COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..98619 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 38..281 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgtaatccccgatttgtggggcaagtcttccgac CDS complement(508..1776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1837..4416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(4663..6282) product FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229235.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene mnmC CDS 6402..6770 product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247553.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 6821..7558 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217627.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene ubiE CDS 7774..8247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687711.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(8381..8875) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687713.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene folK CDS complement(8885..9259) product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217625.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(9312..9878) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225444.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(9953..10228) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687717.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene hfq CDS complement(10380..11318) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225443.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 11622..12059 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357251.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 12113..12988 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690783.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene xerD CDS 13170..13370 product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214037.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 13612..13845 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219546.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(14221..15084) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692740.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene rfbD CDS 15295..16158 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225440.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 16395..18515 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980838.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene pnp CDS complement(18589..19257) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214027.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 19704..20555 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002237817.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene dapF CDS 20552..21157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687740.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 21354..22286 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217611.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene cysK CDS 22673..23347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(23503..24522) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706641.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene lepB CDS complement(24665..26458) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225433.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene lepA CDS complement(26601..27302) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244067.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 27462..28598 product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704392.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 28633..29610 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222732.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 29614..29964 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214009.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 29969..30748 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225430.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(31304..32194) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705545.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 32382..32960 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694496.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 32992..33264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 33311..33811 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104932.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 33904..34239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 34473..34781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 35193..35504 product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214004.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene grxD CDS 35610..36236 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690802.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene upp CDS 36259..36576 product DUF2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222730.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 36738..37169 product protein Gly1ORF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222729.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 37191..37901 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225427.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 37968..39332 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980843.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 39329..40546 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003698136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 40626..41690 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222724.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene hemE CDS 41879..43258 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235637.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene radA CDS complement(43364..43843) product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222722.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(43903..44262) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219522.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(44301..47915) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225423.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene recB CDS complement(47995..48360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 note possible pseudo, frameshifted CDS complement(48357..48902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 note possible pseudo, frameshifted CDS 49274..50098 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706633.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 50088..50804 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687787.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 50814..51569 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980846.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(51685..51948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002234239.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(51998..53380) product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690828.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(53544..54053) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213981.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(54145..54507) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226480.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(54504..54710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(54770..55360) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687802.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene pth CDS complement(55395..55673) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217575.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(55666..56097) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223901.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(56242..58209) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219513.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene ftsH CDS complement(58274..58894) product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213963.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 59003..59287 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244068.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene yhbY CDS 59588..59794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 59803..60510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 note possible pseudo, frameshifted CDS 60643..61644 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225417.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene hemB CDS complement(61708..62865) product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219510.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 63057..63830 product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014580530.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene folE2 CDS 63943..64608 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687816.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(64663..65421) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687817.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(65446..66336) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687818.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(66356..66928) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217565.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(66982..67788) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225414.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(67991..68635) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692786.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(68653..69693) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225411.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene murB CDS complement(69769..71148) product multidrug efflux MATE transporter NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980851.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene norM CDS 71699..72997 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222698.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(73337..74176) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357358.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene htpX CDS 74395..75042 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222696.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene adk CDS 75149..75889 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687835.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene pyrF CDS 75944..76906 product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217546.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene hldA CDS 76970..77974 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225405.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene rfaD CDS complement(78092..79504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(79610..81502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 81647..82012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(82070..84361) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701038.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene clpA CDS complement(84363..84665) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221161.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene clpS CDS 84915..85118 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217533.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 85166..85366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(85444..86775) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217529.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene pmbA CDS 86928..87440 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225402.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene yjgA CDS 87487..88200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244078.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 88269..89969 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225400.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene recJ CDS 90032..90955 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225105.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(91032..92420) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225106.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene fumC CDS complement(92569..94548) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244175.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene tkt CDS 95113..96609 product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688230.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene ccoG CDS 96612..97160 product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688232.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(97220..98395) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230674.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 sequence02 source 1..76388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2693 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002222588.1:autotransporter adhesin NhhA locus_tag LOCUS_01010 CDS complement(3022..3942) product LysR family transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224776.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene oxyR CDS complement(3946..4209) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690052.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene minE CDS complement(4213..5028) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215463.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene minD CDS complement(5057..5803) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700581.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene minC CDS complement(5920..6288) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224774.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene rplQ CDS complement(6312..7298) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215457.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene rpoA CDS complement(7324..7944) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215455.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene rpsD CDS complement(7964..8359) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216249.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene rpsK CDS complement(8379..8741) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215453.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene rpsM CDS complement(8939..9157) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215452.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene infA CDS complement(9162..10472) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215450.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene secY CDS complement(10485..10919) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215449.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene rplO CDS complement(10921..11106) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215447.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene rpmD CDS complement(11099..11617) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215445.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene rpsE CDS complement(11635..11988) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215441.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene rplR CDS complement(12002..12535) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951357.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene rplF CDS complement(12549..12941) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215438.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene rpsH CDS complement(12956..13261) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216244.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene rpsN CDS complement(13264..13803) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene rplE CDS complement(13813..14136) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215435.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene rplX CDS complement(14148..14516) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215434.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene rplN CDS complement(14738..15001) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215433.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene rpsQ CDS complement(15001..15192) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215432.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene rpmC CDS complement(15192..15617) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215430.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene rplP CDS complement(15592..16287) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215427.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene rpsC CDS complement(16297..16626) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215424.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene rplV CDS complement(16635..16913) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215422.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene rpsS CDS complement(16919..17752) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221850.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene rplB CDS complement(17758..18078) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene rplW CDS complement(18069..18689) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215402.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene rplD CDS complement(18689..19333) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215400.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene rplC CDS complement(20087..20398) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215394.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene rpsJ CDS complement(20416..20820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 note possible pseudo, frameshifted CDS complement(20775..21599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 note possible pseudo, frameshifted CDS complement(21685..23790) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218568.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene fusA CDS complement(23809..24279) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215391.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene rpsG CDS complement(24397..24768) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218431.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene rpsL CDS complement(24825..25022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(25026..29201) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700598.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene rpoC CDS complement(29358..33536) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224771.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene rpoB CDS complement(33725..34096) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215374.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene rplL CDS complement(34155..34655) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215373.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene rplJ CDS complement(34879..35574) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218415.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene rplA CDS complement(35574..36008) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218414.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene rplK CDS complement(36110..36646) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215369.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene nusG CDS complement(36648..36926) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690113.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene secE tRNA complement(37042..37117) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(37124..38308) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215366.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene tuf tRNA complement(38357..38431) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(38441..38514) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(38545..38628) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(38730..38981) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(39103..39672) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690114.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene rsmD CDS complement(39761..40138) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002233408.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 40338..41417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 41457..41774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 41784..42476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216227.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(42548..44854) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224768.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene topA CDS complement(44934..45395) product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215351.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(45418..46611) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224767.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene dprA CDS complement(46703..47980) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(47985..50090) product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(50090..50686) product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216221.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(50652..51911) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224763.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene rsmB CDS complement(51991..52917) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697690.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene fmt CDS complement(53005..53508) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216218.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene def CDS 53691..54920 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216217.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(54984..55643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216216.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(55710..56168) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216215.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene pyrI CDS complement(56178..57098) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215336.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene pyrB CDS 57321..58163 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215334.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(58136..58321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(58337..58846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232242.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 59317..60711 product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221819.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(60791..62203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 62357..62539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(62815..63834) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215314.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(63934..65148) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224758.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene gltS CDS complement(65324..65665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(65854..68127) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224749.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 68252..69268 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694383.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene galE CDS 69269..70351 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224748.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene rfbB CDS 70425..71291 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010359534.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene rfbA CDS 71336..71893 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690256.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene rfbC CDS complement(71937..73955) product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224746.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(74153..75274) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215274.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene dnaJ sequence03 source 1..65816 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 278..1204 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235090.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene prmB CDS 1471..2094 product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691604.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 2187..2495 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218494.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 2511..3866 product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218495.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(3927..4985) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951235.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene alr CDS 5210..5674 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216720.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 6459..6947 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951234.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(7004..7732) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689207.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 8056..9474 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002237261.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(9538..10164) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216724.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 10309..11649 product DUF2868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224998.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 11723..13063 product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224999.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(13357..14712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 note possible pseudo, frameshifted CDS complement(14709..16235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 note possible pseudo, frameshifted CDS complement(16247..17749) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225001.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene nusA CDS complement(17777..18208) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216731.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene rimP CDS 18561..19667 product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244251.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene serC CDS 19791..20348 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212693.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(20928..21683) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220499.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(21863..23035) product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225006.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene nirK CDS 23416..25671 product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980966.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(26069..27112) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695921.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(27709..28143) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225008.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(28423..28860) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225009.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene rnhA CDS 29025..29843 product SAM-dependent methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980965.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene tehB CDS complement(29893..30699) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689761.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene thiD tRNA complement(31045..31120) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(31248..32660) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212772.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene trkA CDS complement(32770..34293) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222179.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 34292..34537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(34795..35601) product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689749.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(35653..35904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689748.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 36006..36776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689746.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 36841..38091 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231905.