747137 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858829.1 protein_id gnl|my_center|LOCUS_07020 747933 747712 gene locus_tag LOCUS_07030 747933 747712 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858832.1 protein_id gnl|my_center|LOCUS_07030 750075 747961 gene locus_tag LOCUS_07040 750075 747961 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014290.1 protein_id gnl|my_center|LOCUS_07040 751696 750080 gene locus_tag LOCUS_07050 751696 750080 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858835.1 protein_id gnl|my_center|LOCUS_07050 752437 751751 gene locus_tag LOCUS_07060 752437 751751 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056911.1 protein_id gnl|my_center|LOCUS_07060 753411 752422 gene locus_tag LOCUS_07070 753411 752422 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858840.1 protein_id gnl|my_center|LOCUS_07070 753563 754441 gene locus_tag LOCUS_07080 753563 754441 CDS product DUF3515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014286.1 protein_id gnl|my_center|LOCUS_07080 755545 754448 gene locus_tag LOCUS_07090 755545 754448 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014285.1 protein_id gnl|my_center|LOCUS_07090 756563 755568 gene locus_tag LOCUS_07100 756563 755568 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858849.1 protein_id gnl|my_center|LOCUS_07100 756758 757768 gene locus_tag LOCUS_07110 756758 757768 CDS product bifunctional NUDIX hydrolase/histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858854.1 protein_id gnl|my_center|LOCUS_07110 758437 757847 gene locus_tag LOCUS_07120 gene leuD 758437 757847 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014282.1 protein_id gnl|my_center|LOCUS_07120 759903 758449 gene locus_tag LOCUS_07130 gene leuC 759903 758449 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014281.1 protein_id gnl|my_center|LOCUS_07130 759945 760706 gene locus_tag LOCUS_07140 759945 760706 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014280.1 protein_id gnl|my_center|LOCUS_07140 761274 760717 gene locus_tag LOCUS_07150 761274 760717 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014279.1 protein_id gnl|my_center|LOCUS_07150 761355 762347 gene locus_tag LOCUS_07160 gene bioB 761355 762347 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_07160 762391 762780 gene locus_tag LOCUS_07170 762391 762780 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380304.1 protein_id gnl|my_center|LOCUS_07170 765498 762790 gene locus_tag LOCUS_07180 gene ppc 765498 762790 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014465.1 protein_id gnl|my_center|LOCUS_07180 765748 765675 gene locus_tag LOCUS_t00160 765748 765675 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 766017 765883 gene locus_tag LOCUS_07190 766017 765883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 766353 766072 gene locus_tag LOCUS_07200 766353 766072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 767060 766440 gene locus_tag LOCUS_07210 767060 766440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 767433 767071 gene locus_tag LOCUS_07220 767433 767071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 767900 767328 gene locus_tag LOCUS_07230 767900 767328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 768761 768066 gene locus_tag LOCUS_07240 768761 768066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07240 769329 768919 gene locus_tag LOCUS_07250 769329 768919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 769670 769455 gene locus_tag LOCUS_07260 769670 769455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 769765 769692 gene locus_tag LOCUS_t00170 769765 769692 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 769870 769798 gene locus_tag LOCUS_t00180 769870 769798 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 771012 769972 gene locus_tag LOCUS_07270 771012 769972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 772661 771168 gene locus_tag LOCUS_07280 gene gltX 772661 771168 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020447895.1 protein_id gnl|my_center|LOCUS_07280 772691 773824 gene locus_tag LOCUS_07290 772691 773824 CDS product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014263.1 protein_id gnl|my_center|LOCUS_07290 774215 773805 gene locus_tag LOCUS_07300 774215 773805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 775268 774471 gene locus_tag LOCUS_07310 775268 774471 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861462.1 protein_id gnl|my_center|LOCUS_07310 775506 775342 gene locus_tag LOCUS_07320 775506 775342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 775675 775487 gene locus_tag LOCUS_07330 775675 775487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 775921 775721 gene locus_tag LOCUS_07340 775921 775721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 776607 776230 gene locus_tag LOCUS_07350 776607 776230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07350 777139 776900 gene locus_tag LOCUS_07360 777139 776900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 777418 777149 gene locus_tag LOCUS_07370 777418 777149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07370 778564 777545 gene locus_tag LOCUS_07380 778564 777545 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014258.1 protein_id gnl|my_center|LOCUS_07380 780301 778706 gene locus_tag LOCUS_07390 gene serA 780301 778706 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854094.1 protein_id gnl|my_center|LOCUS_07390 781894 780464 gene locus_tag LOCUS_07400 781894 780464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 783809 782001 gene locus_tag LOCUS_07410 783809 782001 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014255.1 protein_id gnl|my_center|LOCUS_07410 784713 783862 gene locus_tag LOCUS_07420 784713 783862 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014254.1 protein_id gnl|my_center|LOCUS_07420 785948 784935 gene locus_tag LOCUS_07430 gene ilvC 785948 784935 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854117.1 protein_id gnl|my_center|LOCUS_07430 786592 786068 gene locus_tag LOCUS_07440 gene ilvN 786592 786068 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286979.1 protein_id gnl|my_center|LOCUS_07440 788518 786608 gene locus_tag LOCUS_07450 788518 786608 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014246.1 protein_id gnl|my_center|LOCUS_07450 788953 789438 gene locus_tag LOCUS_07460 788953 789438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 789727 791568 gene locus_tag LOCUS_07470 gene ilvD 789727 791568 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854128.1 protein_id gnl|my_center|LOCUS_07470 792772 791645 gene locus_tag LOCUS_07480 792772 791645 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014243.1 protein_id gnl|my_center|LOCUS_07480 793538 792852 gene locus_tag LOCUS_07490 793538 792852 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854724.1 protein_id gnl|my_center|LOCUS_07490 793703 794758 gene locus_tag LOCUS_07500 793703 794758 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014241.1 protein_id gnl|my_center|LOCUS_07500 795650 794769 gene locus_tag LOCUS_07510 795650 794769 CDS product ArgP/LysG family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014240.1 protein_id gnl|my_center|LOCUS_07510 795721 796407 gene locus_tag LOCUS_07520 gene lysE 795721 796407 CDS product L-lysine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854734.1 protein_id gnl|my_center|LOCUS_07520 797533 796436 gene locus_tag LOCUS_07530 gene mgrA 797533 796436 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014239.1 protein_id gnl|my_center|LOCUS_07530 799144 797639 gene locus_tag LOCUS_07540 gene gatB 799144 797639 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854737.1 protein_id gnl|my_center|LOCUS_07540 800280 799252 gene locus_tag LOCUS_07550 800280 799252 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854754.1 protein_id gnl|my_center|LOCUS_07550 800914 800480 gene locus_tag LOCUS_07560 800914 800480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 802359 801295 gene locus_tag LOCUS_07570 802359 801295 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705828.1 protein_id gnl|my_center|LOCUS_07570 803168 802371 gene locus_tag LOCUS_07580 803168 802371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097242.1 protein_id gnl|my_center|LOCUS_07580 804208 803168 gene locus_tag LOCUS_07590 804208 803168 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031517.1 protein_id gnl|my_center|LOCUS_07590 804620 804943 gene locus_tag LOCUS_07600 804620 804943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803871.1 protein_id gnl|my_center|LOCUS_07600 806417 805002 gene locus_tag LOCUS_07610 806417 805002 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854772.1 protein_id gnl|my_center|LOCUS_07610 806481 806972 gene locus_tag LOCUS_07620 806481 806972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 808558 807074 gene locus_tag LOCUS_07630 gene gatA 808558 807074 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014228.1 protein_id gnl|my_center|LOCUS_07630 808857 808558 gene locus_tag LOCUS_07640 gene gatC 808857 808558 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854761.1 protein_id gnl|my_center|LOCUS_07640 809057 808869 gene locus_tag LOCUS_07650 809057 808869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 809107 809769 gene locus_tag LOCUS_07660 809107 809769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861389.1 protein_id gnl|my_center|LOCUS_07660 811865 809832 gene locus_tag LOCUS_07670 gene ligA 811865 809832 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014227.1 protein_id gnl|my_center|LOCUS_07670 811962 812666 gene locus_tag LOCUS_07680 811962 812666 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861387.1 protein_id gnl|my_center|LOCUS_07680 813777 812710 gene locus_tag LOCUS_07690 813777 812710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014226.1 protein_id gnl|my_center|LOCUS_07690 814906 813806 gene locus_tag LOCUS_07700 gene mnmA 814906 813806 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861382.1 protein_id gnl|my_center|LOCUS_07700 815063 815911 gene locus_tag LOCUS_07710 815063 815911 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014223.1 protein_id gnl|my_center|LOCUS_07710 817044 815908 gene locus_tag LOCUS_07720 817044 815908 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014220.1 protein_id gnl|my_center|LOCUS_07720 818457 817504 gene locus_tag LOCUS_07730 818457 817504 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014219.1 protein_id gnl|my_center|LOCUS_07730 819278 818475 gene locus_tag LOCUS_07740 819278 818475 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014218.1 protein_id gnl|my_center|LOCUS_07740 820629 819445 gene locus_tag LOCUS_07750 820629 819445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014217.1 protein_id gnl|my_center|LOCUS_07750 821481 820672 gene locus_tag LOCUS_07760 821481 820672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854804.1 protein_id gnl|my_center|LOCUS_07760 822408 821560 gene locus_tag LOCUS_07770 822408 821560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014216.1 protein_id gnl|my_center|LOCUS_07770 822524 824560 gene locus_tag LOCUS_07780 822524 824560 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014215.1 protein_id gnl|my_center|LOCUS_07780 824615 826813 gene locus_tag LOCUS_07790 gene glgB 824615 826813 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014214.1 protein_id gnl|my_center|LOCUS_07790 828114 827218 gene locus_tag LOCUS_07800 828114 827218 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014209.1 protein_id gnl|my_center|LOCUS_07800 828267 828650 gene locus_tag LOCUS_07810 828267 828650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 829790 828747 gene locus_tag LOCUS_07820 829790 828747 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015613.1 protein_id gnl|my_center|LOCUS_07820 829910 830845 gene locus_tag LOCUS_07830 gene fepD 829910 830845 CDS product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817185.1 protein_id gnl|my_center|LOCUS_07830 830847 831806 gene locus_tag LOCUS_07840 gene fepG 830847 831806 CDS product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817186.1 protein_id gnl|my_center|LOCUS_07840 831803 832624 gene locus_tag LOCUS_07850 831803 832624 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013698.1 protein_id gnl|my_center|LOCUS_07850 832953 832627 gene locus_tag LOCUS_07860 832953 832627 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854825.1 protein_id gnl|my_center|LOCUS_07860 833021 833488 gene locus_tag LOCUS_07870 gene mce 833021 833488 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014207.1 protein_id gnl|my_center|LOCUS_07870 834568 833879 gene locus_tag LOCUS_07880 gene nucS 834568 833879 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014205.1 protein_id gnl|my_center|LOCUS_07880 835060 834593 gene locus_tag LOCUS_07890 835060 834593 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854831.1 protein_id gnl|my_center|LOCUS_07890 835658 835287 gene locus_tag LOCUS_07900 835658 835287 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861337.1 protein_id gnl|my_center|LOCUS_07900 837117 835672 gene locus_tag LOCUS_07910 gene atpD 837117 835672 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014204.1 protein_id gnl|my_center|LOCUS_07910 838098 837121 gene locus_tag LOCUS_07920 838098 837121 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014203.1 protein_id gnl|my_center|LOCUS_07920 839780 838152 gene locus_tag LOCUS_07930 gene atpA 839780 838152 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014202.1 protein_id gnl|my_center|LOCUS_07930 840662 839841 gene locus_tag LOCUS_07940 840662 839841 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854845.1 protein_id gnl|my_center|LOCUS_07940 841234 840668 gene locus_tag LOCUS_07950 841234 840668 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014201.1 protein_id gnl|my_center|LOCUS_07950 841501 841262 gene locus_tag LOCUS_07960 841501 841262 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854855.1 protein_id gnl|my_center|LOCUS_07960 842372 841587 gene locus_tag LOCUS_07970 gene atpB 842372 841587 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854856.1 protein_id gnl|my_center|LOCUS_07970 843301 842858 gene locus_tag LOCUS_07980 843301 842858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854858.1 protein_id gnl|my_center|LOCUS_07980 844488 843319 gene locus_tag LOCUS_07990 844488 843319 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014199.1 protein_id gnl|my_center|LOCUS_07990 845139 844489 gene locus_tag LOCUS_08000 845139 844489 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861324.1 protein_id gnl|my_center|LOCUS_08000 846065 845247 gene locus_tag LOCUS_08010 gene prmC 846065 845247 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014198.1 protein_id gnl|my_center|LOCUS_08010 847140 846070 gene locus_tag LOCUS_08020 gene prfA 847140 846070 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854866.1 protein_id gnl|my_center|LOCUS_08020 849203 847140 gene locus_tag LOCUS_08030 gene rho 849203 847140 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014197.1 protein_id gnl|my_center|LOCUS_08030 849475 849254 gene locus_tag LOCUS_08040 849475 849254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 849553 851304 gene locus_tag LOCUS_08050 849553 851304 CDS product long-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854869.1 protein_id gnl|my_center|LOCUS_08050 852292 851366 gene locus_tag LOCUS_08060 gene thrB 852292 851366 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014183.1 protein_id gnl|my_center|LOCUS_08060 853643 852297 gene locus_tag LOCUS_08070 853643 852297 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854900.1 protein_id gnl|my_center|LOCUS_08070 855177 853849 gene locus_tag LOCUS_08080 gene lysA 855177 853849 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014180.1 protein_id gnl|my_center|LOCUS_08080 856832 855180 gene locus_tag LOCUS_08090 gene argS 856832 855180 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014179.1 protein_id gnl|my_center|LOCUS_08090 858502 856844 gene locus_tag LOCUS_08100 858502 856844 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223995.1 protein_id gnl|my_center|LOCUS_08100 858940 859725 gene locus_tag LOCUS_08110 858940 859725 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 protein_id gnl|my_center|LOCUS_08110 859749 861266 gene locus_tag LOCUS_08120 859749 861266 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 protein_id gnl|my_center|LOCUS_08120 861268 861897 gene locus_tag LOCUS_08130 861268 861897 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_08130 862016 862089 gene locus_tag LOCUS_t00190 862016 862089 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 862259 862831 gene locus_tag LOCUS_08140 862259 862831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08140 862794 863603 gene locus_tag LOCUS_08150 862794 863603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08150 865040 864438 gene locus_tag LOCUS_08160 865040 864438 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053546291.1 protein_id gnl|my_center|LOCUS_08160 865396 865037 gene locus_tag LOCUS_08170 865396 865037 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 protein_id gnl|my_center|LOCUS_08170 865609 865424 gene locus_tag LOCUS_08180 865609 865424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 865840 866031 gene locus_tag LOCUS_08190 865840 866031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 866528 866328 gene locus_tag LOCUS_08200 866528 866328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 867044 866634 gene locus_tag LOCUS_08210 gene rosR 867044 866634 CDS product MarR family transcriptional regulator RosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861276.1 protein_id gnl|my_center|LOCUS_08210 867358 867888 gene locus_tag LOCUS_08220 867358 867888 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854913.1 protein_id gnl|my_center|LOCUS_08220 870529 867965 gene locus_tag LOCUS_08230 870529 867965 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014170.1 protein_id gnl|my_center|LOCUS_08230 871650 870529 gene locus_tag LOCUS_08240 871650 870529 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014169.1 protein_id gnl|my_center|LOCUS_08240 872503 871682 gene locus_tag LOCUS_08250 872503 871682 CDS product 2-oxo acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854920.1 protein_id gnl|my_center|LOCUS_08250 875593 872504 gene locus_tag LOCUS_08260 875593 872504 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014168.1 protein_id gnl|my_center|LOCUS_08260 875819 877384 gene locus_tag LOCUS_08270 gene putP 875819 877384 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014167.1 protein_id gnl|my_center|LOCUS_08270 877424 878014 gene locus_tag LOCUS_08280 877424 878014 CDS product HNH endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014166.1 protein_id gnl|my_center|LOCUS_08280 878063 878539 gene locus_tag LOCUS_08290 878063 878539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014165.1 protein_id gnl|my_center|LOCUS_08290 879078 878668 gene locus_tag LOCUS_08300 879078 878668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 881215 879167 gene locus_tag LOCUS_08310 881215 879167 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014161.1 protein_id gnl|my_center|LOCUS_08310 881428 881823 gene locus_tag LOCUS_08320 881428 881823 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 protein_id gnl|my_center|LOCUS_08320 881834 884965 gene locus_tag LOCUS_08330 881834 884965 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742338.1 protein_id gnl|my_center|LOCUS_08330 886248 885019 gene locus_tag LOCUS_08340 gene galK 886248 885019 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138635.1 protein_id gnl|my_center|LOCUS_08340 887362 886232 gene locus_tag LOCUS_08350 gene galT 887362 886232 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 protein_id gnl|my_center|LOCUS_08350 887643 887362 gene locus_tag LOCUS_08360 887643 887362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 889314 887656 gene locus_tag LOCUS_08370 889314 887656 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804055.1 protein_id gnl|my_center|LOCUS_08370 890268 889351 gene locus_tag LOCUS_08380 890268 889351 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_08380 890573 891115 gene locus_tag LOCUS_08390 890573 891115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014145.1 protein_id gnl|my_center|LOCUS_08390 891936 891124 gene locus_tag LOCUS_08400 891936 891124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014144.1 protein_id gnl|my_center|LOCUS_08400 892795 891986 gene locus_tag LOCUS_08410 892795 891986 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014143.1 protein_id gnl|my_center|LOCUS_08410 894418 892814 gene locus_tag LOCUS_08420 894418 892814 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854963.1 protein_id gnl|my_center|LOCUS_08420 894522 895229 gene locus_tag LOCUS_08430 894522 895229 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014141.1 protein_id gnl|my_center|LOCUS_08430 895429 895839 gene locus_tag LOCUS_08440 895429 895839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 895951 896781 gene locus_tag LOCUS_08450 895951 896781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014140.1 protein_id gnl|my_center|LOCUS_08450 896789 900529 gene locus_tag LOCUS_08460 896789 900529 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014139.1 protein_id gnl|my_center|LOCUS_08460 900692 904405 gene locus_tag LOCUS_08470 900692 904405 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014138.1 protein_id gnl|my_center|LOCUS_08470 905180 904461 gene locus_tag LOCUS_08480 905180 904461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014136.1 protein_id gnl|my_center|LOCUS_08480 905701 905192 gene locus_tag LOCUS_08490 905701 905192 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014135.1 protein_id gnl|my_center|LOCUS_08490 905836 907116 gene locus_tag LOCUS_08500 905836 907116 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854992.1 protein_id gnl|my_center|LOCUS_08500 907120 907716 gene locus_tag LOCUS_08510 907120 907716 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854995.1 protein_id gnl|my_center|LOCUS_08510 907729 908862 gene locus_tag LOCUS_08520 907729 908862 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854996.1 protein_id gnl|my_center|LOCUS_08520 909308 908865 gene locus_tag LOCUS_08530 gene tatB 909308 908865 CDS product Sec-independent protein translocase subunit TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854998.1 protein_id gnl|my_center|LOCUS_08530 909752 909339 gene locus_tag LOCUS_08540 909752 909339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 910443 909793 gene locus_tag LOCUS_08550 gene sigE 910443 909793 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855001.1 protein_id gnl|my_center|LOCUS_08550 910598 911275 gene locus_tag LOCUS_08560 910598 911275 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863800.1 protein_id gnl|my_center|LOCUS_08560 912767 911334 gene locus_tag LOCUS_08570 gene glgC 912767 911334 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855005.1 protein_id gnl|my_center|LOCUS_08570 912666 913826 gene locus_tag LOCUS_08580 gene glgA 912666 913826 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855006.1 protein_id gnl|my_center|LOCUS_08580 913879 914619 gene locus_tag LOCUS_08590 gene alsD 913879 914619 CDS product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215022.1 protein_id gnl|my_center|LOCUS_08590 914629 916041 gene locus_tag LOCUS_08600 914629 916041 CDS product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014131.1 protein_id gnl|my_center|LOCUS_08600 916968 916099 gene locus_tag LOCUS_08610 916968 916099 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014130.1 protein_id gnl|my_center|LOCUS_08610 917162 916995 gene locus_tag LOCUS_08620 917162 916995 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855015.1 protein_id gnl|my_center|LOCUS_08620 917527 917249 gene locus_tag LOCUS_08630 917527 917249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 918281 917532 gene locus_tag LOCUS_08640 918281 917532 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855018.1 protein_id gnl|my_center|LOCUS_08640 919135 918278 gene locus_tag LOCUS_08650 gene folP 919135 918278 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855021.1 protein_id gnl|my_center|LOCUS_08650 919892 919128 gene locus_tag LOCUS_08660 919892 919128 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863794.1 protein_id gnl|my_center|LOCUS_08660 920997 919900 gene locus_tag LOCUS_08670 gene dapE 920997 919900 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014127.1 protein_id gnl|my_center|LOCUS_08670 921077 921988 gene locus_tag LOCUS_08680 921077 921988 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014126.1 protein_id gnl|my_center|LOCUS_08680 922058 923422 gene locus_tag LOCUS_08690 gene aroP 922058 923422 CDS product aromatic amino acid transport protein AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014125.1 protein_id gnl|my_center|LOCUS_08690 923433 924407 gene locus_tag LOCUS_08700 gene dapD 923433 924407 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730317.1 protein_id gnl|my_center|LOCUS_08700 924471 925883 gene locus_tag LOCUS_08710 gene aroP 924471 925883 CDS product aromatic amino acid transport protein AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014125.1 protein_id gnl|my_center|LOCUS_08710 925973 927148 gene locus_tag LOCUS_08720 925973 927148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 927712 927155 gene locus_tag LOCUS_08730 927712 927155 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858634.1 protein_id gnl|my_center|LOCUS_08730 928563 927949 gene locus_tag LOCUS_08740 928563 927949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08740 929623 928523 gene locus_tag LOCUS_08750 gene dapC 929623 928523 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014123.1 protein_id gnl|my_center|LOCUS_08750 929970 929653 gene locus_tag LOCUS_08760 929970 929653 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858631.1 protein_id gnl|my_center|LOCUS_08760 930400 930020 gene locus_tag LOCUS_08770 930400 930020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858629.1 protein_id gnl|my_center|LOCUS_08770 931308 930427 gene locus_tag LOCUS_08780 gene mshB 931308 930427 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858626.1 protein_id gnl|my_center|LOCUS_08780 932684 931308 gene locus_tag LOCUS_08790 932684 931308 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066569582.1 protein_id gnl|my_center|LOCUS_08790 934758 932848 gene locus_tag LOCUS_08800 gene typA 934758 932848 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014121.1 protein_id gnl|my_center|LOCUS_08800 935115 935801 gene locus_tag LOCUS_08810 935115 935801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014120.1 protein_id gnl|my_center|LOCUS_08810 935805 936338 gene locus_tag LOCUS_08820 935805 936338 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858618.1 protein_id gnl|my_center|LOCUS_08820 936335 936679 gene locus_tag LOCUS_08830 gene arsC 936335 936679 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092775.1 protein_id gnl|my_center|LOCUS_08830 936680 937408 gene locus_tag LOCUS_08840 936680 937408 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014118.1 protein_id gnl|my_center|LOCUS_08840 940186 939110 gene locus_tag LOCUS_08850 940186 939110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 940954 940259 gene locus_tag LOCUS_08860 940954 940259 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116382.1 protein_id gnl|my_center|LOCUS_08860 941259 940957 gene locus_tag LOCUS_08870 941259 940957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 943368 941686 gene locus_tag LOCUS_08880 943368 941686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014807.1 protein_id gnl|my_center|LOCUS_08880 944324 943371 gene locus_tag LOCUS_08890 944324 943371 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284211.1 protein_id gnl|my_center|LOCUS_08890 945243 944317 gene locus_tag LOCUS_08900 945243 944317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857497.1 protein_id gnl|my_center|LOCUS_08900 946924 945335 gene locus_tag LOCUS_08910 946924 945335 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014806.1 protein_id gnl|my_center|LOCUS_08910 947644 947186 gene locus_tag LOCUS_08920 947644 947186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014106.1 protein_id gnl|my_center|LOCUS_08920 948396 947641 gene locus_tag LOCUS_08930 948396 947641 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014105.1 protein_id gnl|my_center|LOCUS_08930 949772 948393 gene locus_tag LOCUS_08940 949772 948393 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862124.1 protein_id gnl|my_center|LOCUS_08940 949916 951091 gene locus_tag LOCUS_08950 949916 951091 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200855.1 protein_id gnl|my_center|LOCUS_08950 951699 951106 gene locus_tag LOCUS_08960 951699 951106 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858584.1 protein_id gnl|my_center|LOCUS_08960 952734 951841 gene locus_tag LOCUS_08970 952734 951841 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014114.1 protein_id gnl|my_center|LOCUS_08970 952813 953727 gene locus_tag LOCUS_08980 952813 953727 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014113.1 protein_id gnl|my_center|LOCUS_08980 954889 953804 gene locus_tag LOCUS_08990 gene ychF 954889 953804 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014061.1 protein_id gnl|my_center|LOCUS_08990 955243 956892 gene locus_tag LOCUS_09000 955243 956892 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856850.1 protein_id gnl|my_center|LOCUS_09000 956892 957062 gene locus_tag LOCUS_09010 gene metS 956892 957062 CDS product methionine/alanine import NSS transporter subunit MetS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014058.1 protein_id gnl|my_center|LOCUS_09010 957152 958573 gene locus_tag LOCUS_09020 957152 958573 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014057.1 protein_id gnl|my_center|LOCUS_09020 958640 959431 gene locus_tag LOCUS_09030 958640 959431 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856844.1 protein_id gnl|my_center|LOCUS_09030 960496 959495 