>Feature sequence1 1691 648 gene locus_tag LOCUS_00010 1691 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2404 1949 gene locus_tag LOCUS_00020 2404 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3010 2627 gene locus_tag LOCUS_00030 3010 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3443 3619 gene locus_tag LOCUS_00040 3443 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3632 4360 gene locus_tag LOCUS_00050 3632 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4371 4811 gene locus_tag LOCUS_00060 4371 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4808 5749 gene locus_tag LOCUS_00070 gene trbB 4808 5749 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015633597.1 protein_id gnl|my_center|LOCUS_00070 5742 6050 gene locus_tag LOCUS_00080 5742 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6047 6322 gene locus_tag LOCUS_00090 6047 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6322 8760 gene locus_tag LOCUS_00100 6322 8760 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028755117.1 protein_id gnl|my_center|LOCUS_00100 8741 9577 gene locus_tag LOCUS_00110 8741 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9798 9574 gene locus_tag LOCUS_00120 9798 9574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 9991 10971 gene locus_tag LOCUS_00130 9991 10971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11644 12309 gene locus_tag LOCUS_00140 11644 12309 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970261.1 protein_id gnl|my_center|LOCUS_00140 12654 12316 gene locus_tag LOCUS_00150 12654 12316 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 protein_id gnl|my_center|LOCUS_00150 12777 13748 gene locus_tag LOCUS_00160 gene trbG 12777 13748 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974834.1 protein_id gnl|my_center|LOCUS_00160 13745 14473 gene locus_tag LOCUS_00170 13745 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 14475 15980 gene locus_tag LOCUS_00180 14475 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 15982 17217 gene locus_tag LOCUS_00190 15982 17217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 17219 17935 gene locus_tag LOCUS_00200 17219 17935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 17940 19532 gene locus_tag LOCUS_00210 17940 19532 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537540.1 protein_id gnl|my_center|LOCUS_00210 19532 20593 gene locus_tag LOCUS_00220 19532 20593 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187516.1 protein_id gnl|my_center|LOCUS_00220 20604 21128 gene locus_tag LOCUS_00230 20604 21128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 21137 22090 gene locus_tag LOCUS_00240 21137 22090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 22087 22485 gene locus_tag LOCUS_00250 22087 22485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 22485 23612 gene locus_tag LOCUS_00260 22485 23612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 23625 23954 gene locus_tag LOCUS_00270 23625 23954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 24049 25212 gene locus_tag LOCUS_00280 24049 25212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 25215 25655 gene locus_tag LOCUS_00290 25215 25655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 25645 27546 gene locus_tag LOCUS_00300 25645 27546 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 protein_id gnl|my_center|LOCUS_00300 27524 27862 gene locus_tag LOCUS_00310 27524 27862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 27859 29430 gene locus_tag LOCUS_00320 27859 29430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 29430 29945 gene locus_tag LOCUS_00330 29430 29945 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368397.1 protein_id gnl|my_center|LOCUS_00330 29938 30165 gene locus_tag LOCUS_00340 29938 30165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 30175 32250 gene locus_tag LOCUS_00350 30175 32250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 32289 32837 gene locus_tag LOCUS_00360 32289 32837 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217433129.1 protein_id gnl|my_center|LOCUS_00360 32885 33151 gene locus_tag LOCUS_00370 32885 33151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 33275 34036 gene locus_tag LOCUS_00380 33275 34036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103737.1 protein_id gnl|my_center|LOCUS_00380 34098 34325 gene locus_tag LOCUS_00390 34098 34325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 34300 34860 gene locus_tag LOCUS_00400 34300 34860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 36347 34866 gene locus_tag LOCUS_00410 36347 34866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 36661 36344 gene locus_tag LOCUS_00420 gene traJ 36661 36344 CDS product conjugal transfer transcriptional regulator TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205281.1 protein_id gnl|my_center|LOCUS_00420 37088 37528 gene locus_tag LOCUS_00430 gene umuD 37088 37528 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219995814.1 protein_id gnl|my_center|LOCUS_00430 37528 38817 gene locus_tag LOCUS_00440 37528 38817 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629647.1 protein_id gnl|my_center|LOCUS_00440 40827 38956 gene locus_tag LOCUS_00450 40827 38956 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214431.1 protein_id gnl|my_center|LOCUS_00450 41318 40824 gene locus_tag LOCUS_00460 41318 40824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204878.1 protein_id gnl|my_center|LOCUS_00460 42411 41311 gene locus_tag LOCUS_00470 42411 41311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127329.1 protein_id gnl|my_center|LOCUS_00470 44547 42820 gene locus_tag LOCUS_00480 44547 42820 CDS product DUF3880 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939536.1 protein_id gnl|my_center|LOCUS_00480 44613 45212 gene locus_tag LOCUS_00490 44613 45212 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939535.1 protein_id gnl|my_center|LOCUS_00490 45267 46013 gene locus_tag LOCUS_00500 45267 46013 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939534.1 protein_id gnl|my_center|LOCUS_00500 46017 46523 gene locus_tag LOCUS_00510 gene ruvC 46017 46523 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939533.1 protein_id gnl|my_center|LOCUS_00510 46632 47249 gene locus_tag LOCUS_00520 46632 47249 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939531.1 protein_id gnl|my_center|LOCUS_00520 47246 48232 gene locus_tag LOCUS_00530 gene ruvB 47246 48232 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939530.1 protein_id gnl|my_center|LOCUS_00530 48483 48265 gene locus_tag LOCUS_00540 48483 48265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 48694 49146 gene locus_tag LOCUS_00550 48694 49146 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_00550 49143 50048 gene locus_tag LOCUS_00560 gene rimK 49143 50048 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261388.1 protein_id gnl|my_center|LOCUS_00560 50786 50187 gene locus_tag LOCUS_00570 50786 50187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 52302 51505 gene locus_tag LOCUS_00580 52302 51505 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_00580 53327 52305 gene locus_tag LOCUS_00590 53327 52305 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940050.1 protein_id gnl|my_center|LOCUS_00590 54144 53449 gene locus_tag LOCUS_00600 54144 53449 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524570.1 protein_id gnl|my_center|LOCUS_00600 56334 54328 gene locus_tag LOCUS_00610 56334 54328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 57340 56450 gene locus_tag LOCUS_00620 57340 56450 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_00620 57483 58409 gene locus_tag LOCUS_00630 57483 58409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 58983 58474 gene locus_tag LOCUS_00640 58983 58474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 60141 59089 gene locus_tag LOCUS_00650 60141 59089 CDS product putative 2-aminoethylphosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527142.1 protein_id gnl|my_center|LOCUS_00650 60968 60138 gene locus_tag LOCUS_00660 60968 60138 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020339.1 protein_id gnl|my_center|LOCUS_00660 61962 60976 gene locus_tag LOCUS_00670 gene wtpA 61962 60976 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013684400.1 protein_id gnl|my_center|LOCUS_00670 62909 62142 gene locus_tag LOCUS_00680 62909 62142 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937704.1 protein_id gnl|my_center|LOCUS_00680 63684 63136 gene locus_tag LOCUS_00690 63684 63136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00690 64583 63615 gene locus_tag LOCUS_00700 64583 63615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00700 64861 65304 gene locus_tag LOCUS_00710 64861 65304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 67226 65385 gene locus_tag LOCUS_00720 gene typA 67226 65385 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939506.1 protein_id gnl|my_center|LOCUS_00720 67396 68640 gene locus_tag LOCUS_00730 67396 68640 CDS product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455065.1 protein_id gnl|my_center|LOCUS_00730 68644 70056 gene locus_tag LOCUS_00740 gene aspA 68644 70056 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851742.1 protein_id gnl|my_center|LOCUS_00740 70496 74089 gene locus_tag LOCUS_00750 gene nifJ 70496 74089 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940284.1 protein_id gnl|my_center|LOCUS_00750 74209 74715 gene locus_tag LOCUS_00760 74209 74715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 74871 76250 gene locus_tag LOCUS_00770 74871 76250 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940286.1 protein_id gnl|my_center|LOCUS_00770 76260 77546 gene locus_tag LOCUS_00780 76260 77546 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791554.1 protein_id gnl|my_center|LOCUS_00780 77564 77788 gene locus_tag LOCUS_00790 77564 77788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00790 77827 79686 gene locus_tag LOCUS_00800 gene pta 77827 79686 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_00800 79731 80936 gene locus_tag LOCUS_00810 79731 80936 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940289.1 protein_id gnl|my_center|LOCUS_00810 81056 81682 gene locus_tag LOCUS_00820 81056 81682 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940291.1 protein_id gnl|my_center|LOCUS_00820 81685 83835 gene locus_tag LOCUS_00830 81685 83835 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940292.1 protein_id gnl|my_center|LOCUS_00830 84219 84521 gene locus_tag LOCUS_00840 84219 84521 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940377.1 protein_id gnl|my_center|LOCUS_00840 84601 84969 gene locus_tag LOCUS_00850 84601 84969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 85097 86242 gene locus_tag LOCUS_00860 85097 86242 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940227.1 protein_id gnl|my_center|LOCUS_00860 86657 86259 gene locus_tag LOCUS_00870 86657 86259 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_00870 86808 89585 gene locus_tag LOCUS_00880 86808 89585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 89738 89652 gene locus_tag LOCUS_t00010 89738 89652 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 91534 89810 gene locus_tag LOCUS_00890 gene hutH 91534 89810 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_00890 92483 91581 gene locus_tag LOCUS_00900 92483 91581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 93696 92461 gene locus_tag LOCUS_00910 gene hutI 93696 92461 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203599.1 protein_id gnl|my_center|LOCUS_00910 95392 93740 gene locus_tag LOCUS_00920 95392 93740 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088981.1 protein_id gnl|my_center|LOCUS_00920 96123 95413 gene locus_tag LOCUS_00930 gene hutC 96123 95413 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704352.1 protein_id gnl|my_center|LOCUS_00930 96267 97028 gene locus_tag LOCUS_00940 96267 97028 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102782.1 protein_id gnl|my_center|LOCUS_00940 97100 97624 gene locus_tag LOCUS_00950 97100 97624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 97637 98824 gene locus_tag LOCUS_00960 97637 98824 CDS product GAK system CofD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938386.1 protein_id gnl|my_center|LOCUS_00960 99634 98816 gene locus_tag LOCUS_00970 99634 98816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 99852 99766 gene locus_tag LOCUS_t00020 99852 99766 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 100804 99956 gene locus_tag LOCUS_00980 100804 99956 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939572.1 protein_id gnl|my_center|LOCUS_00980 102396 101083 gene locus_tag LOCUS_00990 102396 101083 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_00990 102792 103781 gene locus_tag LOCUS_01000 102792 103781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 103771 104235 gene locus_tag LOCUS_01010 103771 104235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 104409 105944 gene locus_tag LOCUS_01020 104409 105944 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275161.1 protein_id gnl|my_center|LOCUS_01020 107965 106007 gene locus_tag LOCUS_01030 107965 106007 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940249.1 protein_id gnl|my_center|LOCUS_01030 109178 107970 gene locus_tag LOCUS_01040 109178 107970 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938060.1 protein_id gnl|my_center|LOCUS_01040 109476 109664 gene locus_tag LOCUS_01050 109476 109664 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_01050 109907 110719 gene locus_tag LOCUS_01060 109907 110719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940532.1 protein_id gnl|my_center|LOCUS_01060 110722 111084 gene locus_tag LOCUS_01070 110722 111084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940531.1 protein_id gnl|my_center|LOCUS_01070 111102 111722 gene locus_tag LOCUS_01080 111102 111722 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940530.1 protein_id gnl|my_center|LOCUS_01080 111897 112592 gene locus_tag LOCUS_01090 111897 112592 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937605.1 protein_id gnl|my_center|LOCUS_01090 113611 112955 gene locus_tag LOCUS_01100 113611 112955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 115278 113656 gene locus_tag LOCUS_01110 115278 113656 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938510.1 protein_id gnl|my_center|LOCUS_01110 115889 115278 gene locus_tag LOCUS_01120 115889 115278 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792502.1 protein_id gnl|my_center|LOCUS_01120 116229 115945 gene locus_tag LOCUS_01130 116229 115945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 116548 117159 gene locus_tag LOCUS_01140 gene prxU 116548 117159 CDS product selenocysteine-containing peroxiredoxin PrxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q9L3Q5 transl_except (pos:116686..116688,aa:Sec) note codon on position 47 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_01140 117393 117202 gene locus_tag LOCUS_01150 117393 117202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 117643 118020 gene locus_tag LOCUS_01160 117643 118020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 118035 118778 gene locus_tag LOCUS_01170 118035 118778 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250964.1 protein_id gnl|my_center|LOCUS_01170 119352 118834 gene locus_tag LOCUS_01180 119352 118834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 119727 119990 gene locus_tag LOCUS_01190 119727 119990 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 protein_id gnl|my_center|LOCUS_01190 121036 120233 gene locus_tag LOCUS_01200 121036 120233 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940371.1 protein_id gnl|my_center|LOCUS_01200 122197 121070 gene locus_tag LOCUS_01210 gene carA 122197 121070 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940372.1 protein_id gnl|my_center|LOCUS_01210 122937 122194 gene locus_tag LOCUS_01220 gene kdsB 122937 122194 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940373.1 protein_id gnl|my_center|LOCUS_01220 124243 122957 gene locus_tag LOCUS_01230 gene waaA 124243 122957 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038436.1 protein_id gnl|my_center|LOCUS_01230 125157 124243 gene locus_tag LOCUS_01240 125157 124243 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937641.1 protein_id gnl|my_center|LOCUS_01240 125626 125123 gene locus_tag LOCUS_01250 125626 125123 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937640.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01250 126048 126365 gene locus_tag LOCUS_01260 126048 126365 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940042.1 protein_id gnl|my_center|LOCUS_01260 126557 127651 gene locus_tag LOCUS_01270 gene hypD 126557 127651 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937632.1 protein_id gnl|my_center|LOCUS_01270 127654 128658 gene locus_tag LOCUS_01280 gene hypE 127654 128658 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937633.1 protein_id gnl|my_center|LOCUS_01280 129699 128743 gene locus_tag LOCUS_01290 129699 128743 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937367.1 protein_id gnl|my_center|LOCUS_01290 130769 129750 gene locus_tag LOCUS_01300 130769 129750 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937365.1 protein_id gnl|my_center|LOCUS_01300 131011 131086 gene locus_tag LOCUS_t00030 131011 131086 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 131097 131182 gene locus_tag LOCUS_t00040 131097 131182 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 131241 131317 gene locus_tag LOCUS_t00050 131241 131317 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 131358 131433 gene locus_tag LOCUS_t00060 131358 131433 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 131497 132690 gene locus_tag LOCUS_01310 gene tuf 131497 132690 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940180.1 protein_id gnl|my_center|LOCUS_01310 132694 132843 gene locus_tag LOCUS_01320 gene rpmG 132694 132843 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940181.1 protein_id gnl|my_center|LOCUS_01320 132860 132936 gene locus_tag LOCUS_t00070 132860 132936 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 133018 133266 gene locus_tag LOCUS_01330 133018 133266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 133294 133851 gene locus_tag LOCUS_01340 gene nusG 133294 133851 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940183.1 protein_id gnl|my_center|LOCUS_01340 133901 134326 gene locus_tag LOCUS_01350 gene rplK 133901 134326 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940184.1 protein_id gnl|my_center|LOCUS_01350 134342 135049 gene locus_tag LOCUS_01360 gene rplA 134342 135049 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940185.1 protein_id gnl|my_center|LOCUS_01360 135208 135729 gene locus_tag LOCUS_01370 gene rplJ 135208 135729 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940186.1 protein_id gnl|my_center|LOCUS_01370 135772 136158 gene locus_tag LOCUS_01380 gene rplL 135772 136158 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940187.1 protein_id gnl|my_center|LOCUS_01380 136472 140575 gene locus_tag LOCUS_01390 gene rpoB 136472 140575 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940188.1 protein_id gnl|my_center|LOCUS_01390 140659 144804 gene locus_tag LOCUS_01400 gene rpoC 140659 144804 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940189.1 protein_id gnl|my_center|LOCUS_01400 145021 145392 gene locus_tag LOCUS_01410 gene rpsL 145021 145392 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_01410 145486 145956 gene locus_tag LOCUS_01420 gene rpsG 145486 145956 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938594.1 protein_id gnl|my_center|LOCUS_01420 146017 148041 gene locus_tag LOCUS_01430 gene fusA 146017 148041 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938595.1 protein_id gnl|my_center|LOCUS_01430 148182 148505 gene locus_tag LOCUS_01440 gene rpsJ 148182 148505 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938597.1 protein_id gnl|my_center|LOCUS_01440 148521 149153 gene locus_tag LOCUS_01450 gene rplC 148521 149153 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938598.1 protein_id gnl|my_center|LOCUS_01450 149174 149797 gene locus_tag LOCUS_01460 gene rplD 149174 149797 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938599.1 protein_id gnl|my_center|LOCUS_01460 149800 150093 gene locus_tag LOCUS_01470 gene rplW 149800 150093 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792455.1 protein_id gnl|my_center|LOCUS_01470 150096 150926 gene locus_tag LOCUS_01480 gene rplB 150096 150926 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_01480 150938 151216 gene locus_tag LOCUS_01490 gene rpsS 150938 151216 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_01490 151228 151560 gene locus_tag LOCUS_01500 gene rplV 151228 151560 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938603.1 protein_id gnl|my_center|LOCUS_01500 151563 152204 gene locus_tag LOCUS_01510 gene rpsC 151563 152204 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938604.1 protein_id gnl|my_center|LOCUS_01510 152204 152617 gene locus_tag LOCUS_01520 gene rplP 152204 152617 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938605.1 protein_id gnl|my_center|LOCUS_01520 152618 152809 gene locus_tag LOCUS_01530 gene rpmC 152618 152809 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776369.1 protein_id gnl|my_center|LOCUS_01530 152813 153058 gene locus_tag LOCUS_01540 gene rpsQ 152813 153058 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938607.1 protein_id gnl|my_center|LOCUS_01540 153106 153474 gene locus_tag LOCUS_01550 gene rplN 153106 153474 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938608.1 protein_id gnl|my_center|LOCUS_01550 153486 153806 gene locus_tag LOCUS_01560 gene rplX 153486 153806 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938609.1 protein_id gnl|my_center|LOCUS_01560 153816 154355 gene locus_tag LOCUS_01570 gene rplE 153816 154355 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938610.1 protein_id gnl|my_center|LOCUS_01570 154366 154551 gene locus_tag LOCUS_01580 154366 154551 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938611.1 protein_id gnl|my_center|LOCUS_01580 154570 154947 gene locus_tag LOCUS_01590 gene rpsH 154570 154947 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938612.1 protein_id gnl|my_center|LOCUS_01590 154960 155496 gene locus_tag LOCUS_01600 gene rplF 154960 155496 