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene metZ CDS 38186..38392 product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212781.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(38467..39219) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689730.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(39318..40835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(40828..42420) product histidine kinase dimerization/phospho-acceptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225015.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(42440..44743) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951227.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene parC CDS 44892..45575 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225017.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(45648..46592) product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225019.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene tehA CDS complement(46872..47060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 47434..47556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(47895..49202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(49288..51912) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980961.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene alaS CDS 52108..53238 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223553.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(53279..54181) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689718.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 54320..54817 product membrane lipoprotein lipid attachment site-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358754.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(54883..55788) product efflux transporter MtrCDE transcriptional activator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212798.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene mtrA CDS 55917..56252 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699221.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 56381..56851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689711.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 56959..57522 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244239.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene pgsA tRNA 57603..57678 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 57702..57775 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 57878..57967 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 58676..59728 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216779.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene sohB CDS complement(59781..60464) product ABC transporter six-transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697963.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 note possible pseudo, internal stop codon CDS complement(60659..61090) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689706.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(61215..62087) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212808.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(62223..62972) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689695.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(63384..64031) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 tRNA 64318..64402 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(64852..65799) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219741.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 sequence04 source 1..32004 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(218..868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 note possible pseudo, internal stop codon CDS 2244..3527 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010359904.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(4071..5024) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219479.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(5063..6271) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208048.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 6403..7107 product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225397.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(7171..7737) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687863.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene dcd CDS complement(7803..8219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225396.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(8281..9180) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219474.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(9211..10668) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225394.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene der CDS complement(10825..11454) product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225392.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(11455..12750) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225391.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene hisS CDS complement(12877..13293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(13643..14092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980803.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(14103..14426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(14588..14875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 16088..17011 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980864.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(17089..17730) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706615.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(17785..18576) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 tRNA 18744..18819 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 18954..19745 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222670.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene panB CDS 19868..20704 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222669.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene panC CDS 20864..22708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222668.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 22863..23444 product outer membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219458.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 23454..24299 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222667.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene ispE tRNA 24307..24382 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 24547..25530 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213870.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 25597..26169 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213865.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 26766..27161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 note possible pseudo, frameshifted CDS 27158..28474 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 note possible pseudo, frameshifted CDS 28485..31148 product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016374.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 sequence05 source 1..8091 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(141..341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(346..534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 680..928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 996..2168 product replication initiation factor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221956.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 2194..2445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 2449..2751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 2748..3161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 3345..3575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 3588..3887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223128.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 3955..5367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 5370..5660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 5671..6822 product zonular occludens toxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689773.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 6965..7192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 7239..7472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 7469..7672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 sequence06 source 1..7550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 312..1520 product type III-B CRISPR module RAMP protein Cmr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229142.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene cmr1 CDS 1538..3388 product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229144.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene cas10 CDS 3385..4560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 4610..5515 product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229141.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene cmr4 CDS 5518..5892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 5889..7010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 repeat_region 7264..>7550 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcggaagacttgccccac sequence07 source 1..5503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(66..174) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA complement(274..3162) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 tRNA complement(3510..3585) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(3591..3667) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 rRNA complement(3770..5305) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence08 source 1..3819 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 41..203 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcggaagacttgccccacaaatc CDS complement(396..1331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 1509..1811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 1861..2838 product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546247.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene cas1 CDS 2841..3116 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546007.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene cas2 repeat_region 3245..>3819 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttgtggggcaagtcttccgac sequence09 source 1..3212 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(187..918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(1725..2252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(2786..3091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 sequence10 source 1..3137 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(699..983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(1025..1246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(1330..1590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(1780..2688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 sequence11 source 1..269686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 20..583 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtagctcccattctcatttcgcagtgctacaat CDS complement(647..973) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040666777.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene cas2 CDS complement(966..1880) product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene cas1 CDS complement(1947..5195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(5473..8907) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010356628.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene dnaE CDS 8872..9081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(9126..9365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 9670..9903 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225660.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 9881..10099 product oxidoreductase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687334.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 10369..11205 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225658.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(11258..12550) product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225657.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(12606..14516) product NADH-dependent dehydratase PglD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222987.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene pglD CDS complement(14564..15739) product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(15877..17118) product NeuD/PglB/VioB family sugar acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225656.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(17111..18283) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704930.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(18303..19373) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704929.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(19370..20791) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704927.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(20849..22156) product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene wbpA CDS complement(22244..23368) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704923.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene ribD CDS complement(23407..23868) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene nrdR CDS complement(23896..24738) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687345.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(24828..25907) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221481.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene aroB CDS complement(25919..26431) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222978.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(26579..28774) product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003698035.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene pilQ CDS complement(28792..29343) product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214522.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(29361..30029) product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217908.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(30030..30629) product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214520.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(30632..31741) product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214517.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 32185..34290 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687357.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(34410..35039) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248759.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene yihA CDS 35245..35868 product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214509.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 36144..38096 product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033909628.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 38089..39276 product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687361.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene ccsB CDS 39639..40703 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687363.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene tsaD CDS complement(40747..41598) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218369.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 41982..43151 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704903.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene metK CDS complement(43216..44625) product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225643.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene dacB CDS 44796..45362 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704526.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 45477..46145 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931888.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 46179..47495 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225641.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(47534..49027) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687377.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene rng CDS 49217..49498 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221441.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene grxC CDS 49522..49956 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687381.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene secB CDS 50054..52096 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690581.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene recG CDS complement(52261..54036) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193219.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 54294..54857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 note possible pseudo, frameshifted CDS 55286..55510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 55544..55825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(55846..57072) product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690589.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 57171..57773 product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363251.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene wrbA CDS 57900..58559 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225597.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene queC CDS 58592..59110 product DUF1543 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225596.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 59121..59399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 note possible pseudo, frameshifted CDS 59363..59554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 note possible pseudo, frameshifted CDS 59646..60017 product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225594.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 60014..60652 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025456391.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 tRNA complement(60985..61061) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(61143..62228) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704881.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene nagZ CDS complement(62284..63804) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002236747.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(64005..65504) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225590.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(65642..66271) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene nth CDS complement(66317..66730) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225588.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 66933..68156 product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217858.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 68481..69860 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225586.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene nhaC CDS complement(69927..70751) product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222904.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(70753..71268) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225585.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene ybeY CDS 71345..72322 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217854.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene hemC CDS complement(72408..73601) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705754.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(73685..74182) product DNA-mimic protein DMP19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225584.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(74571..76157) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214399.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(76401..77123) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689323.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene lpxH CDS complement(77333..78802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 79063..82548 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225580.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene smc CDS complement(82642..83688) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229113.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene adhP CDS complement(83985..84371) product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226625.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 84597..85769 product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951265.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 85842..87776 product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247530.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(87890..88675) product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214390.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 88794..90980 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247531.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(91027..92124) product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244024.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(92117..92809) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689290.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(92809..93606) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049230919.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(93733..94698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(94870..95847) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705777.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(95906..97825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(98041..99969) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689283.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene dnaK CDS complement(100148..100420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225570.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 100608..101294 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689281.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 101423..101761 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219692.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene erpA CDS 101921..102370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225568.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 102617..103915 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225567.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene ubiB CDS complement(103961..104779) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689278.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene cysE CDS 104963..105550 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214370.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene grpE CDS complement(105675..105890) product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214367.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene nqrM CDS complement(105916..106971) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002242382.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(107124..108341) product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951261.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene nqrF CDS complement(108355..108948) product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689273.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene nqrE CDS complement(108952..109578) product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214361.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(109578..110354) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225563.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(110347..111579) product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689269.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(111582..112925) product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225561.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(113170..114591) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172763941.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 115010..115447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074896246.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(116346..116822) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221359.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 116988..117170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 117320..118420 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222873.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene gcvT CDS 118490..119107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689258.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 119159..119545 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695621.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene gcvH CDS 119691..120938 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689254.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene hemA CDS 121255..123498 product NosR/NirI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204371611.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 123626..125587 product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083147.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene nosZ CDS 125759..127114 product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935040.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 127172..128068 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689241.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 128065..128895 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695633.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 128892..129386 product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689238.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(129474..131135) product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222867.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(131456..132367) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225548.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(132444..133319) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692612.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(133354..134109) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169577348.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(134397..134762) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217809.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene rplS CDS complement(134776..135525) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222855.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene trmD CDS complement(135525..136034) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214316.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene rimM CDS complement(136050..136295) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214315.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene rpsP CDS complement(136341..138767) product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(138885..140291) product two-component system sensor histidine kinase MisS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687478.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene misS CDS complement(140304..140981) product two-component system response regulator MisR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214312.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene misR CDS complement(141172..142980) product PglL family O-oligosaccharyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244038.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(142970..143323) product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687481.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(143332..143940) product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222850.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(143991..144761) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222849.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene tatC CDS complement(144775..145461) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222848.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene tatB CDS complement(145465..145668) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214303.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene tatA CDS complement(145715..146038) product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687490.