gene locus_tag LOCUS_09040 960496 959495 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568094.1 protein_id gnl|my_center|LOCUS_09040 960603 961844 gene locus_tag LOCUS_09050 gene xseA 960603 961844 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014055.1 protein_id gnl|my_center|LOCUS_09050 961873 962130 gene locus_tag LOCUS_09060 961873 962130 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856839.1 protein_id gnl|my_center|LOCUS_09060 962718 962140 gene locus_tag LOCUS_09070 962718 962140 CDS product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014052.1 protein_id gnl|my_center|LOCUS_09070 963022 964038 gene locus_tag LOCUS_09080 gene glpX 963022 964038 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856830.1 protein_id gnl|my_center|LOCUS_09080 964296 965699 gene locus_tag LOCUS_09090 964296 965699 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856814.1 protein_id gnl|my_center|LOCUS_09090 965928 966491 gene locus_tag LOCUS_09100 965928 966491 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013614.1 protein_id gnl|my_center|LOCUS_09100 966493 968058 gene locus_tag LOCUS_09110 966493 968058 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859734.1 protein_id gnl|my_center|LOCUS_09110 968629 968063 gene locus_tag LOCUS_09120 968629 968063 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014038.1 protein_id gnl|my_center|LOCUS_09120 969391 968711 gene locus_tag LOCUS_09130 969391 968711 CDS product LysR family transcriptional regulator substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014037.1 protein_id gnl|my_center|LOCUS_09130 969456 969800 gene locus_tag LOCUS_09140 969456 969800 CDS product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856795.1 protein_id gnl|my_center|LOCUS_09140 971160 969871 gene locus_tag LOCUS_09150 gene glyA 971160 969871 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856790.1 protein_id gnl|my_center|LOCUS_09150 971371 972297 gene locus_tag LOCUS_09160 gene coaA 971371 972297 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856789.1 protein_id gnl|my_center|LOCUS_09160 972794 972294 gene locus_tag LOCUS_09170 972794 972294 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014033.1 protein_id gnl|my_center|LOCUS_09170 973637 972840 gene locus_tag LOCUS_09180 973637 972840 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856785.1 protein_id gnl|my_center|LOCUS_09180 974003 973662 gene locus_tag LOCUS_09190 974003 973662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856779.1 protein_id gnl|my_center|LOCUS_09190 974945 974058 gene locus_tag LOCUS_09200 gene mca 974945 974058 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014030.1 protein_id gnl|my_center|LOCUS_09200 975247 975714 gene locus_tag LOCUS_09210 975247 975714 CDS product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856773.1 protein_id gnl|my_center|LOCUS_09210 975892 976413 gene locus_tag LOCUS_09220 gene greA 975892 976413 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014029.1 protein_id gnl|my_center|LOCUS_09220 976629 976832 gene locus_tag LOCUS_09230 976629 976832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 977732 976902 gene locus_tag LOCUS_09240 977732 976902 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014027.1 protein_id gnl|my_center|LOCUS_09240 978768 977863 gene locus_tag LOCUS_09250 978768 977863 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014026.1 protein_id gnl|my_center|LOCUS_09250 979512 979685 gene locus_tag LOCUS_09260 979512 979685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 979631 980740 gene locus_tag LOCUS_09270 979631 980740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09270 980737 980892 gene locus_tag LOCUS_09280 980737 980892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 981088 981012 gene locus_tag LOCUS_t00200 981088 981012 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 982125 981175 gene locus_tag LOCUS_09290 gene ppx2 982125 981175 CDS product exopolyphosphatase Ppx2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568167.1 protein_id gnl|my_center|LOCUS_09290 982688 982122 gene locus_tag LOCUS_09300 982688 982122 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014021.1 protein_id gnl|my_center|LOCUS_09300 983262 982729 gene locus_tag LOCUS_09310 983262 982729 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014020.1 protein_id gnl|my_center|LOCUS_09310 984660 983383 gene locus_tag LOCUS_09320 gene eno 984660 983383 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856756.1 protein_id gnl|my_center|LOCUS_09320 985565 984822 gene locus_tag LOCUS_09330 985565 984822 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014019.1 protein_id gnl|my_center|LOCUS_09330 986308 985610 gene locus_tag LOCUS_09340 986308 985610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 986407 987903 gene locus_tag LOCUS_09350 986407 987903 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014015.1 protein_id gnl|my_center|LOCUS_09350 988396 987914 gene locus_tag LOCUS_09360 988396 987914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 988824 988399 gene locus_tag LOCUS_09370 988824 988399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 992681 988881 gene locus_tag LOCUS_09380 gene mfd 992681 988881 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856733.1 protein_id gnl|my_center|LOCUS_09380 993372 992725 gene locus_tag LOCUS_09390 993372 992725 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014009.1 protein_id gnl|my_center|LOCUS_09390 993542 993470 gene locus_tag LOCUS_t00210 993542 993470 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 995432 993645 gene locus_tag LOCUS_09400 995432 993645 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014424.1 protein_id gnl|my_center|LOCUS_09400 996815 995433 gene locus_tag LOCUS_09410 996815 995433 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066565740.1 protein_id gnl|my_center|LOCUS_09410 997998 997069 gene locus_tag LOCUS_09420 997998 997069 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859319.1 protein_id gnl|my_center|LOCUS_09420 999099 998023 gene locus_tag LOCUS_09430 999099 998023 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066568686.1 protein_id gnl|my_center|LOCUS_09430 999187 1000083 gene locus_tag LOCUS_09440 999187 1000083 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013318.1 protein_id gnl|my_center|LOCUS_09440 1000169 1001623 gene locus_tag LOCUS_09450 gene glmU 1000169 1001623 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013993.1 protein_id gnl|my_center|LOCUS_09450 1001632 1002612 gene locus_tag LOCUS_09460 1001632 1002612 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860060.1 protein_id gnl|my_center|LOCUS_09460 1002736 1004550 gene locus_tag LOCUS_09470 1002736 1004550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1004772 1005389 gene locus_tag LOCUS_09480 1004772 1005389 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013990.1 protein_id gnl|my_center|LOCUS_09480 1005562 1006002 gene locus_tag LOCUS_09490 gene pth 1005562 1006002 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265655.1 protein_id gnl|my_center|LOCUS_09490 1007339 1006176 gene locus_tag LOCUS_09500 1007339 1006176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1007533 1008162 gene locus_tag LOCUS_09510 gene pth 1007533 1008162 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013986.1 protein_id gnl|my_center|LOCUS_09510 1008194 1009003 gene locus_tag LOCUS_09520 1008194 1009003 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479910.1 protein_id gnl|my_center|LOCUS_09520 1009015 1010649 gene locus_tag LOCUS_09530 1009015 1010649 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013982.1 protein_id gnl|my_center|LOCUS_09530 1011547 1010894 gene locus_tag LOCUS_09540 1011547 1010894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013979.1 protein_id gnl|my_center|LOCUS_09540 1011811 1013241 gene locus_tag LOCUS_09550 1011811 1013241 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013988.1 protein_id gnl|my_center|LOCUS_09550 1014242 1014841 gene locus_tag LOCUS_09560 1014242 1014841 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013976.1 protein_id gnl|my_center|LOCUS_09560 1014877 1016136 gene locus_tag LOCUS_09570 1014877 1016136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013974.1 protein_id gnl|my_center|LOCUS_09570 1017185 1016133 gene locus_tag LOCUS_09580 1017185 1016133 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013973.1 protein_id gnl|my_center|LOCUS_09580 1017285 1018085 gene locus_tag LOCUS_09590 1017285 1018085 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858506.1 protein_id gnl|my_center|LOCUS_09590 1018105 1018818 gene locus_tag LOCUS_09600 gene pnuC 1018105 1018818 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013360.1 protein_id gnl|my_center|LOCUS_09600 1019818 1018895 gene locus_tag LOCUS_09610 gene ppk2 1019818 1018895 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013972.1 protein_id gnl|my_center|LOCUS_09610 1021010 1019835 gene locus_tag LOCUS_09620 1021010 1019835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 1021558 1021019 gene locus_tag LOCUS_09630 1021558 1021019 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230397.1 protein_id gnl|my_center|LOCUS_09630 1021972 1021583 gene locus_tag LOCUS_09640 1021972 1021583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 1022410 1022078 gene locus_tag LOCUS_09650 1022410 1022078 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948541.1 protein_id gnl|my_center|LOCUS_09650 1024228 1022420 gene locus_tag LOCUS_09660 1024228 1022420 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013968.1 protein_id gnl|my_center|LOCUS_09660 1025163 1024228 gene locus_tag LOCUS_09670 1025163 1024228 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013967.1 protein_id gnl|my_center|LOCUS_09670 1026047 1025160 gene locus_tag LOCUS_09680 gene rsmA 1026047 1025160 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013966.1 protein_id gnl|my_center|LOCUS_09680 1027256 1026099 gene locus_tag LOCUS_09690 1027256 1026099 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858490.1 protein_id gnl|my_center|LOCUS_09690 1028255 1027401 gene locus_tag LOCUS_09700 1028255 1027401 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013965.1 protein_id gnl|my_center|LOCUS_09700 1030109 1028277 gene locus_tag LOCUS_09710 gene metG 1030109 1028277 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013952.1 protein_id gnl|my_center|LOCUS_09710 1031008 1030133 gene locus_tag LOCUS_09720 gene rsmI 1031008 1030133 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858478.1 protein_id gnl|my_center|LOCUS_09720 1032581 1031118 gene locus_tag LOCUS_09730 1032581 1031118 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 protein_id gnl|my_center|LOCUS_09730 1034573 1032660 gene locus_tag LOCUS_09740 gene betP 1034573 1032660 CDS product glycine betaine transporter BetP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265645.1 protein_id gnl|my_center|LOCUS_09740 1035207 1036649 gene locus_tag LOCUS_09750 1035207 1036649 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013949.1 protein_id gnl|my_center|LOCUS_09750 1037335 1036658 gene locus_tag LOCUS_09760 1037335 1036658 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858471.1 protein_id gnl|my_center|LOCUS_09760 1037720 1037307 gene locus_tag LOCUS_09770 1037720 1037307 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013947.1 protein_id gnl|my_center|LOCUS_09770 1038980 1037763 gene locus_tag LOCUS_09780 1038980 1037763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858464.1 protein_id gnl|my_center|LOCUS_09780 1040989 1039724 gene locus_tag LOCUS_09790 1040989 1039724 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858461.1 protein_id gnl|my_center|LOCUS_09790 1041964 1041086 gene locus_tag LOCUS_09800 1041964 1041086 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858460.1 protein_id gnl|my_center|LOCUS_09800 1042129 1042719 gene locus_tag LOCUS_09810 1042129 1042719 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092258658.1 protein_id gnl|my_center|LOCUS_09810 1042735 1043418 gene locus_tag LOCUS_09820 1042735 1043418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1043525 1043929 gene locus_tag LOCUS_09830 gene mscL 1043525 1043929 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013943.1 protein_id gnl|my_center|LOCUS_09830 1044200 1044015 gene locus_tag LOCUS_09840 1044200 1044015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1044817 1044230 gene locus_tag LOCUS_09850 1044817 1044230 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858456.1 protein_id gnl|my_center|LOCUS_09850 1046142 1044856 gene locus_tag LOCUS_09860 1046142 1044856 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013942.1 protein_id gnl|my_center|LOCUS_09860 1047776 1046232 gene locus_tag LOCUS_09870 1047776 1046232 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013941.1 protein_id gnl|my_center|LOCUS_09870 1048465 1047773 gene locus_tag LOCUS_09880 1048465 1047773 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013940.1 protein_id gnl|my_center|LOCUS_09880 1048867 1048694 gene locus_tag LOCUS_09890 gene rpmF 1048867 1048694 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858448.1 protein_id gnl|my_center|LOCUS_09890 1049152 1048886 gene locus_tag LOCUS_09900 1049152 1048886 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 protein_id gnl|my_center|LOCUS_09900 1049622 1049858 gene locus_tag LOCUS_09910 gene rpmB 1049622 1049858 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858441.1 protein_id gnl|my_center|LOCUS_09910 1049862 1050026 gene locus_tag LOCUS_09920 gene rpmG 1049862 1050026 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858439.1 protein_id gnl|my_center|LOCUS_09920 1050030 1050335 gene locus_tag LOCUS_09930 gene rpsN 1050030 1050335 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013938.1 protein_id gnl|my_center|LOCUS_09930 1050350 1050598 gene locus_tag LOCUS_09940 gene rpsR 1050350 1050598 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858407.1 protein_id gnl|my_center|LOCUS_09940 1050686 1051705 gene locus_tag LOCUS_09950 1050686 1051705 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862417.1 protein_id gnl|my_center|LOCUS_09950 1051830 1052498 gene locus_tag LOCUS_09960 gene amtR 1051830 1052498 CDS product TetR/AcrR family transcriptional regulator AmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013937.1 protein_id gnl|my_center|LOCUS_09960 1053328 1052495 gene locus_tag LOCUS_09970 1053328 1052495 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013936.1 protein_id gnl|my_center|LOCUS_09970 1053837 1053376 gene locus_tag LOCUS_09980 1053837 1053376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1054268 1053792 gene locus_tag LOCUS_09990 1054268 1053792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1054568 1054353 gene locus_tag LOCUS_10000 1054568 1054353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1056751 1055174 gene locus_tag LOCUS_10010 gene purH 1056751 1055174 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013935.1 protein_id gnl|my_center|LOCUS_10010 1057364 1056741 gene locus_tag LOCUS_10020 gene purN 1057364 1056741 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858391.1 protein_id gnl|my_center|LOCUS_10020 1058655 1057390 gene locus_tag LOCUS_10030 1058655 1057390 CDS product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066565006.1 protein_id gnl|my_center|LOCUS_10030 1059250 1059966 gene locus_tag LOCUS_10040 1059250 1059966 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013932.1 protein_id gnl|my_center|LOCUS_10040 1062528 1060042 gene locus_tag LOCUS_10050 gene pcrA 1062528 1060042 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013929.1 protein_id gnl|my_center|LOCUS_10050 1062627 1062941 gene locus_tag LOCUS_10060 1062627 1062941 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858377.1 protein_id gnl|my_center|LOCUS_10060 1064422 1062938 gene locus_tag LOCUS_10070 1064422 1062938 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730606.1 protein_id gnl|my_center|LOCUS_10070 1064625 1066268 gene locus_tag LOCUS_10080 gene pgi 1064625 1066268 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013928.1 protein_id gnl|my_center|LOCUS_10080 1066766 1066353 gene locus_tag LOCUS_10090 1066766 1066353 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858364.1 protein_id gnl|my_center|LOCUS_10090 1066851 1068506 gene locus_tag LOCUS_10100 1066851 1068506 CDS product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859640.1 protein_id gnl|my_center|LOCUS_10100 1069136 1068489 gene locus_tag LOCUS_10110 1069136 1068489 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862398.1 protein_id gnl|my_center|LOCUS_10110 1069348 1069977 gene locus_tag LOCUS_10120 1069348 1069977 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929986.1 protein_id gnl|my_center|LOCUS_10120 1074788 1069974 gene locus_tag LOCUS_10130 1074788 1069974 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013925.1 protein_id gnl|my_center|LOCUS_10130 1074827 1075585 gene locus_tag LOCUS_10140 1074827 1075585 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862394.1 protein_id gnl|my_center|LOCUS_10140 1075652 1076491 gene locus_tag LOCUS_10150 1075652 1076491 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862391.1 protein_id gnl|my_center|LOCUS_10150 1076491 1076994 gene locus_tag LOCUS_10160 1076491 1076994 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013924.1 protein_id gnl|my_center|LOCUS_10160 1077015 1077272 gene locus_tag LOCUS_10170 1077015 1077272 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013923.1 protein_id gnl|my_center|LOCUS_10170 1078043 1077291 gene locus_tag LOCUS_10180 gene cobF 1078043 1077291 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109722.1 protein_id gnl|my_center|LOCUS_10180 1078325 1078050 gene locus_tag LOCUS_10190 1078325 1078050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862386.1 protein_id gnl|my_center|LOCUS_10190 1078519 1078592 gene locus_tag LOCUS_t00220 1078519 1078592 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1078933 1078736 gene locus_tag LOCUS_10200 1078933 1078736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1079272 1078997 gene locus_tag LOCUS_10210 1079272 1078997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1079605 1080171 gene locus_tag LOCUS_10220 1079605 1080171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1080763 1080551 gene locus_tag LOCUS_10230 1080763 1080551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1080895 1082094 gene locus_tag LOCUS_10240 1080895 1082094 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803746.1 protein_id gnl|my_center|LOCUS_10240 1082223 1083131 gene locus_tag LOCUS_10250 1082223 1083131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1083897 1083124 gene locus_tag LOCUS_10260 1083897 1083124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1085755 1084103 gene locus_tag LOCUS_10270 1085755 1084103 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013917.1 protein_id gnl|my_center|LOCUS_10270 1086100 1085759 gene locus_tag LOCUS_10280 1086100 1085759 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013916.1 protein_id gnl|my_center|LOCUS_10280 1087225 1086449 gene locus_tag LOCUS_10290 1087225 1086449 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063562.1 protein_id gnl|my_center|LOCUS_10290 1088097 1087225 gene locus_tag LOCUS_10300 1088097 1087225 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 protein_id gnl|my_center|LOCUS_10300 1088190 1089695 gene locus_tag LOCUS_10310 1088190 1089695 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013915.1 protein_id gnl|my_center|LOCUS_10310 1090143 1089784 gene locus_tag LOCUS_10320 gene fkpA 1090143 1089784 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase FkpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858324.1 protein_id gnl|my_center|LOCUS_10320 1091608 1090310 gene locus_tag LOCUS_10330 1091608 1090310 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013914.1 protein_id gnl|my_center|LOCUS_10330 1091909 1091700 gene locus_tag LOCUS_10340 1091909 1091700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1092290 1093420 gene locus_tag LOCUS_10350 gene serC 1092290 1093420 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013913.1 protein_id gnl|my_center|LOCUS_10350 1093622 1094671 gene locus_tag LOCUS_10360 gene sepH 1093622 1094671 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013912.1 protein_id gnl|my_center|LOCUS_10360 1094692 1095588 gene locus_tag LOCUS_10370 1094692 1095588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858320.1 protein_id gnl|my_center|LOCUS_10370 1096481 1095585 gene locus_tag LOCUS_10380 1096481 1095585 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862361.1 protein_id gnl|my_center|LOCUS_10380 1098047 1096560 gene locus_tag LOCUS_10390 1098047 1096560 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265630.1 protein_id gnl|my_center|LOCUS_10390 1098923 1098222 gene locus_tag LOCUS_10400 1098923 1098222 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104387.1 protein_id gnl|my_center|LOCUS_10400 1099047 1099892 gene locus_tag LOCUS_10410 1099047 1099892 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858314.1 protein_id gnl|my_center|LOCUS_10410 1099879 1100403 gene locus_tag LOCUS_10420 1099879 1100403 CDS product DUF2771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858312.1 protein_id gnl|my_center|LOCUS_10420 1100899 1100510 gene locus_tag LOCUS_10430 1100899 1100510 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858310.1 protein_id gnl|my_center|LOCUS_10430 1101580 1102203 gene locus_tag LOCUS_10440 1101580 1102203 CDS product DUF3235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862355.1 protein_id gnl|my_center|LOCUS_10440 1102567 1102388 gene locus_tag LOCUS_10450 1102567 1102388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858306.1 protein_id gnl|my_center|LOCUS_10450 1102826 1104961 gene locus_tag LOCUS_10460 1102826 1104961 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013909.1 protein_id gnl|my_center|LOCUS_10460 1105007 1106671 gene locus_tag LOCUS_10470 1105007 1106671 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858302.1 protein_id gnl|my_center|LOCUS_10470 1106676 1107323 gene locus_tag LOCUS_10480 1106676 1107323 CDS product DUF3239 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013908.1 protein_id gnl|my_center|LOCUS_10480 1107328 1108065 gene locus_tag LOCUS_10490 1107328 1108065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1108122 1108391 gene locus_tag LOCUS_10500 1108122 1108391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1108628 1108873 gene locus_tag LOCUS_10510 1108628 1108873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1109399 1110607 gene locus_tag LOCUS_10520 1109399 1110607 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014066.1 protein_id gnl|my_center|LOCUS_10520 1111007 1110895 gene locus_tag LOCUS_r00040 1111007 1110895 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1114233 1111172 gene locus_tag LOCUS_r00050 1114233 1111172 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1116123 1114607 gene locus_tag LOCUS_r00060 1116123 1114607 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1116708 1116887 gene locus_tag LOCUS_10530 1116708 1116887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1117514 1117092 gene locus_tag LOCUS_10540 1117514 1117092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10540 1118270 1117971 gene locus_tag LOCUS_10550 1118270 1117971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10550 1118900 1118535 gene locus_tag LOCUS_10560 1118900 1118535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1119515 1118901 gene locus_tag LOCUS_10570 1119515 1118901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10570 1119818 1120621 gene locus_tag LOCUS_10580 1119818 1120621 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730463.1 protein_id gnl|my_center|LOCUS_10580 1120655 1120996 gene locus_tag LOCUS_10590 1120655 1120996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1121737 1121355 gene locus_tag LOCUS_tm00010 1121737 1121355 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1122319 1121828 gene locus_tag LOCUS_10600 gene smpB 1122319 1121828 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858084.1 protein_id gnl|my_center|LOCUS_10600 1123328 1122426 gene locus_tag LOCUS_10610 gene ftsX 1123328 1122426 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858086.1 protein_id gnl|my_center|LOCUS_10610 1124034 1123345 gene locus_tag LOCUS_10620 gene ftsE 1124034 1123345 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858089.1 protein_id gnl|my_center|LOCUS_10620 1124366 1125811 gene locus_tag LOCUS_10630 1124366 1125811 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_10630 1126917 1125808 gene locus_tag LOCUS_10640 gene prfB 1126917 1125808 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863507.1 protein_id gnl|my_center|LOCUS_10640 1127040 1127912 gene locus_tag LOCUS_10650 1127040 1127912 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013899.1 protein_id gnl|my_center|LOCUS_10650 1127968 1128756 gene locus_tag LOCUS_10660 gene hisN 1127968 1128756 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013898.1 protein_id gnl|my_center|LOCUS_10660 1129866 1128775 gene locus_tag LOCUS_10670 1129866 1128775 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096454783.1 protein_id gnl|my_center|LOCUS_10670 1130436 1130068 gene locus_tag LOCUS_10680 1130436 1130068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1130724 1130461 gene locus_tag LOCUS_10690 1130724 1130461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1132294 1130738 gene locus_tag LOCUS_10700 1132294 1130738 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_10700 1133767 1132307 gene locus_tag LOCUS_10710 gene oadA 1133767 1132307 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_10710 1134418 1135374 gene locus_tag LOCUS_10720 1134418 1135374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1135377 1136387 gene locus_tag LOCUS_10730 1135377 1136387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1136723 1137055 gene locus_tag LOCUS_10740 1136723 1137055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10740 1137091 1137552 gene locus_tag LOCUS_10750 1137091 1137552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10750 1137601 1137795 gene locus_tag LOCUS_10760 1137601 1137795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10760 1138178 1138104 gene locus_tag LOCUS_t00230 1138178 1138104 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1141280 1138317 gene locus_tag LOCUS_10770 1141280 1138317 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013886.1 protein_id gnl|my_center|LOCUS_10770 1141453 1141956 gene locus_tag LOCUS_10780 1141453 1141956 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858126.1 protein_id gnl|my_center|LOCUS_10780 1142296 1141991 gene locus_tag LOCUS_10790 1142296 1141991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1142277 1142705 gene locus_tag LOCUS_10800 1142277 1142705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564937.1 protein_id gnl|my_center|LOCUS_10800 1143757 1142717 gene locus_tag LOCUS_10810 1143757 1142717 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013885.1 protein_id gnl|my_center|LOCUS_10810 1143850 1145241 gene locus_tag LOCUS_10820 1143850 1145241 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858132.1 protein_id gnl|my_center|LOCUS_10820 1145642 1145238 gene locus_tag LOCUS_10830 1145642 1145238 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013884.1 protein_id gnl|my_center|LOCUS_10830 1145789 1146688 gene locus_tag LOCUS_10840 1145789 1146688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013883.1 protein_id gnl|my_center|LOCUS_10840 1148684 1146633 gene locus_tag LOCUS_10850 1148684 1146633 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013882.1 protein_id gnl|my_center|LOCUS_10850 1149405 1148677 gene locus_tag LOCUS_10860 1149405 1148677 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013881.1 protein_id gnl|my_center|LOCUS_10860 1150480 1149392 gene locus_tag LOCUS_10870 1150480 1149392 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863539.1 protein_id gnl|my_center|LOCUS_10870 1153755 1150525 gene locus_tag LOCUS_10880 1153755 1150525 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013880.1 protein_id gnl|my_center|LOCUS_10880 1156931 1153749 gene locus_tag LOCUS_10890 1156931 1153749 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013879.1 protein_id gnl|my_center|LOCUS_10890 1157792 1156935 gene locus_tag LOCUS_10900 1157792 1156935 CDS product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858145.1 protein_id gnl|my_center|LOCUS_10900 1158693 1157815 gene locus_tag LOCUS_10910 1158693 1157815 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858148.1 protein_id gnl|my_center|LOCUS_10910 1158923 1158696 gene locus_tag LOCUS_10920 1158923 1158696 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013877.1 protein_id gnl|my_center|LOCUS_10920 1159181 1160491 gene locus_tag LOCUS_10930 1159181 1160491 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013876.1 protein_id gnl|my_center|LOCUS_10930 1160488 1161750 gene locus_tag LOCUS_10940 1160488 1161750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013875.1 protein_id gnl|my_center|LOCUS_10940 1162256 1161744 gene locus_tag LOCUS_10950 1162256 1161744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858157.1 protein_id gnl|my_center|LOCUS_10950 1162838 1163098 gene locus_tag LOCUS_10960 gene whcE 1162838 1163098 CDS product WhiB family transcriptional regulator WhcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858159.1 protein_id gnl|my_center|LOCUS_10960 1163674 1163423 gene locus_tag LOCUS_10970 1163674 1163423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1164294 1163671 gene locus_tag LOCUS_10980 1164294 1163671 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858163.1 protein_id gnl|my_center|LOCUS_10980 1164340 1164843 gene locus_tag LOCUS_10990 gene ybaK 1164340 1164843 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728005.1 protein_id gnl|my_center|LOCUS_10990 1165491 1164829 gene locus_tag LOCUS_11000 1165491 1164829 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511933.1 protein_id gnl|my_center|LOCUS_11000 1165509 