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938613.1 protein_id gnl|my_center|LOCUS_01600 155512 155871 gene locus_tag LOCUS_01610 gene rplR 155512 155871 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938614.1 protein_id gnl|my_center|LOCUS_01610 155887 156378 gene locus_tag LOCUS_01620 gene rpsE 155887 156378 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_01620 156391 156564 gene locus_tag LOCUS_01630 gene rpmD 156391 156564 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938616.1 protein_id gnl|my_center|LOCUS_01630 156561 157010 gene locus_tag LOCUS_01640 gene rplO 156561 157010 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938617.1 protein_id gnl|my_center|LOCUS_01640 157110 158351 gene locus_tag LOCUS_01650 gene secY 157110 158351 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938618.1 protein_id gnl|my_center|LOCUS_01650 158406 159125 gene locus_tag LOCUS_01660 gene map 158406 159125 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938619.1 protein_id gnl|my_center|LOCUS_01660 159380 159754 gene locus_tag LOCUS_01670 gene rpsM 159380 159754 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938621.1 protein_id gnl|my_center|LOCUS_01670 159848 160234 gene locus_tag LOCUS_01680 gene rpsK 159848 160234 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938622.1 protein_id gnl|my_center|LOCUS_01680 160250 160876 gene locus_tag LOCUS_01690 gene rpsD 160250 160876 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938623.1 protein_id gnl|my_center|LOCUS_01690 160890 161930 gene locus_tag LOCUS_01700 160890 161930 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938624.1 protein_id gnl|my_center|LOCUS_01700 161920 162378 gene locus_tag LOCUS_01710 gene rplQ 161920 162378 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938625.1 protein_id gnl|my_center|LOCUS_01710 162459 163376 gene locus_tag LOCUS_01720 162459 163376 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938626.1 protein_id gnl|my_center|LOCUS_01720 164270 163434 gene locus_tag LOCUS_01730 164270 163434 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940024.1 protein_id gnl|my_center|LOCUS_01730 165340 164270 gene locus_tag LOCUS_01740 gene mqnC 165340 164270 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940023.1 protein_id gnl|my_center|LOCUS_01740 165830 165366 gene locus_tag LOCUS_01750 165830 165366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01750 166478 165864 gene locus_tag LOCUS_01760 166478 165864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01760 167143 166475 gene locus_tag LOCUS_01770 167143 166475 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401268.1 protein_id gnl|my_center|LOCUS_01770 167264 168115 gene locus_tag LOCUS_01780 167264 168115 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940021.1 protein_id gnl|my_center|LOCUS_01780 169106 168189 gene locus_tag LOCUS_01790 169106 168189 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940340.1 protein_id gnl|my_center|LOCUS_01790 169539 169273 gene locus_tag LOCUS_01800 169539 169273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 170219 169632 gene locus_tag LOCUS_01810 gene yjgA 170219 169632 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938274.1 protein_id gnl|my_center|LOCUS_01810 170839 170219 gene locus_tag LOCUS_01820 170839 170219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 172090 170939 gene locus_tag LOCUS_01830 172090 170939 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454833.1 protein_id gnl|my_center|LOCUS_01830 172899 172087 gene locus_tag LOCUS_01840 172899 172087 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454839.1 protein_id gnl|my_center|LOCUS_01840 174041 172902 gene locus_tag LOCUS_01850 174041 172902 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454927.1 protein_id gnl|my_center|LOCUS_01850 174204 174680 gene locus_tag LOCUS_01860 174204 174680 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_01860 174706 177726 gene locus_tag LOCUS_01870 gene pruA 174706 177726 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940575.1 protein_id gnl|my_center|LOCUS_01870 178086 177871 gene locus_tag LOCUS_01880 178086 177871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01880 179798 178014 gene locus_tag LOCUS_01890 179798 178014 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939265.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01890 180748 179936 gene locus_tag LOCUS_01900 180748 179936 CDS product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726751.1 protein_id gnl|my_center|LOCUS_01900 181567 180917 gene locus_tag LOCUS_01910 gene rpe 181567 180917 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939801.1 protein_id gnl|my_center|LOCUS_01910 184159 181670 gene locus_tag LOCUS_01920 184159 181670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 184790 184341 gene locus_tag LOCUS_01930 gene ahbA 184790 184341 CDS product siroheme decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938154.1 protein_id gnl|my_center|LOCUS_01930 185952 184795 gene locus_tag LOCUS_01940 gene ahbD 185952 184795 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938155.1 protein_id gnl|my_center|LOCUS_01940 186938 185955 gene locus_tag LOCUS_01950 gene hemB 186938 185955 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938156.1 protein_id gnl|my_center|LOCUS_01950 188295 187102 gene locus_tag LOCUS_01960 gene ahbC 188295 187102 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938157.1 protein_id gnl|my_center|LOCUS_01960 189575 188439 gene locus_tag LOCUS_01970 189575 188439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 190055 189720 gene locus_tag LOCUS_01980 190055 189720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 191163 190069 gene locus_tag LOCUS_01990 191163 190069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 192515 191307 gene locus_tag LOCUS_02000 192515 191307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940669.1 protein_id gnl|my_center|LOCUS_02000 193585 192512 gene locus_tag LOCUS_02010 193585 192512 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938160.1 protein_id gnl|my_center|LOCUS_02010 194404 193715 gene locus_tag LOCUS_02020 194404 193715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 196132 194423 gene locus_tag LOCUS_02030 gene fliD 196132 194423 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938162.1 protein_id gnl|my_center|LOCUS_02030 197191 196274 gene locus_tag LOCUS_02040 197191 196274 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938734.1 protein_id gnl|my_center|LOCUS_02040 199093 197453 gene locus_tag LOCUS_02050 199093 197453 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939625.1 protein_id gnl|my_center|LOCUS_02050 200776 199103 gene locus_tag LOCUS_02060 200776 199103 CDS product DUF3880 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938740.1 protein_id gnl|my_center|LOCUS_02060 201718 200930 gene locus_tag LOCUS_02070 201718 200930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 202763 201798 gene locus_tag LOCUS_02080 202763 201798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 202846 203358 gene locus_tag LOCUS_02090 202846 203358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 203847 203452 gene locus_tag LOCUS_02100 203847 203452 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926892.1 protein_id gnl|my_center|LOCUS_02100 204011 204742 gene locus_tag LOCUS_02110 gene thyX 204011 204742 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939529.1 protein_id gnl|my_center|LOCUS_02110 205312 206697 gene locus_tag LOCUS_02120 205312 206697 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939527.1 protein_id gnl|my_center|LOCUS_02120 208424 206793 gene locus_tag LOCUS_02130 208424 206793 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_02130 209226 208450 gene locus_tag LOCUS_02140 gene tsaB 209226 208450 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938163.1 protein_id gnl|my_center|LOCUS_02140 210265 209201 gene locus_tag LOCUS_02150 gene rseP 210265 209201 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938164.1 protein_id gnl|my_center|LOCUS_02150 211466 210330 gene locus_tag LOCUS_02160 gene dxr 211466 210330 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938165.1 protein_id gnl|my_center|LOCUS_02160 212357 211554 gene locus_tag LOCUS_02170 212357 211554 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938167.1 protein_id gnl|my_center|LOCUS_02170 213167 212466 gene locus_tag LOCUS_02180 gene uppS 213167 212466 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938168.1 protein_id gnl|my_center|LOCUS_02180 213738 213184 gene locus_tag LOCUS_02190 gene frr 213738 213184 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_02190 214462 213740 gene locus_tag LOCUS_02200 gene pyrH 214462 213740 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938170.1 protein_id gnl|my_center|LOCUS_02200 215371 214565 gene locus_tag LOCUS_02210 gene tsf 215371 214565 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938172.1 protein_id gnl|my_center|LOCUS_02210 216147 215371 gene locus_tag LOCUS_02220 gene rpsB 216147 215371 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938173.1 protein_id gnl|my_center|LOCUS_02220 217419 216304 gene locus_tag LOCUS_02230 217419 216304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 218374 217412 gene locus_tag LOCUS_02240 218374 217412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 218634 220697 gene locus_tag LOCUS_02250 218634 220697 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938180.1 protein_id gnl|my_center|LOCUS_02250 220857 221657 gene locus_tag LOCUS_02260 gene thiM 220857 221657 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939636.1 protein_id gnl|my_center|LOCUS_02260 221843 222868 gene locus_tag LOCUS_02270 221843 222868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 223306 222872 gene locus_tag LOCUS_02280 223306 222872 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938241.1 protein_id gnl|my_center|LOCUS_02280 223707 223796 gene locus_tag LOCUS_t00080 223707 223796 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 224939 224043 gene locus_tag LOCUS_02290 224939 224043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 225457 225260 gene locus_tag LOCUS_02300 225457 225260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 226042 225725 gene locus_tag LOCUS_02310 226042 225725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 227622 227428 gene locus_tag LOCUS_02320 227622 227428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 228109 227939 gene locus_tag LOCUS_02330 228109 227939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 229512 229033 gene locus_tag LOCUS_02340 229512 229033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 233469 229549 gene locus_tag LOCUS_02350 233469 229549 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_02350 234000 233479 gene locus_tag LOCUS_02360 234000 233479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 235607 234018 gene locus_tag LOCUS_02370 235607 234018 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203354.1 protein_id gnl|my_center|LOCUS_02370 236964 235600 gene locus_tag LOCUS_02380 236964 235600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 237183 237374 gene locus_tag LOCUS_02390 237183 237374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 237890 237474 gene locus_tag LOCUS_02400 237890 237474 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940429.1 protein_id gnl|my_center|LOCUS_02400 238664 237912 gene locus_tag LOCUS_02410 238664 237912 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937891.1 protein_id gnl|my_center|LOCUS_02410 241711 238664 gene locus_tag LOCUS_02420 gene fdnG 241711 238664 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937890.1 transl_except (pos:complement(241136..241138),aa:Sec) note codon on position 192 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_02420 241963 241733 gene locus_tag LOCUS_02430 241963 241733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 243007 242288 gene locus_tag LOCUS_02440 243007 242288 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064660.1 protein_id gnl|my_center|LOCUS_02440 243976 243026 gene locus_tag LOCUS_02450 gene arcC 243976 243026 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393607.1 protein_id gnl|my_center|LOCUS_02450 245399 243993 gene locus_tag LOCUS_02460 245399 243993 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093933.1 protein_id gnl|my_center|LOCUS_02460 246113 245403 gene locus_tag LOCUS_02470 246113 245403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02470 247855 246956 gene locus_tag LOCUS_02480 247855 246956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 248593 247928 gene locus_tag LOCUS_02490 248593 247928 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194414.1 protein_id gnl|my_center|LOCUS_02490 249000 248614 gene locus_tag LOCUS_02500 249000 248614 CDS product glutamyl-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214035.1 protein_id gnl|my_center|LOCUS_02500 250647 249088 gene locus_tag LOCUS_02510 250647 249088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085511.1 protein_id gnl|my_center|LOCUS_02510 251446 251661 gene locus_tag LOCUS_02520 251446 251661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02520 251749 251961 gene locus_tag LOCUS_02530 251749 251961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02530 251992 252156 gene locus_tag LOCUS_02540 251992 252156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02540 252189 252470 gene locus_tag LOCUS_02550 252189 252470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 253416 252577 gene locus_tag LOCUS_02560 253416 252577 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202917.1 protein_id gnl|my_center|LOCUS_02560 253550 254446 gene locus_tag LOCUS_02570 253550 254446 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088921.1 protein_id gnl|my_center|LOCUS_02570 256517 254637 gene locus_tag LOCUS_02580 256517 254637 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391701.1 protein_id gnl|my_center|LOCUS_02580 257356 256880 gene locus_tag LOCUS_02590 257356 256880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 258413 257592 gene locus_tag LOCUS_02600 258413 257592 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392692.1 protein_id gnl|my_center|LOCUS_02600 260056 258491 gene locus_tag LOCUS_02610 260056 258491 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 protein_id gnl|my_center|LOCUS_02610 260578 261627 gene locus_tag LOCUS_02620 260578 261627 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082297.1 protein_id gnl|my_center|LOCUS_02620 261631 262392 gene locus_tag LOCUS_02630 261631 262392 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_02630 262382 262939 gene locus_tag LOCUS_02640 262382 262939 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_02640 262932 263147 gene locus_tag LOCUS_02650 262932 263147 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_02650 263200 265347 gene locus_tag LOCUS_02660 263200 265347 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878706.1 protein_id gnl|my_center|LOCUS_02660 265385 266710 gene locus_tag LOCUS_02670 265385 266710 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 protein_id gnl|my_center|LOCUS_02670 266811 267188 gene locus_tag LOCUS_02680 266811 267188 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416451.1 protein_id gnl|my_center|LOCUS_02680 267254 268600 gene locus_tag LOCUS_02690 267254 268600 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211863.1 protein_id gnl|my_center|LOCUS_02690 268703 269611 gene locus_tag LOCUS_02700 268703 269611 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938303.1 protein_id gnl|my_center|LOCUS_02700 269613 270692 gene locus_tag LOCUS_02710 gene lpxB 269613 270692 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938656.1 protein_id gnl|my_center|LOCUS_02710 270694 271485 gene locus_tag LOCUS_02720 gene proC 270694 271485 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836906.1 protein_id gnl|my_center|LOCUS_02720 271984 272412 gene locus_tag LOCUS_02730 271984 272412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 273355 272579 gene locus_tag LOCUS_02740 273355 272579 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459063.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02740 276088 273617 gene locus_tag LOCUS_02750 276088 273617 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940090.1 protein_id gnl|my_center|LOCUS_02750 276628 277458 gene locus_tag LOCUS_02760 276628 277458 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810287.1 protein_id gnl|my_center|LOCUS_02760 277965 278960 gene locus_tag LOCUS_02770 277965 278960 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565859.1 protein_id gnl|my_center|LOCUS_02770 279039 280040 gene locus_tag LOCUS_02780 279039 280040 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565859.1 protein_id gnl|my_center|LOCUS_02780 280148 280609 gene locus_tag LOCUS_02790 280148 280609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 280609 281907 gene locus_tag LOCUS_02800 280609 281907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 281986 282930 gene locus_tag LOCUS_02810 281986 282930 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_02810 284339 282969 gene locus_tag LOCUS_02820 284339 282969 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810284.1 protein_id gnl|my_center|LOCUS_02820 284890 284498 gene locus_tag LOCUS_02830 284890 284498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 285583 286392 gene locus_tag LOCUS_02840 285583 286392 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_02840 286493 286987 gene locus_tag LOCUS_02850 286493 286987 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388632.1 protein_id gnl|my_center|LOCUS_02850 286989 287441 gene locus_tag LOCUS_02860 286989 287441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 287607 288293 gene locus_tag LOCUS_02870 287607 288293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 288564 289157 gene locus_tag LOCUS_02880 288564 289157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 289254 289766 gene locus_tag LOCUS_02890 289254 289766 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065519.1 protein_id gnl|my_center|LOCUS_02890 291236 289845 gene locus_tag LOCUS_02900 291236 289845 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003144052.1 protein_id gnl|my_center|LOCUS_02900 291624 292883 gene locus_tag LOCUS_02910 291624 292883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 293546 293220 gene locus_tag LOCUS_02920 293546 293220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 295058 293619 gene locus_tag LOCUS_02930 295058 293619 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 protein_id gnl|my_center|LOCUS_02930 296689 295337 gene locus_tag LOCUS_02940 296689 295337 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_02940 298628 296700 gene locus_tag LOCUS_02950 298628 296700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02950 299225 298785 gene locus_tag LOCUS_02960 299225 298785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 299483 299283 gene locus_tag LOCUS_02970 299483 299283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 299958 299488 gene locus_tag LOCUS_02980 299958 299488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 300265 299969 gene locus_tag LOCUS_02990 300265 299969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 300487 300284 gene locus_tag LOCUS_03000 300487 300284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 300650 300498 gene locus_tag LOCUS_03010 300650 300498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 301821 300664 gene locus_tag LOCUS_03020 301821 300664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 304756 301856 gene locus_tag LOCUS_03030 304756 301856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 305645 305049 gene locus_tag LOCUS_03040 305645 305049 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940393.1 protein_id gnl|my_center|LOCUS_03040 305858 306370 gene locus_tag LOCUS_03050 305858 306370 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706999.1 protein_id gnl|my_center|LOCUS_03050 306383 307903 gene locus_tag LOCUS_03060 306383 307903 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087809.1 protein_id gnl|my_center|LOCUS_03060 307908 308849 gene locus_tag LOCUS_03070 307908 308849 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797774.1 protein_id gnl|my_center|LOCUS_03070 308824 309612 gene locus_tag LOCUS_03080 308824 309612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 313910 309693 gene locus_tag LOCUS_03090 313910 309693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 315152 313953 gene locus_tag LOCUS_03100 315152 313953 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_03100 316435 315149 gene locus_tag LOCUS_03110 316435 315149 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_03110 318396 316438 gene locus_tag LOCUS_03120 318396 316438 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_03120 318940 318698 gene locus_tag LOCUS_03130 318940 318698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 319721 320725 gene locus_tag LOCUS_03140 319721 320725 CDS product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938461.1 protein_id gnl|my_center|LOCUS_03140 320937 322214 gene locus_tag LOCUS_03150 320937 322214 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938460.1 protein_id gnl|my_center|LOCUS_03150 322515 322748 gene locus_tag LOCUS_03160 322515 322748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 322791 323804 gene locus_tag LOCUS_03170 322791 323804 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938457.1 protein_id gnl|my_center|LOCUS_03170 323931 324491 gene locus_tag LOCUS_03180 323931 324491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 324729 327854 gene locus_tag LOCUS_03190 324729 327854 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938454.1 protein_id gnl|my_center|LOCUS_03190 327888 329327 gene locus_tag LOCUS_03200 327888 329327 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938453.1 protein_id gnl|my_center|LOCUS_03200 329408 329614 gene locus_tag LOCUS_03210 329408 329614 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942197.1 protein_id gnl|my_center|LOCUS_03210 329690 331105 gene locus_tag LOCUS_03220 329690 331105 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937922.1 protein_id gnl|my_center|LOCUS_03220 331355 331654 gene locus_tag LOCUS_03230 331355 331654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 331724 332968 gene locus_tag LOCUS_03240 gene ablA 