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(146170..146577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 note possible pseudo, internal stop codon CDS complement(146599..147228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 note possible pseudo, internal stop codon CDS 147254..147700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 147700..148218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 148223..148606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 148856..149056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(149109..150173) product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694824.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(150413..151486) product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222843.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 151614..151880 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214291.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene yajC CDS 151955..153808 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229151.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene secD CDS 153812..154747 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219655.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene secF CDS 154969..155238 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217790.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene rpsO CDS 155513..156637 product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229149.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene potA CDS 156653..157618 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690691.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 157618..158505 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214281.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 158631..159926 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225537.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(160033..161292) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687508.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene rho CDS complement(161516..163900) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222834.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene ppsA CDS 164311..165132 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217768.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(165196..165858) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222833.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(165912..166874) product CDF family zinc transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229873.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene czcD CDS complement(166920..167747) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222832.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 168051..168674 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222831.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene lolA CDS 168953..170092 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244039.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 170165..170701 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687524.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(170771..171106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(171434..171817) product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087117.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(172059..173654) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225531.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(173877..175376) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225525.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene pta CDS complement(175617..176681) product heme ABC transporter ATP-binding protein FbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687540.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene fbpC CDS complement(176703..177410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 note possible pseudo, frameshifted CDS complement(177413..178219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 note possible pseudo, frameshifted CDS complement(178284..179279) product heme ABC transporter substrate-binding protein FbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687545.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene fbpA CDS complement(179594..180064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(180122..181498) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704829.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene argH CDS complement(181517..182386) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687550.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene galU CDS complement(182414..183013) product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687551.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene rdgB CDS complement(183006..183215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(183354..183887) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219633.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(184003..184455) product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002240378.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene nudB tRNA 184843..184919 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 185073..185462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219615.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 185681..186079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692667.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(186120..187577) product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706675.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(187591..188421) product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687564.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(188504..188893) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217718.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(189041..189625) product outer membrane beta-barrel protein NspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225511.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene nspA CDS complement(189766..190344) product outer membrane beta-barrel protein NspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225511.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene nspA CDS complement(190546..191721) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene hemW CDS complement(191778..194273) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene ligA CDS complement(194407..195702) product cell division protein ZipA C-terminal FtsZ-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247799.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(195888..196460) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225509.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene ampD CDS 196544..197539 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225508.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene mltG CDS 197599..198219 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687582.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene tmk CDS 198437..199717 product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225506.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 199799..200080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 200080..201153 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217704.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene lpxK CDS 201307..201888 product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 201957..202139 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221286.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 202136..202897 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225504.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene kdsB CDS 202921..203436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003713441.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 tRNA 203588..203680 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 204176..204679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 205076..205861 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980825.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene trpA CDS 205899..206771 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene accD CDS complement(206830..207441) product CNP1-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692687.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 207549..207773 product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222784.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 208005..208379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 208439..209473 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222782.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene pyrC CDS complement(209553..209978) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214168.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene nusB CDS complement(210057..210533) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222781.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene ribH CDS complement(210582..210944) product DUF2185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002238889.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 211119..211838 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225498.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene rnc CDS 211845..212810 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244050.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene era CDS 213309..214574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 214974..216086 product trimeric porin PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244345.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene porB CDS 216224..218293 product lactoferrin-binding protein LbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225048.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene lbpB CDS 218290..221115 product lactoferrin/transferrin-binding protein LbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247545.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene lbpA CDS complement(221161..221787) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687611.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(221846..222337) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687613.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene greB CDS complement(222437..223981) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225492.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene purF CDS complement(224189..224686) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(224679..225728) product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690743.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene ftsN CDS complement(225741..227015) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225490.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene folC CDS complement(227045..227491) product transcriptional regulator FolI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225489.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(227496..227855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980826.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(227924..228652) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002233691.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(228825..229610) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225484.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene rsmA CDS 229849..230751 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 230741..231394 product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225483.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 231477..232679 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225482.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene trpB CDS 232955..235030 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154236097.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(235103..235906) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 235905..237029 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247551.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene rluD CDS complement(237182..238129) product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 238571..239350 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244057.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene pgeF CDS 239402..239881 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687653.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene lptE CDS 239883..240881 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244058.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene holA CDS 241002..241421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217668.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 241499..242011 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033908763.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(242095..242976) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225470.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(243426..244289) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167435401.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene rpoH CDS complement(244548..245282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 note possible pseudo, frameshifted CDS complement(245353..246087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 note possible pseudo, frameshifted CDS complement(246157..247017) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896539.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(247573..247974) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115437608.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(248087..249097) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687674.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene hemH CDS complement(249220..250335) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225464.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene tgt tRNA 250515..250591 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 250645..252558 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225463.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene thrS CDS 252693..253097 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951024.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene infC CDS 253241..253438 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232040.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene rpmI CDS 253451..253810 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene rplT CDS 254059..255048 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951025.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene pheS CDS 255152..257515 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687684.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene pheT CDS 257589..257891 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687686.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 257875..258183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690777.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 258360..258848 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225457.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene fxsA CDS 258989..260290 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687694.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene bioA CDS 260287..260934 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225454.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene bioD CDS 260949..261425 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225453.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 261455..262351 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951027.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene ubiA CDS 262531..262980 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222750.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene ptsN CDS 262982..263944 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225452.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene hprK CDS 263925..264779 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980831.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene rapZ CDS 264861..265802 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687704.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene ylqF CDS 265923..266855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 266982..267584 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235622.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 267766..269424 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247552.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene recN tRNA 269551..269627 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 sequence12 source 1..2153 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence13 source 1..1489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence14 source 1..1180 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence15 source 1..1154 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 53..331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 sequence16 source 1..1123 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence17 source 1..803 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence18 source 1..620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence19 source 1..566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence20 source 1..547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence21 source 1..520 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 191..475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 sequence22 source 1..252463 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 303..1487 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222148.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene coaBC CDS complement(1555..3732) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222147.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(3807..4013) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212665.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene rpoZ CDS complement(4071..4688) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691634.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene gmk CDS 4850..5416 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232954.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(5462..6250) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222143.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 6439..7794 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene yegQ CDS 7891..8403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705875.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(8627..10390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(10584..11213) product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218916.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 11655..12857 product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162098123.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 note possible pseudo, internal stop codon, frameshifted CDS 12850..14511 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222140.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene pqiB CDS 14511..15029 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222138.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 15036..15587 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220466.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 15714..18566 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705868.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene gcvP CDS complement(18871..19710) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216672.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 tRNA 19995..20070 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(20135..21337) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224987.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(21334..22437) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691661.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene trmA CDS 22580..23680 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224985.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene aroC CDS 23772..24182 product ProQ/FINO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002238237.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(24303..26288) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224983.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene parE CDS complement(26357..26881) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244258.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 27047..28342 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224981.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene serS CDS complement(28420..29418) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222131.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(29580..30656) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222130.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene prfA CDS complement(30761..31540) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222128.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(31548..32549) product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025456610.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(32939..33622) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224979.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 33621..33806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(33813..35147) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224978.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene glmM CDS complement(35277..36128) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693788.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene folP CDS 36403..38523 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222123.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(38725..39018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(39584..41062) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222122.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene ubiD CDS complement(41071..41388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(41396..41905) product DUF2199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222121.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(41912..42457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180320626.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(42533..42778) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222119.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(42790..43050) product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222118.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(43047..43631) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222117.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 note possible pseudo, frameshifted CDS complement(43797..44552) product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244259.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 44742..45233 product thioester dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167435477.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 45271..45999 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222115.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene fabG CDS 45993..47231 product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002257271.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(47291..47917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 47956..49662 product acyl-CoA synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237748.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 49659..50744 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072813.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 50747..51472 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266398.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 51469..52401 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105312.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 52398..52838 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316680.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 52897..53490 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261522.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 53507..55813 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463873.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 55856..56380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 56377..57579 product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002257271.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 tRNA 57633..57708 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 57780..58541 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224973.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 58542..59606 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222112.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 59840..61177 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695694.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(61242..62267) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083152.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(62277..63071) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 63508..64842 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212610.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene gdhA CDS complement(64977..65762) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212609.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 66099..67742 product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071120.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 67924..70050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(70353..71864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(71767..72135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 72495..74657 product TonB-dependent iron piracy receptor TdfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950972.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene tdfF CDS complement(74769..76172) product multidrug efflux transporter outer membrane subunit MtrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244265.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene mtrE CDS complement(76225..79428) product multidrug efflux RND transporter permease subunit MtrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224969.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene mtrD CDS complement(79440..80678) product multidrug efflux RND transporter periplasmic adaptor subunit MtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951249.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene mtrC CDS 80934..81569 product multidrug efflux system transcriptional repressor MtrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693763.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene mtrR CDS complement(81662..81874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358853.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 82044..82241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 note possible pseudo, frameshifted CDS complement(82309..85515) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980978.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene recC CDS complement(85617..87026) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702955.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(87372..88703) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118792797.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene ccoP CDS complement(88727..88897) product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212597.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(88902..89513) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212596.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene ccoO CDS complement(89540..90973) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216619.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene ccoN CDS 91301..93049 product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212594.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 93114..93548 product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220419.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(93613..94047) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212592.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(94052..94711) product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216612.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene exbB CDS complement(94778..95626) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693736.