1166804 gene locus_tag LOCUS_11010 gene aroA 1165509 1166804 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013873.1 protein_id gnl|my_center|LOCUS_11010 1166809 1167816 gene locus_tag LOCUS_11020 gene rsgA 1166809 1167816 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863555.1 protein_id gnl|my_center|LOCUS_11020 1169098 1167818 gene locus_tag LOCUS_11030 1169098 1167818 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893267.1 protein_id gnl|my_center|LOCUS_11030 1170096 1169113 gene locus_tag LOCUS_11040 1170096 1169113 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416922.1 protein_id gnl|my_center|LOCUS_11040 1170914 1170408 gene locus_tag LOCUS_11050 1170914 1170408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858173.1 protein_id gnl|my_center|LOCUS_11050 1171336 1170926 gene locus_tag LOCUS_11060 1171336 1170926 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863558.1 protein_id gnl|my_center|LOCUS_11060 1174561 1172000 gene locus_tag LOCUS_11070 gene secA 1174561 1172000 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013871.1 protein_id gnl|my_center|LOCUS_11070 1175401 1174739 gene locus_tag LOCUS_11080 gene raiA 1175401 1174739 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858182.1 protein_id gnl|my_center|LOCUS_11080 1176001 1175537 gene locus_tag LOCUS_11090 1176001 1175537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1177905 1176160 gene locus_tag LOCUS_11100 gene lpqB 1177905 1176160 CDS product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013869.1 protein_id gnl|my_center|LOCUS_11100 1179133 1177898 gene locus_tag LOCUS_11110 gene mtrB 1179133 1177898 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186458538.1 protein_id gnl|my_center|LOCUS_11110 1180150 1179473 gene locus_tag LOCUS_11120 gene mtrA 1180150 1179473 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013867.1 protein_id gnl|my_center|LOCUS_11120 1180845 1180228 gene locus_tag LOCUS_11130 1180845 1180228 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858194.1 protein_id gnl|my_center|LOCUS_11130 1182281 1180845 gene locus_tag LOCUS_11140 gene ahcY 1182281 1180845 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858195.1 protein_id gnl|my_center|LOCUS_11140 1182740 1182387 gene locus_tag LOCUS_11150 1182740 1182387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1183081 1183932 gene locus_tag LOCUS_11160 1183081 1183932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1185127 1183958 gene locus_tag LOCUS_11170 gene manA 1185127 1183958 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013865.1 protein_id gnl|my_center|LOCUS_11170 1186174 1185167 gene locus_tag LOCUS_11180 1186174 1185167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863573.1 protein_id gnl|my_center|LOCUS_11180 1187599 1186223 gene locus_tag LOCUS_11190 1187599 1186223 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863574.1 protein_id gnl|my_center|LOCUS_11190 1188062 1187697 gene locus_tag LOCUS_11200 1188062 1187697 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863575.1 protein_id gnl|my_center|LOCUS_11200 1188209 1188664 gene locus_tag LOCUS_11210 1188209 1188664 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283667.1 protein_id gnl|my_center|LOCUS_11210 1189037 1188738 gene locus_tag LOCUS_11220 1189037 1188738 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014300514.1 protein_id gnl|my_center|LOCUS_11220 1190583 1189495 gene locus_tag LOCUS_11230 1190583 1189495 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013863.1 protein_id gnl|my_center|LOCUS_11230 1191687 1190737 gene locus_tag LOCUS_11240 1191687 1190737 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013862.1 protein_id gnl|my_center|LOCUS_11240 1191796 1193364 gene locus_tag LOCUS_11250 1191796 1193364 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013861.1 protein_id gnl|my_center|LOCUS_11250 1193376 1194038 gene locus_tag LOCUS_11260 1193376 1194038 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013855.1 protein_id gnl|my_center|LOCUS_11260 1194292 1194035 gene locus_tag LOCUS_11270 1194292 1194035 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_11270 1195341 1194298 gene locus_tag LOCUS_11280 1195341 1194298 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_11280 1195476 1195733 gene locus_tag LOCUS_11290 1195476 1195733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1196242 1195730 gene locus_tag LOCUS_11300 1196242 1195730 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706346.1 protein_id gnl|my_center|LOCUS_11300 1197407 1196253 gene locus_tag LOCUS_11310 1197407 1196253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1199149 1197404 gene locus_tag LOCUS_11320 1199149 1197404 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_11320 1200411 1199155 gene locus_tag LOCUS_11330 1200411 1199155 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545343.1 protein_id gnl|my_center|LOCUS_11330 1201473 1200712 gene locus_tag LOCUS_11340 gene hypB 1201473 1200712 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728271.1 protein_id gnl|my_center|LOCUS_11340 1201973 1201485 gene locus_tag LOCUS_11350 1201973 1201485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1201956 1204070 gene locus_tag LOCUS_11360 gene hypF 1201956 1204070 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728273.1 protein_id gnl|my_center|LOCUS_11360 1205149 1204079 gene locus_tag LOCUS_11370 gene hypE 1205149 1204079 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728538.1 protein_id gnl|my_center|LOCUS_11370 1205207 1205464 gene locus_tag LOCUS_11380 gene hypC 1205207 1205464 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894089.1 protein_id gnl|my_center|LOCUS_11380 1205464 1206579 gene locus_tag LOCUS_11390 gene hypD 1205464 1206579 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728537.1 protein_id gnl|my_center|LOCUS_11390 1207032 1206571 gene locus_tag LOCUS_11400 1207032 1206571 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013839.1 protein_id gnl|my_center|LOCUS_11400 1207537 1207037 gene locus_tag LOCUS_11410 gene purE 1207537 1207037 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858249.1 protein_id gnl|my_center|LOCUS_11410 1208691 1207537 gene locus_tag LOCUS_11420 1208691 1207537 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013836.1 protein_id gnl|my_center|LOCUS_11420 1209260 1208796 gene locus_tag LOCUS_11430 1209260 1208796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059288845.1 protein_id gnl|my_center|LOCUS_11430 1210061 1209261 gene locus_tag LOCUS_11440 1210061 1209261 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858258.1 protein_id gnl|my_center|LOCUS_11440 1210212 1211843 gene locus_tag LOCUS_11450 1210212 1211843 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013833.1 protein_id gnl|my_center|LOCUS_11450 1212853 1212086 gene locus_tag LOCUS_11460 1212853 1212086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1213073 1212867 gene locus_tag LOCUS_11470 1213073 1212867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1213704 1215335 gene locus_tag LOCUS_11480 1213704 1215335 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863615.1 protein_id gnl|my_center|LOCUS_11480 1215431 1215691 gene locus_tag LOCUS_11490 1215431 1215691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1216555 1217610 gene locus_tag LOCUS_11500 1216555 1217610 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014232.1 protein_id gnl|my_center|LOCUS_11500 1217755 1218660 gene locus_tag LOCUS_11510 1217755 1218660 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015041.1 protein_id gnl|my_center|LOCUS_11510 1218679 1219275 gene locus_tag LOCUS_11520 1218679 1219275 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013831.1 protein_id gnl|my_center|LOCUS_11520 1219277 1219705 gene locus_tag LOCUS_11530 1219277 1219705 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013829.1 protein_id gnl|my_center|LOCUS_11530 1221819 1219702 gene locus_tag LOCUS_11540 1221819 1219702 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013830.1 protein_id gnl|my_center|LOCUS_11540 1223072 1222014 gene locus_tag LOCUS_11550 1223072 1222014 CDS product Cj0069 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013828.1 protein_id gnl|my_center|LOCUS_11550 1223669 1224550 gene locus_tag LOCUS_11560 1223669 1224550 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013827.1 protein_id gnl|my_center|LOCUS_11560 1224807 1226591 gene locus_tag LOCUS_11570 1224807 1226591 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013826.1 protein_id gnl|my_center|LOCUS_11570 1226763 1227167 gene locus_tag LOCUS_11580 1226763 1227167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013824.1 protein_id gnl|my_center|LOCUS_11580 1227182 1227946 gene locus_tag LOCUS_11590 1227182 1227946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1231461 1228036 gene locus_tag LOCUS_11600 1231461 1228036 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013816.1 protein_id gnl|my_center|LOCUS_11600 1233387 1231981 gene locus_tag LOCUS_11610 1233387 1231981 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013815.1 protein_id gnl|my_center|LOCUS_11610 1234686 1233496 gene locus_tag LOCUS_11620 1234686 1233496 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013814.1 protein_id gnl|my_center|LOCUS_11620 1235366 1234785 gene locus_tag LOCUS_11630 1235366 1234785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1236165 1235530 gene locus_tag LOCUS_11640 gene upp 1236165 1235530 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858289.1 protein_id gnl|my_center|LOCUS_11640 1236230 1236511 gene locus_tag LOCUS_11650 1236230 1236511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1236508 1237347 gene locus_tag LOCUS_11660 1236508 1237347 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013812.1 protein_id gnl|my_center|LOCUS_11660 1237368 1238600 gene locus_tag LOCUS_11670 1237368 1238600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013811.1 protein_id gnl|my_center|LOCUS_11670 1238875 1238597 gene locus_tag LOCUS_11680 1238875 1238597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1239826 1238882 gene locus_tag LOCUS_11690 1239826 1238882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1239825 1241084 gene locus_tag LOCUS_11700 1239825 1241084 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013810.1 protein_id gnl|my_center|LOCUS_11700 1242260 1241190 gene locus_tag LOCUS_11710 1242260 1241190 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858295.1 protein_id gnl|my_center|LOCUS_11710 1243513 1242479 gene locus_tag LOCUS_11720 gene trpS 1243513 1242479 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013808.1 protein_id gnl|my_center|LOCUS_11720 1243884 1243705 gene locus_tag LOCUS_11730 1243884 1243705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1244935 1244030 gene locus_tag LOCUS_11740 1244935 1244030 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860808.1 protein_id gnl|my_center|LOCUS_11740 1246175 1244946 gene locus_tag LOCUS_11750 1246175 1244946 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854698.1 protein_id gnl|my_center|LOCUS_11750 1246416 1248629 gene locus_tag LOCUS_11760 1246416 1248629 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013800.1 protein_id gnl|my_center|LOCUS_11760 1248881 1250197 gene locus_tag LOCUS_11770 1248881 1250197 CDS product O-acetylhomoserine/O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854667.1 protein_id gnl|my_center|LOCUS_11770 1251115 1250096 gene locus_tag LOCUS_11780 1251115 1250096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1252159 1251302 gene locus_tag LOCUS_11790 1252159 1251302 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013622.1 protein_id gnl|my_center|LOCUS_11790 1253145 1252156 gene locus_tag LOCUS_11800 1253145 1252156 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859752.1 protein_id gnl|my_center|LOCUS_11800 1254148 1253192 gene locus_tag LOCUS_11810 1254148 1253192 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859750.1 protein_id gnl|my_center|LOCUS_11810 1255364 1254264 gene locus_tag LOCUS_11820 1255364 1254264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11820 1256008 1255364 gene locus_tag LOCUS_11830 1256008 1255364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1256793 1257896 gene locus_tag LOCUS_11840 1256793 1257896 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013793.1 protein_id gnl|my_center|LOCUS_11840 1258106 1259218 gene locus_tag LOCUS_11850 1258106 1259218 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564999.1 protein_id gnl|my_center|LOCUS_11850 1259679 1259353 gene locus_tag LOCUS_11860 1259679 1259353 CDS product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013790.1 protein_id gnl|my_center|LOCUS_11860 1260517 1259672 gene locus_tag LOCUS_11870 1260517 1259672 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860764.1 protein_id gnl|my_center|LOCUS_11870 1261410 1260739 gene locus_tag LOCUS_11880 1261410 1260739 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854638.1 protein_id gnl|my_center|LOCUS_11880 1262174 1261368 gene locus_tag LOCUS_11890 1262174 1261368 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111893.1 protein_id gnl|my_center|LOCUS_11890 1263004 1262171 gene locus_tag LOCUS_11900 1263004 1262171 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111894.1 protein_id gnl|my_center|LOCUS_11900 1263779 1262994 gene locus_tag LOCUS_11910 1263779 1262994 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399558.1 protein_id gnl|my_center|LOCUS_11910 1264813 1263848 gene locus_tag LOCUS_11920 1264813 1263848 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115334.1 protein_id gnl|my_center|LOCUS_11920 1266221 1264881 gene locus_tag LOCUS_11930 1266221 1264881 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013786.1 protein_id gnl|my_center|LOCUS_11930 1266556 1266218 gene locus_tag LOCUS_11940 1266556 1266218 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860754.1 protein_id gnl|my_center|LOCUS_11940 1269827 1266708 gene locus_tag LOCUS_11950 1269827 1266708 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013785.1 protein_id gnl|my_center|LOCUS_11950 1270045 1270917 gene locus_tag LOCUS_11960 1270045 1270917 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013784.1 protein_id gnl|my_center|LOCUS_11960 1271091 1271963 gene locus_tag LOCUS_11970 1271091 1271963 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013784.1 protein_id gnl|my_center|LOCUS_11970 1272001 1273023 gene locus_tag LOCUS_11980 1272001 1273023 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854632.1 protein_id gnl|my_center|LOCUS_11980 1273020 1273697 gene locus_tag LOCUS_11990 1273020 1273697 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854626.1 protein_id gnl|my_center|LOCUS_11990 1273798 1275255 gene locus_tag LOCUS_12000 1273798 1275255 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096455574.1 protein_id gnl|my_center|LOCUS_12000 1276150 1275272 gene locus_tag LOCUS_12010 1276150 1275272 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013769.1 protein_id gnl|my_center|LOCUS_12010 1276255 1276956 gene locus_tag LOCUS_12020 1276255 1276956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013768.1 protein_id gnl|my_center|LOCUS_12020 1278498 1276960 gene locus_tag LOCUS_12030 1278498 1276960 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013767.1 protein_id gnl|my_center|LOCUS_12030 1279190 1278507 gene locus_tag LOCUS_12040 1279190 1278507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1279306 1279755 gene locus_tag LOCUS_12050 1279306 1279755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013764.1 protein_id gnl|my_center|LOCUS_12050 1280315 1279965 gene locus_tag LOCUS_12060 1280315 1279965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1281160 1280465 gene locus_tag LOCUS_12070 gene esrR 1281160 1280465 CDS product two-component system response regulator EsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854586.1 protein_id gnl|my_center|LOCUS_12070 1282350 1281166 gene locus_tag LOCUS_12080 gene esrS 1282350 1281166 CDS product two-component system sensor histidine kinase EsrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074469750.1 protein_id gnl|my_center|LOCUS_12080 1282479 1283600 gene locus_tag LOCUS_12090 gene esrI 1282479 1283600 CDS product two-component system EsrSR regulator EsrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013762.1 protein_id gnl|my_center|LOCUS_12090 1284074 1283619 gene locus_tag LOCUS_12100 1284074 1283619 CDS product imm68 putative immunity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860713.1 protein_id gnl|my_center|LOCUS_12100 1284344 1284174 gene locus_tag LOCUS_12110 1284344 1284174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1284307 1284852 gene locus_tag LOCUS_12120 1284307 1284852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1286544 1284928 gene locus_tag LOCUS_12130 gene guaA 1286544 1284928 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013761.1 protein_id gnl|my_center|LOCUS_12130 1287887 1287699 gene locus_tag LOCUS_12140 1287887 1287699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1287816 1288169 gene locus_tag LOCUS_12150 1287816 1288169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1288197 1288334 gene locus_tag LOCUS_12160 1288197 1288334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1288769 1288308 gene locus_tag LOCUS_12170 1288769 1288308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1289998 1288769 gene locus_tag LOCUS_12180 gene sfaA 1289998 1288769 CDS product staphyloferrin A export MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170400.1 protein_id gnl|my_center|LOCUS_12180 1293361 1290038 gene locus_tag LOCUS_12190 1293361 1290038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1294195 1293383 gene locus_tag LOCUS_12200 1294195 1293383 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243882.1 protein_id gnl|my_center|LOCUS_12200 1295182 1294199 gene locus_tag LOCUS_12210 gene yfmE 1295182 1294199 CDS product Fe(3+)-citrate ABC transporter permease YfmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243506.1 protein_id gnl|my_center|LOCUS_12210 1296171 1295182 gene locus_tag LOCUS_12220 1296171 1295182 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705153.1 protein_id gnl|my_center|LOCUS_12220 1297179 1296202 gene locus_tag LOCUS_12230 1297179 1296202 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233159.1 protein_id gnl|my_center|LOCUS_12230 1298374 1297229 gene locus_tag LOCUS_12240 1298374 1297229 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013758.1 protein_id gnl|my_center|LOCUS_12240 1299922 1298402 gene locus_tag LOCUS_12250 gene guaB 1299922 1298402 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013757.1 protein_id gnl|my_center|LOCUS_12250 1300070 1300465 gene locus_tag LOCUS_12260 1300070 1300465 CDS product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020447882.1 protein_id gnl|my_center|LOCUS_12260 1301437 1300535 gene locus_tag LOCUS_12270 1301437 1300535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1302000 1301434 gene locus_tag LOCUS_12280 1302000 1301434 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013755.1 protein_id gnl|my_center|LOCUS_12280 1303817 1302198 gene locus_tag LOCUS_12290 gene groL 1303817 1302198 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013754.1 protein_id gnl|my_center|LOCUS_12290 1304126 1303830 gene locus_tag LOCUS_12300 gene groES 1304126 1303830 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892970.1 protein_id gnl|my_center|LOCUS_12300 1305320 1304268 gene locus_tag LOCUS_12310 gene tsaD 1305320 1304268 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013752.1 protein_id gnl|my_center|LOCUS_12310 1305812 1305321 gene locus_tag LOCUS_12320 gene rimI 1305812 1305321 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860686.1 protein_id gnl|my_center|LOCUS_12320 1306481 1305813 gene locus_tag LOCUS_12330 gene tsaB 1306481 1305813 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013751.1 protein_id gnl|my_center|LOCUS_12330 1307022 1306549 gene locus_tag LOCUS_12340 1307022 1306549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1308854 1307169 gene locus_tag LOCUS_12350 1308854 1307169 CDS product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013749.1 protein_id gnl|my_center|LOCUS_12350 1309535 1309041 gene locus_tag LOCUS_12360 gene tsaE 1309535 1309041 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854549.1 protein_id gnl|my_center|LOCUS_12360 1310690 1309542 gene locus_tag LOCUS_12370 gene alr 1310690 1309542 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013748.1 protein_id gnl|my_center|LOCUS_12370 1310852 1311715 gene locus_tag LOCUS_12380 1310852 1311715 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013747.1 protein_id gnl|my_center|LOCUS_12380 1311994 1311734 gene locus_tag LOCUS_12390 1311994 1311734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1313307 1311988 gene locus_tag LOCUS_12400 1313307 1311988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1313603 1313304 gene locus_tag LOCUS_12410 1313603 1313304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1315060 1313708 gene locus_tag LOCUS_12420 gene glmM 1315060 1313708 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013744.1 protein_id gnl|my_center|LOCUS_12420 1315753 1315220 gene locus_tag LOCUS_12430 gene rpsI 1315753 1315220 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854537.1 protein_id gnl|my_center|LOCUS_12430 1316193 1315750 gene locus_tag LOCUS_12440 gene rplM 1316193 1315750 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854535.1 protein_id gnl|my_center|LOCUS_12440 1316905 1316618 gene locus_tag LOCUS_12450 1316905 1316618 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854533.1 protein_id gnl|my_center|LOCUS_12450 1317378 1316950 gene locus_tag LOCUS_12460 1317378 1316950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1318459 1317470 gene locus_tag LOCUS_12470 1318459 1317470 CDS product type VII secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013742.1 protein_id gnl|my_center|LOCUS_12470 1322147 1318524 gene locus_tag LOCUS_12480 gene eccCa 1322147 1318524 CDS product type VII secretion protein EccCa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167382017.1 protein_id gnl|my_center|LOCUS_12480 1322304 1322149 gene locus_tag LOCUS_12490 1322304 1322149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1322319 1323734 gene locus_tag LOCUS_12500 1322319 1323734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1323747 1324892 gene locus_tag LOCUS_12510 gene mycP 1323747 1324892 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013739.1 protein_id gnl|my_center|LOCUS_12510 1325295 1324873 gene locus_tag LOCUS_12520 1325295 1324873 CDS product TIGR02611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860653.1 protein_id gnl|my_center|LOCUS_12520 1326702 1325404 gene locus_tag LOCUS_12530 gene eccB 1326702 1325404 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013736.1 protein_id gnl|my_center|LOCUS_12530 1327711 1326845 gene locus_tag LOCUS_12540 gene truA 1327711 1326845 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854437.1 protein_id gnl|my_center|LOCUS_12540 1328299 1327826 gene locus_tag LOCUS_12550 1328299 1327826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1329396 1328380 gene locus_tag LOCUS_12560 1329396 1328380 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013731.1 protein_id gnl|my_center|LOCUS_12560 1330083 1329478 gene locus_tag LOCUS_12570 gene rpsD 1330083 1329478 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013730.1 protein_id gnl|my_center|LOCUS_12570 1330511 1330107 gene locus_tag LOCUS_12580 gene rpsK 1330511 1330107 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854428.1 protein_id gnl|my_center|LOCUS_12580 1330883 1330515 gene locus_tag LOCUS_12590 gene rpsM 1330883 1330515 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854425.1 protein_id gnl|my_center|LOCUS_12590 1331389 1331069 gene locus_tag LOCUS_12600 1331389 1331069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1332352 1331594 gene locus_tag LOCUS_12610 1332352 1331594 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013729.1 protein_id gnl|my_center|LOCUS_12610 1334698 1332461 gene locus_tag LOCUS_12620 1334698 1332461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1335789 1334995 gene locus_tag LOCUS_12630 gene map 1335789 1334995 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013728.1 protein_id gnl|my_center|LOCUS_12630 1336448 1335903 gene locus_tag LOCUS_12640 1336448 1335903 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854403.1 protein_id gnl|my_center|LOCUS_12640 1337770 1336448 gene locus_tag LOCUS_12650 gene secY 1337770 1336448 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854402.1 protein_id gnl|my_center|LOCUS_12650 1338258 1339394 gene locus_tag LOCUS_12660 gene ugpC 1338258 1339394 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015140.1 protein_id gnl|my_center|LOCUS_12660 1339509 1340762 gene locus_tag LOCUS_12670 1339509 1340762 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015139.1 protein_id gnl|my_center|LOCUS_12670 1341481 1340759 gene locus_tag LOCUS_12680 1341481 1340759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1342443 1341565 gene locus_tag LOCUS_12690 1342443 1341565 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113786.1 protein_id gnl|my_center|LOCUS_12690 1343846 1342443 gene locus_tag LOCUS_12700 1343846 1342443 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113788.1 protein_id gnl|my_center|LOCUS_12700 1345205 1343964 gene locus_tag LOCUS_12710 1345205 1343964 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 protein_id gnl|my_center|LOCUS_12710 1345624 1347222 gene locus_tag LOCUS_12720 1345624 1347222 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_12720 1347225 1348934 gene locus_tag LOCUS_12730 1347225 1348934 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776262.1 protein_id gnl|my_center|LOCUS_12730 1348922 1349656 gene locus_tag LOCUS_12740 1348922 1349656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1350457 1349657 gene locus_tag LOCUS_12750 1350457 1349657 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727259.1 protein_id gnl|my_center|LOCUS_12750 1351081 1350635 gene locus_tag LOCUS_12760 gene rplO 1351081 1350635 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013717.1 protein_id gnl|my_center|LOCUS_12760 1351269 1351084 gene locus_tag LOCUS_12770 gene rpmD 1351269 1351084 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860590.1 protein_id gnl|my_center|LOCUS_12770 1351899 1351273 gene locus_tag LOCUS_12780 gene rpsE 1351899 1351273 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854347.1 protein_id gnl|my_center|LOCUS_12780 1352347 1351940 gene locus_tag LOCUS_12790 gene rplR 1352347 1351940 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854346.1 protein_id gnl|my_center|LOCUS_12790 1352886 1352350 gene locus_tag LOCUS_12800 gene rplF 1352886 1352350 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860588.1 protein_id gnl|my_center|LOCUS_12800 1353300 1352902 gene locus_tag LOCUS_12810 gene rpsH 1353300 1352902 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 protein_id gnl|my_center|LOCUS_12810 1353751 1353548 gene locus_tag LOCUS_12820 1353751 1353548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1354757 1353978 gene locus_tag LOCUS_12830 gene nagB 1354757 1353978 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030128.1 protein_id gnl|my_center|LOCUS_12830 1355927 1354791 gene locus_tag LOCUS_12840 1355927 1354791 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853898.1 protein_id gnl|my_center|LOCUS_12840 1356658 1355963 gene locus_tag LOCUS_12850 1356658 1355963 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015278.1 protein_id gnl|my_center|LOCUS_12850 1357571 1356687 gene locus_tag LOCUS_12860 1357571 1356687 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015277.1 protein_id gnl|my_center|LOCUS_12860 1358328 1357588 gene locus_tag LOCUS_12870 1358328 1357588 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804466.1 protein_id gnl|my_center|LOCUS_12870 1358574 1358386 gene locus_tag LOCUS_12880 1358574 1358386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1358664 1360286 gene locus_tag LOCUS_12890 1358664 1360286 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853886.1 protein_id gnl|my_center|LOCUS_12890 1360528 1361493 gene locus_tag LOCUS_12900 1360528 1361493 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853884.1 protein_id gnl|my_center|LOCUS_12900 1361493 1363481 gene locus_tag LOCUS_12910 1361493 1363481 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804463.1 protein_id gnl|my_center|LOCUS_12910 1363487 1364320 gene locus_tag LOCUS_12920 1363487 1364320 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015284.1 protein_id gnl|my_center|LOCUS_12920 1364355 1365275 gene locus_tag LOCUS_12930 1364355 1365275 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804461.1 protein_id gnl|my_center|LOCUS_12930 1365798 1365484 gene locus_tag LOCUS_12940 1365798 1365484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12940 1366031 1365795 gene locus_tag LOCUS_12950 1366031 1365795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12950 1366896 1366015 gene locus_tag LOCUS_12960 1366896 1366015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12960 1368105 1366972 gene locus_tag LOCUS_12970 1368105 1366972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12970 1368507 1368172 gene locus_tag LOCUS_12980 1368507 1368172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1368768 1368535 gene locus_tag LOCUS_12990 1368768 1368535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1369108 1370091 gene locus_tag LOCUS_13000 1369108 1370091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1371389 1370229 gene locus_tag LOCUS_13010 1371389 1370229 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015557.1 protein_id gnl|my_center|LOCUS_13010 1371651 1372007 gene locus_tag LOCUS_13020 1371651 1372007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1373210 1373383 gene locus_tag LOCUS_13030 1373210 1373383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1373555 1374622 gene locus_tag LOCUS_13040 1373555 1374622 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014653.1 protein_id