331724 332968 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_03240 332969 333970 gene locus_tag LOCUS_03250 332969 333970 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_03250 333967 334983 gene locus_tag LOCUS_03260 333967 334983 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969744.1 protein_id gnl|my_center|LOCUS_03260 334958 335587 gene locus_tag LOCUS_03270 334958 335587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 335544 335795 gene locus_tag LOCUS_03280 335544 335795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 338775 335959 gene locus_tag LOCUS_03290 338775 335959 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937562.1 protein_id gnl|my_center|LOCUS_03290 339471 338935 gene locus_tag LOCUS_03300 339471 338935 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433888.1 protein_id gnl|my_center|LOCUS_03300 340213 339473 gene locus_tag LOCUS_03310 340213 339473 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433887.1 protein_id gnl|my_center|LOCUS_03310 341274 340213 gene locus_tag LOCUS_03320 gene vorB 341274 340213 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433885.1 protein_id gnl|my_center|LOCUS_03320 341494 341276 gene locus_tag LOCUS_03330 341494 341276 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416663.1 protein_id gnl|my_center|LOCUS_03330 342815 341541 gene locus_tag LOCUS_03340 342815 341541 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454721.1 protein_id gnl|my_center|LOCUS_03340 343745 342849 gene locus_tag LOCUS_03350 343745 342849 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454723.1 protein_id gnl|my_center|LOCUS_03350 344824 343766 gene locus_tag LOCUS_03360 gene buk 344824 343766 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890632.1 protein_id gnl|my_center|LOCUS_03360 345679 344927 gene locus_tag LOCUS_03370 345679 344927 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416661.1 protein_id gnl|my_center|LOCUS_03370 347183 345852 gene locus_tag LOCUS_03380 347183 345852 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 protein_id gnl|my_center|LOCUS_03380 348170 349195 gene locus_tag LOCUS_03390 348170 349195 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938852.1 protein_id gnl|my_center|LOCUS_03390 349274 351994 gene locus_tag LOCUS_03400 349274 351994 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938851.1 protein_id gnl|my_center|LOCUS_03400 352068 354320 gene locus_tag LOCUS_03410 352068 354320 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938850.1 protein_id gnl|my_center|LOCUS_03410 354317 354532 gene locus_tag LOCUS_03420 354317 354532 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938849.1 protein_id gnl|my_center|LOCUS_03420 354529 355191 gene locus_tag LOCUS_03430 354529 355191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 355181 355636 gene locus_tag LOCUS_03440 355181 355636 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938847.1 protein_id gnl|my_center|LOCUS_03440 355636 356985 gene locus_tag LOCUS_03450 355636 356985 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065079778.1 protein_id gnl|my_center|LOCUS_03450 357005 358252 gene locus_tag LOCUS_03460 357005 358252 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938845.1 protein_id gnl|my_center|LOCUS_03460 358262 359278 gene locus_tag LOCUS_03470 358262 359278 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938844.1 protein_id gnl|my_center|LOCUS_03470 359275 360399 gene locus_tag LOCUS_03480 359275 360399 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204617516.1 protein_id gnl|my_center|LOCUS_03480 360974 361153 gene locus_tag LOCUS_03490 360974 361153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 361494 361087 gene locus_tag LOCUS_03500 361494 361087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03500 364214 361497 gene locus_tag LOCUS_03510 364214 361497 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529195.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03510 365251 364211 gene locus_tag LOCUS_03520 365251 364211 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975246.1 protein_id gnl|my_center|LOCUS_03520 365882 365244 gene locus_tag LOCUS_03530 365882 365244 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_03530 366441 366157 gene locus_tag LOCUS_03540 366441 366157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 366590 366790 gene locus_tag LOCUS_03550 366590 366790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 367791 366982 gene locus_tag LOCUS_03560 gene mazG 367791 366982 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938482.1 protein_id gnl|my_center|LOCUS_03560 368397 367822 gene locus_tag LOCUS_03570 368397 367822 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256853.1 protein_id gnl|my_center|LOCUS_03570 368576 369145 gene locus_tag LOCUS_03580 gene rfbC 368576 369145 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938000.1 protein_id gnl|my_center|LOCUS_03580 369148 370578 gene locus_tag LOCUS_03590 369148 370578 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937999.1 protein_id gnl|my_center|LOCUS_03590 370749 371495 gene locus_tag LOCUS_03600 370749 371495 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940677.1 protein_id gnl|my_center|LOCUS_03600 371511 373481 gene locus_tag LOCUS_03610 371511 373481 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937997.1 protein_id gnl|my_center|LOCUS_03610 373493 374317 gene locus_tag LOCUS_03620 373493 374317 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937996.1 protein_id gnl|my_center|LOCUS_03620 374333 375574 gene locus_tag LOCUS_03630 gene nrfD 374333 375574 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937995.1 protein_id gnl|my_center|LOCUS_03630 375928 377040 gene locus_tag LOCUS_03640 375928 377040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 377305 378033 gene locus_tag LOCUS_03650 377305 378033 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939616.1 protein_id gnl|my_center|LOCUS_03650 378063 378869 gene locus_tag LOCUS_03660 378063 378869 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939615.1 protein_id gnl|my_center|LOCUS_03660 378949 379716 gene locus_tag LOCUS_03670 378949 379716 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939614.1 protein_id gnl|my_center|LOCUS_03670 379726 380442 gene locus_tag LOCUS_03680 379726 380442 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939613.1 protein_id gnl|my_center|LOCUS_03680 380443 381108 gene locus_tag LOCUS_03690 gene deoC 380443 381108 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356166.1 protein_id gnl|my_center|LOCUS_03690 381105 381752 gene locus_tag LOCUS_03700 381105 381752 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940346.1 protein_id gnl|my_center|LOCUS_03700 381869 382126 gene locus_tag LOCUS_03710 381869 382126 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939230.1 protein_id gnl|my_center|LOCUS_03710 382133 383278 gene locus_tag LOCUS_03720 382133 383278 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939231.1 protein_id gnl|my_center|LOCUS_03720 383281 384129 gene locus_tag LOCUS_03730 383281 384129 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939232.1 protein_id gnl|my_center|LOCUS_03730 384132 384746 gene locus_tag LOCUS_03740 384132 384746 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939233.1 protein_id gnl|my_center|LOCUS_03740 385172 384831 gene locus_tag LOCUS_03750 385172 384831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940279.1 protein_id gnl|my_center|LOCUS_03750 386295 385372 gene locus_tag LOCUS_03760 386295 385372 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_03760 387361 386288 gene locus_tag LOCUS_03770 387361 386288 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_03770 388869 387358 gene locus_tag LOCUS_03780 388869 387358 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938369.1 protein_id gnl|my_center|LOCUS_03780 389513 388866 gene locus_tag LOCUS_03790 389513 388866 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887523.1 protein_id gnl|my_center|LOCUS_03790 390444 389584 gene locus_tag LOCUS_03800 390444 389584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03800 391186 392079 gene locus_tag LOCUS_03810 391186 392079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 392613 393653 gene locus_tag LOCUS_03820 392613 393653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 393679 395604 gene locus_tag LOCUS_03830 393679 395604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03830 395609 395848 gene locus_tag LOCUS_03840 395609 395848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03840 395845 397047 gene locus_tag LOCUS_03850 395845 397047 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294622.1 protein_id gnl|my_center|LOCUS_03850 397071 398237 gene locus_tag LOCUS_03860 397071 398237 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388450.1 protein_id gnl|my_center|LOCUS_03860 399199 398219 gene locus_tag LOCUS_03870 399199 398219 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_03870 399802 400737 gene locus_tag LOCUS_03880 399802 400737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 400785 402011 gene locus_tag LOCUS_03890 400785 402011 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_03890 402432 405173 gene locus_tag LOCUS_03900 402432 405173 CDS product PHP-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095186.1 protein_id gnl|my_center|LOCUS_03900 405743 405549 gene locus_tag LOCUS_03910 405743 405549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 406241 405747 gene locus_tag LOCUS_03920 406241 405747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 406543 406761 gene locus_tag LOCUS_03930 406543 406761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 407243 406935 gene locus_tag LOCUS_03940 407243 406935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 409505 407436 gene locus_tag LOCUS_03950 409505 407436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 409730 409509 gene locus_tag LOCUS_03960 409730 409509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 410590 409946 gene locus_tag LOCUS_03970 410590 409946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 411008 410922 gene locus_tag LOCUS_t00090 411008 410922 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 412759 411071 gene locus_tag LOCUS_03980 412759 411071 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792498.1 protein_id gnl|my_center|LOCUS_03980 412913 413602 gene locus_tag LOCUS_03990 412913 413602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 414195 413617 gene locus_tag LOCUS_04000 414195 413617 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939211.1 protein_id gnl|my_center|LOCUS_04000 414723 414202 gene locus_tag LOCUS_04010 414723 414202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791831.1 protein_id gnl|my_center|LOCUS_04010 415368 414733 gene locus_tag LOCUS_04020 gene rdgC 415368 414733 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939729.1 protein_id gnl|my_center|LOCUS_04020 415564 415767 gene locus_tag LOCUS_04030 415564 415767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 415851 416231 gene locus_tag LOCUS_04040 415851 416231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939266.1 protein_id gnl|my_center|LOCUS_04040 416852 416232 gene locus_tag LOCUS_04050 416852 416232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 417043 417186 gene locus_tag LOCUS_04060 417043 417186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 418144 417269 gene locus_tag LOCUS_04070 gene rfbA 418144 417269 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904719.1 protein_id gnl|my_center|LOCUS_04070 418272 419015 gene locus_tag LOCUS_04080 418272 419015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 419036 419827 gene locus_tag LOCUS_04090 419036 419827 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938270.1 protein_id gnl|my_center|LOCUS_04090 419933 421288 gene locus_tag LOCUS_04100 419933 421288 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940356.1 protein_id gnl|my_center|LOCUS_04100 421291 421497 gene locus_tag LOCUS_04110 421291 421497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 421637 422440 gene locus_tag LOCUS_04120 421637 422440 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937980.1 protein_id gnl|my_center|LOCUS_04120 423628 422522 gene locus_tag LOCUS_04130 423628 422522 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792173.1 protein_id gnl|my_center|LOCUS_04130 423699 424556 gene locus_tag LOCUS_04140 423699 424556 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_04140 424614 427262 gene locus_tag LOCUS_04150 424614 427262 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294662.1 protein_id gnl|my_center|LOCUS_04150 427356 428102 gene locus_tag LOCUS_04160 gene gpmA 427356 428102 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198007.1 protein_id gnl|my_center|LOCUS_04160 428113 429213 gene locus_tag LOCUS_04170 gene mutY 428113 429213 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629788.1 protein_id gnl|my_center|LOCUS_04170 429282 430304 gene locus_tag LOCUS_04180 429282 430304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 431413 430403 gene locus_tag LOCUS_04190 431413 430403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 431636 431562 gene locus_tag LOCUS_t00100 431636 431562 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 431761 431687 gene locus_tag LOCUS_t00110 431761 431687 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 431837 431763 gene locus_tag LOCUS_t00120 431837 431763 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 431918 431844 gene locus_tag LOCUS_t00130 431918 431844 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 432259 432621 gene locus_tag LOCUS_04200 gene dksA 432259 432621 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939427.1 protein_id gnl|my_center|LOCUS_04200 432640 434154 gene locus_tag LOCUS_04210 432640 434154 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939426.1 protein_id gnl|my_center|LOCUS_04210 435517 434174 gene locus_tag LOCUS_04220 435517 434174 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163428.1 protein_id gnl|my_center|LOCUS_04220 436445 435579 gene locus_tag LOCUS_04230 436445 435579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 437368 436442 gene locus_tag LOCUS_04240 437368 436442 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940234.1 protein_id gnl|my_center|LOCUS_04240 437547 438191 gene locus_tag LOCUS_04250 437547 438191 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940238.1 protein_id gnl|my_center|LOCUS_04250 438222 438983 gene locus_tag LOCUS_04260 gene pssA 438222 438983 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940239.1 protein_id gnl|my_center|LOCUS_04260 439122 440657 gene locus_tag LOCUS_04270 439122 440657 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940240.1 protein_id gnl|my_center|LOCUS_04270 440661 441920 gene locus_tag LOCUS_04280 440661 441920 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940241.1 protein_id gnl|my_center|LOCUS_04280 441954 442445 gene locus_tag LOCUS_04290 441954 442445 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940242.1 protein_id gnl|my_center|LOCUS_04290 442501 443571 gene locus_tag LOCUS_04300 gene leuB 442501 443571 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940244.1 protein_id gnl|my_center|LOCUS_04300 444113 443637 gene locus_tag LOCUS_04310 444113 443637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 444347 444117 gene locus_tag LOCUS_04320 444347 444117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 444714 444442 gene locus_tag LOCUS_04330 444714 444442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 444851 446824 gene locus_tag LOCUS_04340 444851 446824 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940311.1 protein_id gnl|my_center|LOCUS_04340 446821 447213 gene locus_tag LOCUS_04350 446821 447213 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940310.1 protein_id gnl|my_center|LOCUS_04350 447336 448208 gene locus_tag LOCUS_04360 gene metF 447336 448208 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938296.1 protein_id gnl|my_center|LOCUS_04360 448229 449257 gene locus_tag LOCUS_04370 448229 449257 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940307.1 protein_id gnl|my_center|LOCUS_04370 449349 450290 gene locus_tag LOCUS_04380 449349 450290 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940306.1 protein_id gnl|my_center|LOCUS_04380 451241 450348 gene locus_tag LOCUS_04390 451241 450348 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937428.1 protein_id gnl|my_center|LOCUS_04390 451504 454107 gene locus_tag LOCUS_04400 451504 454107 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083633.1 protein_id gnl|my_center|LOCUS_04400 455056 454175 gene locus_tag LOCUS_04410 gene rfbD 455056 454175 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938658.1 protein_id gnl|my_center|LOCUS_04410 456066 455056 gene locus_tag LOCUS_04420 gene rfbB 456066 455056 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938659.1 protein_id gnl|my_center|LOCUS_04420 456591 456139 gene locus_tag LOCUS_04430 456591 456139 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629306.1 protein_id gnl|my_center|LOCUS_04430 457337 456630 gene locus_tag LOCUS_04440 457337 456630 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937892.1 protein_id gnl|my_center|LOCUS_04440 458012 457356 gene locus_tag LOCUS_04450 458012 457356 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938048.1 protein_id gnl|my_center|LOCUS_04450 458704 458009 gene locus_tag LOCUS_04460 458704 458009 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792728.1 protein_id gnl|my_center|LOCUS_04460 459592 458768 gene locus_tag LOCUS_04470 459592 458768 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938046.1 protein_id gnl|my_center|LOCUS_04470 460035 459646 gene locus_tag LOCUS_04480 460035 459646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 461016 460174 gene locus_tag LOCUS_04490 461016 460174 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792788.1 protein_id gnl|my_center|LOCUS_04490 461246 461019 gene locus_tag LOCUS_04500 461246 461019 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938477.1 protein_id gnl|my_center|LOCUS_04500 463088 461361 gene locus_tag LOCUS_04510 463088 461361 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938476.1 protein_id gnl|my_center|LOCUS_04510 463275 463841 gene locus_tag LOCUS_04520 463275 463841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 466331 463935 gene locus_tag LOCUS_04530 gene torA 466331 463935 CDS product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389042.1 protein_id gnl|my_center|LOCUS_04530 467061 466435 gene locus_tag LOCUS_04540 467061 466435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 468232 467075 gene locus_tag LOCUS_04550 gene torC 468232 467075 CDS product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338996.1 protein_id gnl|my_center|LOCUS_04550 468418 468603 gene locus_tag LOCUS_04560 468418 468603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 469278 468514 gene locus_tag LOCUS_04570 469278 468514 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941464.1 protein_id gnl|my_center|LOCUS_04570 470282 469278 gene locus_tag LOCUS_04580 470282 469278 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941465.1 protein_id gnl|my_center|LOCUS_04580 471122 470331 gene locus_tag LOCUS_04590 471122 470331 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941466.1 protein_id gnl|my_center|LOCUS_04590 471357 472300 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgcgcatacggggaacac 472686 472387 gene locus_tag LOCUS_04600 gene cas2e 472686 472387 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942042.1 protein_id gnl|my_center|LOCUS_04600 473572 472661 gene locus_tag LOCUS_04610 gene cas1e 473572 472661 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942041.1 protein_id gnl|my_center|LOCUS_04610 474216 473572 gene locus_tag LOCUS_04620 gene cas6e 474216 473572 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281411.1 protein_id gnl|my_center|LOCUS_04620 474955 474203 gene locus_tag LOCUS_04630 gene cas5e 474955 474203 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387930.1 protein_id gnl|my_center|LOCUS_04630 476080 474959 gene locus_tag LOCUS_04640 gene cas7e 476080 474959 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206445.1 protein_id gnl|my_center|LOCUS_04640 476624 476103 gene locus_tag LOCUS_04650 476624 476103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 478204 476621 gene locus_tag LOCUS_04660 gene casA 478204 476621 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084093.1 protein_id gnl|my_center|LOCUS_04660 481311 478693 gene locus_tag LOCUS_04670 481311 478693 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387934.1 protein_id gnl|my_center|LOCUS_04670 481976 481380 gene locus_tag LOCUS_04680 481976 481380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 482176 482100 gene locus_tag LOCUS_t00140 482176 482100 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 482469 483461 gene locus_tag LOCUS_04690 482469 483461 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939356.1 protein_id gnl|my_center|LOCUS_04690 483503 485440 gene locus_tag LOCUS_04700 483503 485440 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939355.1 protein_id gnl|my_center|LOCUS_04700 485450 486325 gene locus_tag LOCUS_04710 485450 486325 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939354.1 protein_id gnl|my_center|LOCUS_04710 486442 486810 gene locus_tag LOCUS_04720 486442 486810 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939351.1 protein_id gnl|my_center|LOCUS_04720 486879 489857 gene locus_tag LOCUS_04730 486879 489857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 490879 489938 gene locus_tag LOCUS_04740 490879 489938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939349.1 protein_id gnl|my_center|LOCUS_04740 491076 491963 gene locus_tag LOCUS_04750 gene ybgF 491076 491963 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939348.1 protein_id gnl|my_center|LOCUS_04750 492015 493253 gene locus_tag LOCUS_04760 492015 493253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 493301 493573 gene locus_tag LOCUS_04770 493301 493573 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140124.1 protein_id gnl|my_center|LOCUS_04770 493656 494048 gene locus_tag LOCUS_04780 493656 494048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 494052 494888 gene locus_tag LOCUS_04790 494052 494888 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939346.1 