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 95874..96524 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693735.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(96610..97251) product GrxB family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216608.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 97552..99765 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224958.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(99827..100375) product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227008.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(100456..101001) product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689520.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(101111..101383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221302.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(101541..101930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225515.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(101933..102142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(102164..104767) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225125.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene pepN CDS complement(104906..105700) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222307.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(106427..107314) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244166.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(107364..107900) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222304.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene ruvC CDS complement(107903..108142) product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(108172..109182) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225123.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene dusB CDS 109397..110770 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687439.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(111274..112785) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225120.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene lysS CDS complement(112940..114193) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697398.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 114510..116306 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951270.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(116379..117959) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358883.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene purH CDS complement(118120..119343) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229369.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(119409..120080) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225307.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene serB CDS 120471..122012 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225308.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 122016..122399 product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689346.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 122464..123849 product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217354.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene pntB tRNA complement(124349..124424) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(124509..124868) product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212575.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(124887..125531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212574.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(125533..126069) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212573.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(126080..127177) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212572.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(127201..128622) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222078.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(128860..129741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 129964..131292 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224950.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(131374..131658) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224948.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(131808..133616) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224947.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene aspS CDS complement(133677..134378) product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224946.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(134524..135495) product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689377.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(135832..136095) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene rpsT CDS 136393..137535 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951282.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(137643..140372) product transferrin-binding protein TbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980797.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene tbpA CDS complement(140459..142240) product transferrin-binding protein TbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951284.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene tbpB CDS complement(142380..143192) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223465.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene murI CDS 143393..143854 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218833.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene tsaE CDS 143851..145101 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224939.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(145159..146301) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004465704.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(146358..146780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689388.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(146773..147585) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689389.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(147662..148039) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212541.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene acpS CDS complement(148090..148818) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695556.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene pdxJ CDS complement(148879..149619) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene recO CDS complement(149656..150744) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689394.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene pheA CDS complement(150822..152051) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222055.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(152170..153045) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693582.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(153138..153950) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222048.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 154034..154906 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(154970..156127) product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358927.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(156156..156545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224933.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 156719..157165 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689406.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(157330..157950) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229052.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(158050..159360) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689428.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(159496..160674) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212501.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene ftsZ CDS complement(160797..162044) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689434.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene ftsA CDS complement(162130..162858) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218801.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(162848..163762) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223420.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(163914..165323) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224928.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene murC CDS complement(165587..166426) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(166546..167616) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224927.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene murG CDS complement(167620..168888) product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218795.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(169068..170405) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705695.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene murD CDS complement(170437..170925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(170955..172037) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689450.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene mraY CDS complement(172131..172313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693553.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(172310..173668) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243999.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(173734..174714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(174772..176250) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224920.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(176275..178023) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218783.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(178090..178353) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220363.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene ftsL CDS complement(178376..179335) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224919.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene rsmH CDS complement(179332..179787) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689463.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene mraZ CDS 180135..181283 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980791.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 tRNA 181415..181491 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 181498..181573 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(181770..182591) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(182626..183270) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224916.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(183273..184139) product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229030.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene ftsN CDS complement(184243..185739) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224914.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(185753..186073) product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030003521.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 186559..188085 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689473.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene putP CDS 188339..191944 product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224912.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene putA CDS complement(192727..193803) product trimeric porin PorB.IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951356.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene porB CDS complement(194133..194930) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244344.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene truA CDS complement(195067..196188) product trimeric porin PorB.IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951356.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene porB CDS complement(196448..197746) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225666.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene tyrS CDS complement(197787..198605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(198675..199766) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene ychF CDS complement(199877..200671) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229815.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(200860..202536) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003698015.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 202715..203146 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217944.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 203324..204214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(204285..205670) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697660.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(205767..208157) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689984.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene gyrB CDS 208444..209310 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225975.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 209395..211431 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951344.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 211819..211986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 212065..212886 product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693940.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 212971..213249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 note possible pseudo, frameshifted CDS complement(213799..214962) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705279.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(215184..215750) product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690352.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(215928..217442) product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218620.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene katA CDS 217785..219128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 219203..219496 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene raiA CDS 219740..220018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 220077..220196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(220314..221009) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225669.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(221027..221527) product 4-hydroxyphenylacetate 3-monooxygenase, reductase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244300.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene hpaC CDS complement(221645..222085) product MarR family adhesin repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214596.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene nadR CDS complement(222426..222935) product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223011.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 tRNA complement(223024..223099) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 223318..224397 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002257287.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene apbC CDS complement(224583..228929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 229206..232052 product pilus assembly/adherence protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950983.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 232461..233591 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244304.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene carA CDS 233622..233786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 234050..237265 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225779.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene carB CDS complement(237567..238607) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950980.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene queA CDS 238959..239423 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687267.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene accB CDS 239538..240899 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223021.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene accC CDS 241017..241904 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223022.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene prmA CDS 241922..242485 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687260.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene orn CDS complement(242549..243832) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687258.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene hemL CDS complement(243896..244309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 244513..245841 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950977.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene miaB CDS complement(245910..247343) product surface lipoprotein assembly modifier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951324.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(247620..247865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689849.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 247970..248407 product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212270.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 248419..248886 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218702.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(248928..249416) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218701.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(249484..250539) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221951.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene aroG tRNA complement(250331..250406) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 251017..251307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 note possible pseudo, internal stop codon, frameshifted CDS 251479..251640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(251715..251897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(251990..252289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 note possible pseudo, frameshifted sequence23 source 1..228514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(5736..11054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(11578..14415) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224777.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(14516..15292) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243945.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene lpxA CDS complement(15360..15809) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231544.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene fabZ CDS complement(15843..16889) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243946.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene lpxD CDS complement(16924..17424) product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690321.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(17489..19867) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951351.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene bamA CDS complement(19922..21262) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243948.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene rseP CDS complement(21474..22709) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011798751.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene ispC CDS complement(22714..23511) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002239446.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(23514..24260) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690027.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(24316..24873) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216270.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene frr CDS complement(25054..26181) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226918.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 tRNA complement(26255..26330) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 26432..26920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690329.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 27017..27640 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226919.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene rsmG CDS 27731..28516 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221868.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(28653..29237) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010359364.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene rnhB CDS complement(29299..30732) product KAP family NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481767.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(30866..32761) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115437557.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene mnmG CDS complement(33001..34473) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215509.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 34618..35610 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221872.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene pdxA CDS complement(35832..38564) product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980758.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 39067..40059 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225965.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 40107..41279 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033909557.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene lpxB CDS 41338..41532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 41534..41944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220211.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(42058..42867) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002236618.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene dapB CDS complement(42877..43254) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689992.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 43481..43915 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218609.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene fur CDS 43987..44715 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002236619.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene aat CDS complement(44786..45817) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002236620.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene gap CDS complement(46011..46850) product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243957.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 46997..48979 product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243958.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 tRNA 49050..49125 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 49158..49234 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(49638..50162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(50178..50453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(50777..52024) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689969.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene fabF CDS complement(52188..52424) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215574.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene acpP CDS 52655..53665 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243962.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 53857..54138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693718.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 54163..54675 product DUF2247 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215584.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 54778..57570 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981015.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene polA CDS 57830..58675 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215243.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(58992..61409) product haemoglobin-haptoglobin-utilization protein HupB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705045.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene hupB CDS complement(61466..62458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 62801..64324 product surface lipoprotein assembly modifier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010356231.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 64429..65775 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687082.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene mnmE CDS complement(65845..67740) product bifunctional anthranilate synthase component I family protein/class IV aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700811.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 67908..68837 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705040.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene ppk2 CDS complement(68919..70361) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225842.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene aldA CDS complement(70396..70596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(70605..70994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(71202..72116) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221643.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 72294..73094 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221642.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 73142..73918 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219882.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene mlaE CDS 73970..74467 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene mlaD CDS 74504..75094 product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225840.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 75150..75428 product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687106.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 75425..76240 product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951410.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 76366..76728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229974.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 76728..77111 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687109.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 77108..77596 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690423.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(77676..78191) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167435420.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 78327..78542 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218070.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene rpmE CDS 78704..79333 product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002995289.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 79480..81129 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010361207.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 81258..81863 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214825.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 81920..82315 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690431.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(82514..82960) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167435453.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(83267..83479) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214819.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene rpsU CDS complement(83772..85601) product lytic transglycosylase LtgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225836.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene ltgA CDS 85984..86721 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225835.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 86723..87409 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692419.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 87605..88471 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687141.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(88533..89105) product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020996754.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 89260..90120 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223092.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 90350..90703 product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214803.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 90693..91559 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214802.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene atpB CDS 91616..91852 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214801.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene atpE CDS 91989..92396 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214796.