gnl|my_center|LOCUS_13040 1374946 1375287 gene locus_tag LOCUS_13050 1374946 1375287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1375384 1376265 gene locus_tag LOCUS_13060 1375384 1376265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1376442 1377191 gene locus_tag LOCUS_13070 gene modA 1376442 1377191 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728090.1 protein_id gnl|my_center|LOCUS_13070 1377471 1378367 gene locus_tag LOCUS_13080 gene moaA 1377471 1378367 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014195.1 protein_id gnl|my_center|LOCUS_13080 1378389 1379636 gene locus_tag LOCUS_13090 1378389 1379636 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014194.1 protein_id gnl|my_center|LOCUS_13090 1379645 1380112 gene locus_tag LOCUS_13100 gene moaC 1379645 1380112 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_13100 1380090 1380695 gene locus_tag LOCUS_13110 1380090 1380695 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014193.1 protein_id gnl|my_center|LOCUS_13110 1381191 1380682 gene locus_tag LOCUS_13120 1381191 1380682 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014189.1 protein_id gnl|my_center|LOCUS_13120 1381510 1382700 gene locus_tag LOCUS_13130 1381510 1382700 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123927512.1 protein_id gnl|my_center|LOCUS_13130 1383121 1383267 gene locus_tag LOCUS_13140 1383121 1383267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1383575 1384906 gene locus_tag LOCUS_13150 1383575 1384906 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014188.1 protein_id gnl|my_center|LOCUS_13150 1384946 1388668 gene locus_tag LOCUS_13160 1384946 1388668 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014187.1 protein_id gnl|my_center|LOCUS_13160 1388668 1390269 gene locus_tag LOCUS_13170 gene narH 1388668 1390269 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014186.1 protein_id gnl|my_center|LOCUS_13170 1390273 1390950 gene locus_tag LOCUS_13180 gene narJ 1390273 1390950 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014185.1 protein_id gnl|my_center|LOCUS_13180 1390963 1391742 gene locus_tag LOCUS_13190 gene narI 1390963 1391742 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854891.1 protein_id gnl|my_center|LOCUS_13190 1391919 1393826 gene locus_tag LOCUS_13200 1391919 1393826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1394122 1393853 gene locus_tag LOCUS_13210 1394122 1393853 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863405.1 protein_id gnl|my_center|LOCUS_13210 1394199 1395200 gene locus_tag LOCUS_13220 1394199 1395200 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230247.1 protein_id gnl|my_center|LOCUS_13220 1395200 1396258 gene locus_tag LOCUS_13230 1395200 1396258 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013472.1 protein_id gnl|my_center|LOCUS_13230 1397283 1396255 gene locus_tag LOCUS_13240 1397283 1396255 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860401.1 protein_id gnl|my_center|LOCUS_13240 1398738 1397362 gene locus_tag LOCUS_13250 gene sdaA 1398738 1397362 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624291.1 protein_id gnl|my_center|LOCUS_13250 1400106 1398763 gene locus_tag LOCUS_13260 gene sdaC 1400106 1398763 CDS product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450476.1 protein_id gnl|my_center|LOCUS_13260 1401373 1400810 gene locus_tag LOCUS_13270 gene rplE 1401373 1400810 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854317.1 protein_id gnl|my_center|LOCUS_13270 1401690 1401376 gene locus_tag LOCUS_13280 gene rplX 1401690 1401376 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854314.1 protein_id gnl|my_center|LOCUS_13280 1402061 1401693 gene locus_tag LOCUS_13290 gene rplN 1402061 1401693 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854312.1 protein_id gnl|my_center|LOCUS_13290 1403567 1402257 gene locus_tag LOCUS_13300 1403567 1402257 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015552.1 protein_id gnl|my_center|LOCUS_13300 1404280 1403564 gene locus_tag LOCUS_13310 1404280 1403564 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855103.1 protein_id gnl|my_center|LOCUS_13310 1405838 1404297 gene locus_tag LOCUS_13320 1405838 1404297 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015553.1 protein_id gnl|my_center|LOCUS_13320 1406384 1406106 gene locus_tag LOCUS_13330 gene rpsQ 1406384 1406106 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854306.1 protein_id gnl|my_center|LOCUS_13330 1406617 1406387 gene locus_tag LOCUS_13340 gene rpmC 1406617 1406387 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854304.1 protein_id gnl|my_center|LOCUS_13340 1407033 1406617 gene locus_tag LOCUS_13350 gene rplP 1407033 1406617 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854302.1 protein_id gnl|my_center|LOCUS_13350 1407783 1407037 gene locus_tag LOCUS_13360 gene rpsC 1407783 1407037 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854298.1 protein_id gnl|my_center|LOCUS_13360 1408145 1407783 gene locus_tag LOCUS_13370 gene rplV 1408145 1407783 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854297.1 protein_id gnl|my_center|LOCUS_13370 1408427 1408149 gene locus_tag LOCUS_13380 gene rpsS 1408427 1408149 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854296.1 protein_id gnl|my_center|LOCUS_13380 1409286 1408444 gene locus_tag LOCUS_13390 gene rplB 1409286 1408444 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854295.1 protein_id gnl|my_center|LOCUS_13390 1409613 1409308 gene locus_tag LOCUS_13400 gene rplW 1409613 1409308 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854294.1 protein_id gnl|my_center|LOCUS_13400 1410266 1409613 gene locus_tag LOCUS_13410 gene rplD 1410266 1409613 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854293.1 protein_id gnl|my_center|LOCUS_13410 1410919 1410263 gene locus_tag LOCUS_13420 gene rplC 1410919 1410263 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854292.1 protein_id gnl|my_center|LOCUS_13420 1411257 1410952 gene locus_tag LOCUS_13430 gene rpsJ 1411257 1410952 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854291.1 protein_id gnl|my_center|LOCUS_13430 1412326 1411769 gene locus_tag LOCUS_13440 1412326 1411769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1413594 1412404 gene locus_tag LOCUS_13450 gene tuf 1413594 1412404 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013696.1 protein_id gnl|my_center|LOCUS_13450 1416038 1413912 gene locus_tag LOCUS_13460 gene fusA 1416038 1413912 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854224.1 protein_id gnl|my_center|LOCUS_13460 1416758 1416291 gene locus_tag LOCUS_13470 gene rpsG 1416758 1416291 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854222.1 protein_id gnl|my_center|LOCUS_13470 1417133 1416762 gene locus_tag LOCUS_13480 gene rpsL 1417133 1416762 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854221.1 protein_id gnl|my_center|LOCUS_13480 1417761 1417408 gene locus_tag LOCUS_13490 1417761 1417408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1417920 1419704 gene locus_tag LOCUS_13500 1417920 1419704 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192163.1 protein_id gnl|my_center|LOCUS_13500 1419670 1420293 gene locus_tag LOCUS_13510 1419670 1420293 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196980.1 protein_id gnl|my_center|LOCUS_13510 1421228 1420290 gene locus_tag LOCUS_13520 1421228 1420290 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225345.1 protein_id gnl|my_center|LOCUS_13520 1421896 1421225 gene locus_tag LOCUS_13530 1421896 1421225 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731009.1 protein_id gnl|my_center|LOCUS_13530 1422679 1421912 gene locus_tag LOCUS_13540 1422679 1421912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1423638 1422700 gene locus_tag LOCUS_13550 1423638 1422700 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015345.1 protein_id gnl|my_center|LOCUS_13550 1424402 1423701 gene locus_tag LOCUS_13560 1424402 1423701 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399561.1 protein_id gnl|my_center|LOCUS_13560 1425495 1424407 gene locus_tag LOCUS_13570 1425495 1424407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1425808 1426215 gene locus_tag LOCUS_13580 1425808 1426215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1426308 1426772 gene locus_tag LOCUS_13590 1426308 1426772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1426956 1427315 gene locus_tag LOCUS_13600 1426956 1427315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1427441 1427725 gene locus_tag LOCUS_13610 1427441 1427725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1428135 1427950 gene locus_tag LOCUS_13620 1428135 1427950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1428901 1428641 gene locus_tag LOCUS_13630 1428901 1428641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1428848 1429786 gene locus_tag LOCUS_13640 1428848 1429786 CDS product YydG family radical SAM peptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242609.1 protein_id gnl|my_center|LOCUS_13640 1429791 1430561 gene locus_tag LOCUS_13650 gene liaK 1429791 1430561 CDS product zinc metalloprotease LiaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243055.1 protein_id gnl|my_center|LOCUS_13650 1430558 1431949 gene locus_tag LOCUS_13660 1430558 1431949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1431949 1432665 gene locus_tag LOCUS_13670 1431949 1432665 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975187.1 protein_id gnl|my_center|LOCUS_13670 1436988 1432978 gene locus_tag LOCUS_13680 1436988 1432978 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013691.1 protein_id gnl|my_center|LOCUS_13680 1440566 1437036 gene locus_tag LOCUS_13690 1440566 1437036 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265569.1 protein_id gnl|my_center|LOCUS_13690 1441665 1440727 gene locus_tag LOCUS_13700 1441665 1440727 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031512298.1 protein_id gnl|my_center|LOCUS_13700 1442701 1441670 gene locus_tag LOCUS_13710 1442701 1441670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1443560 1442706 gene locus_tag LOCUS_13720 1443560 1442706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1445560 1443578 gene locus_tag LOCUS_13730 1445560 1443578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1446416 1445553 gene locus_tag LOCUS_13740 1446416 1445553 CDS product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 protein_id gnl|my_center|LOCUS_13740 1447146 1446418 gene locus_tag LOCUS_13750 1447146 1446418 CDS product anchored repeat-type ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399434.1 protein_id gnl|my_center|LOCUS_13750 1448035 1447139 gene locus_tag LOCUS_13760 1448035 1447139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1449505 1448036 gene locus_tag LOCUS_13770 1449505 1448036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1450011 1449631 gene locus_tag LOCUS_13780 gene rplL 1450011 1449631 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854210.1 protein_id gnl|my_center|LOCUS_13780 1450570 1450055 gene locus_tag LOCUS_13790 gene rplJ 1450570 1450055 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013688.1 protein_id gnl|my_center|LOCUS_13790 1451589 1450882 gene locus_tag LOCUS_13800 gene rplA 1451589 1450882 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013680.1 protein_id gnl|my_center|LOCUS_13800 1452084 1451656 gene locus_tag LOCUS_13810 gene rplK 1452084 1451656 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013679.1 protein_id gnl|my_center|LOCUS_13810 1453020 1452229 gene locus_tag LOCUS_13820 gene nusG 1453020 1452229 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013678.1 protein_id gnl|my_center|LOCUS_13820 1453420 1453115 gene locus_tag LOCUS_13830 gene secE 1453420 1453115 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013677.1 protein_id gnl|my_center|LOCUS_13830 1453595 1453522 gene locus_tag LOCUS_t00240 1453595 1453522 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1453695 1453623 gene locus_tag LOCUS_t00250 1453695 1453623 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1453806 1453733 gene locus_tag LOCUS_t00260 1453806 1453733 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1454079 1453997 gene locus_tag LOCUS_t00270 1454079 1453997 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1455123 1454131 gene locus_tag LOCUS_13840 1455123 1454131 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013676.1 protein_id gnl|my_center|LOCUS_13840 1455247 1456407 gene locus_tag LOCUS_13850 1455247 1456407 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013675.1 protein_id gnl|my_center|LOCUS_13850 1456418 1457368 gene locus_tag LOCUS_13860 1456418 1457368 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966817.1 protein_id gnl|my_center|LOCUS_13860 1458029 1457355 gene locus_tag LOCUS_13870 1458029 1457355 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013674.1 protein_id gnl|my_center|LOCUS_13870 1459044 1458022 gene locus_tag LOCUS_13880 1459044 1458022 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854169.1 protein_id gnl|my_center|LOCUS_13880 1459415 1459023 gene locus_tag LOCUS_13890 1459415 1459023 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013671.1 protein_id gnl|my_center|LOCUS_13890 1460941 1459412 gene locus_tag LOCUS_13900 gene menD 1460941 1459412 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013670.1 protein_id gnl|my_center|LOCUS_13900 1461803 1460925 gene locus_tag LOCUS_13910 1461803 1460925 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013669.1 protein_id gnl|my_center|LOCUS_13910 1461892 1462758 gene locus_tag LOCUS_13920 1461892 1462758 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860502.1 protein_id gnl|my_center|LOCUS_13920 1462769 1463878 gene locus_tag LOCUS_13930 gene menE 1462769 1463878 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013660.1 protein_id gnl|my_center|LOCUS_13930 1464857 1463838 gene locus_tag LOCUS_13940 1464857 1463838 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564999.1 protein_id gnl|my_center|LOCUS_13940 1465089 1465952 gene locus_tag LOCUS_13950 1465089 1465952 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013659.1 protein_id gnl|my_center|LOCUS_13950 1466268 1465927 gene locus_tag LOCUS_13960 1466268 1465927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1466267 1466455 gene locus_tag LOCUS_13970 1466267 1466455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1466495 1466764 gene locus_tag LOCUS_13980 1466495 1466764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1467660 1466761 gene locus_tag LOCUS_13990 gene ccsB 1467660 1466761 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855590.1 protein_id gnl|my_center|LOCUS_13990 1469261 1467669 gene locus_tag LOCUS_14000 1469261 1467669 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013653.1 protein_id gnl|my_center|LOCUS_14000 1470061 1469270 gene locus_tag LOCUS_14010 1470061 1469270 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013652.1 protein_id gnl|my_center|LOCUS_14010 1470618 1470058 gene locus_tag LOCUS_14020 1470618 1470058 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855585.1 protein_id gnl|my_center|LOCUS_14020 1471227 1470619 gene locus_tag LOCUS_14030 1471227 1470619 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855583.1 protein_id gnl|my_center|LOCUS_14030 1472516 1471224 gene locus_tag LOCUS_14040 gene hemL 1472516 1471224 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265562.1 protein_id gnl|my_center|LOCUS_14040 1473924 1472572 gene locus_tag LOCUS_14050 1473924 1472572 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013650.1 protein_id gnl|my_center|LOCUS_14050 1474965 1473940 gene locus_tag LOCUS_14060 gene hemE 1474965 1473940 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265560.1 protein_id gnl|my_center|LOCUS_14060 1475064 1476158 gene locus_tag LOCUS_14070 1475064 1476158 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014749.1 protein_id gnl|my_center|LOCUS_14070 1478661 1476136 gene locus_tag LOCUS_14080 1478661 1476136 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013648.1 protein_id gnl|my_center|LOCUS_14080 1479127 1478645 gene locus_tag LOCUS_14090 1479127 1478645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1480133 1479141 gene locus_tag LOCUS_14100 gene hemB 1480133 1479141 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013646.1 protein_id gnl|my_center|LOCUS_14100 1481788 1480130 gene locus_tag LOCUS_14110 1481788 1480130 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013645.1 protein_id gnl|my_center|LOCUS_14110 1482745 1481861 gene locus_tag LOCUS_14120 gene hemC 1482745 1481861 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013637.1 protein_id gnl|my_center|LOCUS_14120 1484103 1482742 gene locus_tag LOCUS_14130 1484103 1482742 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265556.1 protein_id gnl|my_center|LOCUS_14130 1484411 1484175 gene locus_tag LOCUS_14140 1484411 1484175 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855545.1 protein_id gnl|my_center|LOCUS_14140 1484483 1485526 gene locus_tag LOCUS_14150 1484483 1485526 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855543.1 protein_id gnl|my_center|LOCUS_14150 1486361 1485492 gene locus_tag LOCUS_14160 1486361 1485492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1486656 1486441 gene locus_tag LOCUS_14170 1486656 1486441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1486921 1486730 gene locus_tag LOCUS_14180 1486921 1486730 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855509.1 protein_id gnl|my_center|LOCUS_14180 1487989 1487177 gene locus_tag LOCUS_14190 gene proC 1487989 1487177 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855505.1 protein_id gnl|my_center|LOCUS_14190 1488646 1488023 gene locus_tag LOCUS_14200 1488646 1488023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855504.1 protein_id gnl|my_center|LOCUS_14200 1488864 1488652 gene locus_tag LOCUS_14210 1488864 1488652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1488936 1489781 gene locus_tag LOCUS_14220 1488936 1489781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013633.1 protein_id gnl|my_center|LOCUS_14220 1490424 1489744 gene locus_tag LOCUS_14230 1490424 1489744 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013630.1 protein_id gnl|my_center|LOCUS_14230 1491578 1490430 gene locus_tag LOCUS_14240 1491578 1490430 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855497.1 protein_id gnl|my_center|LOCUS_14240 1492336 1491590 gene locus_tag LOCUS_14250 1492336 1491590 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855496.1 protein_id gnl|my_center|LOCUS_14250 1493678 1492395 gene locus_tag LOCUS_14260 gene mshA 1493678 1492395 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013628.1 protein_id gnl|my_center|LOCUS_14260 1493762 1495462 gene locus_tag LOCUS_14270 1493762 1495462 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855494.1 protein_id gnl|my_center|LOCUS_14270 1495524 1497230 gene locus_tag LOCUS_14280 1495524 1497230 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855494.1 protein_id gnl|my_center|LOCUS_14280 1498400 1497297 gene locus_tag LOCUS_14290 1498400 1497297 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396413.1 protein_id gnl|my_center|LOCUS_14290 1498424 1498927 gene locus_tag LOCUS_14300 1498424 1498927 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855491.1 protein_id gnl|my_center|LOCUS_14300 1498943 1499755 gene locus_tag LOCUS_14310 1498943 1499755 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013626.1 protein_id gnl|my_center|LOCUS_14310 1500107 1502203 gene locus_tag LOCUS_14320 gene pflB 1500107 1502203 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582507.1 protein_id gnl|my_center|LOCUS_14320 1502253 1502504 gene locus_tag LOCUS_14330 1502253 1502504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1502583 1503458 gene locus_tag LOCUS_14340 gene pflA 1502583 1503458 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068217.1 protein_id gnl|my_center|LOCUS_14340 1503464 1504207 gene locus_tag LOCUS_14350 1503464 1504207 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096454126.1 protein_id gnl|my_center|LOCUS_14350 1504692 1504204 gene locus_tag LOCUS_14360 1504692 1504204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1504974 1504699 gene locus_tag LOCUS_14370 1504974 1504699 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013613.1 protein_id gnl|my_center|LOCUS_14370 1506255 1504987 gene locus_tag LOCUS_14380 1506255 1504987 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855471.1 protein_id gnl|my_center|LOCUS_14380 1506804 1506454 gene locus_tag LOCUS_14390 1506804 1506454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013608.1 protein_id gnl|my_center|LOCUS_14390 1507630 1506881 gene locus_tag LOCUS_14400 1507630 1506881 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013607.1 protein_id gnl|my_center|LOCUS_14400 1509645 1507630 gene locus_tag LOCUS_14410 1509645 1507630 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013606.1 protein_id gnl|my_center|LOCUS_14410 1510422 1509664 gene locus_tag LOCUS_14420 1510422 1509664 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855465.1 protein_id gnl|my_center|LOCUS_14420 1510872 1512296 gene locus_tag LOCUS_14430 gene ramB 1510872 1512296 CDS product acetate metabolism transcriptional regulator RamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859703.1 protein_id gnl|my_center|LOCUS_14430 1513914 1512505 gene locus_tag LOCUS_14440 gene lpdA 1513914 1512505 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013602.1 protein_id gnl|my_center|LOCUS_14440 1514327 1515448 gene locus_tag LOCUS_14450 1514327 1515448 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 protein_id gnl|my_center|LOCUS_14450 1515536 1517530 gene locus_tag LOCUS_14460 1515536 1517530 CDS product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013580.1 protein_id gnl|my_center|LOCUS_14460 1517527 1518879 gene locus_tag LOCUS_14470 1517527 1518879 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013579.1 protein_id gnl|my_center|LOCUS_14470 1518885 1519892 gene locus_tag LOCUS_14480 gene rfbB 1518885 1519892 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855430.1 protein_id gnl|my_center|LOCUS_14480 1519931 1521277 gene locus_tag LOCUS_14490 1519931 1521277 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013573.1 protein_id gnl|my_center|LOCUS_14490 1521289 1522161 gene locus_tag LOCUS_14500 gene rfbA 1521289 1522161 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013572.1 protein_id gnl|my_center|LOCUS_14500 1522913 1522125 gene locus_tag LOCUS_14510 1522913 1522125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1523043 1524695 gene locus_tag LOCUS_14520 gene fadD2 1523043 1524695 CDS product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876813.1 protein_id gnl|my_center|LOCUS_14520 1525731 1526069 gene locus_tag LOCUS_14530 1525731 1526069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14530 1526224 1527663 gene locus_tag LOCUS_14540 1526224 1527663 CDS product IS30-like element ISMsm8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728521.1 protein_id gnl|my_center|LOCUS_14540 1527614 1527823 gene locus_tag LOCUS_14550 1527614 1527823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14550 1527756 1527983 gene locus_tag LOCUS_14560 1527756 1527983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14560 1527976 1528143 gene locus_tag LOCUS_14570 1527976 1528143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1528460 1528969 gene locus_tag LOCUS_14580 1528460 1528969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1529576 1530328 gene locus_tag LOCUS_14590 1529576 1530328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1531121 1530423 gene locus_tag LOCUS_14600 1531121 1530423 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013424.1 protein_id gnl|my_center|LOCUS_14600 1531257 1532414 gene locus_tag LOCUS_14610 1531257 1532414 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035469.1 protein_id gnl|my_center|LOCUS_14610 1532721 1532476 gene locus_tag LOCUS_14620 1532721 1532476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1532949 1532734 gene locus_tag LOCUS_14630 1532949 1532734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14630 1533959 1533000 gene locus_tag LOCUS_14640 1533959 1533000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14640 1534538 1534951 gene locus_tag LOCUS_14650 1534538 1534951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1535501 1535175 gene locus_tag LOCUS_14660 1535501 1535175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1536089 1535508 gene locus_tag LOCUS_14670 1536089 1535508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1536295 1536540 gene locus_tag LOCUS_14680 1536295 1536540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14680 1536464 1536895 gene locus_tag LOCUS_14690 1536464 1536895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14690 1537185 1537394 gene locus_tag LOCUS_14700 1537185 1537394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1537620 1538384 gene locus_tag LOCUS_14710 1537620 1538384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1538795 1538388 gene locus_tag LOCUS_14720 1538795 1538388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1539594 1539519 gene locus_tag LOCUS_t00280 1539594 1539519 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1540963 1539692 gene locus_tag LOCUS_14730 1540963 1539692 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013555.1 protein_id gnl|my_center|LOCUS_14730 1540956 1542482 gene locus_tag LOCUS_14740 1540956 1542482 CDS product class III adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285716.1 protein_id gnl|my_center|LOCUS_14740 1543386 1542487 gene locus_tag LOCUS_14750 1543386 1542487 CDS product DUF4862 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113941.1 protein_id gnl|my_center|LOCUS_14750 1543493 1545529 gene locus_tag LOCUS_14760 1543493 1545529 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399386.1 protein_id gnl|my_center|LOCUS_14760 1545616 1547592 gene locus_tag LOCUS_14770 1545616 1547592 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727591.1 protein_id gnl|my_center|LOCUS_14770 1547831 1547667 gene locus_tag LOCUS_14780 1547831 1547667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1548071 1548733 gene locus_tag LOCUS_14790 1548071 1548733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1551547 1548653 gene locus_tag LOCUS_14800 gene topA 1551547 1548653 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013552.1 protein_id gnl|my_center|LOCUS_14800 1551687 1553180 gene locus_tag LOCUS_14810 1551687 1553180 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854612.1 protein_id gnl|my_center|LOCUS_14810 1554918 1553158 gene locus_tag LOCUS_14820 1554918 1553158 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031071.1 protein_id gnl|my_center|LOCUS_14820 1556406 1554919 gene locus_tag LOCUS_14830 1556406 1554919 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031070.1 protein_id gnl|my_center|LOCUS_14830 1557650 1556403 gene locus_tag LOCUS_14840 1557650 1556403 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420953.1 protein_id gnl|my_center|LOCUS_14840 1558354 1557647 gene locus_tag LOCUS_14850 1558354 1557647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1558968 1558351 gene locus_tag LOCUS_14860 1558968 1558351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1559345 1559142 gene locus_tag LOCUS_14870 1559345 1559142 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862487.1 protein_id gnl|my_center|LOCUS_14870 1559635 1561950 gene locus_tag LOCUS_14880 1559635 1561950 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013550.1 protein_id gnl|my_center|LOCUS_14880 1562266 1561940 gene locus_tag LOCUS_14890 1562266 1561940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1562538 1562263 gene locus_tag LOCUS_14900 1562538 1562263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863285.1 protein_id gnl|my_center|LOCUS_14900 1562732 1562535 gene locus_tag LOCUS_14910 1562732 1562535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1563334 1562756 gene locus_tag LOCUS_14920 1563334 1562756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1564080 1563334 gene locus_tag LOCUS_14930 1564080 1563334 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104598.1 protein_id gnl|my_center|LOCUS_14930 1565174 1564077 gene locus_tag LOCUS_14940 1565174 1564077 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013547.1 protein_id gnl|my_center|LOCUS_14940 1566204 1565167 gene locus_tag LOCUS_14950 1566204 1565167 CDS product CpaE-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013546.1 protein_id gnl|my_center|LOCUS_14950 1566203 1566514 gene locus_tag LOCUS_14960 1566203 1566514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1566676 1567533 gene locus_tag LOCUS_14970 1566676 1567533 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013545.1 protein_id gnl|my_center|LOCUS_14970 1568124 1567471 gene locus_tag LOCUS_14980 1568124 1567471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230534.1 protein_id gnl|my_center|LOCUS_14980 1568252 1568752 gene locus_tag LOCUS_14990 1568252 1568752 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013544.1 protein_id gnl|my_center|LOCUS_14990 1568840 1569778 gene locus_tag LOCUS_15000 1568840 1569778 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013543.1 protein_id gnl|my_center|LOCUS_15000 1570971 1569775 gene locus_tag LOCUS_15010 1570971 1569775 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013542.1 protein_id gnl|my_center|LOCUS_15010 1571737 1570994 gene locus_tag LOCUS_15020 1571737 1570994 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013541.1 protein_id gnl|my_center|LOCUS_15020 1572294 1571734 gene locus_tag LOCUS_15030 1572294 1571734 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013540.1 protein_id gnl|my_center|LOCUS_15030 1573042 1572287 gene locus_tag LOCUS_15040 gene nth 1573042 1572287 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 protein_id gnl|my_center|LOCUS_15040 1573547 1574230 gene locus_tag LOCUS_15050 1573547 1574230 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855810.1 protein_id gnl|my_center|LOCUS_15050 1575115 1574291 gene locus_tag LOCUS_15060 1575115 1574291 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285704.1 