protein_id gnl|my_center|LOCUS_04790 494947 495909 gene locus_tag LOCUS_04800 494947 495909 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939345.1 protein_id gnl|my_center|LOCUS_04800 495884 496834 gene locus_tag LOCUS_04810 gene xerD 495884 496834 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_04810 496857 497366 gene locus_tag LOCUS_04820 496857 497366 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937593.1 protein_id gnl|my_center|LOCUS_04820 499224 497449 gene locus_tag LOCUS_04830 499224 497449 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938052.1 protein_id gnl|my_center|LOCUS_04830 500125 499298 gene locus_tag LOCUS_04840 500125 499298 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938053.1 protein_id gnl|my_center|LOCUS_04840 500966 500202 gene locus_tag LOCUS_04850 500966 500202 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938054.1 protein_id gnl|my_center|LOCUS_04850 502485 501106 gene locus_tag LOCUS_04860 502485 501106 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197529993.1 protein_id gnl|my_center|LOCUS_04860 503068 502640 gene locus_tag LOCUS_04870 503068 502640 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546418.1 protein_id gnl|my_center|LOCUS_04870 503765 503118 gene locus_tag LOCUS_04880 503765 503118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 504145 503789 gene locus_tag LOCUS_04890 504145 503789 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_04890 505878 504142 gene locus_tag LOCUS_04900 505878 504142 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940221.1 protein_id gnl|my_center|LOCUS_04900 507117 505900 gene locus_tag LOCUS_04910 507117 505900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 509262 507139 gene locus_tag LOCUS_04920 509262 507139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 509861 509277 gene locus_tag LOCUS_04930 509861 509277 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792236.1 protein_id gnl|my_center|LOCUS_04930 511472 510069 gene locus_tag LOCUS_04940 511472 510069 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941505.1 protein_id gnl|my_center|LOCUS_04940 512040 512312 gene locus_tag LOCUS_04950 512040 512312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 512330 514342 gene locus_tag LOCUS_04960 512330 514342 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484757.1 protein_id gnl|my_center|LOCUS_04960 514354 514779 gene locus_tag LOCUS_04970 514354 514779 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_04970 514804 515931 gene locus_tag LOCUS_04980 514804 515931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 515947 519393 gene locus_tag LOCUS_04990 515947 519393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 519409 519975 gene locus_tag LOCUS_05000 519409 519975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 519972 520898 gene locus_tag LOCUS_05010 519972 520898 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_05010 520923 521837 gene locus_tag LOCUS_05020 520923 521837 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937570.1 protein_id gnl|my_center|LOCUS_05020 521942 523267 gene locus_tag LOCUS_05030 521942 523267 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392962.1 protein_id gnl|my_center|LOCUS_05030 523660 523328 gene locus_tag LOCUS_05040 523660 523328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 523935 523859 gene locus_tag LOCUS_t00150 523935 523859 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 526118 524013 gene locus_tag LOCUS_05050 526118 524013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 526704 526129 gene locus_tag LOCUS_05060 526704 526129 CDS product RnfABCDGE type electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940062.1 protein_id gnl|my_center|LOCUS_05060 527397 526717 gene locus_tag LOCUS_05070 527397 526717 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940061.1 protein_id gnl|my_center|LOCUS_05070 527988 527407 gene locus_tag LOCUS_05080 527988 527407 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940060.1 protein_id gnl|my_center|LOCUS_05080 528964 527981 gene locus_tag LOCUS_05090 528964 527981 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940059.1 protein_id gnl|my_center|LOCUS_05090 530157 528961 gene locus_tag LOCUS_05100 530157 528961 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940058.1 protein_id gnl|my_center|LOCUS_05100 530908 530171 gene locus_tag LOCUS_05110 530908 530171 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294645.1 protein_id gnl|my_center|LOCUS_05110 531382 531095 gene locus_tag LOCUS_05120 531382 531095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 531489 532115 gene locus_tag LOCUS_05130 531489 532115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 533036 532125 gene locus_tag LOCUS_05140 gene trxB 533036 532125 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879051.1 protein_id gnl|my_center|LOCUS_05140 533893 533111 gene locus_tag LOCUS_05150 533893 533111 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_05150 535004 533898 gene locus_tag LOCUS_05160 535004 533898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 535848 535063 gene locus_tag LOCUS_05170 535848 535063 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938651.1 protein_id gnl|my_center|LOCUS_05170 536183 535854 gene locus_tag LOCUS_05180 536183 535854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 536387 536794 gene locus_tag LOCUS_05190 536387 536794 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940036.1 protein_id gnl|my_center|LOCUS_05190 536778 537308 gene locus_tag LOCUS_05200 536778 537308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 537344 538057 gene locus_tag LOCUS_05210 537344 538057 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939484.1 protein_id gnl|my_center|LOCUS_05210 538059 539792 gene locus_tag LOCUS_05220 538059 539792 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939485.1 protein_id gnl|my_center|LOCUS_05220 539991 540308 gene locus_tag LOCUS_05230 539991 540308 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940042.1 protein_id gnl|my_center|LOCUS_05230 540604 540831 gene locus_tag LOCUS_05240 gene rpmE 540604 540831 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940172.1 protein_id gnl|my_center|LOCUS_05240 541002 541952 gene locus_tag LOCUS_05250 541002 541952 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940173.1 protein_id gnl|my_center|LOCUS_05250 541956 543023 gene locus_tag LOCUS_05260 gene prfA 541956 543023 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940174.1 protein_id gnl|my_center|LOCUS_05260 543030 543908 gene locus_tag LOCUS_05270 gene prmC 543030 543908 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940176.1 protein_id gnl|my_center|LOCUS_05270 544088 545008 gene locus_tag LOCUS_05280 gene lpxC 544088 545008 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940177.1 protein_id gnl|my_center|LOCUS_05280 545905 545084 gene locus_tag LOCUS_05290 545905 545084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 546340 545933 gene locus_tag LOCUS_05300 546340 545933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 546771 546442 gene locus_tag LOCUS_05310 546771 546442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940484.1 protein_id gnl|my_center|LOCUS_05310 547496 546774 gene locus_tag LOCUS_05320 547496 546774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 547909 547529 gene locus_tag LOCUS_05330 547909 547529 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940486.1 protein_id gnl|my_center|LOCUS_05330 548714 547929 gene locus_tag LOCUS_05340 548714 547929 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940487.1 protein_id gnl|my_center|LOCUS_05340 549483 548656 gene locus_tag LOCUS_05350 549483 548656 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791427.1 protein_id gnl|my_center|LOCUS_05350 550571 549501 gene locus_tag LOCUS_05360 550571 549501 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940489.1 protein_id gnl|my_center|LOCUS_05360 552686 550581 gene locus_tag LOCUS_05370 gene flhA 552686 550581 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940490.1 protein_id gnl|my_center|LOCUS_05370 553819 552749 gene locus_tag LOCUS_05380 gene flhB 553819 552749 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940491.1 protein_id gnl|my_center|LOCUS_05380 554620 553832 gene locus_tag LOCUS_05390 gene fliR 554620 553832 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940492.1 protein_id gnl|my_center|LOCUS_05390 555653 554748 gene locus_tag LOCUS_05400 555653 554748 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791421.1 protein_id gnl|my_center|LOCUS_05400 556467 555679 gene locus_tag LOCUS_05410 556467 555679 CDS product tRNA 2-thiocytidine biosynthesis TtcA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940499.1 protein_id gnl|my_center|LOCUS_05410 556602 557972 gene locus_tag LOCUS_05420 556602 557972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 558006 558221 gene locus_tag LOCUS_05430 gene rpoZ 558006 558221 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940500.1 protein_id gnl|my_center|LOCUS_05430 558239 559354 gene locus_tag LOCUS_05440 gene dnaJ 558239 559354 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940501.1 protein_id gnl|my_center|LOCUS_05440 559482 559835 gene locus_tag LOCUS_05450 559482 559835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05450 560903 559983 gene locus_tag LOCUS_05460 560903 559983 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937965.1 protein_id gnl|my_center|LOCUS_05460 561835 560915 gene locus_tag LOCUS_05470 gene cysK 561835 560915 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_05470 563033 561840 gene locus_tag LOCUS_05480 gene nifS 563033 561840 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_05480 563893 563036 gene locus_tag LOCUS_05490 gene nifU 563893 563036 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_05490 564329 564072 gene locus_tag LOCUS_05500 564329 564072 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403995.1 protein_id gnl|my_center|LOCUS_05500 564520 566652 gene locus_tag LOCUS_05510 564520 566652 CDS product GGDEF and EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294638.1 protein_id gnl|my_center|LOCUS_05510 566696 566878 gene locus_tag LOCUS_05520 566696 566878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 567050 567466 gene locus_tag LOCUS_05530 567050 567466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 567482 569977 gene locus_tag LOCUS_05540 567482 569977 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792370.1 protein_id gnl|my_center|LOCUS_05540 569981 570211 gene locus_tag LOCUS_05550 569981 570211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 570540 572219 gene locus_tag LOCUS_05560 gene ilvB 570540 572219 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937667.1 protein_id gnl|my_center|LOCUS_05560 572209 572490 gene locus_tag LOCUS_05570 gene ilvN 572209 572490 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171826.1 protein_id gnl|my_center|LOCUS_05570 573580 574413 gene locus_tag LOCUS_05580 573580 574413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 574557 574481 gene locus_tag LOCUS_t00160 574557 574481 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 574806 574731 gene locus_tag LOCUS_t00170 574806 574731 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 574928 574852 gene locus_tag LOCUS_t00180 574928 574852 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 575214 577229 gene locus_tag LOCUS_05590 575214 577229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 577301 577846 gene locus_tag LOCUS_05600 577301 577846 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937895.1 protein_id gnl|my_center|LOCUS_05600 578652 577930 gene locus_tag LOCUS_05610 578652 577930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 578823 579581 gene locus_tag LOCUS_05620 578823 579581 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938321.1 protein_id gnl|my_center|LOCUS_05620 579604 580764 gene locus_tag LOCUS_05630 579604 580764 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938320.1 protein_id gnl|my_center|LOCUS_05630 580977 581192 gene locus_tag LOCUS_05640 580977 581192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 581321 581611 gene locus_tag LOCUS_05650 581321 581611 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890723.1 protein_id gnl|my_center|LOCUS_05650 582588 581623 gene locus_tag LOCUS_05660 582588 581623 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705146.1 protein_id gnl|my_center|LOCUS_05660 582756 583211 gene locus_tag LOCUS_05670 582756 583211 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938305.1 protein_id gnl|my_center|LOCUS_05670 584304 583216 gene locus_tag LOCUS_05680 584304 583216 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940450.1 protein_id gnl|my_center|LOCUS_05680 586388 584310 gene locus_tag LOCUS_05690 gene sucD 586388 584310 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792056.1 protein_id gnl|my_center|LOCUS_05690 586536 587315 gene locus_tag LOCUS_05700 586536 587315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 587735 587325 gene locus_tag LOCUS_05710 587735 587325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 588670 587756 gene locus_tag LOCUS_05720 588670 587756 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_05720 589910 588786 gene locus_tag LOCUS_05730 589910 588786 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939122.1 protein_id gnl|my_center|LOCUS_05730 589937 590656 gene locus_tag LOCUS_05740 589937 590656 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939121.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05740 590544 590852 gene locus_tag LOCUS_05750 590544 590852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 590928 594632 gene locus_tag LOCUS_05760 590928 594632 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939120.1 protein_id gnl|my_center|LOCUS_05760 595127 598720 gene locus_tag LOCUS_05770 595127 598720 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939119.1 protein_id gnl|my_center|LOCUS_05770 599574 598795 gene locus_tag LOCUS_05780 gene hisF 599574 598795 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_05780 600205 599564 gene locus_tag LOCUS_05790 gene hisH 600205 599564 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_05790 600432 600584 gene locus_tag LOCUS_05800 600432 600584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 601375 600587 gene locus_tag LOCUS_05810 601375 600587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 601852 601409 gene locus_tag LOCUS_05820 601852 601409 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938301.1 protein_id gnl|my_center|LOCUS_05820 602268 601849 gene locus_tag LOCUS_05830 602268 601849 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792591.1 protein_id gnl|my_center|LOCUS_05830 602348 603568 gene locus_tag LOCUS_05840 602348 603568 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938299.1 protein_id gnl|my_center|LOCUS_05840 604834 603644 gene locus_tag LOCUS_05850 604834 603644 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940145.1 protein_id gnl|my_center|LOCUS_05850 606698 604845 gene locus_tag LOCUS_05860 606698 604845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 606796 606871 gene locus_tag LOCUS_t00190 606796 606871 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 607037 607112 gene locus_tag LOCUS_t00200 607037 607112 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 607265 607340 gene locus_tag LOCUS_t00210 607265 607340 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 608781 607402 gene locus_tag LOCUS_05870 608781 607402 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942946.1 protein_id gnl|my_center|LOCUS_05870 609940 608876 gene locus_tag LOCUS_05880 609940 608876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 611479 609968 gene locus_tag LOCUS_05890 611479 609968 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925110.1 protein_id gnl|my_center|LOCUS_05890 612841 611705 gene locus_tag LOCUS_05900 612841 611705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_05900 613776 612838 gene locus_tag LOCUS_05910 613776 612838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_05910 614754 613780 gene locus_tag LOCUS_05920 614754 613780 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957343.1 protein_id gnl|my_center|LOCUS_05920 615040 614876 gene locus_tag LOCUS_05930 615040 614876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 615239 615164 gene locus_tag LOCUS_t00220 615239 615164 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 615446 615371 gene locus_tag LOCUS_t00230 615446 615371 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 615672 617255 gene locus_tag LOCUS_05940 gene lysS 615672 617255 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791906.1 protein_id gnl|my_center|LOCUS_05940 617297 618526 gene locus_tag LOCUS_05950 617297 618526 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_05950 618543 619202 gene locus_tag LOCUS_05960 618543 619202 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939647.1 protein_id gnl|my_center|LOCUS_05960 619192 621909 gene locus_tag LOCUS_05970 gene bamA 619192 621909 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791908.1 protein_id gnl|my_center|LOCUS_05970 621946 622470 gene locus_tag LOCUS_05980 621946 622470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 622475 623515 gene locus_tag LOCUS_05990 gene lpxD 622475 623515 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939642.1 protein_id gnl|my_center|LOCUS_05990 623508 623969 gene locus_tag LOCUS_06000 gene fabZ 623508 623969 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939641.1 protein_id gnl|my_center|LOCUS_06000 623969 624784 gene locus_tag LOCUS_06010 gene lpxA 623969 624784 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939640.1 protein_id gnl|my_center|LOCUS_06010 624792 625622 gene locus_tag LOCUS_06020 gene lpxI 624792 625622 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_06020 625774 626652 gene locus_tag LOCUS_06030 625774 626652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 626673 629789 gene locus_tag LOCUS_06040 626673 629789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 629849 631243 gene locus_tag LOCUS_06050 629849 631243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 632657 631533 gene locus_tag LOCUS_06060 gene tgt 632657 631533 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938027.1 protein_id gnl|my_center|LOCUS_06060 633297 632662 gene locus_tag LOCUS_06070 633297 632662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 633426 633740 gene locus_tag LOCUS_06080 633426 633740 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294592.1 protein_id gnl|my_center|LOCUS_06080 633820 634749 gene locus_tag LOCUS_06090 633820 634749 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938287.1 protein_id gnl|my_center|LOCUS_06090 634780 635862 gene locus_tag LOCUS_06100 634780 635862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 635865 636443 gene locus_tag LOCUS_06110 gene cysC 635865 636443 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232097.1 protein_id gnl|my_center|LOCUS_06110 636525 637874 gene locus_tag LOCUS_06120 gene miaB 636525 637874 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938283.1 protein_id gnl|my_center|LOCUS_06120 637868 638359 gene locus_tag LOCUS_06130 637868 638359 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938282.1 protein_id gnl|my_center|LOCUS_06130 638366 639016 gene locus_tag LOCUS_06140 638366 639016 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938281.1 protein_id gnl|my_center|LOCUS_06140 639134 639841 gene locus_tag LOCUS_06150 gene tolQ 639134 639841 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940358.1 protein_id gnl|my_center|LOCUS_06150 639851 640264 gene locus_tag LOCUS_06160 gene tolR 639851 640264 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940359.1 protein_id gnl|my_center|LOCUS_06160 640291 641178 gene locus_tag LOCUS_06170 640291 641178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 641183 642493 gene locus_tag LOCUS_06180 gene tolB 641183 642493 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524613.1 protein_id gnl|my_center|LOCUS_06180 642619 643185 gene locus_tag LOCUS_06190 gene pal 642619 643185 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940363.1 protein_id gnl|my_center|LOCUS_06190 643734 643258 gene locus_tag LOCUS_06200 643734 643258 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937834.1 protein_id gnl|my_center|LOCUS_06200 644058 644288 gene locus_tag LOCUS_06210 644058 644288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 644989 644369 gene locus_tag LOCUS_06220 644989 644369 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937833.1 protein_id gnl|my_center|LOCUS_06220 645167 645889 gene locus_tag LOCUS_06230 645167 645889 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_06230 645907 646782 gene locus_tag LOCUS_06240 645907 646782 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666986.1 protein_id gnl|my_center|LOCUS_06240 646874 647821 gene locus_tag LOCUS_06250 646874 647821 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294587.1 protein_id gnl|my_center|LOCUS_06250 647852 648529 gene locus_tag LOCUS_06260 647852 648529 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457207.1 protein_id gnl|my_center|LOCUS_06260 648516 649967 gene locus_tag LOCUS_06270 648516 649967 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938336.1 protein_id gnl|my_center|LOCUS_06270 650021 650503 gene locus_tag LOCUS_06280 gene gpt 650021 650503 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938365.1 protein_id gnl|my_center|LOCUS_06280 650626 651762 gene locus_tag LOCUS_06290 650626 651762 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_06290 651869 652834 gene locus_tag LOCUS_06300 651869 652834 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938367.1 protein_id gnl|my_center|LOCUS_06300 652854 653771 gene locus_tag LOCUS_06310 652854 653771 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938368.1 protein_id gnl|my_center|LOCUS_06310 653775 655313 gene locus_tag LOCUS_06320 653775 655313 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938369.1 protein_id gnl|my_center|LOCUS_06320 655385 656146 gene locus_tag LOCUS_06330 655385 656146 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081258.1 protein_id gnl|my_center|LOCUS_06330 656214 656924 gene locus_tag LOCUS_06340 656214 656924 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392641.1 protein_id gnl|my_center|LOCUS_06340 657028 