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 92401..92934 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225831.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 92945..94492 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225830.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene atpA CDS 94517..95392 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225829.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene atpG CDS 95431..96828 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219871.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene atpD CDS 96839..97261 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225828.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 97434..98339 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218046.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene glyQ CDS 98416..98826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 98847..99164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 note possible pseudo, frameshifted CDS 99119..100909 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244319.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene glyS CDS 100973..101971 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002257440.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 assembly_gap 102090..102184 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 102325..102585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(102816..103541) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692438.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 103654..104448 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002234194.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(104664..105038) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692441.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 note possible pseudo, frameshifted CDS complement(105209..105955) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225822.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene fabG CDS complement(106017..107585) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696594.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene guaA CDS complement(107631..108047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(108104..109972) product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010359721.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene msbA CDS complement(110111..111037) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225819.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene fabD CDS complement(111063..111374) product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687178.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(111480..112442) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225817.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(112692..113117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689511.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(113135..113365) product MafI family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244315.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(113428..113784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223957.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(113995..115050) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981006.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene plsX CDS complement(115151..115678) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244314.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(115851..116030) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214744.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene rpmF CDS complement(116064..116567) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221556.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 116715..117305 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221554.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 117364..118077 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025456712.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(118158..119795) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687191.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene yidC CDS complement(119963..120184) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214730.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene yidD CDS complement(120234..120599) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223062.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene rnpA CDS complement(120602..120736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 121009..122556 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687194.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene dnaA CDS 122636..123739 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223059.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene dnaN CDS complement(123943..126000) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225804.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene ppk1 CDS complement(126166..126609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225803.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(126616..127131) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225802.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 127560..130190 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025456399.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene leuS CDS complement(130357..131646) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689841.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 131726..132694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224861.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(132871..134784) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225782.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene dxs CDS complement(134867..135856) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225783.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene xerC CDS 135956..137020 product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225784.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene fba CDS 137178..138002 product factor H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981001.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 138149..138826 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225786.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene tsaB CDS 138823..139263 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700855.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene rimI CDS 139257..139997 product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225788.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 140059..140700 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene pyrE CDS 140774..141205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690500.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 141400..143415 product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225789.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(143665..143844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 143837..144052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(144097..145527) product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(145626..146237) product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 146290..146415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(146426..146752) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(146829..147485) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687226.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 147692..148465 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003708296.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene tpiA CDS 148472..148831 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214678.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene secG tRNA 148849..148934 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 149127..149372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(149511..150197) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(150272..150745) product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224865.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene queF CDS 151027..152199 product fatty acid resistance MFS efflux transporter adaptor subunit FarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224866.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene farA CDS 152223..153749 product fatty acid resistance MFS efflux transporter permease subunit FarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224867.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene farB CDS 154004..154237 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216391.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene rpmB CDS 154266..154421 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212306.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene rpmG CDS complement(154635..155819) product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243976.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene ubiM CDS complement(156064..156336) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212328.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene rpmA CDS complement(156364..156672) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216394.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene rplU CDS 156895..157869 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216396.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene ispB CDS 157874..158320 product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 tRNA 158341..158412 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 158670..160346 product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221967.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene pilB CDS complement(160439..160648) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696096.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(160641..161273) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689816.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene coaE CDS complement(161275..162135) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212335.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(162209..163441) product type 4 pilus assembly protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216405.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene pilG CDS 163786..165429 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224874.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene pgi CDS 165639..166460 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224875.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene dapD CDS 166627..167412 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223367.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene fabI CDS 167561..168001 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921414.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene mscL CDS complement(168060..169058) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689799.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene ilvE CDS 169382..169696 product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216413.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 169668..170876 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689796.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene lapB CDS 170898..171314 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216418.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene gloA CDS complement(171458..173791) product FimV/HubP family polar landmark-like protein TspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180298734.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene tspA CDS 174088..174618 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010359130.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 174615..174911 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980782.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 174911..175189 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216424.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 175229..176095 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689790.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 176166..176924 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221975.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 177000..177461 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689787.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene dtd CDS 177511..178521 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224882.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene dusA CDS complement(178591..179478) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221978.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene gluQRS CDS complement(179495..179785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(179939..180994) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221981.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene tal CDS 181085..182065 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243982.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 182130..182666 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689546.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 182663..183244 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231784.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene lptC CDS 183225..183755 product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216438.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene lptA CDS 183799..184563 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216440.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene lptB tRNA 184754..184829 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(185031..185732) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224887.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene mtgA CDS complement(185735..186544) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689536.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene aroE CDS 186734..187105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 187379..188797 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226993.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene glnA CDS 188995..190230 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689532.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 190227..190502 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218732.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(190545..191087) product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705815.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(191080..191232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(191220..191453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695641.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(191506..191829) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695639.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(191819..192172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216461.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(192385..192720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222807.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(193277..193732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010360642.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(193713..194342) product HINT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003749677.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(194473..194850) product immunity 41 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(194856..196595) product polymorphic toxin MafB class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951299.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene mafB CDS complement(196599..197540) product adhesin MafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222000.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene mafA CDS complement(197660..198760) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455827.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 198913..200487 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212449.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(200695..202113) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216474.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene hemN CDS 202248..202982 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene fnr CDS complement(203109..204059) product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212453.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 204421..205194 product peptidoglycan-binding outer membrane protein RmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212455.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene rmpM CDS 205316..206272 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689496.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene thiL CDS 206265..206750 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212457.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(206803..208479) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243991.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene ettA CDS complement(208851..210395) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene nadB CDS complement(210447..211559) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222012.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene nadA CDS 211760..212698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222013.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 212928..213809 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689485.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene nadC CDS complement(214040..214279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 214551..214832 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222014.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 214890..215660 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951295.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene xth CDS complement(215945..216622) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703604.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(216697..217578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 217706..218077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 218178..219098 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244299.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene ribF CDS 219240..222032 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225664.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene ileS CDS 222292..222798 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217934.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene lspA CDS 222817..223785 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221497.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene ispH CDS complement(223861..224520) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222994.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 224680..226794 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167395505.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 226982..227791 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225663.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 repeat_region 228036..228466 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtagctcccattctcatttcgcagtgctacaat sequence24 source 1..212329 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(447..1298) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063673.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 1396..2382 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037507.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(2533..3192) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224520.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene ung CDS complement(3410..3676) product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680497.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 3765..4085 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222437.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 4100..5047 product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222438.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(5251..6342) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225205.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 6504..6779 product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002237935.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 6781..7404 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217173.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene lipB CDS 7397..8380 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688622.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene lipA CDS 8855..9319 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217177.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene bfr CDS 9348..9821 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213535.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene bfr CDS 10160..10477 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688619.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 10523..13081 product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225207.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene glnD CDS 13228..14691 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213540.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene guaB CDS complement(14880..17270) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225208.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene rnr tRNA 17344..17430 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 17468..17558 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(17968..19779) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219266.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene typA CDS complement(19871..20776) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225209.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 20838..21494 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688607.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 21716..23575 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688598.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene ilvD CDS 23626..24816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(24893..25945) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217196.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene bioB CDS complement(26149..26670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 note possible pseudo, frameshifted CDS complement(26670..27524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 note possible pseudo, frameshifted CDS complement(27586..27891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222465.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(27903..28367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(28381..28563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(28698..29483) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697046.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(29556..30866) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222469.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene tilS CDS complement(30935..31894) product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691155.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 32102..32503 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217207.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(32557..32754) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222472.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene iscX CDS 32831..33424 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225220.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(33524..33865) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217209.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene fdx CDS complement(33958..34320) product TIGR02328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837049.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(34399..36261) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244129.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene hscA CDS 36433..37281 product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225224.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene hpnD CDS 37278..38591 product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225226.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene hpnE CDS 38669..39388 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225227.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 39750..40421 product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693243.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 40431..40796 product DUF4810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219297.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 40793..41443 product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217218.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 41729..43498 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693484.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 43599..44267 product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213636.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene hda CDS 44264..44932 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225254.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 45027..46157 product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244116.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 46233..47090 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688557.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene lgt CDS complement(47153..47815) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002233833.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(47913..49706) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704087.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(50385..53399) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225260.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 53564..54244 product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225261.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 54258..54632 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225263.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(54791..54967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(55182..55718) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225264.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(55749..56105) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221051.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene folB CDS 56161..56769 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691121.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene plsY CDS 56847..57692 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951135.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(57797..58129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(58179..58421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688538.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 58528..59658 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244111.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(59817..60035) product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213659.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 60246..61496 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 61589..62233 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219343.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 62252..64162 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222546.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 64183..64548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 64660..66135 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219345.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene trpE CDS 66394..67530 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230480.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 67593..68075 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224566.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 68181..69236 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225284.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 69390..69995 product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221065.