protein_id gnl|my_center|LOCUS_15060 1575628 1575164 gene locus_tag LOCUS_15070 1575628 1575164 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855793.1 protein_id gnl|my_center|LOCUS_15070 1575818 1575630 gene locus_tag LOCUS_15080 1575818 1575630 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855791.1 protein_id gnl|my_center|LOCUS_15080 1576173 1575826 gene locus_tag LOCUS_15090 gene whcA 1576173 1575826 CDS product WhiB family transcriptional regulator WhcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855789.1 protein_id gnl|my_center|LOCUS_15090 1576372 1578756 gene locus_tag LOCUS_15100 1576372 1578756 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013529.1 protein_id gnl|my_center|LOCUS_15100 1579225 1578761 gene locus_tag LOCUS_15110 1579225 1578761 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863321.1 protein_id gnl|my_center|LOCUS_15110 1579262 1580167 gene locus_tag LOCUS_15120 1579262 1580167 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013528.1 protein_id gnl|my_center|LOCUS_15120 1580241 1580317 gene locus_tag LOCUS_t00290 1580241 1580317 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1580524 1581414 gene locus_tag LOCUS_15130 1580524 1581414 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015309.1 protein_id gnl|my_center|LOCUS_15130 1582790 1581483 gene locus_tag LOCUS_15140 1582790 1581483 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013522.1 protein_id gnl|my_center|LOCUS_15140 1583116 1585920 gene locus_tag LOCUS_15150 1583116 1585920 CDS product DUF4040 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013521.1 protein_id gnl|my_center|LOCUS_15150 1585924 1586349 gene locus_tag LOCUS_15160 1585924 1586349 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013520.1 protein_id gnl|my_center|LOCUS_15160 1586349 1587872 gene locus_tag LOCUS_15170 1586349 1587872 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271326.1 protein_id gnl|my_center|LOCUS_15170 1587875 1588252 gene locus_tag LOCUS_15180 1587875 1588252 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013518.1 protein_id gnl|my_center|LOCUS_15180 1588252 1588518 gene locus_tag LOCUS_15190 1588252 1588518 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013517.1 protein_id gnl|my_center|LOCUS_15190 1588518 1588820 gene locus_tag LOCUS_15200 1588518 1588820 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863340.1 protein_id gnl|my_center|LOCUS_15200 1588977 1589762 gene locus_tag LOCUS_15210 1588977 1589762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1589755 1590456 gene locus_tag LOCUS_15220 1589755 1590456 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230642.1 protein_id gnl|my_center|LOCUS_15220 1590585 1591955 gene locus_tag LOCUS_15230 gene glpT 1590585 1591955 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831473.1 protein_id gnl|my_center|LOCUS_15230 1592036 1593037 gene locus_tag LOCUS_15240 1592036 1593037 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636730.1 protein_id gnl|my_center|LOCUS_15240 1593034 1594587 gene locus_tag LOCUS_15250 1593034 1594587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1594578 1595636 gene locus_tag LOCUS_15260 1594578 1595636 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762690.1 protein_id gnl|my_center|LOCUS_15260 1597164 1595626 gene locus_tag LOCUS_15270 1597164 1595626 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013509.1 protein_id gnl|my_center|LOCUS_15270 1597280 1597858 gene locus_tag LOCUS_15280 1597280 1597858 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013508.1 protein_id gnl|my_center|LOCUS_15280 1598465 1597863 gene locus_tag LOCUS_15290 1598465 1597863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1599308 1598466 gene locus_tag LOCUS_15300 1599308 1598466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1600239 1599298 gene locus_tag LOCUS_15310 1600239 1599298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1601911 1600271 gene locus_tag LOCUS_15320 1601911 1600271 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399737.1 protein_id gnl|my_center|LOCUS_15320 1603462 1601960 gene locus_tag LOCUS_15330 1603462 1601960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1604663 1603542 gene locus_tag LOCUS_15340 1604663 1603542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1606569 1605538 gene locus_tag LOCUS_15350 1606569 1605538 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013506.1 protein_id gnl|my_center|LOCUS_15350 1607757 1606618 gene locus_tag LOCUS_15360 1607757 1606618 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855724.1 protein_id gnl|my_center|LOCUS_15360 1608074 1608910 gene locus_tag LOCUS_15370 1608074 1608910 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013505.1 protein_id gnl|my_center|LOCUS_15370 1609949 1608912 gene locus_tag LOCUS_15380 1609949 1608912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1611648 1609996 gene locus_tag LOCUS_15390 1611648 1609996 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_15390 1612312 1611656 gene locus_tag LOCUS_15400 gene deoC 1612312 1611656 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776136.1 protein_id gnl|my_center|LOCUS_15400 1613711 1612347 gene locus_tag LOCUS_15410 gene tet(38) 1613711 1612347 CDS product tetracycline efflux MFS transporter Tet(38) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100299.1 protein_id gnl|my_center|LOCUS_15410 1614424 1613708 gene locus_tag LOCUS_15420 gene deoD 1614424 1613708 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843292.1 protein_id gnl|my_center|LOCUS_15420 1615893 1615726 gene locus_tag LOCUS_15430 1615893 1615726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1617004 1615904 gene locus_tag LOCUS_15440 1617004 1615904 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096457649.1 protein_id gnl|my_center|LOCUS_15440 1618241 1617210 gene locus_tag LOCUS_15450 1618241 1617210 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989862.1 protein_id gnl|my_center|LOCUS_15450 1618390 1620207 gene locus_tag LOCUS_15460 gene leuA 1618390 1620207 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015439406.1 protein_id gnl|my_center|LOCUS_15460 1620222 1621019 gene locus_tag LOCUS_15470 1620222 1621019 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546159.1 protein_id gnl|my_center|LOCUS_15470 1621068 1622144 gene locus_tag LOCUS_15480 1621068 1622144 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013503.1 protein_id gnl|my_center|LOCUS_15480 1622165 1623427 gene locus_tag LOCUS_15490 1622165 1623427 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013502.1 protein_id gnl|my_center|LOCUS_15490 1623429 1624181 gene locus_tag LOCUS_15500 1623429 1624181 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013501.1 protein_id gnl|my_center|LOCUS_15500 1624843 1624187 gene locus_tag LOCUS_15510 1624843 1624187 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013500.1 protein_id gnl|my_center|LOCUS_15510 1625167 1624847 gene locus_tag LOCUS_15520 1625167 1624847 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855676.1 protein_id gnl|my_center|LOCUS_15520 1627199 1625238 gene locus_tag LOCUS_15530 1627199 1625238 CDS product DNA polymerase III subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013499.1 protein_id gnl|my_center|LOCUS_15530 1627923 1627372 gene locus_tag LOCUS_15540 1627923 1627372 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855671.1 protein_id gnl|my_center|LOCUS_15540 1629186 1627927 gene locus_tag LOCUS_15550 1629186 1627927 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222431737.1 protein_id gnl|my_center|LOCUS_15550 1629539 1629625 gene locus_tag LOCUS_t00300 1629539 1629625 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1629906 1630655 gene locus_tag LOCUS_15560 gene idnO 1629906 1630655 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210264.1 protein_id gnl|my_center|LOCUS_15560 1630658 1631629 gene locus_tag LOCUS_15570 1630658 1631629 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027915.1 protein_id gnl|my_center|LOCUS_15570 1631626 1632129 gene locus_tag LOCUS_15580 1631626 1632129 CDS product gluconokinase, GntK/IdnK-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015160.1 protein_id gnl|my_center|LOCUS_15580 1633514 1632126 gene locus_tag LOCUS_15590 1633514 1632126 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015481.1 protein_id gnl|my_center|LOCUS_15590 1634487 1633594 gene locus_tag LOCUS_15600 gene gluQRS 1634487 1633594 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013493.1 protein_id gnl|my_center|LOCUS_15600 1635789 1634497 gene locus_tag LOCUS_15610 gene tgt 1635789 1634497 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309519.1 protein_id gnl|my_center|LOCUS_15610 1638405 1636069 gene locus_tag LOCUS_15620 1638405 1636069 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013489.1 protein_id gnl|my_center|LOCUS_15620 1638920 1638753 gene locus_tag LOCUS_15630 1638920 1638753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1639432 1638920 gene locus_tag LOCUS_15640 1639432 1638920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1639760 1639670 gene locus_tag LOCUS_t00310 1639760 1639670 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1640250 1639807 gene locus_tag LOCUS_15650 gene tadA 1640250 1639807 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855650.1 protein_id gnl|my_center|LOCUS_15650 1640741 1640289 gene locus_tag LOCUS_15660 1640741 1640289 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863394.1 protein_id gnl|my_center|LOCUS_15660 1640779 1641789 gene locus_tag LOCUS_15670 1640779 1641789 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013487.1 protein_id gnl|my_center|LOCUS_15670 1641930 1642454 gene locus_tag LOCUS_15680 1641930 1642454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1643042 1643347 gene locus_tag LOCUS_15690 1643042 1643347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1646807 1643715 gene locus_tag LOCUS_15700 1646807 1643715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 1647692 1646901 gene locus_tag LOCUS_15710 1647692 1646901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1648549 1647692 gene locus_tag LOCUS_15720 1648549 1647692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1650494 1648782 gene locus_tag LOCUS_15730 1650494 1648782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1650634 1650870 gene locus_tag LOCUS_15740 1650634 1650870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1651167 1652105 gene locus_tag LOCUS_15750 1651167 1652105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1652619 1655888 gene locus_tag LOCUS_15760 1652619 1655888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1656525 1655968 gene locus_tag LOCUS_15770 gene pdxT 1656525 1655968 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013889.1 protein_id gnl|my_center|LOCUS_15770 1657421 1656519 gene locus_tag LOCUS_15780 gene pdxS 1657421 1656519 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858119.1 protein_id gnl|my_center|LOCUS_15780 1657503 1658867 gene locus_tag LOCUS_15790 gene pdxR 1657503 1658867 CDS product pyridoxine biosynthesis transcriptional regulator PdxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013887.1 protein_id gnl|my_center|LOCUS_15790 1660087 1658864 gene locus_tag LOCUS_15800 1660087 1658864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1660777 1660704 gene locus_tag LOCUS_t00320 1660777 1660704 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1662428 1660854 gene locus_tag LOCUS_15810 1662428 1660854 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_15810 1662950 1662877 gene locus_tag LOCUS_t00330 1662950 1662877 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1663086 1662997 gene locus_tag LOCUS_t00340 1663086 1662997 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1663194 1664228 gene locus_tag LOCUS_15820 gene hisC 1663194 1664228 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013481.1 protein_id gnl|my_center|LOCUS_15820 1664498 1664413 gene locus_tag LOCUS_t00350 1664498 1664413 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1664585 1665532 gene locus_tag LOCUS_15830 1664585 1665532 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857642.1 protein_id gnl|my_center|LOCUS_15830 1666722 1665529 gene locus_tag LOCUS_15840 1666722 1665529 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013468.1 protein_id gnl|my_center|LOCUS_15840 1666859 1667719 gene locus_tag LOCUS_15850 1666859 1667719 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857646.1 protein_id gnl|my_center|LOCUS_15850 1667738 1668517 gene locus_tag LOCUS_15860 1667738 1668517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013466.1 protein_id gnl|my_center|LOCUS_15860 1669661 1668624 gene locus_tag LOCUS_15870 1669661 1668624 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458881.1 protein_id gnl|my_center|LOCUS_15870 1670597 1669746 gene locus_tag LOCUS_15880 1670597 1669746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1671493 1670594 gene locus_tag LOCUS_15890 gene troC 1671493 1670594 CDS product transition metal ABC transporter permease subunit TroC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677722.1 protein_id gnl|my_center|LOCUS_15890 1672224 1671490 gene locus_tag LOCUS_15900 1672224 1671490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_15900 1673288 1672323 gene locus_tag LOCUS_15910 1673288 1672323 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256106.1 protein_id gnl|my_center|LOCUS_15910 1673462 1674379 gene locus_tag LOCUS_15920 1673462 1674379 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013464.1 protein_id gnl|my_center|LOCUS_15920 1675232 1674513 gene locus_tag LOCUS_15930 1675232 1674513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15930 1675920 1675501 gene locus_tag LOCUS_15940 1675920 1675501 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013462.1 protein_id gnl|my_center|LOCUS_15940 1676480 1675932 gene locus_tag LOCUS_15950 1676480 1675932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1676881 1676477 gene locus_tag LOCUS_15960 1676881 1676477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1676940 1677188 gene locus_tag LOCUS_15970 1676940 1677188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1677305 1678771 gene locus_tag LOCUS_15980 1677305 1678771 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863441.1 protein_id gnl|my_center|LOCUS_15980 1678791 1679552 gene locus_tag LOCUS_15990 1678791 1679552 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013458.1 protein_id gnl|my_center|LOCUS_15990 1679747 1681747 gene locus_tag LOCUS_16000 1679747 1681747 CDS product galactan 5-O-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857673.1 protein_id gnl|my_center|LOCUS_16000 1681740 1685165 gene locus_tag LOCUS_16010 1681740 1685165 CDS product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013456.1 protein_id gnl|my_center|LOCUS_16010 1685391 1685828 gene locus_tag LOCUS_16020 1685391 1685828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1686757 1685849 gene locus_tag LOCUS_16030 1686757 1685849 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776965.1 protein_id gnl|my_center|LOCUS_16030 1687667 1686747 gene locus_tag LOCUS_16040 1687667 1686747 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013432.1 protein_id gnl|my_center|LOCUS_16040 1688296 1687664 gene locus_tag LOCUS_16050 1688296 1687664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1688339 1690333 gene locus_tag LOCUS_16060 1688339 1690333 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013430.1 protein_id gnl|my_center|LOCUS_16060 1690967 1690341 gene locus_tag LOCUS_16070 1690967 1690341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863725.1 protein_id gnl|my_center|LOCUS_16070 1691107 1692027 gene locus_tag LOCUS_16080 1691107 1692027 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013428.1 protein_id gnl|my_center|LOCUS_16080 1692342 1692037 gene locus_tag LOCUS_16090 1692342 1692037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1693172 1692348 gene locus_tag LOCUS_16100 1693172 1692348 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857162.1 protein_id gnl|my_center|LOCUS_16100 1693465 1693172 gene locus_tag LOCUS_16110 1693465 1693172 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857164.1 protein_id gnl|my_center|LOCUS_16110 1693855 1693592 gene locus_tag LOCUS_16120 1693855 1693592 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681985.1 protein_id gnl|my_center|LOCUS_16120 1694075 1693839 gene locus_tag LOCUS_16130 1694075 1693839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1694421 1694236 gene locus_tag LOCUS_16140 1694421 1694236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1694578 1695261 gene locus_tag LOCUS_16150 1694578 1695261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1696149 1695472 gene locus_tag LOCUS_16160 1696149 1695472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1696994 1696146 gene locus_tag LOCUS_16170 1696994 1696146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1698032 1697274 gene locus_tag LOCUS_16180 1698032 1697274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1698344 1698141 gene locus_tag LOCUS_16190 1698344 1698141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1698696 1698298 gene locus_tag LOCUS_16200 1698696 1698298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16200 1699483 1698707 gene locus_tag LOCUS_16210 1699483 1698707 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856628.1 protein_id gnl|my_center|LOCUS_16210 1700057 1699440 gene locus_tag LOCUS_16220 1700057 1699440 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015424.1 protein_id gnl|my_center|LOCUS_16220 1700685 1700080 gene locus_tag LOCUS_16230 1700685 1700080 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013424.1 protein_id gnl|my_center|LOCUS_16230 1700791 1701162 gene locus_tag LOCUS_16240 1700791 1701162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1701152 1703497 gene locus_tag LOCUS_16250 1701152 1703497 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013422.1 protein_id gnl|my_center|LOCUS_16250 1704257 1703487 gene locus_tag LOCUS_16260 1704257 1703487 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283863.1 protein_id gnl|my_center|LOCUS_16260 1704340 1704840 gene locus_tag LOCUS_16270 1704340 1704840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1704845 1705897 gene locus_tag LOCUS_16280 1704845 1705897 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013419.1 protein_id gnl|my_center|LOCUS_16280 1706303 1705875 gene locus_tag LOCUS_16290 1706303 1705875 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224812.1 protein_id gnl|my_center|LOCUS_16290 1707962 1706349 gene locus_tag LOCUS_16300 1707962 1706349 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013418.1 protein_id gnl|my_center|LOCUS_16300 1709059 1707974 gene locus_tag LOCUS_16310 1709059 1707974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1710580 1709210 gene locus_tag LOCUS_16320 1710580 1709210 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567734.1 protein_id gnl|my_center|LOCUS_16320 1711017 1711946 gene locus_tag LOCUS_16330 1711017 1711946 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283847.1 protein_id gnl|my_center|LOCUS_16330 1712497 1711943 gene locus_tag LOCUS_16340 1712497 1711943 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013406.1 protein_id gnl|my_center|LOCUS_16340 1713730 1714017 gene locus_tag LOCUS_16350 1713730 1714017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1713932 1714597 gene locus_tag LOCUS_16360 1713932 1714597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1715180 1714602 gene locus_tag LOCUS_16370 1715180 1714602 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013575.1 protein_id gnl|my_center|LOCUS_16370 1715277 1716059 gene locus_tag LOCUS_16380 1715277 1716059 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013373.1 protein_id gnl|my_center|LOCUS_16380 1716154 1716912 gene locus_tag LOCUS_16390 1716154 1716912 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015522.1 protein_id gnl|my_center|LOCUS_16390 1717159 1718226 gene locus_tag LOCUS_16400 1717159 1718226 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112786.1 protein_id gnl|my_center|LOCUS_16400 1718632 1718213 gene locus_tag LOCUS_16410 1718632 1718213 CDS product DUF2871 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737904.1 protein_id gnl|my_center|LOCUS_16410 1719995 1718655 gene locus_tag LOCUS_16420 1719995 1718655 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013780.1 protein_id gnl|my_center|LOCUS_16420 1720417 1720010 gene locus_tag LOCUS_16430 1720417 1720010 CDS product iron chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989448.1 protein_id gnl|my_center|LOCUS_16430 1721913 1720435 gene locus_tag LOCUS_16440 1721913 1720435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014256.1 protein_id gnl|my_center|LOCUS_16440 1722761 1722003 gene locus_tag LOCUS_16450 1722761 1722003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065320.1 protein_id gnl|my_center|LOCUS_16450 1723806 1722763 gene locus_tag LOCUS_16460 1723806 1722763 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243562.1 protein_id gnl|my_center|LOCUS_16460 1724994 1723807 gene locus_tag LOCUS_16470 1724994 1723807 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061356.1 protein_id gnl|my_center|LOCUS_16470 1725642 1725382 gene locus_tag LOCUS_16480 1725642 1725382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013366.1 protein_id gnl|my_center|LOCUS_16480 1726637 1725642 gene locus_tag LOCUS_16490 gene bioB 1726637 1725642 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861135.1 protein_id gnl|my_center|LOCUS_16490 1726715 1728061 gene locus_tag LOCUS_16500 1726715 1728061 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015415.1 protein_id gnl|my_center|LOCUS_16500 1728072 1728239 gene locus_tag LOCUS_16510 1728072 1728239 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730673.1 protein_id gnl|my_center|LOCUS_16510 1728303 1729070 gene locus_tag LOCUS_16520 1728303 1729070 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776341.1 protein_id gnl|my_center|LOCUS_16520 1730777 1729137 gene locus_tag LOCUS_16530 1730777 1729137 CDS product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936521.1 protein_id gnl|my_center|LOCUS_16530 1731008 1731253 gene locus_tag LOCUS_16540 1731008 1731253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1731280 1731864 gene locus_tag LOCUS_16550 1731280 1731864 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977103.1 protein_id gnl|my_center|LOCUS_16550 1731861 1732469 gene locus_tag LOCUS_16560 1731861 1732469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1732479 1733309 gene locus_tag LOCUS_16570 1732479 1733309 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776968.1 protein_id gnl|my_center|LOCUS_16570 1733300 1733941 gene locus_tag LOCUS_16580 1733300 1733941 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143979554.1 protein_id gnl|my_center|LOCUS_16580 1733948 1734622 gene locus_tag LOCUS_16590 1733948 1734622 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776966.1 protein_id gnl|my_center|LOCUS_16590 1734976 1735317 gene locus_tag LOCUS_16600 1734976 1735317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1735476 1736642 gene locus_tag LOCUS_16610 1735476 1736642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1736642 1737301 gene locus_tag LOCUS_16620 1736642 1737301 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776062.1 protein_id gnl|my_center|LOCUS_16620 1737340 1738041 gene locus_tag LOCUS_16630 1737340 1738041 CDS product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986262.1 protein_id gnl|my_center|LOCUS_16630 1738034 1739473 gene locus_tag LOCUS_16640 1738034 1739473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1739625 1739888 gene locus_tag LOCUS_16650 1739625 1739888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16650 1740495 1740758 gene locus_tag LOCUS_16660 1740495 1740758 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104405.1 protein_id gnl|my_center|LOCUS_16660 1740763 1741278 gene locus_tag LOCUS_16670 1740763 1741278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1741635 1741423 gene locus_tag LOCUS_16680 1741635 1741423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1741685 1741984 gene locus_tag LOCUS_16690 1741685 1741984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1742273 1742189 gene locus_tag LOCUS_t00360 1742273 1742189 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1742494 1743360 gene locus_tag LOCUS_16700 1742494 1743360 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861088.1 protein_id gnl|my_center|LOCUS_16700 1743374 1743862 gene locus_tag LOCUS_16710 1743374 1743862 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861086.1 protein_id gnl|my_center|LOCUS_16710 1743862 1745316 gene locus_tag LOCUS_16720 1743862 1745316 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013344.1 protein_id gnl|my_center|LOCUS_16720 1745317 1746666 gene locus_tag LOCUS_16730 1745317 1746666 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013343.1 protein_id gnl|my_center|LOCUS_16730 1746663 1748123 gene locus_tag LOCUS_16740 1746663 1748123 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013342.1 protein_id gnl|my_center|LOCUS_16740 1748136 1749662 gene locus_tag LOCUS_16750 1748136 1749662 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013341.1 protein_id gnl|my_center|LOCUS_16750 1749659 1751668 gene locus_tag LOCUS_16760 gene pknB 1749659 1751668 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013340.1 protein_id gnl|my_center|LOCUS_16760 1751785 1752054 gene locus_tag LOCUS_16770 gene crgA 1751785 1752054 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861074.1 protein_id gnl|my_center|LOCUS_16770 1753485 1752697 gene locus_tag LOCUS_16780 1753485 1752697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16780 1753696 1753514 gene locus_tag LOCUS_16790 1753696 1753514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16790 1753956 1754438 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctggggttcagttctcaaaaaccctgatagacttc 1754818 1754489 gene locus_tag LOCUS_16800 1754818 1754489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1755716 1754802 gene locus_tag LOCUS_16810 gene cas1 1755716 1754802 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_16810 1758974 1755720 gene locus_tag LOCUS_16820 1758974 1755720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1760945 1760091 gene locus_tag LOCUS_16830 1760945 1760091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1761952 1760942 gene locus_tag LOCUS_16840 1761952 1760942 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014840.1 protein_id gnl|my_center|LOCUS_16840 1762737 1761952 gene locus_tag LOCUS_16850 1762737 1761952 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857587.1 protein_id gnl|my_center|LOCUS_16850 1762939 1762739 gene locus_tag LOCUS_16860 1762939 1762739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1764011 1762923 gene locus_tag LOCUS_16870 gene thiO 1764011 1762923 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861894.1 protein_id gnl|my_center|LOCUS_16870 1764676 1764008 gene locus_tag LOCUS_16880 1764676 1764008 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014839.1 protein_id gnl|my_center|LOCUS_16880 1766459 1764660 gene locus_tag LOCUS_16890 gene thiC 1766459 1764660 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014273.1 protein_id gnl|my_center|LOCUS_16890 1766428 1766700 gene locus_tag LOCUS_16900 1766428 1766700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1768152 1767535 gene locus_tag LOCUS_16910 1768152 1767535 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855383.1 protein_id gnl|my_center|LOCUS_16910 1768736 1769086 gene locus_tag LOCUS_16920 1768736 1769086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1769549 1769704 gene locus_tag LOCUS_16930 1769549 1769704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1770318 1769794 gene locus_tag LOCUS_16940 1770318 1769794 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031512456.1 protein_id gnl|my_center|LOCUS_16940 1770399 1771007 gene locus_tag LOCUS_16950 1770399 1771007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013334.1 protein_id gnl|my_center|LOCUS_16950 1771816 1771055 gene locus_tag LOCUS_16960 1771816 1771055 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013333.1 protein_id gnl|my_center|LOCUS_16960 1772848 1771817 gene locus_tag LOCUS_16970 1772848 1771817 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855379.1 protein_id gnl|my_center|LOCUS_16970 1773843 1772845 gene locus_tag LOCUS_16980 1773843 1772845 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013332.1 protein_id gnl|my_center|LOCUS_16980 1773986 1774243 gene locus_tag LOCUS_16990 1773986 1774243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1774266 1774619 gene locus_tag LOCUS_17000 1774266 1774619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17000 1774744 1774616 gene locus_tag LOCUS_17010 1774744 1774616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1775103 1775030 gene locus_tag LOCUS_t00370 1775103 1775030 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1775217 1775615 gene locus_tag LOCUS_17020 1775217 1775615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1776157 1776084 gene locus_tag LOCUS_t00380 1776157 1776084 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1776243 1776167 gene locus_tag LOCUS_t00390 1776243 1776167 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1777957 1776311 gene locus_tag LOCUS_17030 1777957 1776311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014865.1 protein_id gnl|my_center|LOCUS_17030 1779560 1777947 gene locus_tag LOCUS_17040 1779560 1777947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1780152 1779679 gene locus_tag LOCUS_17050 1780152 1779679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1780649 1782319 gene locus_tag LOCUS_17060 1780649 1782319 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223995.1 protein_id gnl|my_center|LOCUS_17060 1782392 1783114 gene locus_tag LOCUS_17070 1782392 1783114 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727054.1 protein_id gnl|my_center|LOCUS_17070 1783384 1783311 gene locus_tag LOCUS_t00400 1783384 1783311 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1783470 