658299 gene locus_tag LOCUS_06350 657028 658299 CDS product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888443.1 protein_id gnl|my_center|LOCUS_06350 658606 658379 gene locus_tag LOCUS_06360 658606 658379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 659524 658736 gene locus_tag LOCUS_06370 659524 658736 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_06370 660011 659592 gene locus_tag LOCUS_06380 660011 659592 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_06380 661207 660011 gene locus_tag LOCUS_06390 661207 660011 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_06390 662516 661221 gene locus_tag LOCUS_06400 662516 661221 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938189.1 protein_id gnl|my_center|LOCUS_06400 663732 662521 gene locus_tag LOCUS_06410 663732 662521 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938190.1 protein_id gnl|my_center|LOCUS_06410 663920 664843 gene locus_tag LOCUS_06420 663920 664843 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791450.1 protein_id gnl|my_center|LOCUS_06420 665061 666980 gene locus_tag LOCUS_06430 gene dnaX 665061 666980 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940456.1 protein_id gnl|my_center|LOCUS_06430 667015 667323 gene locus_tag LOCUS_06440 667015 667323 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940457.1 protein_id gnl|my_center|LOCUS_06440 667332 667937 gene locus_tag LOCUS_06450 gene recR 667332 667937 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940458.1 protein_id gnl|my_center|LOCUS_06450 668040 670250 gene locus_tag LOCUS_06460 668040 670250 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_06460 670453 670959 gene locus_tag LOCUS_06470 670453 670959 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938859.1 protein_id gnl|my_center|LOCUS_06470 671066 672751 gene locus_tag LOCUS_06480 671066 672751 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938860.1 protein_id gnl|my_center|LOCUS_06480 672761 673612 gene locus_tag LOCUS_06490 672761 673612 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938861.1 protein_id gnl|my_center|LOCUS_06490 673678 675360 gene locus_tag LOCUS_06500 gene ettA 673678 675360 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939856.1 protein_id gnl|my_center|LOCUS_06500 675498 675827 gene locus_tag LOCUS_06510 675498 675827 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939282.1 protein_id gnl|my_center|LOCUS_06510 676636 675824 gene locus_tag LOCUS_06520 676636 675824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 677886 676816 gene locus_tag LOCUS_06530 677886 676816 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_06530 680343 678100 gene locus_tag LOCUS_06540 680343 678100 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939500.1 protein_id gnl|my_center|LOCUS_06540 681768 680350 gene locus_tag LOCUS_06550 681768 680350 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939501.1 protein_id gnl|my_center|LOCUS_06550 682017 683279 gene locus_tag LOCUS_06560 682017 683279 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_06560 685569 683338 gene locus_tag LOCUS_06570 685569 683338 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090647.1 protein_id gnl|my_center|LOCUS_06570 685767 687089 gene locus_tag LOCUS_06580 685767 687089 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938312.1 protein_id gnl|my_center|LOCUS_06580 687133 688824 gene locus_tag LOCUS_06590 687133 688824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 688832 690178 gene locus_tag LOCUS_06600 688832 690178 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464847.1 protein_id gnl|my_center|LOCUS_06600 690536 690718 gene locus_tag LOCUS_06610 690536 690718 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937612.1 protein_id gnl|my_center|LOCUS_06610 690900 691277 gene locus_tag LOCUS_06620 690900 691277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 691356 691853 gene locus_tag LOCUS_06630 691356 691853 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890795.1 protein_id gnl|my_center|LOCUS_06630 692296 691850 gene locus_tag LOCUS_06640 692296 691850 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_06640 693026 692376 gene locus_tag LOCUS_06650 gene yihA 693026 692376 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938953.1 protein_id gnl|my_center|LOCUS_06650 693112 693549 gene locus_tag LOCUS_06660 693112 693549 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938954.1 protein_id gnl|my_center|LOCUS_06660 693604 694161 gene locus_tag LOCUS_06670 gene efp 693604 694161 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938955.1 protein_id gnl|my_center|LOCUS_06670 694245 696518 gene locus_tag LOCUS_06680 694245 696518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 696533 697231 gene locus_tag LOCUS_06690 gene lolA 696533 697231 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938957.1 protein_id gnl|my_center|LOCUS_06690 698051 697299 gene locus_tag LOCUS_06700 698051 697299 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938958.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06700 698754 698134 gene locus_tag LOCUS_06710 gene yedF 698754 698134 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938959.1 protein_id gnl|my_center|LOCUS_06710 698922 699581 gene locus_tag LOCUS_06720 698922 699581 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938961.1 protein_id gnl|my_center|LOCUS_06720 701110 699689 gene locus_tag LOCUS_06730 701110 699689 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706437.1 protein_id gnl|my_center|LOCUS_06730 702959 701229 gene locus_tag LOCUS_06740 702959 701229 CDS product LytS/YhcK type 5TM receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101534157.1 protein_id gnl|my_center|LOCUS_06740 703752 702961 gene locus_tag LOCUS_06750 703752 702961 CDS product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937899.1 protein_id gnl|my_center|LOCUS_06750 704870 703860 gene locus_tag LOCUS_06760 704870 703860 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224436.1 protein_id gnl|my_center|LOCUS_06760 705500 704874 gene locus_tag LOCUS_06770 705500 704874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06770 706757 705879 gene locus_tag LOCUS_06780 gene rbsB 706757 705879 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463703.1 protein_id gnl|my_center|LOCUS_06780 707754 706786 gene locus_tag LOCUS_06790 gene rbsC 707754 706786 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463702.1 protein_id gnl|my_center|LOCUS_06790 709265 707754 gene locus_tag LOCUS_06800 gene rbsA 709265 707754 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189455.1 protein_id gnl|my_center|LOCUS_06800 709672 709265 gene locus_tag LOCUS_06810 gene rbsD 709672 709265 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262034.1 protein_id gnl|my_center|LOCUS_06810 710030 710123 gene locus_tag LOCUS_t00240 710030 710123 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 711301 710237 gene locus_tag LOCUS_06820 711301 710237 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_06820 712073 711627 gene locus_tag LOCUS_06830 712073 711627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 713408 712155 gene locus_tag LOCUS_06840 713408 712155 CDS product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229907.1 protein_id gnl|my_center|LOCUS_06840 714341 713424 gene locus_tag LOCUS_06850 714341 713424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 714983 714354 gene locus_tag LOCUS_06860 714983 714354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 715294 714986 gene locus_tag LOCUS_06870 715294 714986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 715545 715297 gene locus_tag LOCUS_06880 715545 715297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 716046 715759 gene locus_tag LOCUS_06890 716046 715759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 717027 716305 gene locus_tag LOCUS_06900 717027 716305 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_06900 718696 718325 gene locus_tag LOCUS_06910 718696 718325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 718809 719027 gene locus_tag LOCUS_06920 718809 719027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 719310 719035 gene locus_tag LOCUS_06930 719310 719035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 719370 719855 gene locus_tag LOCUS_06940 719370 719855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 719860 720243 gene locus_tag LOCUS_06950 719860 720243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 720249 721382 gene locus_tag LOCUS_06960 720249 721382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 721303 721644 gene locus_tag LOCUS_06970 721303 721644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 721641 721856 gene locus_tag LOCUS_06980 721641 721856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 721849 722343 gene locus_tag LOCUS_06990 721849 722343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 722340 723134 gene locus_tag LOCUS_07000 722340 723134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 723131 723334 gene locus_tag LOCUS_07010 723131 723334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 723542 724687 gene locus_tag LOCUS_07020 723542 724687 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933793.1 protein_id gnl|my_center|LOCUS_07020 725302 725039 gene locus_tag LOCUS_07030 725302 725039 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769718.1 protein_id gnl|my_center|LOCUS_07030 725559 725302 gene locus_tag LOCUS_07040 gene yefM 725559 725302 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259256.1 protein_id gnl|my_center|LOCUS_07040 726623 725844 gene locus_tag LOCUS_07050 726623 725844 CDS product phage antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286575.1 protein_id gnl|my_center|LOCUS_07050 726610 726912 gene locus_tag LOCUS_07060 726610 726912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 727159 727022 gene locus_tag LOCUS_07070 727159 727022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 727312 727983 gene locus_tag LOCUS_07080 727312 727983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 728029 728598 gene locus_tag LOCUS_07090 728029 728598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 728826 729233 gene locus_tag LOCUS_07100 728826 729233 CDS product DUF5675 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964411.1 protein_id gnl|my_center|LOCUS_07100 729236 729646 gene locus_tag LOCUS_07110 729236 729646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 729643 729885 gene locus_tag LOCUS_07120 729643 729885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 730202 730630 gene locus_tag LOCUS_07130 730202 730630 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293088.1 protein_id gnl|my_center|LOCUS_07130 730620 731906 gene locus_tag LOCUS_07140 730620 731906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531618.1 protein_id gnl|my_center|LOCUS_07140 731907 734000 gene locus_tag LOCUS_07150 731907 734000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 733997 734200 gene locus_tag LOCUS_07160 733997 734200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 734543 735814 gene locus_tag LOCUS_07170 734543 735814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 735790 736884 gene locus_tag LOCUS_07180 735790 736884 CDS product N4-gp56 family major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214474.1 protein_id gnl|my_center|LOCUS_07180 736948 737571 gene locus_tag LOCUS_07190 736948 737571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 737586 738245 gene locus_tag LOCUS_07200 737586 738245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 738242 738883 gene locus_tag LOCUS_07210 738242 738883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 738895 739284 gene locus_tag LOCUS_07220 738895 739284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 739294 739968 gene locus_tag LOCUS_07230 739294 739968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 739970 741424 gene locus_tag LOCUS_07240 739970 741424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 741437 741790 gene locus_tag LOCUS_07250 741437 741790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 741790 743577 gene locus_tag LOCUS_07260 741790 743577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 743574 743780 gene locus_tag LOCUS_07270 743574 743780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 743777 744328 gene locus_tag LOCUS_07280 743777 744328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 744315 744884 gene locus_tag LOCUS_07290 744315 744884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 744889 745170 gene locus_tag LOCUS_07300 744889 745170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 745325 746692 gene locus_tag LOCUS_07310 745325 746692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 746744 749809 gene locus_tag LOCUS_07320 746744 749809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 749820 756896 gene locus_tag LOCUS_07330 749820 756896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07330 756913 759756 gene locus_tag LOCUS_07340 756913 759756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 760090 759803 gene locus_tag LOCUS_07350 760090 759803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 760213 760094 gene locus_tag LOCUS_07360 760213 760094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 761201 760674 gene locus_tag LOCUS_07370 761201 760674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 763724 761226 gene locus_tag LOCUS_07380 763724 761226 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974842.1 protein_id gnl|my_center|LOCUS_07380 764572 763733 gene locus_tag LOCUS_07390 764572 763733 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217633758.1 protein_id gnl|my_center|LOCUS_07390 764814 764945 gene locus_tag LOCUS_07400 764814 764945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 766636 765557 gene locus_tag LOCUS_07410 766636 765557 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097898.1 protein_id gnl|my_center|LOCUS_07410 767200 767436 gene locus_tag LOCUS_07420 767200 767436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 767526 767714 gene locus_tag LOCUS_07430 767526 767714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 767740 768714 gene locus_tag LOCUS_07440 767740 768714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 768833 769954 gene locus_tag LOCUS_07450 768833 769954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 769971 770522 gene locus_tag LOCUS_07460 769971 770522 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_07460 770567 770953 gene locus_tag LOCUS_07470 770567 770953 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_07470 771128 770928 gene locus_tag LOCUS_07480 771128 770928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 771297 772346 gene locus_tag LOCUS_07490 771297 772346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 772355 773338 gene locus_tag LOCUS_07500 772355 773338 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_07500 773338 774654 gene locus_tag LOCUS_07510 773338 774654 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_07510 774664 775122 gene locus_tag LOCUS_07520 774664 775122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 775705 775217 gene locus_tag LOCUS_07530 gene tadA 775705 775217 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810985.1 protein_id gnl|my_center|LOCUS_07530 776528 775713 gene locus_tag LOCUS_07540 776528 775713 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938913.1 protein_id gnl|my_center|LOCUS_07540 776700 778334 gene locus_tag LOCUS_07550 776700 778334 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938914.1 protein_id gnl|my_center|LOCUS_07550 778341 779144 gene locus_tag LOCUS_07560 gene kdsA 778341 779144 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938915.1 protein_id gnl|my_center|LOCUS_07560 779134 779661 gene locus_tag LOCUS_07570 779134 779661 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938916.1 protein_id gnl|my_center|LOCUS_07570 779662 780282 gene locus_tag LOCUS_07580 779662 780282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 780290 781135 gene locus_tag LOCUS_07590 780290 781135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 781141 781866 gene locus_tag LOCUS_07600 gene lptB 781141 781866 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938918.1 protein_id gnl|my_center|LOCUS_07600 782109 783533 gene locus_tag LOCUS_07610 gene rpoN 782109 783533 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938919.1 protein_id gnl|my_center|LOCUS_07610 783572 784117 gene locus_tag LOCUS_07620 gene raiA 783572 784117 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938920.1 protein_id gnl|my_center|LOCUS_07620 784119 784568 gene locus_tag LOCUS_07630 784119 784568 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_07630 784583 785464 gene locus_tag LOCUS_07640 gene rapZ 784583 785464 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938922.1 protein_id gnl|my_center|LOCUS_07640 785516 785911 gene locus_tag LOCUS_07650 785516 785911 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938923.1 protein_id gnl|my_center|LOCUS_07650 785914 786378 gene locus_tag LOCUS_07660 785914 786378 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938924.1 protein_id gnl|my_center|LOCUS_07660 786382 786561 gene locus_tag LOCUS_07670 786382 786561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 786512 787081 gene locus_tag LOCUS_07680 786512 787081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 787176 788096 gene locus_tag LOCUS_07690 787176 788096 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938927.1 protein_id gnl|my_center|LOCUS_07690 789167 788286 gene locus_tag LOCUS_07700 gene dapA 789167 788286 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_07700 789921 789211 gene locus_tag LOCUS_07710 789921 789211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 790345 790070 gene locus_tag LOCUS_07720 790345 790070 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939150.1 protein_id gnl|my_center|LOCUS_07720 791304 790480 gene locus_tag LOCUS_07730 791304 790480 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939149.1 protein_id gnl|my_center|LOCUS_07730 792165 791311 gene locus_tag LOCUS_07740 792165 791311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 793057 792143 gene locus_tag LOCUS_07750 gene prfB 793057 792143 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939147.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07750 794777 793266 gene locus_tag LOCUS_07760 gene lnt 794777 793266 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939146.1 protein_id gnl|my_center|LOCUS_07760 795618 794782 gene locus_tag LOCUS_07770 795618 794782 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942919.1 protein_id gnl|my_center|LOCUS_07770 797622 795739 gene locus_tag LOCUS_07780 gene mnmG 797622 795739 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939115.1 protein_id gnl|my_center|LOCUS_07780 798858 797635 gene locus_tag LOCUS_07790 798858 797635 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939114.1 protein_id gnl|my_center|LOCUS_07790 799253 798969 gene locus_tag LOCUS_07800 799253 798969 CDS product PxxKW family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939113.1 protein_id gnl|my_center|LOCUS_07800 800714 799374 gene locus_tag LOCUS_07810 800714 799374 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_07810 801470 800727 gene locus_tag LOCUS_07820 801470 800727 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_07820 802005 801487 gene locus_tag LOCUS_07830 gene apt 802005 801487 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206218.1 protein_id gnl|my_center|LOCUS_07830 802127 802903 gene locus_tag LOCUS_07840 gene rsmA 802127 802903 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792217.1 protein_id gnl|my_center|LOCUS_07840 803176 803448 gene locus_tag LOCUS_07850 803176 803448 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939083.1 protein_id gnl|my_center|LOCUS_07850 803461 803637 gene locus_tag LOCUS_07860 803461 803637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939082.1 protein_id gnl|my_center|LOCUS_07860 803819 804019 gene locus_tag LOCUS_07870 803819 804019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 804025 804471 gene locus_tag LOCUS_07880 804025 804471 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939079.1 protein_id gnl|my_center|LOCUS_07880 804500 806803 gene locus_tag LOCUS_07890 804500 806803 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939078.1 protein_id gnl|my_center|LOCUS_07890 806829 808580 gene locus_tag LOCUS_07900 gene dnaG 806829 808580 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151150154.1 protein_id gnl|my_center|LOCUS_07900 808567 810321 gene locus_tag LOCUS_07910 gene rpoD 808567 810321 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939076.1 protein_id gnl|my_center|LOCUS_07910 810376 811314 gene locus_tag LOCUS_07920 810376 811314 CDS product CobD/CbiB family cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939512.1 protein_id gnl|my_center|LOCUS_07920 811963 811316 gene locus_tag LOCUS_07930 811963 811316 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939817.1 protein_id gnl|my_center|LOCUS_07930 812086 813399 gene locus_tag LOCUS_07940 812086 813399 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938380.1 protein_id gnl|my_center|LOCUS_07940 813509 814198 gene locus_tag LOCUS_07950 813509 814198 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_07950 814211 814528 gene locus_tag LOCUS_07960 814211 814528 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938537.1 protein_id gnl|my_center|LOCUS_07960 814539 815237 gene locus_tag LOCUS_07970 814539 815237 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938888.1 protein_id gnl|my_center|LOCUS_07970 815224 815889 gene locus_tag LOCUS_07980 815224 815889 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938888.1 protein_id gnl|my_center|LOCUS_07980 816028 817398 gene locus_tag LOCUS_07990 gene trkA 816028 817398 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_07990 817399 818856 gene locus_tag LOCUS_08000 817399 818856 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_08000 819692 818937 gene locus_tag LOCUS_08010 819692 818937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 821468 819864 gene locus_tag LOCUS_08020 gene nadB 821468 819864 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939096.1 protein_id gnl|my_center|LOCUS_08020 822527 821487 gene locus_tag LOCUS_08030 gene nadA 822527 821487 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939095.1 