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 tmRNA 70058..70419 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 70598..70750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 71505..72821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 note possible pseudo, frameshifted CDS 73762..74598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 74598..77858 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583655.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 77855..80686 product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(81444..82874) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222388.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 83080..86484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 86635..87018 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217080.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 87040..87882 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222386.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene kdsA CDS 87904..88344 product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688914.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 88389..89675 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691316.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene eno CDS 89690..89968 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213385.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene ftsB CDS complement(90433..91587) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357909.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene nrdB CDS complement(91878..94157) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222380.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene nrdA CDS 94656..94958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688925.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(94989..95756) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688926.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(95852..96679) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225172.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene mutM CDS complement(96730..97395) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688928.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 97581..99545 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225171.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 99609..100301 product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225170.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 100785..102149 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692969.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 102413..103069 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224491.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene cmk CDS 103224..104909 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002237993.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene rpsA CDS 104920..105234 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213349.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(105668..106075) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213348.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 106197..107360 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220876.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 107501..108196 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225169.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene fghA note possible pseudo, internal stop codon CDS 108746..109888 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220874.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene zapE CDS 109959..110384 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213338.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene ndk CDS 110524..111624 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688948.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene rlmN CDS 111621..112385 product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227268.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene pilW CDS 112401..113666 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688953.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene ispG CDS complement(113719..114339) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688955.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene clpP CDS complement(114427..115740) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226314.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene tig CDS complement(115946..118378) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691325.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 118594..119805 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225164.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(119852..120334) product DUF4189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691328.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 120758..121504 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213318.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene pssA CDS 121505..122311 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688964.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(122455..123909) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216936.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(123906..124607) product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216938.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(124604..125383) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 125646..127070 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244170.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 127158..128708 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358244.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 128766..129305 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219084.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(129389..130591) product DUF1311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693055.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(130908..131756) product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213148.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene hexR CDS complement(131804..132784) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216974.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(132765..133460) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688731.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene pgl CDS complement(133524..134969) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693052.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene zwf CDS complement(135108..135335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 135354..137189 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691226.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene edd CDS 137280..137918 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225133.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(138220..139230) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225132.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 139387..140448 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216969.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene mutY CDS complement(140593..141336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 141648..142097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(142285..143313) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358628.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene trpD CDS complement(143386..144126) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204885.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(144117..144716) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217367.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 145217..147415 product TonB-dependent zinc receptor ZnuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244095.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene znuD CDS complement(147557..148279) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689647.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 148432..151293 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244094.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene uvrA CDS 151322..152686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(153189..154508) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119617.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(154904..155794) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222615.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene sucD CDS complement(155805..156971) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225315.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene sucC CDS complement(157040..157330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225316.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(157425..158858) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225317.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene lpdA CDS complement(159117..160298) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225318.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene odhB CDS complement(160398..163226) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213758.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(163431..164714) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213761.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene gltA CDS complement(164840..165088) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213764.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(165092..165799) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221124.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(165919..167682) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980875.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene sdhA CDS complement(167685..168026) product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223854.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene sdhD CDS complement(168020..168397) product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688393.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene sdhC CDS complement(168675..170078) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980874.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(170327..171064) product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213776.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(171343..173619) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223856.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene metE CDS complement(173757..174635) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223857.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene metF CDS 174835..175110 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217400.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 175110..175235 product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213788.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene ykgO CDS complement(175341..175541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 175699..176838 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225323.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 176835..177416 product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225324.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene metW CDS 177536..178372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(178420..178980) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219406.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene efp CDS complement(179022..180173) product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225328.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene earP CDS complement(180222..180500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455789.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 180627..181295 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene can CDS 181346..182287 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225331.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene miaA CDS 182291..183010 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693308.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene tadA CDS 183015..183503 product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225333.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 183569..184321 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706327.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene rlmB CDS complement(184383..185774) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225335.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 186152..187027 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225337.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene dapA CDS 187105..188232 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693315.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene bamC CDS complement(188289..189221) product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688351.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene pip CDS 189315..189752 product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230436.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene yciA CDS complement(189795..190616) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222631.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 190732..191190 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222632.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 191348..193573 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225341.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 193716..194021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 tRNA complement(194356..194445) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(194521..194611) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(194692..195471) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706583.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene yaaA CDS 195400..195579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(195627..196814) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225352.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene dapC CDS complement(196892..197344) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951049.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene dut CDS 197589..198200 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108043587.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 198197..198505 product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951048.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(198573..199064) product PilX family type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455782.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(199061..199615) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244085.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(199615..200541) product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244084.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(200538..201074) product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149323756.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene pilV CDS complement(201170..201787) product Tfp pilus assembly protein FimT/FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230433.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(201995..203401) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225362.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene dnaB CDS 203565..204146 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220670.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(204259..204594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 204780..205616 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225366.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene cysT CDS 205701..206561 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225368.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene cysW CDS 206558..207631 product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225369.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(207687..209213) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225371.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene ilvA CDS 209366..210535 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225372.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(210752..211099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 211349..212149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 sequence25 source 1..130215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(80..496) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215267.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene dksA CDS complement(639..1430) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243933.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene proC CDS complement(1886..2572) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243931.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 2691..3734 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218487.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene pilT CDS 3793..5019 product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692100.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 5137..7287 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221798.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene yccS CDS complement(7426..7872) product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(8087..8548) product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223804324.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(8650..8874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(9124..9390) product DUF3079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184524.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(9703..10968) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243928.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene ftsY CDS 11114..12682 product bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980745.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene msrAB CDS complement(12767..13252) product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215245.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(13283..14284) product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 14343..15023 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705095.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 15049..15321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686997.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 15375..16745 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225769.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene glmU CDS 16822..17151 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225768.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(17222..18487) product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243924.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene efeB CDS complement(18630..19796) product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215233.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(19793..20632) product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225766.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 20838..22163 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221791.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 22306..24144 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225764.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene glmS CDS 24263..26320 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225763.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene metG tRNA complement(26143..26237) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(26395..27348) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118793072.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 27482..27700 product DUF2061 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221786.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 27778..28107 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216146.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 28271..29194 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216134.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene lpxC CDS 29859..31307 product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225759.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene gnd CDS 31369..32646 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225758.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene waaA CDS 32684..33133 product CopD family copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225757.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 33163..34134 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688067.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 tRNA 34203..34278 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 34475..35728 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225755.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene murA CDS 35812..36990 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248921.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(37055..37303) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221759.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(37391..38308) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225753.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene ftsX CDS complement(38305..38955) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225752.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene ftsE CDS complement(39155..39637) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688077.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 39770..40123 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692077.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene arsC CDS 40120..40833 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220030.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 40833..42284 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225749.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene gltX CDS 42359..42700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225748.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 42704..43222 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225747.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(43316..45913) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688085.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene mutS CDS complement(46531..47205) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688090.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene tsaA CDS 47319..47954 product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223229.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 47993..48961 product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218264.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene waaC CDS 49187..49936 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218263.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 49947..50882 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225744.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 50945..51556 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002255036.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(51608..51925) product DUF4298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225742.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 52081..53352 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705171.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene purD CDS 53386..53988 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688107.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(54348..54767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221737.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(55206..55793) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688115.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(55815..56552) product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705168.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(56542..57384) product DUF692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010355671.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(57602..57850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(57921..58370) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225738.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 58600..59493 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010355679.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 59597..60700 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225736.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene prfB CDS complement(60858..61187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(61330..62787) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688130.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(63042..67196) product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705164.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(67250..69076) product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688132.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 69356..70576 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215131.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene sstT CDS complement(70701..71330) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(71343..71792) product DUF3290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355544.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(71887..72102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248798.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(72095..72310) product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218233.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(72382..73725) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223213.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene argG CDS complement(73885..74271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 74361..75173 product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225729.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 75213..76199 product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218229.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 76451..76807 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224824.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 76798..77280 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215610.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 77294..77887 product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224826.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 77877..79133 product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224828.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene nuoD CDS 79133..79606 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224830.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene nuoE CDS 79664..80959 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224831.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene nuoF CDS 81018..83279 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene nuoG CDS 83282..84358 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221910.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene nuoH CDS 84434..84829 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 84885..85364 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216341.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene nuoI CDS 85376..86047 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689941.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 86044..86349 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215628.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene nuoK CDS 86352..88376 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221913.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene nuoL CDS 88472..89968 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691918.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 89978..91420 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224835.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene nuoN CDS 91536..91835 product DUF2818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010359269.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(91929..93425) product subtype B tannase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898589.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(93568..94464) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691917.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(94448..94756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(94784..95650) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221919.