1783394 gene locus_tag LOCUS_t00410 1783470 1783394 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1783926 1783582 gene locus_tag LOCUS_17080 1783926 1783582 CDS product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860996.1 protein_id gnl|my_center|LOCUS_17080 1786496 1783926 gene locus_tag LOCUS_17090 gene gyrA 1786496 1783926 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855346.1 protein_id gnl|my_center|LOCUS_17090 1786607 1786807 gene locus_tag LOCUS_17100 1786607 1786807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013316.1 protein_id gnl|my_center|LOCUS_17100 1786812 1787084 gene locus_tag LOCUS_17110 1786812 1787084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1787345 1787782 gene locus_tag LOCUS_17120 1787345 1787782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013314.1 protein_id gnl|my_center|LOCUS_17120 1789894 1787849 gene locus_tag LOCUS_17130 gene gyrB 1789894 1787849 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855339.1 protein_id gnl|my_center|LOCUS_17130 1790559 1790008 gene locus_tag LOCUS_17140 1790559 1790008 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855338.1 protein_id gnl|my_center|LOCUS_17140 1791742 1790549 gene locus_tag LOCUS_17150 gene recF 1791742 1790549 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013310.1 protein_id gnl|my_center|LOCUS_17150 1792968 1791781 gene locus_tag LOCUS_17160 gene dnaN 1792968 1791781 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855336.1 protein_id gnl|my_center|LOCUS_17160 1795283 1793607 gene locus_tag LOCUS_17170 gene dnaA 1795283 1793607 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013309.1 protein_id gnl|my_center|LOCUS_17170 1796210 1796353 gene locus_tag LOCUS_17180 gene rpmH 1796210 1796353 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855320.1 protein_id gnl|my_center|LOCUS_17180 1796385 1796744 gene locus_tag LOCUS_17190 gene rnpA 1796385 1796744 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860977.1 protein_id gnl|my_center|LOCUS_17190 1797037 1797990 gene locus_tag LOCUS_17200 gene yidC 1797037 1797990 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855313.1 protein_id gnl|my_center|LOCUS_17200 1798112 1798783 gene locus_tag LOCUS_17210 gene rsmG 1798112 1798783 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855311.1 protein_id gnl|my_center|LOCUS_17210 1798906 1799922 gene locus_tag LOCUS_17220 1798906 1799922 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855308.1 protein_id gnl|my_center|LOCUS_17220 1799929 1801032 gene locus_tag LOCUS_17230 1799929 1801032 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855307.1 protein_id gnl|my_center|LOCUS_17230 1802281 1801100 gene locus_tag LOCUS_17240 1802281 1801100 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855304.1 protein_id gnl|my_center|LOCUS_17240 1802652 1802329 gene locus_tag LOCUS_17250 gene trxA 1802652 1802329 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855302.1 protein_id gnl|my_center|LOCUS_17250 1803611 1802667 gene locus_tag LOCUS_17260 gene trxB 1803611 1802667 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855300.1 protein_id gnl|my_center|LOCUS_17260 1804349 1803747 gene locus_tag LOCUS_17270 1804349 1803747 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015623.1 protein_id gnl|my_center|LOCUS_17270 1807838 1804509 gene locus_tag LOCUS_17280 1807838 1804509 CDS product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015622.1 protein_id gnl|my_center|LOCUS_17280 1810662 1807948 gene locus_tag LOCUS_17290 1810662 1807948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015621.1 protein_id gnl|my_center|LOCUS_17290 1811444 1810659 gene locus_tag LOCUS_17300 1811444 1810659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1811671 1813158 gene locus_tag LOCUS_17310 1811671 1813158 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855284.1 protein_id gnl|my_center|LOCUS_17310 1813159 1813755 gene locus_tag LOCUS_17320 1813159 1813755 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855283.1 protein_id gnl|my_center|LOCUS_17320 1813756 1814487 gene locus_tag LOCUS_17330 1813756 1814487 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015619.1 protein_id gnl|my_center|LOCUS_17330 1814484 1814861 gene locus_tag LOCUS_17340 1814484 1814861 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015618.1 protein_id gnl|my_center|LOCUS_17340 1815296 1814970 gene locus_tag LOCUS_17350 1815296 1814970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015617.1 protein_id gnl|my_center|LOCUS_17350 1816261 1815293 gene locus_tag LOCUS_17360 1816261 1815293 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855200.1 protein_id gnl|my_center|LOCUS_17360 1816635 1816282 gene locus_tag LOCUS_17370 1816635 1816282 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855195.1 protein_id gnl|my_center|LOCUS_17370 1816797 1817000 gene locus_tag LOCUS_17380 1816797 1817000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1817087 1817422 gene locus_tag LOCUS_17390 1817087 1817422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1818752 1817526 gene locus_tag LOCUS_17400 gene trpB 1818752 1817526 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567953.1 protein_id gnl|my_center|LOCUS_17400 1819089 1819880 gene locus_tag LOCUS_17410 gene panB 1819089 1819880 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411489.1 protein_id gnl|my_center|LOCUS_17410 1820737 1819877 gene locus_tag LOCUS_17420 gene panC 1820737 1819877 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092170.1 protein_id gnl|my_center|LOCUS_17420 1821111 1820734 gene locus_tag LOCUS_17430 1821111 1820734 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015574.1 protein_id gnl|my_center|LOCUS_17430 1822629 1821172 gene locus_tag LOCUS_17440 gene trpCF 1822629 1821172 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015582.1 protein_id gnl|my_center|LOCUS_17440 1823644 1822619 gene locus_tag LOCUS_17450 gene trpD 1823644 1822619 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855178.1 protein_id gnl|my_center|LOCUS_17450 1824303 1823659 gene locus_tag LOCUS_17460 1824303 1823659 CDS product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855176.1 protein_id gnl|my_center|LOCUS_17460 1825628 1824300 gene locus_tag LOCUS_17470 1825628 1824300 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015581.1 protein_id gnl|my_center|LOCUS_17470 1825827 1825600 gene locus_tag LOCUS_17480 1825827 1825600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17480 1827191 1825860 gene locus_tag LOCUS_17490 gene trpB 1827191 1825860 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567953.1 protein_id gnl|my_center|LOCUS_17490 1827905 1827444 gene locus_tag LOCUS_17500 1827905 1827444 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855171.1 protein_id gnl|my_center|LOCUS_17500 1828104 1829348 gene locus_tag LOCUS_17510 1828104 1829348 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015579.1 protein_id gnl|my_center|LOCUS_17510 1829530 1830414 gene locus_tag LOCUS_17520 1829530 1830414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1830478 1831971 gene locus_tag LOCUS_17530 1830478 1831971 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015555.1 protein_id gnl|my_center|LOCUS_17530 1832617 1831979 gene locus_tag LOCUS_17540 1832617 1831979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1832740 1833447 gene locus_tag LOCUS_17550 1832740 1833447 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567731.1 protein_id gnl|my_center|LOCUS_17550 1834624 1833458 gene locus_tag LOCUS_17560 1834624 1833458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1835334 1834642 gene locus_tag LOCUS_17570 1835334 1834642 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015418.1 protein_id gnl|my_center|LOCUS_17570 1836098 1835340 gene locus_tag LOCUS_17580 1836098 1835340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015419.1 protein_id gnl|my_center|LOCUS_17580 1837189 1836194 gene locus_tag LOCUS_17590 1837189 1836194 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015421.1 protein_id gnl|my_center|LOCUS_17590 1837226 1838446 gene locus_tag LOCUS_17600 1837226 1838446 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014060.1 protein_id gnl|my_center|LOCUS_17600 1840356 1839037 gene locus_tag LOCUS_17610 1840356 1839037 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068364.1 protein_id gnl|my_center|LOCUS_17610 1841210 1840542 gene locus_tag LOCUS_17620 gene dhaM 1841210 1840542 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229493.1 protein_id gnl|my_center|LOCUS_17620 1841848 1841207 gene locus_tag LOCUS_17630 gene dhaL 1841848 1841207 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229494.1 protein_id gnl|my_center|LOCUS_17630 1842847 1841852 gene locus_tag LOCUS_17640 gene dhaK 1842847 1841852 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229495.1 protein_id gnl|my_center|LOCUS_17640 1844676 1843054 gene locus_tag LOCUS_17650 1844676 1843054 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015583.1 protein_id gnl|my_center|LOCUS_17650 1845496 1844702 gene locus_tag LOCUS_17660 1845496 1844702 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015584.1 protein_id gnl|my_center|LOCUS_17660 1847055 1845664 gene locus_tag LOCUS_17670 1847055 1845664 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086774.1 protein_id gnl|my_center|LOCUS_17670 1847507 1849408 gene locus_tag LOCUS_17680 1847507 1849408 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014501.1 protein_id gnl|my_center|LOCUS_17680 1849505 1850050 gene locus_tag LOCUS_17690 1849505 1850050 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015564.1 protein_id gnl|my_center|LOCUS_17690 1850646 1850047 gene locus_tag LOCUS_17700 1850646 1850047 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230184.1 protein_id gnl|my_center|LOCUS_17700 1851896 1850643 gene locus_tag LOCUS_17710 1851896 1850643 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803690.1 protein_id gnl|my_center|LOCUS_17710 1852027 1854627 gene locus_tag LOCUS_17720 1852027 1854627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1854763 1855797 gene locus_tag LOCUS_17730 1854763 1855797 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803689.1 protein_id gnl|my_center|LOCUS_17730 1855794 1856459 gene locus_tag LOCUS_17740 1855794 1856459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977459.1 protein_id gnl|my_center|LOCUS_17740 1856516 1857238 gene locus_tag LOCUS_17750 1856516 1857238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 1857487 1857320 gene locus_tag LOCUS_17760 1857487 1857320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1857526 1860402 gene locus_tag LOCUS_17770 gene leuS 1857526 1860402 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015573.1 protein_id gnl|my_center|LOCUS_17770 1860853 1860635 gene locus_tag LOCUS_17780 1860853 1860635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1861094 1861747 gene locus_tag LOCUS_17790 1861094 1861747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 1861837 1863525 gene locus_tag LOCUS_17800 1861837 1863525 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804193.1 protein_id gnl|my_center|LOCUS_17800 1863707 1864978 gene locus_tag LOCUS_17810 1863707 1864978 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 protein_id gnl|my_center|LOCUS_17810 1865087 1864923 gene locus_tag LOCUS_17820 1865087 1864923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1865386 1867200 gene locus_tag LOCUS_17830 1865386 1867200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1867281 1868888 gene locus_tag LOCUS_17840 1867281 1868888 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414057.1 protein_id gnl|my_center|LOCUS_17840 1868888 1870108 gene locus_tag LOCUS_17850 1868888 1870108 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926902.1 protein_id gnl|my_center|LOCUS_17850 1870101 1873301 gene locus_tag LOCUS_17860 1870101 1873301 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_17860 1873384 1875111 gene locus_tag LOCUS_17870 1873384 1875111 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776777.1 protein_id gnl|my_center|LOCUS_17870 1875263 1876978 gene locus_tag LOCUS_17880 1875263 1876978 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013327.1 protein_id gnl|my_center|LOCUS_17880 1877715 1877086 gene locus_tag LOCUS_17890 1877715 1877086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1878493 1877732 gene locus_tag LOCUS_17900 1878493 1877732 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729922.1 protein_id gnl|my_center|LOCUS_17900 1879536 1878490 gene locus_tag LOCUS_17910 1879536 1878490 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510662.1 protein_id gnl|my_center|LOCUS_17910 1880530 1879541 gene locus_tag LOCUS_17920 1880530 1879541 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016726.1 protein_id gnl|my_center|LOCUS_17920 1880810 1881919 gene locus_tag LOCUS_17930 1880810 1881919 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528694.1 protein_id gnl|my_center|LOCUS_17930 1881976 1882722 gene locus_tag LOCUS_17940 1881976 1882722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 1882837 1883937 gene locus_tag LOCUS_17950 1882837 1883937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 1885464 1883950 gene locus_tag LOCUS_17960 1885464 1883950 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013753.1 protein_id gnl|my_center|LOCUS_17960 1886334 1885480 gene locus_tag LOCUS_17970 1886334 1885480 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855116.1 protein_id gnl|my_center|LOCUS_17970 1886422 1886913 gene locus_tag LOCUS_17980 gene dps 1886422 1886913 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861220.1 protein_id gnl|my_center|LOCUS_17980 1887687 1887049 gene locus_tag LOCUS_17990 1887687 1887049 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107019778.1 protein_id gnl|my_center|LOCUS_17990 1887874 1888812 gene locus_tag LOCUS_18000 1887874 1888812 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015551.1 protein_id gnl|my_center|LOCUS_18000 1888984 1889289 gene locus_tag LOCUS_18010 1888984 1889289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 1889925 1889452 gene locus_tag LOCUS_18020 1889925 1889452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861203.1 protein_id gnl|my_center|LOCUS_18020 1890608 1889937 gene locus_tag LOCUS_18030 1890608 1889937 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230982.1 protein_id gnl|my_center|LOCUS_18030 1891585 1890620 gene locus_tag LOCUS_18040 1891585 1890620 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855086.1 protein_id gnl|my_center|LOCUS_18040 1891984 1891595 gene locus_tag LOCUS_18050 gene carR 1891984 1891595 CDS product MarR family transcriptional regulator CarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855083.1 protein_id gnl|my_center|LOCUS_18050 1892164 1892526 gene locus_tag LOCUS_18060 1892164 1892526 CDS product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015548.1 protein_id gnl|my_center|LOCUS_18060 1892614 1894794 gene locus_tag LOCUS_18070 1892614 1894794 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015547.1 protein_id gnl|my_center|LOCUS_18070 1895007 1896410 gene locus_tag LOCUS_18080 1895007 1896410 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015546.1 protein_id gnl|my_center|LOCUS_18080 1896410 1896589 gene locus_tag LOCUS_18090 1896410 1896589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861194.1 protein_id gnl|my_center|LOCUS_18090 1896784 1897071 gene locus_tag LOCUS_18100 gene rpsF 1896784 1897071 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855074.1 protein_id gnl|my_center|LOCUS_18100 1897196 1897777 gene locus_tag LOCUS_18110 1897196 1897777 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015545.1 protein_id gnl|my_center|LOCUS_18110 1897908 1898360 gene locus_tag LOCUS_18120 gene rplI 1897908 1898360 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015544.1 protein_id gnl|my_center|LOCUS_18120 1898934 1900454 gene locus_tag LOCUS_18130 gene dnaB 1898934 1900454 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015543.1 protein_id gnl|my_center|LOCUS_18130 1901783 1900458 gene locus_tag LOCUS_18140 1901783 1900458 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855060.1 protein_id gnl|my_center|LOCUS_18140 1904112 1901881 gene locus_tag LOCUS_18150 1904112 1901881 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013619.1 protein_id gnl|my_center|LOCUS_18150 1904479 1904270 gene locus_tag LOCUS_18160 1904479 1904270 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860938.1 protein_id gnl|my_center|LOCUS_18160 1904687 1905070 gene locus_tag LOCUS_18170 gene trxA 1904687 1905070 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 protein_id gnl|my_center|LOCUS_18170 1905241 1906005 gene locus_tag LOCUS_18180 gene rsmP 1905241 1906005 CDS product rod-shaped morphology protein RsmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855053.1 protein_id gnl|my_center|LOCUS_18180 1907433 1906078 gene locus_tag LOCUS_18190 1907433 1906078 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015516.1 protein_id gnl|my_center|LOCUS_18190 1907673 1908047 gene locus_tag LOCUS_18200 1907673 1908047 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015515.1 protein_id gnl|my_center|LOCUS_18200 1908044 1908913 gene locus_tag LOCUS_18210 1908044 1908913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804332.1 protein_id gnl|my_center|LOCUS_18210 1909030 1908809 gene locus_tag LOCUS_18220 1909030 1908809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1909029 1909928 gene locus_tag LOCUS_18230 1909029 1909928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1910465 1911981 gene locus_tag LOCUS_r00070 1910465 1911981 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1912355 1915416 gene locus_tag LOCUS_r00080 1912355 1915416 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1915580 1915692 gene locus_tag LOCUS_r00090 1915580 1915692 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1917050 1916064 gene locus_tag LOCUS_18240 1917050 1916064 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015513.1 protein_id gnl|my_center|LOCUS_18240 1917352 1918254 gene locus_tag LOCUS_18250 1917352 1918254 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 protein_id gnl|my_center|LOCUS_18250 1918537 1918800 gene locus_tag LOCUS_18260 1918537 1918800 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015510.1 protein_id gnl|my_center|LOCUS_18260 1920878 1919571 gene locus_tag LOCUS_18270 gene yidC 1920878 1919571 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015508.1 protein_id gnl|my_center|LOCUS_18270 1921009 1921830 gene locus_tag LOCUS_18280 1921009 1921830 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015507.1 protein_id gnl|my_center|LOCUS_18280 1923299 1922052 gene locus_tag LOCUS_18290 gene uhpT 1923299 1922052 CDS product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455961.1 protein_id gnl|my_center|LOCUS_18290 1923186 1923467 gene locus_tag LOCUS_18300 1923186 1923467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 1924163 1923594 gene locus_tag LOCUS_18310 1924163 1923594 CDS product DUF2020 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015506.1 protein_id gnl|my_center|LOCUS_18310 1924162 1925442 gene locus_tag LOCUS_18320 1924162 1925442 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015505.1 protein_id gnl|my_center|LOCUS_18320 1925524 1926162 gene locus_tag LOCUS_18330 1925524 1926162 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862544.1 protein_id gnl|my_center|LOCUS_18330 1926537 1926220 gene locus_tag LOCUS_18340 1926537 1926220 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_18340 1927291 1926659 gene locus_tag LOCUS_18350 1927291 1926659 CDS product DUF6474 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015503.1 protein_id gnl|my_center|LOCUS_18350 1927814 1927437 gene locus_tag LOCUS_18360 1927814 1927437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1927866 1928975 gene locus_tag LOCUS_18370 1927866 1928975 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015502.1 protein_id gnl|my_center|LOCUS_18370 1928992 1930341 gene locus_tag LOCUS_18380 1928992 1930341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 1930874 1930338 gene locus_tag LOCUS_18390 1930874 1930338 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704526.1 protein_id gnl|my_center|LOCUS_18390 1931722 1931123 gene locus_tag LOCUS_18400 1931722 1931123 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862560.1 protein_id gnl|my_center|LOCUS_18400 1931876 1932538 gene locus_tag LOCUS_18410 gene msrA 1931876 1932538 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015498.1 protein_id gnl|my_center|LOCUS_18410 1933572 1932745 gene locus_tag LOCUS_18420 gene nadC 1933572 1932745 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082204.1 protein_id gnl|my_center|LOCUS_18420 1934789 1933560 gene locus_tag LOCUS_18430 1934789 1933560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 1935703 1934786 gene locus_tag LOCUS_18440 gene nadA 1935703 1934786 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296580.1 protein_id gnl|my_center|LOCUS_18440 1936000 1936485 gene locus_tag LOCUS_18450 1936000 1936485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1936844 1937800 gene locus_tag LOCUS_18460 1936844 1937800 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015483.1 protein_id gnl|my_center|LOCUS_18460 1937944 1938627 gene locus_tag LOCUS_18470 1937944 1938627 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053545848.1 protein_id gnl|my_center|LOCUS_18470 1938639 1939544 gene locus_tag LOCUS_18480 1938639 1939544 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284785.1 protein_id gnl|my_center|LOCUS_18480 1941399 1939606 gene locus_tag LOCUS_18490 1941399 1939606 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068225.1 protein_id gnl|my_center|LOCUS_18490 1941590 1943080 gene locus_tag LOCUS_18500 1941590 1943080 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776828.1 protein_id gnl|my_center|LOCUS_18500 1944504 1943209 gene locus_tag LOCUS_18510 1944504 1943209 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197702410.1 protein_id gnl|my_center|LOCUS_18510 1944716 1947007 gene locus_tag LOCUS_18520 1944716 1947007 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527410.1 protein_id gnl|my_center|LOCUS_18520 1947707 1946991 gene locus_tag LOCUS_18530 1947707 1946991 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857812.1 protein_id gnl|my_center|LOCUS_18530 1948840 1947704 gene locus_tag LOCUS_18540 1948840 1947704 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066568791.1 protein_id gnl|my_center|LOCUS_18540 1948876 1949778 gene locus_tag LOCUS_18550 gene pheA 1948876 1949778 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862609.1 protein_id gnl|my_center|LOCUS_18550 1949805 1950449 gene locus_tag LOCUS_18560 1949805 1950449 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015472.1 protein_id gnl|my_center|LOCUS_18560 1951682 1950435 gene locus_tag LOCUS_18570 1951682 1950435 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_18570 1952104 1951757 gene locus_tag LOCUS_18580 1952104 1951757 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862613.1 protein_id gnl|my_center|LOCUS_18580 1953103 1952111 gene locus_tag LOCUS_18590 1953103 1952111 CDS product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857824.1 protein_id gnl|my_center|LOCUS_18590 1953872 1953114 gene locus_tag LOCUS_18600 1953872 1953114 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862621.1 protein_id gnl|my_center|LOCUS_18600 1953985 1955244 gene locus_tag LOCUS_18610 gene serS 1953985 1955244 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857828.1 protein_id gnl|my_center|LOCUS_18610 1955274 1956101 gene locus_tag LOCUS_18620 1955274 1956101 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015468.1 protein_id gnl|my_center|LOCUS_18620 1956114 1957946 gene locus_tag LOCUS_18630 1956114 1957946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 1958142 1959866 gene locus_tag LOCUS_18640 1958142 1959866 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080751.1 protein_id gnl|my_center|LOCUS_18640 1959866 1960606 gene locus_tag LOCUS_18650 1959866 1960606 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742072.1 protein_id gnl|my_center|LOCUS_18650 1960625 1962145 gene locus_tag LOCUS_18660 gene glpK 1960625 1962145 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857839.1 protein_id gnl|my_center|LOCUS_18660 1962708 1962529 gene locus_tag LOCUS_18670 1962708 1962529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1962877 1966131 gene locus_tag LOCUS_18680 gene hsdR 1962877 1966131 CDS product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122926.1 protein_id gnl|my_center|LOCUS_18680 1966128 1967537 gene locus_tag LOCUS_18690 1966128 1967537 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 protein_id gnl|my_center|LOCUS_18690 1967538 1968878 gene locus_tag LOCUS_18700 1967538 1968878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 1969219 1970304 gene locus_tag LOCUS_18710 1969219 1970304 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068364.1 protein_id gnl|my_center|LOCUS_18710 1970332 1970931 gene locus_tag LOCUS_18720 1970332 1970931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 1973399 1971636 gene locus_tag LOCUS_18730 1973399 1971636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1974415 1973618 gene locus_tag LOCUS_18740 1974415 1973618 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027480.1 protein_id gnl|my_center|LOCUS_18740 1974523 1975344 gene locus_tag LOCUS_18750 1974523 1975344 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263344.1 protein_id gnl|my_center|LOCUS_18750 1975334 1975699 gene locus_tag LOCUS_18760 1975334 1975699 CDS product DUF2255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644458.1 protein_id gnl|my_center|LOCUS_18760 1975754 1976419 gene locus_tag LOCUS_18770 1975754 1976419 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816623.1 protein_id gnl|my_center|LOCUS_18770 1976465 1976884 gene locus_tag LOCUS_18780 1976465 1976884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1977503 1977883 gene locus_tag LOCUS_18790 1977503 1977883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 1978716 1978009 gene locus_tag LOCUS_18800 1978716 1978009 CDS product IS6-like element IS1628 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014005.1 protein_id gnl|my_center|LOCUS_18800 1979058 1979252 gene locus_tag LOCUS_18810 1979058 1979252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1979256 1979648 gene locus_tag LOCUS_18820 1979256 1979648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1980552 1980755 gene locus_tag LOCUS_18830 1980552 1980755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1981333 1981869 gene locus_tag LOCUS_18840 1981333 1981869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 1981862 1982047 gene locus_tag LOCUS_18850 1981862 1982047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18850 1982191 1982637 gene locus_tag LOCUS_18860 1982191 1982637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 1982676 1983839 gene locus_tag LOCUS_18870 gene glf 1982676 1983839 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015466.1 protein_id gnl|my_center|LOCUS_18870 1985818 1984025 gene locus_tag LOCUS_18880 gene betA 1985818 1984025 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 protein_id gnl|my_center|LOCUS_18880 1986090 1988315 gene locus_tag LOCUS_18890 gene betT 1986090 1988315 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097646.1 protein_id gnl|my_center|LOCUS_18890 1988382 1989959 gene locus_tag LOCUS_18900 1988382 1989959 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292971.1 protein_id gnl|my_center|LOCUS_18900 1990000 1990515 gene locus_tag LOCUS_18910 1990000 1990515 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015463.1 protein_id gnl|my_center|LOCUS_18910 1990600 1992585 gene locus_tag LOCUS_18920 1990600 1992585 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284777.1 protein_id gnl|my_center|LOCUS_18920 1992585 1993079 gene locus_tag LOCUS_18930 1992585 1993079 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015460.1 protein_id gnl|my_center|LOCUS_18930 1993076 1994053 gene locus_tag LOCUS_18940 1993076 1994053 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015459.1 protein_id gnl|my_center|LOCUS_18940 1994081 1995760 gene locus_tag LOCUS_18950 gene aftB 1994081 1995760 CDS product beta-(1->2)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015458.1 protein_id gnl|my_center|LOCUS_18950 1995921 1996937 gene locus_tag LOCUS_18960 1995921 1996937 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015457.1 protein_id gnl|my_center|LOCUS_18960 1997091 1998224 gene locus_tag LOCUS_18970 1997091 1998224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1998407 2000323 gene locus_tag LOCUS_18980 1998407 2000323 CDS product protein PS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015455.1 protein_id gnl|my_center|LOCUS_18980 2000323 2000838 gene locus_tag LOCUS_18990 2000323 2000838 CDS product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015454.1 protein_id gnl|my_center|LOCUS_18990 2000844 2001755 gene locus_tag LOCUS_19000 2000844 2001755 CDS product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015453.1 protein_id gnl|my_center|LOCUS_19000 2001830 2003644 gene locus_tag LOCUS_19010 2001830 2003644 CDS product FadD32-like long-chain-fatty-acid--AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015452.1 protein_id gnl|my_center|LOCUS_19010 2003743 2008503 gene locus_tag LOCUS_19020 gene pks13 2003743 2008503 CDS product polyketide synthase Pks13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015451.1 protein_id gnl|my_center|LOCUS_19020 2008515 2010065 gene locus_tag LOCUS_19030 2008515 2010065 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857874.1 protein_id gnl|my_center|LOCUS_19030 2010194 2010895 gene locus_tag LOCUS_19040 2010194 2010895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19040 2011157 2011363 gene locus_tag LOCUS_19050 2011157 2011363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2011768 2012022 gene locus_tag LOCUS_19060 2011768 2012022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2012343 2014250 gene locus_tag LOCUS_19070 2012343 