protein_id gnl|my_center|LOCUS_08030 823412 822540 gene locus_tag LOCUS_08040 gene nadC 823412 822540 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939094.1 protein_id gnl|my_center|LOCUS_08040 823570 824907 gene locus_tag LOCUS_08050 gene mgtE 823570 824907 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939093.1 protein_id gnl|my_center|LOCUS_08050 826179 824953 gene locus_tag LOCUS_08060 826179 824953 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938975.1 protein_id gnl|my_center|LOCUS_08060 826520 826176 gene locus_tag LOCUS_08070 826520 826176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08070 826691 826930 gene locus_tag LOCUS_08080 826691 826930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 828208 826970 gene locus_tag LOCUS_08090 gene lysA 828208 826970 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938936.1 protein_id gnl|my_center|LOCUS_08090 828697 828239 gene locus_tag LOCUS_08100 828697 828239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 831336 828697 gene locus_tag LOCUS_08110 gene mutS 831336 828697 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938938.1 protein_id gnl|my_center|LOCUS_08110 832506 831364 gene locus_tag LOCUS_08120 832506 831364 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938939.1 protein_id gnl|my_center|LOCUS_08120 832880 832515 gene locus_tag LOCUS_08130 832880 832515 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938940.1 protein_id gnl|my_center|LOCUS_08130 833377 832892 gene locus_tag LOCUS_08140 833377 832892 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524404.1 protein_id gnl|my_center|LOCUS_08140 836293 833609 gene locus_tag LOCUS_08150 836293 833609 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938942.1 protein_id gnl|my_center|LOCUS_08150 837247 836318 gene locus_tag LOCUS_08160 gene xerD 837247 836318 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792251.1 protein_id gnl|my_center|LOCUS_08160 837439 838605 gene locus_tag LOCUS_08170 837439 838605 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938944.1 protein_id gnl|my_center|LOCUS_08170 838632 839102 gene locus_tag LOCUS_08180 gene folK 838632 839102 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428870.1 protein_id gnl|my_center|LOCUS_08180 839134 839412 gene locus_tag LOCUS_08190 839134 839412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938946.1 protein_id gnl|my_center|LOCUS_08190 839912 842026 gene locus_tag LOCUS_08200 839912 842026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 842302 843342 gene locus_tag LOCUS_08210 842302 843342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 843359 844321 gene locus_tag LOCUS_08220 843359 844321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 844462 844376 gene locus_tag LOCUS_t00250 844462 844376 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 844729 845424 gene locus_tag LOCUS_08230 844729 845424 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480275.1 protein_id gnl|my_center|LOCUS_08230 845417 845725 gene locus_tag LOCUS_08240 845417 845725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 845749 845979 gene locus_tag LOCUS_08250 845749 845979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 846126 846040 gene locus_tag LOCUS_t00260 846126 846040 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 846484 846140 gene locus_tag LOCUS_08260 gene secG 846484 846140 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938965.1 protein_id gnl|my_center|LOCUS_08260 847280 846528 gene locus_tag LOCUS_08270 gene tpiA 847280 846528 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938966.1 protein_id gnl|my_center|LOCUS_08270 848479 847277 gene locus_tag LOCUS_08280 848479 847277 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_08280 848977 848510 gene locus_tag LOCUS_08290 gene rimI 848977 848510 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938967.1 protein_id gnl|my_center|LOCUS_08290 849191 849595 gene locus_tag LOCUS_08300 849191 849595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 850402 849611 gene locus_tag LOCUS_08310 850402 849611 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938969.1 protein_id gnl|my_center|LOCUS_08310 850938 852686 gene locus_tag LOCUS_08320 850938 852686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938972.1 protein_id gnl|my_center|LOCUS_08320 852712 853797 gene locus_tag LOCUS_08330 gene gcvT 852712 853797 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938973.1 protein_id gnl|my_center|LOCUS_08330 855010 853880 gene locus_tag LOCUS_08340 855010 853880 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938952.1 protein_id gnl|my_center|LOCUS_08340 856143 855010 gene locus_tag LOCUS_08350 gene lptF 856143 855010 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938951.1 protein_id gnl|my_center|LOCUS_08350 856362 856180 gene locus_tag LOCUS_08360 856362 856180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938950.1 protein_id gnl|my_center|LOCUS_08360 856563 857354 gene locus_tag LOCUS_08370 856563 857354 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938949.1 protein_id gnl|my_center|LOCUS_08370 857452 857528 gene locus_tag LOCUS_t00270 857452 857528 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 857697 858083 gene locus_tag LOCUS_tm00010 857697 858083 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 859354 858158 gene locus_tag LOCUS_08380 859354 858158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 859721 859485 gene locus_tag LOCUS_08390 859721 859485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 860039 859791 gene locus_tag LOCUS_08400 860039 859791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 860399 860103 gene locus_tag LOCUS_08410 860399 860103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 860685 860425 gene locus_tag LOCUS_08420 860685 860425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 861752 861018 gene locus_tag LOCUS_08430 861752 861018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 862237 861872 gene locus_tag LOCUS_08440 862237 861872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 862738 862532 gene locus_tag LOCUS_08450 862738 862532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 863259 862753 gene locus_tag LOCUS_08460 863259 862753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 863641 863336 gene locus_tag LOCUS_08470 863641 863336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 864029 863703 gene locus_tag LOCUS_08480 864029 863703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 864268 864546 gene locus_tag LOCUS_08490 864268 864546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 864662 865249 gene locus_tag LOCUS_08500 864662 865249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 865296 866132 gene locus_tag LOCUS_08510 865296 866132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 866250 866435 gene locus_tag LOCUS_08520 866250 866435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 866562 867854 gene locus_tag LOCUS_08530 866562 867854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 868558 868082 gene locus_tag LOCUS_08540 868558 868082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 869117 868569 gene locus_tag LOCUS_08550 869117 868569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 870139 869117 gene locus_tag LOCUS_08560 870139 869117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 874349 870141 gene locus_tag LOCUS_08570 874349 870141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 874857 874450 gene locus_tag LOCUS_08580 874857 874450 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939431.1 protein_id gnl|my_center|LOCUS_08580 875381 874866 gene locus_tag LOCUS_08590 875381 874866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 875770 875390 gene locus_tag LOCUS_08600 875770 875390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939433.1 protein_id gnl|my_center|LOCUS_08600 877888 875774 gene locus_tag LOCUS_08610 877888 875774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 877927 878082 gene locus_tag LOCUS_08620 877927 878082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 878349 878056 gene locus_tag LOCUS_08630 878349 878056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 878657 878385 gene locus_tag LOCUS_08640 878657 878385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 880064 878661 gene locus_tag LOCUS_08650 880064 878661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 880535 880077 gene locus_tag LOCUS_08660 880535 880077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 881227 880547 gene locus_tag LOCUS_08670 881227 880547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 881571 881224 gene locus_tag LOCUS_08680 881571 881224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 881840 881568 gene locus_tag LOCUS_08690 881840 881568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 882171 881773 gene locus_tag LOCUS_08700 882171 881773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 882749 882156 gene locus_tag LOCUS_08710 882749 882156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 882897 882676 gene locus_tag LOCUS_08720 882897 882676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 883055 882897 gene locus_tag LOCUS_08730 883055 882897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 883291 883052 gene locus_tag LOCUS_08740 883291 883052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 883776 883378 gene locus_tag LOCUS_08750 883776 883378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 884790 883786 gene locus_tag LOCUS_08760 884790 883786 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939445.1 protein_id gnl|my_center|LOCUS_08760 885174 884800 gene locus_tag LOCUS_08770 885174 884800 CDS product head decoration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939446.1 protein_id gnl|my_center|LOCUS_08770 886431 885184 gene locus_tag LOCUS_08780 886431 885184 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190275052.1 protein_id gnl|my_center|LOCUS_08780 887933 886428 gene locus_tag LOCUS_08790 887933 886428 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940132.1 protein_id gnl|my_center|LOCUS_08790 888091 887930 gene locus_tag LOCUS_08800 888091 887930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 890212 888914 gene locus_tag LOCUS_08810 890212 888914 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_08810 890551 890354 gene locus_tag LOCUS_08820 890551 890354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 892532 890562 gene locus_tag LOCUS_08830 892532 890562 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078686218.1 protein_id gnl|my_center|LOCUS_08830 893256 892519 gene locus_tag LOCUS_08840 893256 892519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940137.1 protein_id gnl|my_center|LOCUS_08840 894593 893253 gene locus_tag LOCUS_08850 894593 893253 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937502.1 protein_id gnl|my_center|LOCUS_08850 896153 894714 gene locus_tag LOCUS_08860 896153 894714 CDS product primase-helicase zinc-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940139.1 protein_id gnl|my_center|LOCUS_08860 898269 896428 gene locus_tag LOCUS_08870 898269 896428 CDS product phage/plasmid primase, P4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937499.1 protein_id gnl|my_center|LOCUS_08870 900082 898982 gene locus_tag LOCUS_08880 900082 898982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 900275 900649 gene locus_tag LOCUS_08890 900275 900649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 901337 900942 gene locus_tag LOCUS_08900 901337 900942 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263098.1 protein_id gnl|my_center|LOCUS_08900 901710 901363 gene locus_tag LOCUS_08910 901710 901363 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_08910 902506 901712 gene locus_tag LOCUS_08920 902506 901712 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_08920 903208 902522 gene locus_tag LOCUS_08930 903208 902522 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_08930 905136 903550 gene locus_tag LOCUS_08940 905136 903550 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230124.1 protein_id gnl|my_center|LOCUS_08940 905504 905785 gene locus_tag LOCUS_08950 905504 905785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 905948 907057 gene locus_tag LOCUS_08960 905948 907057 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938039.1 protein_id gnl|my_center|LOCUS_08960 907079 909940 gene locus_tag LOCUS_08970 907079 909940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 911140 910442 gene locus_tag LOCUS_08980 911140 910442 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937942.1 protein_id gnl|my_center|LOCUS_08980 911974 911222 gene locus_tag LOCUS_08990 911974 911222 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937943.1 protein_id gnl|my_center|LOCUS_08990 913099 911981 gene locus_tag LOCUS_09000 913099 911981 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938741.1 protein_id gnl|my_center|LOCUS_09000 913410 913796 gene locus_tag LOCUS_09010 913410 913796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 913947 914240 gene locus_tag LOCUS_09020 913947 914240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 915379 914318 gene locus_tag LOCUS_09030 915379 914318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 916152 915526 gene locus_tag LOCUS_09040 916152 915526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 916355 919171 gene locus_tag LOCUS_09050 gene ileS 916355 919171 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939213.1 protein_id gnl|my_center|LOCUS_09050 919181 919669 gene locus_tag LOCUS_09060 gene lspA 919181 919669 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_09060 919707 919925 gene locus_tag LOCUS_09070 919707 919925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 919931 920854 gene locus_tag LOCUS_09080 919931 920854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 920917 921360 gene locus_tag LOCUS_09090 920917 921360 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939217.1 protein_id gnl|my_center|LOCUS_09090 921374 921895 gene locus_tag LOCUS_09100 921374 921895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 921925 922659 gene locus_tag LOCUS_09110 921925 922659 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938751.1 protein_id gnl|my_center|LOCUS_09110 923994 922729 gene locus_tag LOCUS_09120 923994 922729 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938758.1 protein_id gnl|my_center|LOCUS_09120 925301 924042 gene locus_tag LOCUS_09130 925301 924042 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938757.1 protein_id gnl|my_center|LOCUS_09130 925410 926087 gene locus_tag LOCUS_09140 925410 926087 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938756.1 protein_id gnl|my_center|LOCUS_09140 926074 926880 gene locus_tag LOCUS_09150 gene ccsA 926074 926880 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792376.1 protein_id gnl|my_center|LOCUS_09150 926884 928254 gene locus_tag LOCUS_09160 gene hemA 926884 928254 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938754.1 protein_id gnl|my_center|LOCUS_09160 928254 928601 gene locus_tag LOCUS_09170 928254 928601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938753.1 protein_id gnl|my_center|LOCUS_09170 928604 929614 gene locus_tag LOCUS_09180 gene tilS 928604 929614 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792378.1 protein_id gnl|my_center|LOCUS_09180 929675 930340 gene locus_tag LOCUS_09190 929675 930340 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939218.1 protein_id gnl|my_center|LOCUS_09190 931629 930556 gene locus_tag LOCUS_09200 gene secF 931629 930556 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939105.1 protein_id gnl|my_center|LOCUS_09200 933237 931642 gene locus_tag LOCUS_09210 gene secD 933237 931642 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939106.1 protein_id gnl|my_center|LOCUS_09210 933712 933365 gene locus_tag LOCUS_09220 gene yajC 933712 933365 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_09220 934516 933755 gene locus_tag LOCUS_09230 934516 933755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939108.1 protein_id gnl|my_center|LOCUS_09230 935617 934520 gene locus_tag LOCUS_09240 935617 934520 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939109.1 protein_id gnl|my_center|LOCUS_09240 936912 935632 gene locus_tag LOCUS_09250 936912 935632 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_09250 937395 936949 gene locus_tag LOCUS_09260 937395 936949 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941894.1 protein_id gnl|my_center|LOCUS_09260 938931 937408 gene locus_tag LOCUS_09270 938931 937408 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939110.1 protein_id gnl|my_center|LOCUS_09270 939566 939706 gene locus_tag LOCUS_09280 939566 939706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 939709 941316 gene locus_tag LOCUS_09290 939709 941316 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_09290 941485 941943 gene locus_tag LOCUS_09300 gene dut 941485 941943 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791926.1 protein_id gnl|my_center|LOCUS_09300 941961 943169 gene locus_tag LOCUS_09310 941961 943169 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939620.1 protein_id gnl|my_center|LOCUS_09310 943231 943443 gene locus_tag LOCUS_09320 943231 943443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 943525 944385 gene locus_tag LOCUS_09330 943525 944385 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939612.1 protein_id gnl|my_center|LOCUS_09330 944387 945043 gene locus_tag LOCUS_09340 944387 945043 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939611.1 protein_id gnl|my_center|LOCUS_09340 945040 946137 gene locus_tag LOCUS_09350 945040 946137 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294660.1 protein_id gnl|my_center|LOCUS_09350 946179 947465 gene locus_tag LOCUS_09360 946179 947465 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939609.1 protein_id gnl|my_center|LOCUS_09360 947484 948731 gene locus_tag LOCUS_09370 947484 948731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 949072 950049 gene locus_tag LOCUS_09380 gene fliM 949072 950049 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_09380 950167 951117 gene locus_tag LOCUS_09390 950167 951117 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529687.1 protein_id gnl|my_center|LOCUS_09390 951222 952121 gene locus_tag LOCUS_09400 951222 952121 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972480.1 protein_id gnl|my_center|LOCUS_09400 952118 952912 gene locus_tag LOCUS_09410 952118 952912 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027210.1 protein_id gnl|my_center|LOCUS_09410 952982 953404 gene locus_tag LOCUS_09420 gene ndk 952982 953404 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939606.1 protein_id gnl|my_center|LOCUS_09420 953405 954202 gene locus_tag LOCUS_09430 gene proC 953405 954202 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939605.1 protein_id gnl|my_center|LOCUS_09430 955121 954273 gene locus_tag LOCUS_09440 955121 954273 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938277.1 protein_id gnl|my_center|LOCUS_09440 955565 955302 gene locus_tag LOCUS_09450 gene rpsT 955565 955302 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_09450 957802 955694 gene locus_tag LOCUS_09460 gene glyS 957802 955694 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939183.1 protein_id gnl|my_center|LOCUS_09460 958705 957836 gene locus_tag LOCUS_09470 gene glyQ 958705 957836 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939184.1 protein_id gnl|my_center|LOCUS_09470 959483 958719 gene locus_tag LOCUS_09480 gene recO 959483 958719 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939185.1 protein_id gnl|my_center|LOCUS_09480 960471 959509 gene locus_tag LOCUS_09490 960471 959509 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939186.1 protein_id gnl|my_center|LOCUS_09490 961446 960475 gene locus_tag LOCUS_09500 961446 960475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 962647 961550 gene locus_tag LOCUS_09510 962647 961550 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792159.1 protein_id gnl|my_center|LOCUS_09510 966133 962657 gene locus_tag LOCUS_09520 gene mfd 966133 962657 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792158.1 protein_id gnl|my_center|LOCUS_09520 966714 966223 gene locus_tag LOCUS_09530 966714 966223 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_09530 967029 967244 gene locus_tag LOCUS_09540 967029 967244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792157.1 protein_id gnl|my_center|LOCUS_09540 968657 967320 gene locus_tag LOCUS_09550 968657 967320 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939193.1 protein_id gnl|my_center|LOCUS_09550 968846 969571 gene locus_tag LOCUS_09560 968846 969571 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939194.1 protein_id gnl|my_center|LOCUS_09560 969578 969952 gene locus_tag LOCUS_09570 969578 969952 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939195.1 protein_id gnl|my_center|LOCUS_09570 969967 971511 gene locus_tag LOCUS_09580 969967 971511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 971498 971950 gene locus_tag LOCUS_09590 971498 971950 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939197.1 protein_id gnl|my_center|LOCUS_09590 971959 972465 gene locus_tag LOCUS_09600 gene tsaE 971959 972465 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939198.1 protein_id gnl|my_center|LOCUS_09600 972462 973694 gene locus_tag LOCUS_09610 972462 973694 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939199.1 protein_id gnl|my_center|LOCUS_09610 973694 975292 gene locus_tag LOCUS_09620 gene cimA 973694 975292 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939200.1 protein_id gnl|my_center|LOCUS_09620 976607 975363 gene locus_tag LOCUS_09630 976607 975363 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_09630 977822 976845 gene locus_tag LOCUS_09640 gene gap 977822 976845 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939421.1 protein_id gnl|my_center|LOCUS_09640 978673 977921 gene locus_tag LOCUS_09650 gene surE 978673 977921 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939419.1 protein_id gnl|my_center|LOCUS_09650 978812 979840 gene locus_tag LOCUS_09660 978812 979840 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939418.1 protein_id gnl|my_center|LOCUS_09660 979816 980448 gene locus_tag LOCUS_09670 gene tmk 979816 980448 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939417.1 protein_id gnl|my_center|LOCUS_09670 980675 981436 gene locus_tag LOCUS_09680 980675 981436 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479143.1 protein_id gnl|my_center|LOCUS_09680 981467 982303 gene locus_tag LOCUS_09690 981467 982303 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937978.1 protein_id gnl|my_center|LOCUS_09690 982320 983210 gene locus_tag LOCUS_09700 982320 983210 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937979.1 protein_id gnl|my_center|LOCUS_09700 983215 983583 gene locus_tag LOCUS_09710 983215 983583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 983587 983919 gene locus_tag LOCUS_09720 983587 983919 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938183.1 protein_id gnl|my_center|LOCUS_09720 984902 984147 gene locus_tag LOCUS_09730 984902 984147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 987139 984899 gene locus_tag LOCUS_09740 987139 984899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 988615 987314 gene locus_tag LOCUS_09750 988615 987314 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_09750 990089 988764 gene locus_tag LOCUS_09760 gene trmFO 990089 988764 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791925.1 protein_id gnl|my_center|LOCUS_09760 990168 991136 gene locus_tag LOCUS_09770 990168 991136 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034325.1 protein_id gnl|my_center|LOCUS_09770 991143 992090 gene locus_tag LOCUS_09780 991143 992090 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_09780 992278 992841 gene locus_tag LOCUS_09790 992278 992841 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792111.1 protein_id gnl|my_center|LOCUS_09790 992869 993483 gene locus_tag LOCUS_09800 992869 993483 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528636.1 protein_id gnl|my_center|LOCUS_09800 993677 994369 gene locus_tag LOCUS_09810 gene cbiQ 993677 994369 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938356.