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene rsgA CDS complement(95714..97570) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980767.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(97606..98190) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689924.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene ruvA CDS complement(98272..98598) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689921.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(98664..99383) product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221924.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(99511..99975) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218664.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene trmL CDS complement(100040..100537) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012503965.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 100764..101507 product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012503964.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene bioH CDS 101509..102297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224840.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(102348..104648) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221929.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene recQ CDS complement(104713..105495) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221930.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene trpC CDS complement(105546..106502) product YheT family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224842.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(106499..107146) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(107150..108688) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935990.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene murJ CDS 108892..109590 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224844.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(109647..110651) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224845.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 110721..113129 product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243965.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 113231..114226 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187820231.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 repeat_region 114513..114891 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcggaaaacttgccccacaaatcggggattacgac CDS complement(114951..116831) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224849.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(116923..117627) product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212125.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene truC CDS 117694..118326 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215682.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 118399..119769 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224850.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene purB CDS 119959..120192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(120353..120967) product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224851.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(121003..123153) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224852.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene dinG CDS complement(123547..124839) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691893.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(124829..125740) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221945.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 125848..126246 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216361.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 126295..126900 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230218.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(126955..127410) product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689877.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(127665..129035) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951325.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene ffh CDS 129253..130059 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689873.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 sequence26 source 1..124428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(474..1145) product TIGR01621 family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230022.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1181..1741) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692360.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene coaD CDS complement(1820..2503) product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225674.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(2662..2928) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214948.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(3003..3473) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225675.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene rlmH CDS complement(3527..3913) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687037.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene rsfS CDS complement(3972..4577) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223158.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene nadD CDS complement(4574..5173) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690382.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(5202..6743) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002259776.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(7001..7918) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218156.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene thrB CDS complement(7955..8671) product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene ubiG CDS 8851..10092 product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225681.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(10162..11814) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951396.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 11957..12520 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705078.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene gmhB CDS 12549..13292 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225683.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 13289..13978 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705080.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 14170..14370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 14370..14714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(14979..16880) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene thiC tRNA 17222..17298 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 17431..18306 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686971.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 18315..19253 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225688.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(19375..21150) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686967.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene ptsP CDS complement(21150..21419) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686964.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(21487..21924) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214994.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(22013..22579) product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694420.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(22646..23389) product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225694.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 23561..24193 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218182.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(24399..26183) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225695.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(26418..26780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(27024..27800) product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699304.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(27827..29176) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215003.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(29195..29776) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene petA CDS complement(29899..30648) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225699.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 30779..31708 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225700.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(31862..32254) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686946.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene rpsI CDS complement(32264..32695) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215010.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene rplM CDS complement(33060..33362) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215011.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(33376..33744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215012.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(33756..34745) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215013.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(34868..37570) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244350.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene ppc CDS 37773..38543 product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935810.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(38755..38979) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219958.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(38980..40368) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225704.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(40470..41291) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230051.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene prmC CDS complement(41354..42796) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692003.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene tldD CDS 43082..44317 product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225706.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene cytX CDS 44314..45408 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701763.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 45517..45918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 46061..46708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 46724..47341 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225708.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene thiE CDS 47448..47642 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219965.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene thiS CDS 47702..48490 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221723.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(48951..49814) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225710.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(49826..51604) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225711.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(51601..52107) product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686901.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene rfaE2 tRNA complement(52323..52398) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(52427..52503) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(52528..52605) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 52828..53682 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686899.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene folD CDS complement(53742..54326) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686897.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 54500..55615 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696344.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene asd CDS complement(55709..56239) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225715.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(56250..56594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686892.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(56581..57426) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225717.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(57448..58869) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010355798.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene cysS CDS complement(58880..59749) product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189681.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(59810..60964) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686881.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene obgE CDS complement(60964..61152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 61241..61771 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066380.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(61806..62681) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225719.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene rsmI CDS 62727..63074 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217775.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 63079..63672 product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692028.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 63733..64341 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686871.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 64409..64969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225720.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 65017..65796 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218216.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene map CDS 65940..66233 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 66481..66855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010355785.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(66914..68377) product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219978.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(68762..69178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(69413..69994) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244352.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 70072..70314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225724.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 70489..71217 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218221.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene rpsB CDS 71341..72195 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218222.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene tsf CDS 72414..73133 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686859.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene pyrH CDS 73463..74233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 74236..74559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688020.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 74597..74941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215110.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 75467..75829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 75837..76052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688150.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(76173..78380) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980762.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene uvrD CDS complement(78803..81493) product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224816.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene glnE CDS complement(81711..81908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 note possible pseudo, frameshifted CDS complement(82036..82542) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687075.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene luxS CDS complement(82596..82919) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225851.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene cyaY CDS 82990..83160 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225850.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 83171..84391 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene lysA CDS 84597..85028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687065.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(85072..85212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(85169..86704) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221654.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(87017..88651) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214867.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene groL CDS complement(88812..89036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 note possible pseudo, frameshifted CDS 89385..91550 product TonB-dependent siderophore receptor FetA/FrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981016.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene fetA CDS 91686..92645 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981017.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 92853..93821 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981018.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 93811..94785 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221668.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 94830..95456 product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002258733.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 95696..96454 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226767.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 96763..99075 product YadA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003780110.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(99141..99479) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218119.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 99939..103895 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014580344.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene purL CDS 103990..104748 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219913.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene gloB CDS 104951..109672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 109909..111363 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225872.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene mgtE CDS complement(111453..112358) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981020.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene hslO CDS 112603..113184 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219917.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 113203..113421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214913.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 113559..113906 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002237372.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 113903..114595 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214916.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 114651..116060 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 116288..120541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 120583..122124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 122395..122547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691757.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 122678..123739 product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055032204.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(123800..124249) product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214937.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 sequence27 source 1..119175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(141..347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(274..777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225204.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(1255..3174) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225202.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(3251..3622) product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033909640.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 3820..5127 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222431.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 5120..5554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217157.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(5613..5882) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213508.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(6064..8526) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225200.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene lon CDS 8744..9847 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230064.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(9927..11675) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225198.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene recD CDS complement(11741..12436) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225197.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene lolD CDS complement(12429..13676) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225196.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 13868..14146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213502.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(14204..14836) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706246.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene recR CDS complement(14890..16428) product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225194.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(16515..16868) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225193.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 17019..18647 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002260424.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 18732..19985 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225191.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 20105..20413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217140.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 20485..21516 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691202.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene ruvB CDS complement(21593..22276) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213492.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene rpe CDS 22435..22869 product Spy/CpxP family protein refolding chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688677.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(22881..23744) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980911.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(23752..24372) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217135.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(24476..24970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(25045..25659) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691204.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 25866..27638 product nitrate/nitrite sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225189.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 27635..28291 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225188.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(28663..29697) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222409.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene purM CDS complement(30162..35816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(36919..37287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(37710..39692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(39689..40777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(40989..41150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(41147..41395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(41392..41625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(41731..42015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(42012..42203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(42684..42908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(42911..43210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(43207..43467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(43626..44039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(44342..45559) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772645.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 tRNA complement(45780..45864) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 46109..46687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689160.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 46680..47273 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220947.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene ribA CDS 47426..48763 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223744.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene ribBA CDS complement(48853..50454) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688773.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(50522..51361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688774.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(51372..51932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002239757.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(51925..53166) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691244.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(53295..56306) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455799.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(56417..57727) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688780.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 57842..58213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691259.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 58286..59695 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244109.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene thrC CDS 59754..60536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980885.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 60724..61500 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213456.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(61589..64057) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219226.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(64054..65235) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219225.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene hflX CDS complement(65241..66518) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693022.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(66659..67384) product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213448.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(67457..68134) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213447.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene radC CDS complement(68221..69570) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223737.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene gshA CDS 69826..71235 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219221.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene leuC CDS 71360..71647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688807.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 71751..72116 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940847.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 72162..72803 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222556.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene leuD CDS 72868..73329 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 73420..74490 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213431.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene leuB CDS 74840..75403 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217107.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 75620..77986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 78421..79818 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217106.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene aspA CDS complement(79886..81391) product surface lipoprotein assembly modifier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951081.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(81536..82498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706105.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(82739..86161) product TonB-dependent receptor TdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951080.