2014250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 2014674 2014450 gene locus_tag LOCUS_19080 2014674 2014450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2014863 2015039 gene locus_tag LOCUS_19090 2014863 2015039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2015708 2015352 gene locus_tag LOCUS_19100 2015708 2015352 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401978.1 protein_id gnl|my_center|LOCUS_19100 2016763 2015705 gene locus_tag LOCUS_19110 2016763 2015705 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015450.1 protein_id gnl|my_center|LOCUS_19110 2018990 2016750 gene locus_tag LOCUS_19120 2018990 2016750 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015449.1 protein_id gnl|my_center|LOCUS_19120 2019637 2019005 gene locus_tag LOCUS_19130 2019637 2019005 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857880.1 protein_id gnl|my_center|LOCUS_19130 2020401 2019622 gene locus_tag LOCUS_19140 gene trmB 2020401 2019622 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015448.1 protein_id gnl|my_center|LOCUS_19140 2020459 2020650 gene locus_tag LOCUS_19150 2020459 2020650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2020858 2022696 gene locus_tag LOCUS_19160 2020858 2022696 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015446.1 protein_id gnl|my_center|LOCUS_19160 2023455 2022721 gene locus_tag LOCUS_19170 2023455 2022721 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015445.1 protein_id gnl|my_center|LOCUS_19170 2023527 2024651 gene locus_tag LOCUS_19180 2023527 2024651 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015443.1 protein_id gnl|my_center|LOCUS_19180 2025946 2024534 gene locus_tag LOCUS_19190 2025946 2024534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015442.1 protein_id gnl|my_center|LOCUS_19190 2027031 2025937 gene locus_tag LOCUS_19200 2027031 2025937 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401257.1 protein_id gnl|my_center|LOCUS_19200 2027140 2028183 gene locus_tag LOCUS_19210 gene tmaT 2027140 2028183 CDS product trehalose corynomycolate mycolyl acetyltransferase TmaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015440.1 protein_id gnl|my_center|LOCUS_19210 2031152 2028075 gene locus_tag LOCUS_19220 2031152 2028075 CDS product DUF3367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853429.1 protein_id gnl|my_center|LOCUS_19220 2031491 2031153 gene locus_tag LOCUS_19230 2031491 2031153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2031376 2032527 gene locus_tag LOCUS_19240 2031376 2032527 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853452.1 protein_id gnl|my_center|LOCUS_19240 2032545 2034215 gene locus_tag LOCUS_19250 2032545 2034215 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015435.1 protein_id gnl|my_center|LOCUS_19250 2034238 2035029 gene locus_tag LOCUS_19260 2034238 2035029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 2035031 2036509 gene locus_tag LOCUS_19270 2035031 2036509 CDS product DUF5129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015462.1 protein_id gnl|my_center|LOCUS_19270 2037735 2036506 gene locus_tag LOCUS_19280 2037735 2036506 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028249.1 protein_id gnl|my_center|LOCUS_19280 2037928 2037746 gene locus_tag LOCUS_19290 2037928 2037746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2039332 2038046 gene locus_tag LOCUS_19300 2039332 2038046 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061782.1 protein_id gnl|my_center|LOCUS_19300 2040865 2039459 gene locus_tag LOCUS_19310 2040865 2039459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113016.1 protein_id gnl|my_center|LOCUS_19310 2041683 2040862 gene locus_tag LOCUS_19320 2041683 2040862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2042633 2041680 gene locus_tag LOCUS_19330 2042633 2041680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031823.1 protein_id gnl|my_center|LOCUS_19330 2044145 2042646 gene locus_tag LOCUS_19340 2044145 2042646 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242875.1 protein_id gnl|my_center|LOCUS_19340 2044533 2044862 gene locus_tag LOCUS_19350 2044533 2044862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2044793 2045401 gene locus_tag LOCUS_19360 2044793 2045401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 2045454 2047235 gene locus_tag LOCUS_19370 2045454 2047235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762824.1 protein_id gnl|my_center|LOCUS_19370 2047238 2048992 gene locus_tag LOCUS_19380 2047238 2048992 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107304.1 protein_id gnl|my_center|LOCUS_19380 2049362 2049120 gene locus_tag LOCUS_19390 2049362 2049120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2049736 2050092 gene locus_tag LOCUS_19400 2049736 2050092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19400 2051075 2050089 gene locus_tag LOCUS_19410 2051075 2050089 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 protein_id gnl|my_center|LOCUS_19410 2051335 2051727 gene locus_tag LOCUS_19420 2051335 2051727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2052403 2051846 gene locus_tag LOCUS_19430 2052403 2051846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 2052831 2053088 gene locus_tag LOCUS_19440 2052831 2053088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2053213 2053142 gene locus_tag LOCUS_t00420 2053213 2053142 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2053273 2053836 gene locus_tag LOCUS_19450 gene dcd 2053273 2053836 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853460.1 protein_id gnl|my_center|LOCUS_19450 2053842 2055047 gene locus_tag LOCUS_19460 2053842 2055047 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080026.1 protein_id gnl|my_center|LOCUS_19460 2055072 2055692 gene locus_tag LOCUS_19470 2055072 2055692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2055655 2056332 gene locus_tag LOCUS_19480 2055655 2056332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2059588 2056439 gene locus_tag LOCUS_19490 gene lysX 2059588 2056439 CDS product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110833.1 protein_id gnl|my_center|LOCUS_19490 2060903 2059614 gene locus_tag LOCUS_19500 2060903 2059614 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015432.1 protein_id gnl|my_center|LOCUS_19500 2062197 2060926 gene locus_tag LOCUS_19510 2062197 2060926 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862691.1 protein_id gnl|my_center|LOCUS_19510 2062439 2063530 gene locus_tag LOCUS_19520 2062439 2063530 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980817.1 protein_id gnl|my_center|LOCUS_19520 2064273 2063623 gene locus_tag LOCUS_19530 2064273 2063623 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853486.1 protein_id gnl|my_center|LOCUS_19530 2066868 2064319 gene locus_tag LOCUS_19540 2066868 2064319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19540 2067430 2066942 gene locus_tag LOCUS_19550 2067430 2066942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2067558 2067899 gene locus_tag LOCUS_19560 2067558 2067899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19560 2067862 2068152 gene locus_tag LOCUS_19570 2067862 2068152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19570 2068532 2069599 gene locus_tag LOCUS_19580 2068532 2069599 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013805.1 protein_id gnl|my_center|LOCUS_19580 2069602 2070633 gene locus_tag LOCUS_19590 2069602 2070633 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013804.1 protein_id gnl|my_center|LOCUS_19590 2070630 2071685 gene locus_tag LOCUS_19600 2070630 2071685 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013803.1 protein_id gnl|my_center|LOCUS_19600 2071737 2072546 gene locus_tag LOCUS_19610 2071737 2072546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013802.1 protein_id gnl|my_center|LOCUS_19610 2072591 2073628 gene locus_tag LOCUS_19620 2072591 2073628 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013801.1 protein_id gnl|my_center|LOCUS_19620 2074367 2074612 gene locus_tag LOCUS_19630 2074367 2074612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19630 2074596 2074805 gene locus_tag LOCUS_19640 2074596 2074805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19640 2074774 2074947 gene locus_tag LOCUS_19650 2074774 2074947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19650 2074944 2075852 gene locus_tag LOCUS_19660 2074944 2075852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19660 2079679 2075963 gene locus_tag LOCUS_19670 2079679 2075963 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038431186.1 protein_id gnl|my_center|LOCUS_19670 2080386 2081902 gene locus_tag LOCUS_r00100 2080386 2081902 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2082276 2085337 gene locus_tag LOCUS_r00110 2082276 2085337 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2085501 2085613 gene locus_tag LOCUS_r00120 2085501 2085613 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2086229 2085984 gene locus_tag LOCUS_19680 2086229 2085984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2087041 2086841 gene locus_tag LOCUS_19690 2087041 2086841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2087439 2088584 gene locus_tag LOCUS_19700 2087439 2088584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2089068 2088589 gene locus_tag LOCUS_19710 2089068 2088589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2089267 2090868 gene locus_tag LOCUS_19720 2089267 2090868 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411694.1 protein_id gnl|my_center|LOCUS_19720 2091070 2092674 gene locus_tag LOCUS_19730 2091070 2092674 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030930.1 protein_id gnl|my_center|LOCUS_19730 2092723 2093673 gene locus_tag LOCUS_19740 2092723 2093673 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270309.1 protein_id gnl|my_center|LOCUS_19740 2093666 2095294 gene locus_tag LOCUS_19750 2093666 2095294 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975338.1 protein_id gnl|my_center|LOCUS_19750 2095281 2095922 gene locus_tag LOCUS_19760 2095281 2095922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2097318 2095996 gene locus_tag LOCUS_19770 2097318 2095996 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015391.1 protein_id gnl|my_center|LOCUS_19770 2098672 2097368 gene locus_tag LOCUS_19780 2098672 2097368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2099087 2100922 gene locus_tag LOCUS_19790 gene dnaK 2099087 2100922 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015390.1 protein_id gnl|my_center|LOCUS_19790 2100922 2101581 gene locus_tag LOCUS_19800 gene grpE 2100922 2101581 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015389.1 protein_id gnl|my_center|LOCUS_19800 2101691 2102863 gene locus_tag LOCUS_19810 gene dnaJ 2101691 2102863 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015388.1 protein_id gnl|my_center|LOCUS_19810 2102885 2103283 gene locus_tag LOCUS_19820 2102885 2103283 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015387.1 protein_id gnl|my_center|LOCUS_19820 2105357 2103777 gene locus_tag LOCUS_19830 2105357 2103777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2105650 2107170 gene locus_tag LOCUS_19840 2105650 2107170 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015386.1 protein_id gnl|my_center|LOCUS_19840 2107325 2108365 gene locus_tag LOCUS_19850 gene adhP 2107325 2108365 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015397.1 protein_id gnl|my_center|LOCUS_19850 2109482 2108352 gene locus_tag LOCUS_19860 2109482 2108352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2109709 2109470 gene locus_tag LOCUS_19870 2109709 2109470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2109866 2110636 gene locus_tag LOCUS_19880 2109866 2110636 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015383.1 protein_id gnl|my_center|LOCUS_19880 2111709 2110615 gene locus_tag LOCUS_19890 2111709 2110615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015382.1 protein_id gnl|my_center|LOCUS_19890 2111739 2112764 gene locus_tag LOCUS_19900 2111739 2112764 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459574.1 protein_id gnl|my_center|LOCUS_19900 2112891 2114228 gene locus_tag LOCUS_19910 2112891 2114228 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015371.1 protein_id gnl|my_center|LOCUS_19910 2114546 2114731 gene locus_tag LOCUS_19920 2114546 2114731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2114958 2115158 gene locus_tag LOCUS_19930 2114958 2115158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2116723 2115155 gene locus_tag LOCUS_19940 2116723 2115155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014826.1 protein_id gnl|my_center|LOCUS_19940 2117513 2116725 gene locus_tag LOCUS_19950 2117513 2116725 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861735.1 protein_id gnl|my_center|LOCUS_19950 2117643 2117972 gene locus_tag LOCUS_19960 2117643 2117972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2118171 2120720 gene locus_tag LOCUS_19970 gene clpB 2118171 2120720 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015370.1 protein_id gnl|my_center|LOCUS_19970 2121682 2122074 gene locus_tag LOCUS_19980 2121682 2122074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2122634 2123458 gene locus_tag LOCUS_19990 2122634 2123458 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015366.1 protein_id gnl|my_center|LOCUS_19990 2123458 2124372 gene locus_tag LOCUS_20000 2123458 2124372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 2124428 2124961 gene locus_tag LOCUS_20010 gene pyrE 2124428 2124961 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862850.1 protein_id gnl|my_center|LOCUS_20010 2124954 2125622 gene locus_tag LOCUS_20020 2124954 2125622 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511861.1 protein_id gnl|my_center|LOCUS_20020 2125616 2126761 gene locus_tag LOCUS_20030 2125616 2126761 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167382136.1 protein_id gnl|my_center|LOCUS_20030 2126880 2127914 gene locus_tag LOCUS_20040 gene fbaA 2126880 2127914 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015363.1 protein_id gnl|my_center|LOCUS_20040 2128521 2128820 gene locus_tag LOCUS_20050 2128521 2128820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20050 2129277 2129699 gene locus_tag LOCUS_20060 2129277 2129699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20060 2130408 2130124 gene locus_tag LOCUS_20070 2130408 2130124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 2130455 2130685 gene locus_tag LOCUS_20080 2130455 2130685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2131104 2131340 gene locus_tag LOCUS_20090 2131104 2131340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2132481 2132209 gene locus_tag LOCUS_20100 2132481 2132209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2132562 2132750 gene locus_tag LOCUS_20110 2132562 2132750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2132927 2133265 gene locus_tag LOCUS_20120 2132927 2133265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20120 2133420 2134859 gene locus_tag LOCUS_20130 2133420 2134859 CDS product IS30-like element ISMsm8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728521.1 protein_id gnl|my_center|LOCUS_20130 2134873 2135163 gene locus_tag LOCUS_20140 2134873 2135163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 2135163 2135342 gene locus_tag LOCUS_20150 2135163 2135342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 2136486 2135665 gene locus_tag LOCUS_20160 2136486 2135665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2137240 2136479 gene locus_tag LOCUS_20170 2137240 2136479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 2138301 2137237 gene locus_tag LOCUS_20180 2138301 2137237 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226541.1 protein_id gnl|my_center|LOCUS_20180 2138723 2139352 gene locus_tag LOCUS_20190 2138723 2139352 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203642.1 protein_id gnl|my_center|LOCUS_20190 2139360 2140577 gene locus_tag LOCUS_20200 2139360 2140577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2140574 2141359 gene locus_tag LOCUS_20210 2140574 2141359 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229866.1 protein_id gnl|my_center|LOCUS_20210 2141598 2141428 gene locus_tag LOCUS_20220 2141598 2141428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2141597 2143153 gene locus_tag LOCUS_20230 2141597 2143153 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390093.1 protein_id gnl|my_center|LOCUS_20230 2143153 2144877 gene locus_tag LOCUS_20240 2143153 2144877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390092.1 protein_id gnl|my_center|LOCUS_20240 2146359 2144881 gene locus_tag LOCUS_20250 2146359 2144881 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462215.1 protein_id gnl|my_center|LOCUS_20250 2147102 2146356 gene locus_tag LOCUS_20260 2147102 2146356 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815503.1 protein_id gnl|my_center|LOCUS_20260 2147728 2147102 gene locus_tag LOCUS_20270 2147728 2147102 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680633.1 protein_id gnl|my_center|LOCUS_20270 2155391 2147820 gene locus_tag LOCUS_20280 gene irp2 2155391 2147820 CDS product yersiniabactin non-ribosomal peptide synthetase HMWP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623021.1 protein_id gnl|my_center|LOCUS_20280 2157035 2155404 gene locus_tag LOCUS_20290 gene ybtE 2157035 2155404 CDS product yersiniabactin biosynthesis salycil-AMP ligase YbtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104104.1 protein_id gnl|my_center|LOCUS_20290 2157640 2157032 gene locus_tag LOCUS_20300 2157640 2157032 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808283.1 protein_id gnl|my_center|LOCUS_20300 2163167 2157633 gene locus_tag LOCUS_20310 2163167 2157633 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031828.1 protein_id gnl|my_center|LOCUS_20310 2164294 2163149 gene locus_tag LOCUS_20320 2164294 2163149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2165368 2164337 gene locus_tag LOCUS_20330 2165368 2164337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2166487 2165933 gene locus_tag LOCUS_20340 2166487 2165933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20340 2166812 2166474 gene locus_tag LOCUS_20350 2166812 2166474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20350 2167009 2166812 gene locus_tag LOCUS_20360 2167009 2166812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 2167062 2167376 gene locus_tag LOCUS_20370 2167062 2167376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20370 2167376 2168194 gene locus_tag LOCUS_20380 2167376 2168194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20380 2168299 2169483 gene locus_tag LOCUS_20390 2168299 2169483 CDS product IS30-like element ISMsm8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728521.1 protein_id gnl|my_center|LOCUS_20390 2169434 2169628 gene locus_tag LOCUS_20400 2169434 2169628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20400 2170098 2170568 gene locus_tag LOCUS_20410 2170098 2170568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2170973 2170590 gene locus_tag LOCUS_20420 2170973 2170590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20420 2171192 2171025 gene locus_tag LOCUS_20430 2171192 2171025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2171601 2171116 gene locus_tag LOCUS_20440 2171601 2171116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20440 2172163 2171582 gene locus_tag LOCUS_20450 2172163 2171582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2173699 2174415 gene locus_tag LOCUS_20460 2173699 2174415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2174785 2174435 gene locus_tag LOCUS_20470 2174785 2174435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 2176292 2176513 gene locus_tag LOCUS_20480 2176292 2176513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2177317 2177048 gene locus_tag LOCUS_20490 2177317 2177048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 2177643 2177311 gene locus_tag LOCUS_20500 2177643 2177311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20500 2177995 2177555 gene locus_tag LOCUS_20510 2177995 2177555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2179177 2178251 gene locus_tag LOCUS_20520 2179177 2178251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 2180174 2179086 gene locus_tag LOCUS_20530 2180174 2179086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2181287 2180487 gene locus_tag LOCUS_20540 2181287 2180487 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013482.1 protein_id gnl|my_center|LOCUS_20540 2181699 2182880 gene locus_tag LOCUS_20550 2181699 2182880 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 protein_id gnl|my_center|LOCUS_20550 2184105 2182972 gene locus_tag LOCUS_20560 2184105 2182972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 2184218 2185345 gene locus_tag LOCUS_20570 2184218 2185345 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 protein_id gnl|my_center|LOCUS_20570 2186178 2185342 gene locus_tag LOCUS_20580 2186178 2185342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853637.1 protein_id gnl|my_center|LOCUS_20580 2186752 2188041 gene locus_tag LOCUS_20590 2186752 2188041 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015361.1 protein_id gnl|my_center|LOCUS_20590 2188255 2188422 gene locus_tag LOCUS_20600 2188255 2188422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 2188423 2189853 gene locus_tag LOCUS_20610 gene dsbI 2188423 2189853 CDS product disulfide bond formation protein DsbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002787430.1 protein_id gnl|my_center|LOCUS_20610 2190644 2189850 gene locus_tag LOCUS_20620 2190644 2189850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2191258 2190758 gene locus_tag LOCUS_20630 2191258 2190758 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776234.1 protein_id gnl|my_center|LOCUS_20630 2191290 2192186 gene locus_tag LOCUS_20640 2191290 2192186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2192599 2192183 gene locus_tag LOCUS_20650 2192599 2192183 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015352.1 protein_id gnl|my_center|LOCUS_20650 2193964 2192606 gene locus_tag LOCUS_20660 2193964 2192606 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015406.1 protein_id gnl|my_center|LOCUS_20660 2194215 2195594 gene locus_tag LOCUS_20670 gene pta 2194215 2195594 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853660.1 protein_id gnl|my_center|LOCUS_20670 2195595 2196794 gene locus_tag LOCUS_20680 2195595 2196794 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862874.1 protein_id gnl|my_center|LOCUS_20680 2198976 2196814 gene locus_tag LOCUS_20690 2198976 2196814 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015349.1 protein_id gnl|my_center|LOCUS_20690 2199920 2198973 gene locus_tag LOCUS_20700 2199920 2198973 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015348.1 protein_id gnl|my_center|LOCUS_20700 2201173 2199917 gene locus_tag LOCUS_20710 2201173 2199917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309579.1 protein_id gnl|my_center|LOCUS_20710 2201247 2202104 gene locus_tag LOCUS_20720 2201247 2202104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015345.1 protein_id gnl|my_center|LOCUS_20720 2202088 2202825 gene locus_tag LOCUS_20730 2202088 2202825 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853677.1 protein_id gnl|my_center|LOCUS_20730 2204684 2203251 gene locus_tag LOCUS_20740 2204684 2203251 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853689.1 protein_id gnl|my_center|LOCUS_20740 2205388 2204681 gene locus_tag LOCUS_20750 2205388 2204681 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853692.1 protein_id gnl|my_center|LOCUS_20750 2206280 2205393 gene locus_tag LOCUS_20760 2206280 2205393 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015341.1 protein_id gnl|my_center|LOCUS_20760 2206860 2206297 gene locus_tag LOCUS_20770 2206860 2206297 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862894.1 protein_id gnl|my_center|LOCUS_20770 2206859 2207062 gene locus_tag LOCUS_20780 2206859 2207062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2207065 2207613 gene locus_tag LOCUS_20790 2207065 2207613 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015340.1 protein_id gnl|my_center|LOCUS_20790 2207610 2208689 gene locus_tag LOCUS_20800 2207610 2208689 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853704.1 protein_id gnl|my_center|LOCUS_20800 2209726 2208632 gene locus_tag LOCUS_20810 2209726 2208632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2211577 2210204 gene locus_tag LOCUS_20820 2211577 2210204 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015336.1 protein_id gnl|my_center|LOCUS_20820 2211819 2211682 gene locus_tag LOCUS_20830 2211819 2211682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2211813 2211941 gene locus_tag LOCUS_20840 2211813 2211941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2212190 2213539 gene locus_tag LOCUS_20850 2212190 2213539 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 protein_id gnl|my_center|LOCUS_20850 2213692 2213498 gene locus_tag LOCUS_20860 2213692 2213498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2213979 2214200 gene locus_tag LOCUS_20870 2213979 2214200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2214986 2214138 gene locus_tag LOCUS_20880 2214986 2214138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20880 2215686 2215886 gene locus_tag LOCUS_20890 2215686 2215886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2215974 2216138 gene locus_tag LOCUS_20900 2215974 2216138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2218033 2217221 gene locus_tag LOCUS_20910 2218033 2217221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 2218640 2218966 gene locus_tag LOCUS_20920 2218640 2218966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 2219447 2221087 gene locus_tag LOCUS_20930 gene groL 2219447 2221087 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862917.1 protein_id gnl|my_center|LOCUS_20930 2221702 2221875 gene locus_tag LOCUS_20940 2221702 2221875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2221908 2222039 gene locus_tag LOCUS_20950 2221908 2222039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2222147 2222983 gene locus_tag LOCUS_20960 2222147 2222983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2223349 2224245 gene locus_tag LOCUS_20970 gene ppk2 2223349 2224245 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853756.1 protein_id gnl|my_center|LOCUS_20970 2225210 2224749 gene locus_tag LOCUS_20980 2225210 2224749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 2226203 2225352 gene locus_tag LOCUS_20990 2226203 2225352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2226551 2226775 gene locus_tag LOCUS_21000 2226551 2226775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2230799 2226957 gene locus_tag LOCUS_21010 2230799 2226957 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015325.1 protein_id gnl|my_center|LOCUS_21010 2231240 2230800 gene locus_tag LOCUS_21020 2231240 2230800 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015324.1 protein_id gnl|my_center|LOCUS_21020 2231633 2231337 gene locus_tag LOCUS_21030 2231633 2231337 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862931.1 protein_id gnl|my_center|LOCUS_21030 2232266 2231790 gene locus_tag LOCUS_21040 2232266 2231790 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015320.1 protein_id gnl|my_center|LOCUS_21040 2232331 2233581 gene locus_tag LOCUS_21050 gene dacB 2232331 2233581 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015319.1 protein_id gnl|my_center|LOCUS_21050 2233574 2234452 gene locus_tag LOCUS_21060 gene tilS 2233574 2234452 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015318.1 protein_id gnl|my_center|LOCUS_21060 2234455 2235060 gene locus_tag LOCUS_21070 gene hpt 2234455 2235060 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285928.1 protein_id gnl|my_center|LOCUS_21070 2235192 2237657 gene locus_tag LOCUS_21080 gene ftsH 2235192 2237657 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015317.1 protein_id gnl|my_center|LOCUS_21080 2237665 2238237 gene locus_tag LOCUS_21090 gene folE 2237665 2238237 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015316.1 protein_id gnl|my_center|LOCUS_21090 2238240 2238554 gene locus_tag LOCUS_21100 2238240 2238554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2238678 2239514 gene locus_tag LOCUS_21110 gene folP 2238678 2239514 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173664572.1 protein_id gnl|my_center|LOCUS_21110 2239511 2239885 gene locus_tag LOCUS_21120 gene folB 2239511 2239885 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230465.1 protein_id gnl|my_center|LOCUS_21120 2239895 2240374 gene locus_tag LOCUS_21130 gene folK 2239895 2240374 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015314.1 protein_id gnl|my_center|LOCUS_21130 2240371 2240838 gene locus_tag LOCUS_21140 2240371 2240838 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853810.1 protein_id gnl|my_center|LOCUS_21140 2240840 2241757 gene locus_tag LOCUS_21150 2240840 2241757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2241769 2242377 gene locus_tag LOCUS_21160 2241769 2242377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2242390 2243169 gene locus_tag LOCUS_21170 2242390 2243169 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015311.1 protein_id gnl|my_center|LOCUS_21170 2244458 2243166 gene locus_tag LOCUS_21180 2244458 2243166 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015206.1 protein_id gnl|my_center|LOCUS_21180 2244705 2244508 gene locus_tag LOCUS_21190 2244705 2244508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015423.1 protein_id gnl|my_center|LOCUS_21190 2245673 2244705 gene locus_tag LOCUS_21200 2245673 2244705 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015422.1 protein_id gnl|my_center|LOCUS_21200 2246148 2247071 gene locus_tag LOCUS_21210 2246148 2247071 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223406.1 protein_id gnl|my_center|LOCUS_21210 2247068 2247826 gene locus_tag LOCUS_21220 2247068 2247826 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223407.1 protein_id gnl|my_center|LOCUS_21220 2248781 2247846 gene locus_tag LOCUS_21230 2248781 