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09810 994366 995079 gene locus_tag LOCUS_09820 994366 995079 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938355.1 protein_id gnl|my_center|LOCUS_09820 995202 996593 gene locus_tag LOCUS_09830 995202 996593 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939825.1 protein_id gnl|my_center|LOCUS_09830 996598 997482 gene locus_tag LOCUS_09840 996598 997482 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939824.1 protein_id gnl|my_center|LOCUS_09840 997637 998413 gene locus_tag LOCUS_09850 997637 998413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 998437 999792 gene locus_tag LOCUS_09860 998437 999792 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937466.1 protein_id gnl|my_center|LOCUS_09860 999783 1001900 gene locus_tag LOCUS_09870 999783 1001900 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937467.1 protein_id gnl|my_center|LOCUS_09870 1001924 1002883 gene locus_tag LOCUS_09880 gene thiL 1001924 1002883 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937468.1 protein_id gnl|my_center|LOCUS_09880 1002892 1003305 gene locus_tag LOCUS_09890 gene tsaA 1002892 1003305 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229491.1 protein_id gnl|my_center|LOCUS_09890 1003305 1004171 gene locus_tag LOCUS_09900 1003305 1004171 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244040.1 protein_id gnl|my_center|LOCUS_09900 1004834 1004262 gene locus_tag LOCUS_09910 1004834 1004262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1006025 1005033 gene locus_tag LOCUS_09920 gene ilvC 1006025 1005033 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_09920 1006644 1006153 gene locus_tag LOCUS_09930 gene ilvN 1006644 1006153 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938672.1 protein_id gnl|my_center|LOCUS_09930 1008346 1006655 gene locus_tag LOCUS_09940 gene ilvB 1008346 1006655 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938671.1 protein_id gnl|my_center|LOCUS_09940 1008578 1008348 gene locus_tag LOCUS_09950 1008578 1008348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938670.1 protein_id gnl|my_center|LOCUS_09950 1008893 1008600 gene locus_tag LOCUS_09960 1008893 1008600 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938669.1 protein_id gnl|my_center|LOCUS_09960 1009429 1008926 gene locus_tag LOCUS_09970 1009429 1008926 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938668.1 protein_id gnl|my_center|LOCUS_09970 1009757 1009440 gene locus_tag LOCUS_09980 1009757 1009440 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938667.1 protein_id gnl|my_center|LOCUS_09980 1010514 1009834 gene locus_tag LOCUS_09990 1010514 1009834 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938666.1 protein_id gnl|my_center|LOCUS_09990 1011332 1010541 gene locus_tag LOCUS_10000 1011332 1010541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1011733 1011347 gene locus_tag LOCUS_10010 1011733 1011347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792423.1 protein_id gnl|my_center|LOCUS_10010 1011951 1012142 gene locus_tag LOCUS_10020 1011951 1012142 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938662.1 protein_id gnl|my_center|LOCUS_10020 1012796 1012221 gene locus_tag LOCUS_10030 1012796 1012221 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_10030 1013703 1012807 gene locus_tag LOCUS_10040 1013703 1012807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1014629 1013709 gene locus_tag LOCUS_10050 1014629 1013709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1014792 1015277 gene locus_tag LOCUS_10060 gene sixA 1014792 1015277 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_10060 1016219 1015284 gene locus_tag LOCUS_10070 gene miaA 1016219 1015284 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938825.1 protein_id gnl|my_center|LOCUS_10070 1016735 1016226 gene locus_tag LOCUS_10080 gene coaD 1016735 1016226 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938824.1 protein_id gnl|my_center|LOCUS_10080 1017286 1016723 gene locus_tag LOCUS_10090 gene rsmD 1017286 1016723 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938823.1 protein_id gnl|my_center|LOCUS_10090 1018903 1017296 gene locus_tag LOCUS_10100 1018903 1017296 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_10100 1019098 1019754 gene locus_tag LOCUS_10110 1019098 1019754 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938821.1 protein_id gnl|my_center|LOCUS_10110 1019761 1020657 gene locus_tag LOCUS_10120 1019761 1020657 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940333.1 protein_id gnl|my_center|LOCUS_10120 1020654 1020824 gene locus_tag LOCUS_10130 1020654 1020824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1021239 1020994 gene locus_tag LOCUS_10140 1021239 1020994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938911.1 protein_id gnl|my_center|LOCUS_10140 1022773 1021244 gene locus_tag LOCUS_10150 gene gpmI 1022773 1021244 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938910.1 protein_id gnl|my_center|LOCUS_10150 1023164 1022793 gene locus_tag LOCUS_10160 gene rsfS 1023164 1022793 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938909.1 protein_id gnl|my_center|LOCUS_10160 1023769 1023185 gene locus_tag LOCUS_10170 1023769 1023185 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_10170 1024609 1023851 gene locus_tag LOCUS_10180 1024609 1023851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1024868 1026172 gene locus_tag LOCUS_10190 1024868 1026172 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938906.1 protein_id gnl|my_center|LOCUS_10190 1026212 1026643 gene locus_tag LOCUS_10200 1026212 1026643 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938903.1 protein_id gnl|my_center|LOCUS_10200 1026766 1028217 gene locus_tag LOCUS_10210 1026766 1028217 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356999.1 protein_id gnl|my_center|LOCUS_10210 1028232 1028585 gene locus_tag LOCUS_10220 1028232 1028585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1029951 1028593 gene locus_tag LOCUS_10230 1029951 1028593 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051563.1 protein_id gnl|my_center|LOCUS_10230 1030842 1030063 gene locus_tag LOCUS_10240 gene dapB 1030842 1030063 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938900.1 protein_id gnl|my_center|LOCUS_10240 1032589 1030871 gene locus_tag LOCUS_10250 1032589 1030871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10250 1032899 1032531 gene locus_tag LOCUS_10260 1032899 1032531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10260 1033951 1032917 gene locus_tag LOCUS_10270 1033951 1032917 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792329.1 protein_id gnl|my_center|LOCUS_10270 1035952 1033955 gene locus_tag LOCUS_10280 gene uvrB 1035952 1033955 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938896.1 protein_id gnl|my_center|LOCUS_10280 1036040 1036516 gene locus_tag LOCUS_10290 1036040 1036516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792331.1 protein_id gnl|my_center|LOCUS_10290 1037288 1036542 gene locus_tag LOCUS_10300 gene aat 1037288 1036542 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_10300 1039615 1037300 gene locus_tag LOCUS_10310 gene clpA 1039615 1037300 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938893.1 protein_id gnl|my_center|LOCUS_10310 1039937 1039623 gene locus_tag LOCUS_10320 1039937 1039623 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938892.1 protein_id gnl|my_center|LOCUS_10320 1040617 1040021 gene locus_tag LOCUS_10330 1040617 1040021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1040664 1041041 gene locus_tag LOCUS_10340 gene crcB 1040664 1041041 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938890.1 protein_id gnl|my_center|LOCUS_10340 1041066 1041410 gene locus_tag LOCUS_10350 1041066 1041410 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_10350 1042555 1041488 gene locus_tag LOCUS_10360 1042555 1041488 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_10360 1044797 1042587 gene locus_tag LOCUS_10370 1044797 1042587 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941945.1 protein_id gnl|my_center|LOCUS_10370 1046860 1044947 gene locus_tag LOCUS_10380 1046860 1044947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1047817 1047284 gene locus_tag LOCUS_10390 1047817 1047284 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939086.1 protein_id gnl|my_center|LOCUS_10390 1049836 1047821 gene locus_tag LOCUS_10400 gene fusA 1049836 1047821 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939087.1 protein_id gnl|my_center|LOCUS_10400 1050756 1049875 gene locus_tag LOCUS_10410 1050756 1049875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1051494 1050793 gene locus_tag LOCUS_10420 1051494 1050793 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792195.1 protein_id gnl|my_center|LOCUS_10420 1052361 1051531 gene locus_tag LOCUS_10430 1052361 1051531 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939124.1 protein_id gnl|my_center|LOCUS_10430 1052775 1052455 gene locus_tag LOCUS_10440 gene trxA 1052775 1052455 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939125.1 protein_id gnl|my_center|LOCUS_10440 1054011 1052923 gene locus_tag LOCUS_10450 gene tsaD 1054011 1052923 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939126.1 protein_id gnl|my_center|LOCUS_10450 1055045 1054011 gene locus_tag LOCUS_10460 gene fbp 1055045 1054011 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939127.1 protein_id gnl|my_center|LOCUS_10460 1055804 1055094 gene locus_tag LOCUS_10470 1055804 1055094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1056773 1055964 gene locus_tag LOCUS_10480 1056773 1055964 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939129.1 protein_id gnl|my_center|LOCUS_10480 1057083 1056766 gene locus_tag LOCUS_10490 1057083 1056766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1057393 1057088 gene locus_tag LOCUS_10500 1057393 1057088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1057974 1057390 gene locus_tag LOCUS_10510 gene pgsA 1057974 1057390 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939132.1 protein_id gnl|my_center|LOCUS_10510 1058871 1057987 gene locus_tag LOCUS_10520 1058871 1057987 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939133.1 protein_id gnl|my_center|LOCUS_10520 1059864 1058917 gene locus_tag LOCUS_10530 1059864 1058917 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071604.1 protein_id gnl|my_center|LOCUS_10530 1060198 1059914 gene locus_tag LOCUS_10540 1060198 1059914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10540 1060553 1060158 gene locus_tag LOCUS_10550 1060553 1060158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10550 1060728 1061159 gene locus_tag LOCUS_10560 1060728 1061159 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939136.1 protein_id gnl|my_center|LOCUS_10560 1061416 1062747 gene locus_tag LOCUS_10570 1061416 1062747 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_10570 1062931 1063518 gene locus_tag LOCUS_10580 1062931 1063518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765473.1 protein_id gnl|my_center|LOCUS_10580 1064071 1064544 gene locus_tag LOCUS_10590 1064071 1064544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1064550 1065701 gene locus_tag LOCUS_10600 1064550 1065701 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940058.1 protein_id gnl|my_center|LOCUS_10600 1065731 1066702 gene locus_tag LOCUS_10610 1065731 1066702 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940059.1 protein_id gnl|my_center|LOCUS_10610 1066705 1067274 gene locus_tag LOCUS_10620 1066705 1067274 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940060.1 protein_id gnl|my_center|LOCUS_10620 1067284 1067961 gene locus_tag LOCUS_10630 1067284 1067961 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940061.1 protein_id gnl|my_center|LOCUS_10630 1067977 1068552 gene locus_tag LOCUS_10640 1067977 1068552 CDS product RnfABCDGE type electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940062.1 protein_id gnl|my_center|LOCUS_10640 1068575 1070689 gene locus_tag LOCUS_10650 1068575 1070689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1071180 1070773 gene locus_tag LOCUS_10660 1071180 1070773 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090036.1 protein_id gnl|my_center|LOCUS_10660 1072228 1071281 gene locus_tag LOCUS_10670 1072228 1071281 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227377.1 protein_id gnl|my_center|LOCUS_10670 1072349 1073047 gene locus_tag LOCUS_10680 gene mtnN 1072349 1073047 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217037.1 protein_id gnl|my_center|LOCUS_10680 1073059 1073538 gene locus_tag LOCUS_10690 1073059 1073538 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_10690 1073731 1074789 gene locus_tag LOCUS_10700 1073731 1074789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1074969 1074894 gene locus_tag LOCUS_t00280 1074969 1074894 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1075183 1075950 gene locus_tag LOCUS_10710 1075183 1075950 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625959.1 protein_id gnl|my_center|LOCUS_10710 1075953 1076738 gene locus_tag LOCUS_10720 1075953 1076738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940302.1 protein_id gnl|my_center|LOCUS_10720 1076854 1078584 gene locus_tag LOCUS_10730 1076854 1078584 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940347.1 protein_id gnl|my_center|LOCUS_10730 1078692 1079846 gene locus_tag LOCUS_10740 1078692 1079846 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486144.1 protein_id gnl|my_center|LOCUS_10740 1079848 1080318 gene locus_tag LOCUS_10750 1079848 1080318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1081888 1080377 gene locus_tag LOCUS_10760 gene glpK 1081888 1080377 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_10760 1082829 1081972 gene locus_tag LOCUS_10770 1082829 1081972 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939675.1 protein_id gnl|my_center|LOCUS_10770 1083956 1082826 gene locus_tag LOCUS_10780 1083956 1082826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1084462 1083929 gene locus_tag LOCUS_10790 1084462 1083929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1085803 1084529 gene locus_tag LOCUS_10800 gene glpB 1085803 1084529 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939225.1 protein_id gnl|my_center|LOCUS_10800 1087383 1085800 gene locus_tag LOCUS_10810 gene glpA 1087383 1085800 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939226.1 protein_id gnl|my_center|LOCUS_10810 1087700 1088539 gene locus_tag LOCUS_10820 1087700 1088539 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189076.1 protein_id gnl|my_center|LOCUS_10820 1088681 1089760 gene locus_tag LOCUS_10830 1088681 1089760 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740065.1 protein_id gnl|my_center|LOCUS_10830 1089796 1090893 gene locus_tag LOCUS_10840 1089796 1090893 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104697.1 protein_id gnl|my_center|LOCUS_10840 1090886 1091758 gene locus_tag LOCUS_10850 1090886 1091758 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810946.1 protein_id gnl|my_center|LOCUS_10850 1091755 1092558 gene locus_tag LOCUS_10860 1091755 1092558 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067119.1 protein_id gnl|my_center|LOCUS_10860 1092571 1092849 gene locus_tag LOCUS_10870 1092571 1092849 CDS product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376264.1 protein_id gnl|my_center|LOCUS_10870 1092929 1094677 gene locus_tag LOCUS_10880 1092929 1094677 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148771775.1 protein_id gnl|my_center|LOCUS_10880 1096043 1094736 gene locus_tag LOCUS_10890 1096043 1094736 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392962.1 protein_id gnl|my_center|LOCUS_10890 1096274 1096429 gene locus_tag LOCUS_10900 1096274 1096429 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933679.1 protein_id gnl|my_center|LOCUS_10900 1096527 1097372 gene locus_tag LOCUS_10910 1096527 1097372 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379078.1 protein_id gnl|my_center|LOCUS_10910 1097460 1097882 gene locus_tag LOCUS_10920 1097460 1097882 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939250.1 protein_id gnl|my_center|LOCUS_10920 1099107 1097896 gene locus_tag LOCUS_10930 1099107 1097896 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938186.1 protein_id gnl|my_center|LOCUS_10930 1100200 1099118 gene locus_tag LOCUS_10940 1100200 1099118 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524330.1 protein_id gnl|my_center|LOCUS_10940 1101785 1100223 gene locus_tag LOCUS_10950 1101785 1100223 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937984.1 protein_id gnl|my_center|LOCUS_10950 1102084 1102944 gene locus_tag LOCUS_10960 1102084 1102944 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938265.1 protein_id gnl|my_center|LOCUS_10960 1103045 1104034 gene locus_tag LOCUS_10970 1103045 1104034 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938266.1 protein_id gnl|my_center|LOCUS_10970 1104031 1104762 gene locus_tag LOCUS_10980 1104031 1104762 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409382.1 protein_id gnl|my_center|LOCUS_10980 1105707 1104844 gene locus_tag LOCUS_10990 1105707 1104844 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228552.1 protein_id gnl|my_center|LOCUS_10990 1105914 1105711 gene locus_tag LOCUS_11000 1105914 1105711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1106607 1105936 gene locus_tag LOCUS_11010 1106607 1105936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1107060 1107302 gene locus_tag LOCUS_11020 1107060 1107302 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939842.1 protein_id gnl|my_center|LOCUS_11020 1107362 1109548 gene locus_tag LOCUS_11030 gene feoB 1107362 1109548 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939841.1 protein_id gnl|my_center|LOCUS_11030 1109658 1110623 gene locus_tag LOCUS_11040 1109658 1110623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938657.1 protein_id gnl|my_center|LOCUS_11040 1110647 1111030 gene locus_tag LOCUS_11050 1110647 1111030 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174212.1 protein_id gnl|my_center|LOCUS_11050 1111174 1111809 gene locus_tag LOCUS_11060 1111174 1111809 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938666.1 protein_id gnl|my_center|LOCUS_11060 1112049 1112840 gene locus_tag LOCUS_11070 1112049 1112840 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937767.1 protein_id gnl|my_center|LOCUS_11070 1113523 1113218 gene locus_tag LOCUS_11080 1113523 1113218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1113665 1114837 gene locus_tag LOCUS_11090 gene mltC 1113665 1114837 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490305.1 protein_id gnl|my_center|LOCUS_11090 1114851 1115753 gene locus_tag LOCUS_11100 1114851 1115753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1116167 1115811 gene locus_tag LOCUS_11110 1116167 1115811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1116775 1116170 gene locus_tag LOCUS_11120 1116775 1116170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937717.1 protein_id gnl|my_center|LOCUS_11120 1118407 1116857 gene locus_tag LOCUS_11130 1118407 1116857 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937718.1 protein_id gnl|my_center|LOCUS_11130 1119547 1118471 gene locus_tag LOCUS_11140 1119547 1118471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1119720 1119989 gene locus_tag LOCUS_11150 1119720 1119989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1119991 1121562 gene locus_tag LOCUS_11160 gene actP 1119991 1121562 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546484.1 protein_id gnl|my_center|LOCUS_11160 1121758 1122099 gene locus_tag LOCUS_11170 1121758 1122099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1122170 1124716 gene locus_tag LOCUS_11180 1122170 1124716 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938725.1 protein_id gnl|my_center|LOCUS_11180 1125109 1124795 gene locus_tag LOCUS_11190 1125109 1124795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1125423 1127060 gene locus_tag LOCUS_11200 1125423 1127060 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937480.1 protein_id gnl|my_center|LOCUS_11200 1127344 1128321 gene locus_tag LOCUS_11210 1127344 1128321 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937479.1 protein_id gnl|my_center|LOCUS_11210 1128322 1129239 gene locus_tag LOCUS_11220 1128322 1129239 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937478.1 protein_id gnl|my_center|LOCUS_11220 1129243 1130205 gene locus_tag LOCUS_11230 1129243 1130205 