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene tdfG CDS complement(86669..87544) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219215.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(87546..88244) product DUF4870 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357715.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(88267..88746) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217103.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene ybaK CDS 88821..89180 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357712.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 89216..90079 product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229395.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 90177..91136 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222563.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene ttcA CDS complement(91270..91824) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222405.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(91889..92815) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706094.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(92803..93279) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217097.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(93344..93799) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702839.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(93866..94969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222398.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(95077..96564) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935398.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 96918..102128 product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235238.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(102219..102431) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217091.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 102579..103736 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093428.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 103861..105297 product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244145.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 105309..106295 product DUF459 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225181.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 106292..107485 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225180.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 107591..108643 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191693.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 108671..109717 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193524.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 109825..111372 product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691393.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 111510..113063 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537535.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 113117..115129 product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244147.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(115191..116213) product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688898.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene mltB CDS complement(116461..116913) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232586.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene rplI CDS complement(116930..117160) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213306.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene rpsR CDS complement(117167..117469) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213304.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene priB CDS complement(117470..117838) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene rpsF CDS complement(117987..118931) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213296.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene trxB sequence28 source 1..106947 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(754..1038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(1080..1301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(1384..1653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(1670..2470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 3032..4759 product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225031.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene ilvB CDS 4771..5262 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212817.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene ilvN CDS 5326..5619 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212818.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 5693..6706 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689683.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene ilvC CDS complement(6836..7831) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212820.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(7976..10561) product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689681.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene acnB CDS complement(10770..11840) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212823.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene lptG CDS complement(11837..12952) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212824.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene lptF CDS 13121..14527 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689678.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 14590..15030 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244237.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 15138..15959 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212827.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 16071..16697 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700925.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene purN CDS 16713..17174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 note possible pseudo, frameshifted CDS 17210..17383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 note possible pseudo, frameshifted CDS 17501..17923 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689668.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 18179..18895 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212831.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 19044..19946 product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225035.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 19989..20762 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 20840..22561 product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247565.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 22654..23610 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162817181.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene gshB CDS 23669..24052 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951219.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 24189..24662 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222219.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 24790..25893 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232768.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene mnmA CDS 25965..27635 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225041.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 27747..29381 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225042.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 29652..31181 product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(31463..32242) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704691.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(32317..33048) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(33050..33718) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692001.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(33708..34367) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686917.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(34612..36540) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225051.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene rpoD CDS complement(36725..38497) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225052.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene dnaG CDS complement(38653..41403) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225053.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene secA CDS 41534..41956 product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225054.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 42240..42794 product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225055.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene azu CDS 42887..43438 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220565.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 43515..44135 product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688277.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 44235..45380 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688278.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene dapE CDS 45467..46222 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082013565.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 tRNA 46413..46488 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 46814..47824 product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225061.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene waaF CDS 47879..48325 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358325.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene smpB CDS complement(48502..49869) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225062.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(49976..50218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 50692..51174 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212871.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 51369..52073 product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020997346.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene hpnC CDS complement(52153..52623) product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223573.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 52710..54545 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229696.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(54944..56140) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222237.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 56491..56790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222238.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 56790..56975 product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688317.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene ccoS CDS 56965..58278 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219025.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 58436..59170 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693344.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene dnaQ CDS 59167..59856 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225068.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene ispD CDS 59887..60369 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951155.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene ispF CDS 60456..61127 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225069.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene rpiA CDS 61193..61867 product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212884.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 62022..62768 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216849.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(63074..64792) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225071.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene argS CDS complement(64884..66092) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225072.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene pncB CDS complement(66200..67522) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182724.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene brnQ CDS complement(67543..68388) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225073.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 68530..68745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(68742..69269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002238123.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(69407..70183) product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696991.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 70379..70843 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688341.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 70925..71653 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688342.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene rph CDS 72056..73273 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688344.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(73397..76114) product TonB-dependent zinc piracy receptor TdfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706334.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene tdfH CDS complement(76445..77005) product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216863.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(77122..77316) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212918.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(77306..79387) product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225081.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 79973..80260 product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688168.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(80605..81237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115280.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(81346..81666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(81674..81907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 82055..83488 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225085.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 83601..84383 product fimb protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224433.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 84611..86167 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244180.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 86181..86927 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951167.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene surE CDS 87030..88043 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020996850.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(88163..88645) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225088.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(88798..88959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(89033..89461) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225089.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene recX CDS complement(89566..90273) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688188.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 90671..91936 product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225092.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(91996..92802) product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225093.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 92991..93200 product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212949.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 93288..94502 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225095.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(94574..97147) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702540.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene clpB CDS 97407..98417 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225097.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene trpS CDS 98485..99030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225098.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 99385..99708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225099.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(99996..101636) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225100.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene ppx CDS 101802..102425 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219051.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 102559..103917 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951164.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 103919..104461 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695064.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(104637..105311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 105632..105994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(106044..106436) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654127.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene cueR CDS 106584..106793 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217091.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 sequence29 source 1..103232 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(61..137) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 255..1640 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230673.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(1851..2630) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225108.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 2905..5994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 6138..7196 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695315.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene dinB CDS complement(7400..9415) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225110.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene rep CDS complement(9435..10199) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688696.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene aroD CDS 10399..11445 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688695.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene recA CDS complement(11616..12536) product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419505.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene yddG CDS complement(12661..12996) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219073.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(13078..15246) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244171.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene dnaX CDS complement(15334..17310) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003698476.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene mutL CDS 17454..17639 product DUF3460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213027.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 17650..18318 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222286.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 18318..19034 product tol-pal system YbgF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697104.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 19082..19567 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222288.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene purE CDS complement(19639..20079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 note possible pseudo, frameshifted CDS complement(20022..20939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 note possible pseudo, frameshifted CDS 21330..21806 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688476.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene greA CDS 21943..22086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951147.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 22258..22440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688481.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(22502..23503) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688483.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(23580..27413) product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244102.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 27943..29631 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222583.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene dld CDS 29820..30191 product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213703.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 30350..30898 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002236926.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 30994..32085 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222585.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 32210..32380 product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688501.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(32494..34563) product TonB-dependent siderophore receptor FetA/FrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981016.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene fetA CDS complement(34861..37617) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216981.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene gyrA CDS 38210..39241 product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974439.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 39500..39805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 39802..40890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(40951..41451) product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219110.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene hscB CDS 41534..41755 product alternative ribosome-rescue factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213166.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(41715..42035) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216984.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene iscA CDS complement(42396..42782) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213175.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene iscU CDS complement(42850..42978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(43059..44273) product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980928.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(44303..44749) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688879.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene iscR CDS 45104..46276 product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(46341..47264) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222326.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene truB CDS complement(47297..47668) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220822.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene rbfA CDS 47833..49077 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222327.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene clpX CDS 49770..50270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229590.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 50365..50919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222329.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(51268..52689) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219125.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 53027..53974 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226288.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(54025..54357) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213213.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene trxA CDS 54655..55128 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225143.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(55198..55989) product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009348575.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene nadE CDS complement(56034..56267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 56216..57571 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225145.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene xseA CDS 57621..59162 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222334.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(59219..59629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(59700..60749) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695399.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 60980..61612 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222336.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene pdxH CDS complement(61820..62338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(62368..63378) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217007.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(63485..64915) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225147.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene gatB CDS complement(64928..65704) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225149.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(65930..67375) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951102.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene gatA CDS complement(67438..67728) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688831.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene gatC CDS 67880..68533 product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222344.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 68538..69881 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222345.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(69930..70361) product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688825.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(70709..71965) product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222346.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(72002..72850) product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691269.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(72911..73726) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217017.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 73902..74687 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688815.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 75100..77385 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267792.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 77497..79059 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688997.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(79497..81281) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225155.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene lpdA CDS complement(81359..82987) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357738.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene aceF CDS complement(83137..85800) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222352.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene aceE CDS 86494..88206 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222353.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 88209..88925 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222354.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(88933..89388) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213272.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene ruvX CDS complement(89381..89929) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222355.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(89931..90488) product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691340.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 90682..92538 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222357.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 92667..94148 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688980.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 94295..96391 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951086.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene uvrB CDS 96581..97498 product DUF4917 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161327.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(97662..97952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 98031..98561 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219860.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(98864..99580) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222361.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene trmB CDS complement(99697..101100) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225161.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(101218..103071) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229553.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene uvrC