2247846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 2248926 2249162 gene locus_tag LOCUS_21240 2248926 2249162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2249542 2249372 gene locus_tag LOCUS_21250 2249542 2249372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2251568 2250555 gene locus_tag LOCUS_21260 2251568 2250555 CDS product thiopeptide-type bacteriocin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004937.1 protein_id gnl|my_center|LOCUS_21260 2254168 2251568 gene locus_tag LOCUS_21270 2254168 2251568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2255151 2254165 gene locus_tag LOCUS_21280 2255151 2254165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2256437 2255685 gene locus_tag LOCUS_21290 2256437 2255685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21290 2258950 2257232 gene locus_tag LOCUS_21300 2258950 2257232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2259417 2260979 gene locus_tag LOCUS_21310 gene lysS 2259417 2260979 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015310.1 protein_id gnl|my_center|LOCUS_21310 2261388 2261254 gene locus_tag LOCUS_21320 2261388 2261254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2261803 2261630 gene locus_tag LOCUS_21330 2261803 2261630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2263210 2261996 gene locus_tag LOCUS_21340 2263210 2261996 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243750.1 protein_id gnl|my_center|LOCUS_21340 2263636 2263214 gene locus_tag LOCUS_21350 2263636 2263214 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_21350 2263846 2265129 gene locus_tag LOCUS_21360 2263846 2265129 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776139.1 protein_id gnl|my_center|LOCUS_21360 2265678 2265145 gene locus_tag LOCUS_21370 2265678 2265145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2266684 2266046 gene locus_tag LOCUS_21380 2266684 2266046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2266720 2267175 gene locus_tag LOCUS_21390 2266720 2267175 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_21390 2267623 2270259 gene locus_tag LOCUS_21400 2267623 2270259 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015301.1 protein_id gnl|my_center|LOCUS_21400 2270290 2270460 gene locus_tag LOCUS_21410 2270290 2270460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2270567 2271844 gene locus_tag LOCUS_21420 2270567 2271844 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123926043.1 protein_id gnl|my_center|LOCUS_21420 2272728 2271841 gene locus_tag LOCUS_21430 2272728 2271841 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015296.1 protein_id gnl|my_center|LOCUS_21430 2272859 2273488 gene locus_tag LOCUS_21440 2272859 2273488 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853851.1 protein_id gnl|my_center|LOCUS_21440 2273558 2274274 gene locus_tag LOCUS_21450 2273558 2274274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015294.1 protein_id gnl|my_center|LOCUS_21450 2275552 2274302 gene locus_tag LOCUS_21460 gene radA 2275552 2274302 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015292.1 protein_id gnl|my_center|LOCUS_21460 2276050 2277399 gene locus_tag LOCUS_21470 2276050 2277399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 2278069 2277503 gene locus_tag LOCUS_21480 2278069 2277503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015291.1 protein_id gnl|my_center|LOCUS_21480 2278340 2278921 gene locus_tag LOCUS_21490 2278340 2278921 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853867.1 protein_id gnl|my_center|LOCUS_21490 2278955 2279665 gene locus_tag LOCUS_21500 gene ispD 2278955 2279665 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015289.1 protein_id gnl|my_center|LOCUS_21500 2279658 2280140 gene locus_tag LOCUS_21510 gene ispF 2279658 2280140 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015288.1 protein_id gnl|my_center|LOCUS_21510 2280159 2281550 gene locus_tag LOCUS_21520 gene cysS 2280159 2281550 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015271.1 protein_id gnl|my_center|LOCUS_21520 2281578 2282519 gene locus_tag LOCUS_21530 gene rlmB 2281578 2282519 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863034.1 protein_id gnl|my_center|LOCUS_21530 2282529 2283668 gene locus_tag LOCUS_21540 2282529 2283668 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015259.1 protein_id gnl|my_center|LOCUS_21540 2284389 2283631 gene locus_tag LOCUS_21550 gene otsB 2284389 2283631 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863055.1 protein_id gnl|my_center|LOCUS_21550 2284861 2284379 gene locus_tag LOCUS_21560 2284861 2284379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2286337 2284889 gene locus_tag LOCUS_21570 2286337 2284889 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015258.1 protein_id gnl|my_center|LOCUS_21570 2286681 2286337 gene locus_tag LOCUS_21580 2286681 2286337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2288286 2286742 gene locus_tag LOCUS_21590 2288286 2286742 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853939.1 protein_id gnl|my_center|LOCUS_21590 2288415 2288488 gene locus_tag LOCUS_t00430 2288415 2288488 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2290136 2288685 gene locus_tag LOCUS_21600 2290136 2288685 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853939.1 protein_id gnl|my_center|LOCUS_21600 2290249 2291985 gene locus_tag LOCUS_21610 2290249 2291985 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015247.1 protein_id gnl|my_center|LOCUS_21610 2294449 2292536 gene locus_tag LOCUS_21620 2294449 2292536 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015065.1 protein_id gnl|my_center|LOCUS_21620 2295125 2294505 gene locus_tag LOCUS_21630 2295125 2294505 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015249.1 protein_id gnl|my_center|LOCUS_21630 2296611 2295112 gene locus_tag LOCUS_21640 2296611 2295112 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015248.1 protein_id gnl|my_center|LOCUS_21640 2297584 2298294 gene locus_tag LOCUS_21650 2297584 2298294 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863097.1 protein_id gnl|my_center|LOCUS_21650 2298603 2299889 gene locus_tag LOCUS_21660 2298603 2299889 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015245.1 protein_id gnl|my_center|LOCUS_21660 2300568 2299903 gene locus_tag LOCUS_21670 2300568 2299903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 2301010 2300585 gene locus_tag LOCUS_21680 2301010 2300585 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015240.1 protein_id gnl|my_center|LOCUS_21680 2301089 2302375 gene locus_tag LOCUS_21690 gene purD 2301089 2302375 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863105.1 protein_id gnl|my_center|LOCUS_21690 2302459 2303793 gene locus_tag LOCUS_21700 2302459 2303793 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_21700 2303786 2304442 gene locus_tag LOCUS_21710 2303786 2304442 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_21710 2304444 2305589 gene locus_tag LOCUS_21720 2304444 2305589 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285864.1 protein_id gnl|my_center|LOCUS_21720 2305598 2307028 gene locus_tag LOCUS_21730 gene purB 2305598 2307028 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173328348.1 protein_id gnl|my_center|LOCUS_21730 2307087 2308007 gene locus_tag LOCUS_21740 2307087 2308007 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863110.1 protein_id gnl|my_center|LOCUS_21740 2308299 2308087 gene locus_tag LOCUS_21750 2308299 2308087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2308298 2310427 gene locus_tag LOCUS_21760 2308298 2310427 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015237.1 protein_id gnl|my_center|LOCUS_21760 2310429 2310899 gene locus_tag LOCUS_21770 2310429 2310899 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015234.1 protein_id gnl|my_center|LOCUS_21770 2312503 2312676 gene locus_tag LOCUS_21780 2312503 2312676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2313639 2312614 gene locus_tag LOCUS_21790 gene nrdF 2313639 2312614 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776779.1 protein_id gnl|my_center|LOCUS_21790 2314061 2313636 gene locus_tag LOCUS_21800 gene nrdI 2314061 2313636 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776482.1 protein_id gnl|my_center|LOCUS_21800 2314286 2314984 gene locus_tag LOCUS_21810 2314286 2314984 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015232.1 protein_id gnl|my_center|LOCUS_21810 2315326 2315721 gene locus_tag LOCUS_21820 2315326 2315721 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863125.1 protein_id gnl|my_center|LOCUS_21820 2315762 2317336 gene locus_tag LOCUS_21830 gene purF 2315762 2317336 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265975.1 protein_id gnl|my_center|LOCUS_21830 2317396 2318460 gene locus_tag LOCUS_21840 gene purM 2317396 2318460 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863129.1 protein_id gnl|my_center|LOCUS_21840 2318800 2318594 gene locus_tag LOCUS_21850 2318800 2318594 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863131.1 protein_id gnl|my_center|LOCUS_21850 2320125 2319022 gene locus_tag LOCUS_21860 2320125 2319022 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015229.1 protein_id gnl|my_center|LOCUS_21860 2320179 2321075 gene locus_tag LOCUS_21870 2320179 2321075 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015228.1 protein_id gnl|my_center|LOCUS_21870 2321729 2321082 gene locus_tag LOCUS_21880 2321729 2321082 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863137.1 protein_id gnl|my_center|LOCUS_21880 2321769 2322821 gene locus_tag LOCUS_21890 2321769 2322821 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015227.1 protein_id gnl|my_center|LOCUS_21890 2323664 2322861 gene locus_tag LOCUS_21900 2323664 2322861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2323694 2324614 gene locus_tag LOCUS_21910 gene mshD 2323694 2324614 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015225.1 protein_id gnl|my_center|LOCUS_21910 2324665 2324871 gene locus_tag LOCUS_21920 2324665 2324871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2325039 2325251 gene locus_tag LOCUS_21930 2325039 2325251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2326153 2325401 gene locus_tag LOCUS_21940 gene phoU 2326153 2325401 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015220.1 protein_id gnl|my_center|LOCUS_21940 2327323 2326172 gene locus_tag LOCUS_21950 gene dusB 2327323 2326172 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858945.1 protein_id gnl|my_center|LOCUS_21950 2327657 2329171 gene locus_tag LOCUS_21960 2327657 2329171 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015219.1 protein_id gnl|my_center|LOCUS_21960 2330797 2329250 gene locus_tag LOCUS_21970 gene cydC 2330797 2329250 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014154.1 protein_id gnl|my_center|LOCUS_21970 2332365 2330794 gene locus_tag LOCUS_21980 gene cydD 2332365 2330794 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408022.1 protein_id gnl|my_center|LOCUS_21980 2333336 2332362 gene locus_tag LOCUS_21990 gene cydB 2333336 2332362 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894621.1 protein_id gnl|my_center|LOCUS_21990 2334879 2333344 gene locus_tag LOCUS_22000 2334879 2333344 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111152.1 protein_id gnl|my_center|LOCUS_22000 2335372 2335445 gene locus_tag LOCUS_t00440 2335372 2335445 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2337311 2336979 gene locus_tag LOCUS_22010 2337311 2336979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 2340084 2339389 gene locus_tag LOCUS_22020 2340084 2339389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 2340464 2340117 gene locus_tag LOCUS_22030 2340464 2340117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2341501 2341629 gene locus_tag LOCUS_22040 2341501 2341629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 2342333 2342641 gene locus_tag LOCUS_22050 2342333 2342641 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013963.1 protein_id gnl|my_center|LOCUS_22050 2342642 2343238 gene locus_tag LOCUS_22060 2342642 2343238 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053546291.1 protein_id gnl|my_center|LOCUS_22060 2343455 2343658 gene locus_tag LOCUS_22070 2343455 2343658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 2343770 2344066 gene locus_tag LOCUS_22080 2343770 2344066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 2344256 2344101 gene locus_tag LOCUS_22090 2344256 2344101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 2345482 2344253 gene locus_tag LOCUS_22100 2345482 2344253 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114145401.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22100 2345843 2346178 gene locus_tag LOCUS_22110 2345843 2346178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2346248 2346916 gene locus_tag LOCUS_22120 2346248 2346916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22120 2347162 2348025 gene locus_tag LOCUS_22130 2347162 2348025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2348399 2349325 gene locus_tag LOCUS_22140 2348399 2349325 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804087.1 protein_id gnl|my_center|LOCUS_22140 2349346 2350353 gene locus_tag LOCUS_22150 2349346 2350353 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014491.1 protein_id gnl|my_center|LOCUS_22150 2350402 2351127 gene locus_tag LOCUS_22160 2350402 2351127 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014492.1 protein_id gnl|my_center|LOCUS_22160 2351221 2351296 gene locus_tag LOCUS_t00450 2351221 2351296 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2351323 2351397 gene locus_tag LOCUS_t00460 2351323 2351397 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2351570 2352646 gene locus_tag LOCUS_22170 2351570 2352646 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263718.1 protein_id gnl|my_center|LOCUS_22170 2352766 2352840 gene locus_tag LOCUS_t00470 2352766 2352840 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2352862 2352935 gene locus_tag LOCUS_t00480 2352862 2352935 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2353028 2353309 gene locus_tag LOCUS_22180 2353028 2353309 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015215.1 protein_id gnl|my_center|LOCUS_22180 2353929 2353363 gene locus_tag LOCUS_22190 gene cysE 2353929 2353363 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286028.1 protein_id gnl|my_center|LOCUS_22190 2354969 2354034 gene locus_tag LOCUS_22200 gene cysK 2354969 2354034 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567803.1 protein_id gnl|my_center|LOCUS_22200 2355652 2356497 gene locus_tag LOCUS_22210 2355652 2356497 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857068.1 protein_id gnl|my_center|LOCUS_22210 2357125 2356550 gene locus_tag LOCUS_22220 2357125 2356550 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015213.1 protein_id gnl|my_center|LOCUS_22220 2357164 2358420 gene locus_tag LOCUS_22230 gene murA 2357164 2358420 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015212.1 protein_id gnl|my_center|LOCUS_22230 2358957 2360473 gene locus_tag LOCUS_r00130 2358957 2360473 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2360847 2363908 gene locus_tag LOCUS_r00140 2360847 2363908 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2364072 2364184 gene locus_tag LOCUS_r00150 2364072 2364184 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2364741 2365490 gene locus_tag LOCUS_22240 2364741 2365490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860245.1 protein_id gnl|my_center|LOCUS_22240 2365491 2368055 gene locus_tag LOCUS_22250 2365491 2368055 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857914.1 protein_id gnl|my_center|LOCUS_22250 2368366 2368052 gene locus_tag LOCUS_22260 2368366 2368052 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860253.1 protein_id gnl|my_center|LOCUS_22260 2368587 2368363 gene locus_tag LOCUS_22270 2368587 2368363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2368716 2370353 gene locus_tag LOCUS_22280 gene pgm 2368716 2370353 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015199.1 protein_id gnl|my_center|LOCUS_22280 2370350 2370853 gene locus_tag LOCUS_22290 2370350 2370853 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 protein_id gnl|my_center|LOCUS_22290 2370903 2371637 gene locus_tag LOCUS_22300 2370903 2371637 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857927.1 protein_id gnl|my_center|LOCUS_22300 2371725 2371799 gene locus_tag LOCUS_t00490 2371725 2371799 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2372503 2371838 gene locus_tag LOCUS_22310 2372503 2371838 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929996.1 protein_id gnl|my_center|LOCUS_22310 2372640 2373704 gene locus_tag LOCUS_22320 2372640 2373704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550161.1 protein_id gnl|my_center|LOCUS_22320 2373708 2375000 gene locus_tag LOCUS_22330 2373708 2375000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22330 2374990 2376378 gene locus_tag LOCUS_22340 2374990 2376378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22340 2376418 2376690 gene locus_tag LOCUS_22350 2376418 2376690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2376737 2377174 gene locus_tag LOCUS_22360 2376737 2377174 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015196.1 protein_id gnl|my_center|LOCUS_22360 2378004 2377171 gene locus_tag LOCUS_22370 gene nadE 2378004 2377171 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015194.1 protein_id gnl|my_center|LOCUS_22370 2378158 2378280 gene locus_tag LOCUS_22380 gene ykgO 2378158 2378280 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857945.1 protein_id gnl|my_center|LOCUS_22380 2379875 2378349 gene locus_tag LOCUS_22390 2379875 2378349 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013773.1 protein_id gnl|my_center|LOCUS_22390 2380740 2379868 gene locus_tag LOCUS_22400 2380740 2379868 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013774.1 protein_id gnl|my_center|LOCUS_22400 2381042 2381275 gene locus_tag LOCUS_22410 gene nrdH 2381042 2381275 CDS product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857948.1 protein_id gnl|my_center|LOCUS_22410 2381369 2381794 gene locus_tag LOCUS_22420 gene nrdI 2381369 2381794 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857951.1 protein_id gnl|my_center|LOCUS_22420 2381844 2384003 gene locus_tag LOCUS_22430 gene nrdE 2381844 2384003 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857952.1 protein_id gnl|my_center|LOCUS_22430 2384540 2384055 gene locus_tag LOCUS_22440 2384540 2384055 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860285.1 protein_id gnl|my_center|LOCUS_22440 2384852 2385838 gene locus_tag LOCUS_22450 gene nrdF 2384852 2385838 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015189.1 protein_id gnl|my_center|LOCUS_22450 2386200 2387894 gene locus_tag LOCUS_22460 gene ctaD 2386200 2387894 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015188.1 protein_id gnl|my_center|LOCUS_22460 2388001 2389284 gene locus_tag LOCUS_22470 gene serB 2388001 2389284 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082353449.1 protein_id gnl|my_center|LOCUS_22470 2389277 2389984 gene locus_tag LOCUS_22480 2389277 2389984 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567712.1 protein_id gnl|my_center|LOCUS_22480 2391068 2389968 gene locus_tag LOCUS_22490 2391068 2389968 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096457649.1 protein_id gnl|my_center|LOCUS_22490 2391685 2391158 gene locus_tag LOCUS_22500 2391685 2391158 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226319392.1 protein_id gnl|my_center|LOCUS_22500 2393654 2391687 gene locus_tag LOCUS_22510 2393654 2391687 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015186.1 protein_id gnl|my_center|LOCUS_22510 2394999 2393686 gene locus_tag LOCUS_22520 2394999 2393686 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015184.1 protein_id gnl|my_center|LOCUS_22520 2395061 2395402 gene locus_tag LOCUS_22530 gene clpS 2395061 2395402 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897801.1 protein_id gnl|my_center|LOCUS_22530 2395419 2395955 gene locus_tag LOCUS_22540 2395419 2395955 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857980.1 protein_id gnl|my_center|LOCUS_22540 2395955 2396887 gene locus_tag LOCUS_22550 2395955 2396887 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015182.1 protein_id gnl|my_center|LOCUS_22550 2396884 2397456 gene locus_tag LOCUS_22560 2396884 2397456 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860306.1 protein_id gnl|my_center|LOCUS_22560 2397453 2398250 gene locus_tag LOCUS_22570 gene murI 2397453 2398250 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567685.1 protein_id gnl|my_center|LOCUS_22570 2398303 2399070 gene locus_tag LOCUS_22580 gene cdpA 2398303 2399070 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857989.1 protein_id gnl|my_center|LOCUS_22580 2399081 2399806 gene locus_tag LOCUS_22590 gene rph 2399081 2399806 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857993.1 protein_id gnl|my_center|LOCUS_22590 2399803 2400420 gene locus_tag LOCUS_22600 gene rdgB 2399803 2400420 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015172.1 protein_id gnl|my_center|LOCUS_22600 2400814 2400458 gene locus_tag LOCUS_22610 2400814 2400458 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857996.1 protein_id gnl|my_center|LOCUS_22610 2401138 2400842 gene locus_tag LOCUS_22620 2401138 2400842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857998.1 protein_id gnl|my_center|LOCUS_22620 2401306 2401388 gene locus_tag LOCUS_t00500 2401306 2401388 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2401659 2401895 gene locus_tag LOCUS_22630 2401659 2401895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2402074 2411007 gene locus_tag LOCUS_22640 2402074 2411007 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015170.1 protein_id gnl|my_center|LOCUS_22640 2411036 2411425 gene locus_tag LOCUS_22650 2411036 2411425 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015166.1 protein_id gnl|my_center|LOCUS_22650 2412066 2411422 gene locus_tag LOCUS_22660 2412066 2411422 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857691.1 protein_id gnl|my_center|LOCUS_22660 2412540 2412067 gene locus_tag LOCUS_22670 gene bcp 2412540 2412067 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015164.1 protein_id gnl|my_center|LOCUS_22670 2412629 2412904 gene locus_tag LOCUS_22680 2412629 2412904 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015163.1 protein_id gnl|my_center|LOCUS_22680 2412917 2413222 gene locus_tag LOCUS_22690 2412917 2413222 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015550.1 protein_id gnl|my_center|LOCUS_22690 2413675 2413226 gene locus_tag LOCUS_22700 2413675 2413226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 2413674 2413802 gene locus_tag LOCUS_22710 2413674 2413802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2414122 2413808 gene locus_tag LOCUS_22720 2414122 2413808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22720 2414381 2414154 gene locus_tag LOCUS_22730 2414381 2414154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 2415472 2415996 gene locus_tag LOCUS_22740 2415472 2415996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 2416171 2416362 gene locus_tag LOCUS_22750 2416171 2416362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2416470 2416397 gene locus_tag LOCUS_t00510 2416470 2416397 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2416780 2417928 gene locus_tag LOCUS_22760 2416780 2417928 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015151.1 protein_id gnl|my_center|LOCUS_22760 2418759 2417929 gene locus_tag LOCUS_22770 gene dapA 2418759 2417929 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460382.1 protein_id gnl|my_center|LOCUS_22770 2418887 2418813 gene locus_tag LOCUS_t00520 2418887 2418813 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2419569 2418937 gene locus_tag LOCUS_22780 gene orn 2419569 2418937 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015149.1 protein_id gnl|my_center|LOCUS_22780 2420436 2419588 gene locus_tag LOCUS_22790 gene cmrA 2420436 2419588 CDS product mycolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015148.1 protein_id gnl|my_center|LOCUS_22790 2421494 2420448 gene locus_tag LOCUS_22800 2421494 2420448 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015197.1 protein_id gnl|my_center|LOCUS_22800 2421576 2421650 gene locus_tag LOCUS_t00530 2421576 2421650 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2421883 2423088 gene locus_tag LOCUS_22810 2421883 2423088 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_22810 2423320 2423120 gene locus_tag LOCUS_22820 2423320 2423120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2425626 2423341 gene locus_tag LOCUS_22830 2425626 2423341 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860780.1 protein_id gnl|my_center|LOCUS_22830 2425853 2427889 gene locus_tag LOCUS_22840 2425853 2427889 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015135.1 protein_id gnl|my_center|LOCUS_22840 2428073 2428561 gene locus_tag LOCUS_22850 2428073 2428561 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 protein_id gnl|my_center|LOCUS_22850 2428659 2430329 gene locus_tag LOCUS_22860 gene ettA 2428659 2430329 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015133.1 protein_id gnl|my_center|LOCUS_22860 2430456 2430899 gene locus_tag LOCUS_22870 2430456 2430899 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567531.1 protein_id gnl|my_center|LOCUS_22870 2430909 2431529 gene locus_tag LOCUS_22880 2430909 2431529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567537.1 protein_id gnl|my_center|LOCUS_22880 2431918 2431526 gene locus_tag LOCUS_22890 2431918 2431526 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015129.1 protein_id gnl|my_center|LOCUS_22890 2432946 2431930 gene locus_tag LOCUS_22900 2432946 2431930 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727594.1 protein_id gnl|my_center|LOCUS_22900 2433145 2433351 gene locus_tag LOCUS_22910 2433145 2433351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 2435946 2433328 gene locus_tag LOCUS_22920 gene pepN 2435946 2433328 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015108.1 protein_id gnl|my_center|LOCUS_22920 2436068 2436688 gene locus_tag LOCUS_22930 2436068 2436688 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015107.1 protein_id gnl|my_center|LOCUS_22930 2436720 2437193 gene locus_tag LOCUS_22940 2436720 2437193 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859211.1 protein_id gnl|my_center|LOCUS_22940 2438052 2437270 gene locus_tag LOCUS_22950 2438052 2437270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 2438435 2438199 gene locus_tag LOCUS_22960 2438435 2438199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859215.1 protein_id gnl|my_center|LOCUS_22960 2438690 2438764 gene locus_tag LOCUS_t00540 2438690 2438764 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2439105 2439179 gene locus_tag LOCUS_t00550 2439105 2439179 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2439262 2440608 gene locus_tag LOCUS_22970 gene tig 2439262 2440608 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567596.1 protein_id gnl|my_center|LOCUS_22970 2440774 2441373 gene locus_tag LOCUS_22980 2440774 2441373 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 protein_id gnl|my_center|LOCUS_22980 2441391 2442020 gene locus_tag LOCUS_22990 2441391 2442020 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859221.1 protein_id gnl|my_center|LOCUS_22990 2442115 2444640 gene locus_tag LOCUS_23000 2442115 2444640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2444853 2446079 gene locus_tag LOCUS_23010 gene clpX 2444853 2446079 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015085.1 protein_id gnl|my_center|LOCUS_23010 2446867 2446115 gene locus_tag LOCUS_23020 2446867 2446115 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015080.1 protein_id gnl|my_center|LOCUS_23020 2447350 2448330 gene locus_tag LOCUS_23030 2447350 2448330 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015079.1 protein_id gnl|my_center|LOCUS_23030 2448425 2451133 gene locus_tag LOCUS_23040 2448425 2451133 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015075.1 protein_id gnl|my_center|LOCUS_23040 2451130 2452626 gene locus_tag LOCUS_23050 2451130 2452626 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567661.1 protein_id gnl|my_center|LOCUS_23050 2452623 2453036 gene locus_tag LOCUS_23060 2452623 2453036 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567665.1 protein_id gnl|my_center|LOCUS_23060 2453227 2453637 gene locus_tag LOCUS_23070 gene ndk 2453227 2453637 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859294.1 protein_id gnl|my_center|LOCUS_23070 2453919 2456819 gene locus_tag LOCUS_23080 2453919 2456819 CDS product translation initiation factor IF-2 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015068.1 protein_id gnl|my_center|LOCUS_23080 2456994 2457299 gene locus_tag LOCUS_23090 gene rplU 2456994 2457299 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859302.1 protein_id gnl|my_center|LOCUS_23090 2457340 2457606 gene locus_tag LOCUS_23100 gene rpmA 2457340 2457606 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859304.1 protein_id gnl|my_center|LOCUS_23100 2457768 2459294 gene locus_tag LOCUS_23110 gene obgE 2457768 2459294 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015064.1 protein_id gnl|my_center|LOCUS_23110 2459298 2459549 gene locus_tag LOCUS_23120 2459298 2459549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 2459570 2460700 gene locus_tag LOCUS_23130 gene proB 2459570 2460700 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015063.1 protein_id gnl|my_center|LOCUS_23130 2460718 2462010 gene locus_tag LOCUS_23140 2460718 2462010 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859321.1 protein_id gnl|my_center|LOCUS_23140 2462034 2462720 gene locus_tag LOCUS_23150 gene nadD 2462034 2462720 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015061.1 protein_id gnl|my_center|LOCUS_23150 2462743 2463210 gene locus_tag LOCUS_23160 gene rsfS 2462743 2463210 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859327.1 protein_id gnl|my_center|LOCUS_23160