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937477.1 protein_id gnl|my_center|LOCUS_11230 1130217 1131236 gene locus_tag LOCUS_11240 1130217 1131236 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937476.1 protein_id gnl|my_center|LOCUS_11240 1131292 1131507 gene locus_tag LOCUS_11250 1131292 1131507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1131870 1131529 gene locus_tag LOCUS_11260 1131870 1131529 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937898.1 protein_id gnl|my_center|LOCUS_11260 1132243 1131872 gene locus_tag LOCUS_11270 1132243 1131872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1132857 1132462 gene locus_tag LOCUS_11280 1132857 1132462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1134651 1132942 gene locus_tag LOCUS_11290 1134651 1132942 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940470.1 protein_id gnl|my_center|LOCUS_11290 1135863 1134685 gene locus_tag LOCUS_11300 1135863 1134685 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707233.1 protein_id gnl|my_center|LOCUS_11300 1136385 1136044 gene locus_tag LOCUS_11310 1136385 1136044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938073.1 protein_id gnl|my_center|LOCUS_11310 1136858 1136691 gene locus_tag LOCUS_11320 1136858 1136691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1137251 1136952 gene locus_tag LOCUS_11330 1137251 1136952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11330 1137505 1137212 gene locus_tag LOCUS_11340 1137505 1137212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11340 1138344 1137505 gene locus_tag LOCUS_11350 1138344 1137505 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940522.1 protein_id gnl|my_center|LOCUS_11350 1138811 1141489 gene locus_tag LOCUS_11360 1138811 1141489 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_11360 1141716 1142192 gene locus_tag LOCUS_11370 1141716 1142192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1143515 1142193 gene locus_tag LOCUS_11380 gene deoA 1143515 1142193 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188257.1 protein_id gnl|my_center|LOCUS_11380 1143945 1143517 gene locus_tag LOCUS_11390 1143945 1143517 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130469.1 protein_id gnl|my_center|LOCUS_11390 1146538 1144082 gene locus_tag LOCUS_11400 gene lon 1146538 1144082 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938632.1 protein_id gnl|my_center|LOCUS_11400 1147909 1146656 gene locus_tag LOCUS_11410 gene clpX 1147909 1146656 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938631.1 protein_id gnl|my_center|LOCUS_11410 1148520 1147912 gene locus_tag LOCUS_11420 gene clpP 1148520 1147912 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938630.1 protein_id gnl|my_center|LOCUS_11420 1150296 1148794 gene locus_tag LOCUS_11430 gene tig 1150296 1148794 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938629.1 protein_id gnl|my_center|LOCUS_11430 1150436 1150352 gene locus_tag LOCUS_t00290 1150436 1150352 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1150911 1150510 gene locus_tag LOCUS_11440 1150911 1150510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1151893 1150967 gene locus_tag LOCUS_11450 gene thiD 1151893 1150967 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938230.1 protein_id gnl|my_center|LOCUS_11450 1152432 1152004 gene locus_tag LOCUS_11460 1152432 1152004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939597.1 protein_id gnl|my_center|LOCUS_11460 1153115 1152552 gene locus_tag LOCUS_11470 1153115 1152552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1154188 1153730 gene locus_tag LOCUS_11480 1154188 1153730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1154570 1154962 gene locus_tag LOCUS_11490 1154570 1154962 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939797.1 protein_id gnl|my_center|LOCUS_11490 1155322 1155615 gene locus_tag LOCUS_11500 1155322 1155615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11500 1156182 1156415 gene locus_tag LOCUS_11510 1156182 1156415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1157212 1156910 gene locus_tag LOCUS_11520 1157212 1156910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11520 1158138 1158030 gene locus_tag LOCUS_r00010 1158138 1158030 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1161124 1158190 gene locus_tag LOCUS_r00020 1161124 1158190 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1161279 1161204 gene locus_tag LOCUS_t00300 1161279 1161204 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1161368 1161292 gene locus_tag LOCUS_t00310 1161368 1161292 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1162989 1161435 gene locus_tag LOCUS_r00030 1162989 1161435 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1163845 1164747 gene locus_tag LOCUS_11530 1163845 1164747 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396530.1 protein_id gnl|my_center|LOCUS_11530 1166158 1164791 gene locus_tag LOCUS_11540 gene asnS 1166158 1164791 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_11540 1166388 1167809 gene locus_tag LOCUS_11550 gene ftsY 1166388 1167809 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940318.1 protein_id gnl|my_center|LOCUS_11550 1167821 1169302 gene locus_tag LOCUS_11560 1167821 1169302 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938762.1 protein_id gnl|my_center|LOCUS_11560 1170208 1169396 gene locus_tag LOCUS_11570 1170208 1169396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1170360 1171346 gene locus_tag LOCUS_11580 gene ala 1170360 1171346 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_11580 1171347 1172249 gene locus_tag LOCUS_11590 1171347 1172249 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228840.1 protein_id gnl|my_center|LOCUS_11590 1172246 1175419 gene locus_tag LOCUS_11600 1172246 1175419 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939340.1 protein_id gnl|my_center|LOCUS_11600 1175419 1178307 gene locus_tag LOCUS_11610 1175419 1178307 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939341.1 protein_id gnl|my_center|LOCUS_11610 1178336 1179529 gene locus_tag LOCUS_11620 gene lhgO 1178336 1179529 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958479.1 protein_id gnl|my_center|LOCUS_11620 1179628 1180845 gene locus_tag LOCUS_11630 1179628 1180845 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939342.1 protein_id gnl|my_center|LOCUS_11630 1180947 1181363 gene locus_tag LOCUS_11640 1180947 1181363 CDS product DUF296 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943617.1 protein_id gnl|my_center|LOCUS_11640 1183610 1181445 gene locus_tag LOCUS_11650 1183610 1181445 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939360.1 protein_id gnl|my_center|LOCUS_11650 1185323 1183725 gene locus_tag LOCUS_11660 1185323 1183725 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_11660 1185557 1188769 gene locus_tag LOCUS_11670 1185557 1188769 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939362.1 protein_id gnl|my_center|LOCUS_11670 1188852 1189637 gene locus_tag LOCUS_11680 1188852 1189637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937941.1 protein_id gnl|my_center|LOCUS_11680 1189871 1190095 gene locus_tag LOCUS_11690 1189871 1190095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1190120 1193137 gene locus_tag LOCUS_11700 gene fdnG 1190120 1193137 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021760008.1 transl_except (pos:1190693..1190695,aa:Sec) note codon on position 192 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_11700 1193148 1193873 gene locus_tag LOCUS_11710 1193148 1193873 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791820.1 protein_id gnl|my_center|LOCUS_11710 1194062 1194604 gene locus_tag LOCUS_11720 1194062 1194604 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940335.1 protein_id gnl|my_center|LOCUS_11720 1194613 1195227 gene locus_tag LOCUS_11730 1194613 1195227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1195457 1195302 gene locus_tag LOCUS_11740 1195457 1195302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1195810 1195547 gene locus_tag LOCUS_11750 1195810 1195547 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_11750 1196782 1196216 gene locus_tag LOCUS_11760 1196782 1196216 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939497.1 protein_id gnl|my_center|LOCUS_11760 1197171 1196827 gene locus_tag LOCUS_11770 1197171 1196827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1197854 1197204 gene locus_tag LOCUS_11780 1197854 1197204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939499.1 protein_id gnl|my_center|LOCUS_11780 1200173 1197906 gene locus_tag LOCUS_11790 1200173 1197906 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939500.1 protein_id gnl|my_center|LOCUS_11790 1201587 1200175 gene locus_tag LOCUS_11800 1201587 1200175 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939501.1 protein_id gnl|my_center|LOCUS_11800 1201974 1201597 gene locus_tag LOCUS_11810 1201974 1201597 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939502.1 protein_id gnl|my_center|LOCUS_11810 1202750 1202007 gene locus_tag LOCUS_11820 1202750 1202007 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939503.1 protein_id gnl|my_center|LOCUS_11820 1203502 1202750 gene locus_tag LOCUS_11830 1203502 1202750 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939504.1 protein_id gnl|my_center|LOCUS_11830 1203704 1204423 gene locus_tag LOCUS_11840 1203704 1204423 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939505.1 protein_id gnl|my_center|LOCUS_11840 1204486 1205130 gene locus_tag LOCUS_11850 1204486 1205130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1206194 1205133 gene locus_tag LOCUS_11860 gene aroC 1206194 1205133 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938193.1 protein_id gnl|my_center|LOCUS_11860 1206856 1206203 gene locus_tag LOCUS_11870 1206856 1206203 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937719.1 protein_id gnl|my_center|LOCUS_11870 1208235 1206874 gene locus_tag LOCUS_11880 1208235 1206874 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937720.1 protein_id gnl|my_center|LOCUS_11880 1208794 1208273 gene locus_tag LOCUS_11890 gene aroL 1208794 1208273 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938191.1 protein_id gnl|my_center|LOCUS_11890 1209639 1208854 gene locus_tag LOCUS_11900 1209639 1208854 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294674.1 protein_id gnl|my_center|LOCUS_11900 1210514 1209636 gene locus_tag LOCUS_11910 1210514 1209636 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948769.1 protein_id gnl|my_center|LOCUS_11910 1211712 1210504 gene locus_tag LOCUS_11920 1211712 1210504 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940045.1 protein_id gnl|my_center|LOCUS_11920 1212668 1211709 gene locus_tag LOCUS_11930 1212668 1211709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937598.1 protein_id gnl|my_center|LOCUS_11930 1213627 1212644 gene locus_tag LOCUS_11940 1213627 1212644 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937599.1 protein_id gnl|my_center|LOCUS_11940 1213719 1213934 gene locus_tag LOCUS_11950 1213719 1213934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1214524 1213940 gene locus_tag LOCUS_11960 1214524 1213940 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937707.1 protein_id gnl|my_center|LOCUS_11960 1216031 1214598 gene locus_tag LOCUS_11970 1216031 1214598 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366800.1 protein_id gnl|my_center|LOCUS_11970 1217693 1216260 gene locus_tag LOCUS_11980 1217693 1216260 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_11980 1219235 1217700 gene locus_tag LOCUS_11990 1219235 1217700 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969262.1 protein_id gnl|my_center|LOCUS_11990 1221051 1219261 gene locus_tag LOCUS_12000 1221051 1219261 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969263.1 protein_id gnl|my_center|LOCUS_12000 1221298 1221041 gene locus_tag LOCUS_12010 1221298 1221041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1222858 1221308 gene locus_tag LOCUS_12020 1222858 1221308 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969265.1 protein_id gnl|my_center|LOCUS_12020 1223169 1222861 gene locus_tag LOCUS_12030 gene nuoK 1223169 1222861 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902440.1 protein_id gnl|my_center|LOCUS_12030 1223675 1223166 gene locus_tag LOCUS_12040 1223675 1223166 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257850.1 protein_id gnl|my_center|LOCUS_12040 1224266 1223679 gene locus_tag LOCUS_12050 gene nuoI 1224266 1223679 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222460.1 protein_id gnl|my_center|LOCUS_12050 1225244 1224276 gene locus_tag LOCUS_12060 gene nuoH 1225244 1224276 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_12060 1226423 1225254 gene locus_tag LOCUS_12070 gene nuoD 1226423 1225254 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_12070 1226990 1226463 gene locus_tag LOCUS_12080 1226990 1226463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1227517 1226993 gene locus_tag LOCUS_12090 1227517 1226993 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392493.1 protein_id gnl|my_center|LOCUS_12090 1227894 1227517 gene locus_tag LOCUS_12100 1227894 1227517 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186624.1 protein_id gnl|my_center|LOCUS_12100 1229424 1228090 gene locus_tag LOCUS_12110 1229424 1228090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1230142 1229450 gene locus_tag LOCUS_12120 1230142 1229450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1230285 1231241 gene locus_tag LOCUS_12130 1230285 1231241 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_12130 1232017 1231250 gene locus_tag LOCUS_12140 1232017 1231250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1233351 1232353 gene locus_tag LOCUS_12150 1233351 1232353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1234538 1233357 gene locus_tag LOCUS_12160 1234538 1233357 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939904.1 protein_id gnl|my_center|LOCUS_12160 1234577 1235500 gene locus_tag LOCUS_12170 1234577 1235500 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_12170 1235644 1236234 gene locus_tag LOCUS_12180 1235644 1236234 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940497.1 protein_id gnl|my_center|LOCUS_12180 1236967 1236257 gene locus_tag LOCUS_12190 1236967 1236257 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939331.1 protein_id gnl|my_center|LOCUS_12190 1237215 1236967 gene locus_tag LOCUS_12200 1237215 1236967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1237939 1237217 gene locus_tag LOCUS_12210 1237939 1237217 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_12210 1238029 1238105 gene locus_tag LOCUS_t00320 1238029 1238105 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1238686 1238159 gene locus_tag LOCUS_12220 1238686 1238159 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389675.1 protein_id gnl|my_center|LOCUS_12220 1238938 1239014 gene locus_tag LOCUS_t00330 1238938 1239014 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1239686 1239078 gene locus_tag LOCUS_12230 1239686 1239078 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706713.1 protein_id gnl|my_center|LOCUS_12230 1241241 1239931 gene locus_tag LOCUS_12240 gene thiC 1241241 1239931 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047970.1 protein_id gnl|my_center|LOCUS_12240 1241896 1241249 gene locus_tag LOCUS_12250 gene thiE 1241896 1241249 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939368.1 protein_id gnl|my_center|LOCUS_12250 1242522 1241893 gene locus_tag LOCUS_12260 gene thiF 1242522 1241893 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939369.1 protein_id gnl|my_center|LOCUS_12260 1243559 1242519 gene locus_tag LOCUS_12270 gene thiH 1243559 1242519 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393166.1 protein_id gnl|my_center|LOCUS_12270 1244412 1243453 gene locus_tag LOCUS_12280 1244412 1243453 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939371.1 protein_id gnl|my_center|LOCUS_12280 1244628 1244428 gene locus_tag LOCUS_12290 gene thiS 1244628 1244428 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393164.1 protein_id gnl|my_center|LOCUS_12290 1245084 1245521 gene locus_tag LOCUS_12300 1245084 1245521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1246862 1245603 gene locus_tag LOCUS_12310 1246862 1245603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1247385 1246876 gene locus_tag LOCUS_12320 1247385 1246876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1249819 1247456 gene locus_tag LOCUS_12330 gene priA 1249819 1247456 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938580.1 protein_id gnl|my_center|LOCUS_12330 1250581 1249826 gene locus_tag LOCUS_12340 1250581 1249826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1251441 1250569 gene locus_tag LOCUS_12350 gene galU 1251441 1250569 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792462.1 protein_id gnl|my_center|LOCUS_12350 1252815 1251463 gene locus_tag LOCUS_12360 gene glmM 1252815 1251463 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938578.1 protein_id gnl|my_center|LOCUS_12360 1253749 1252841 gene locus_tag LOCUS_12370 1253749 1252841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1254501 1253752 gene locus_tag LOCUS_12380 gene cdaA 1254501 1253752 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938576.1 protein_id gnl|my_center|LOCUS_12380 1255336 1254515 gene locus_tag LOCUS_12390 gene folP 1255336 1254515 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938575.1 protein_id gnl|my_center|LOCUS_12390 1257404 1255398 gene locus_tag LOCUS_12400 gene ftsH 1257404 1255398 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938574.1 protein_id gnl|my_center|LOCUS_12400 1257716 1257492 gene locus_tag LOCUS_12410 1257716 1257492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1257761 1257964 gene locus_tag LOCUS_12420 1257761 1257964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1259247 1257859 gene locus_tag LOCUS_12430 gene argH 1259247 1257859 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938393.1 protein_id gnl|my_center|LOCUS_12430 1260485 1259253 gene locus_tag LOCUS_12440 1260485 1259253 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938394.1 protein_id gnl|my_center|LOCUS_12440 1261417 1260515 gene locus_tag LOCUS_12450 gene argF 1261417 1260515 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938395.1 protein_id gnl|my_center|LOCUS_12450 1263264 1261687 gene locus_tag LOCUS_12460 1263264 1261687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1263713 1263279 gene locus_tag LOCUS_12470 gene ybeY 1263713 1263279 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939169.1 protein_id gnl|my_center|LOCUS_12470 1264703 1263717 gene locus_tag LOCUS_12480 1264703 1263717 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_12480 1265461 1264703 gene locus_tag LOCUS_12490 1265461 1264703 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811476.1 protein_id gnl|my_center|LOCUS_12490 1266195 1265458 gene locus_tag LOCUS_12500 1266195 1265458 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877601.1 protein_id gnl|my_center|LOCUS_12500 1267131 1266199 gene locus_tag LOCUS_12510 1267131 1266199 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877602.1 protein_id gnl|my_center|LOCUS_12510 1268314 1267244 gene locus_tag LOCUS_12520 1268314 1267244 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_12520 1268729 1268382 gene locus_tag LOCUS_12530 1268729 1268382 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940054.1 protein_id gnl|my_center|LOCUS_12530 1269336 1268818 gene locus_tag LOCUS_12540 gene tpx 1269336 1268818 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938524.1 protein_id gnl|my_center|LOCUS_12540 1270514 1269426 gene locus_tag LOCUS_12550 1270514 1269426 CDS product lpg1639 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947366.1 protein_id gnl|my_center|LOCUS_12550 1273457 1270575 gene locus_tag LOCUS_12560 1273457 1270575 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938263.1 protein_id gnl|my_center|LOCUS_12560 1273758 1274714 gene locus_tag LOCUS_12570 1273758 1274714 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937367.1 protein_id gnl|my_center|LOCUS_12570 1274711 1275112 gene locus_tag LOCUS_12580 1274711 1275112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1275717 1275208 gene locus_tag LOCUS_12590 1275717 1275208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1277578 1275737 gene locus_tag LOCUS_12600 1277578 1275737 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791940.1 protein_id gnl|my_center|LOCUS_12600 1277876 1277667 gene locus_tag LOCUS_12610 1277876 1277667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1278122 1278511 gene locus_tag LOCUS_12620 1278122 1278511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1278616 1279158 gene locus_tag LOCUS_12630 1278616 1279158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1279182 1279826 gene locus_tag LOCUS_12640 1279182 1279826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1280402 1279911 gene locus_tag LOCUS_12650 1280402 1279911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1281005 1280490 gene locus_tag LOCUS_12660 1281005 1280490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1281197 1281556 gene locus_tag LOCUS_12670 1281197 1281556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1281809 1281733 gene locus_tag LOCUS_t00340 1281809 1281733 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1282007 1282573 gene locus_tag LOCUS_12680 1282007 1282573 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940563.1 protein_id gnl|my_center|LOCUS_12680 1282584 1283261 gene locus_tag LOCUS_12690 1282584 1283261 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940564.1 protein_id gnl|my_center|LOCUS_12690 1285299 1283470 gene locus_tag LOCUS_12700 gene uvrC 1285299 1283470 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_12700 1285524 1286963 gene locus_tag LOCUS_12710 1285524 1286963 CDS product outer membrane homotrimeric porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629791.1 protein_id gnl|my_center|LOCUS_12710 1287397 1288701 gene locus_tag LOCUS_12720 gene hisD 1287397 1288701 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938097.1 protein_id gnl|my_center|LOCUS_12720 1288719 1289615 gene locus_tag LOCUS_12730 1288719 1289615 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938096.1 protein_id gnl|my_center|LOCUS_12730 1289882 1290172 gene locus_tag LOCUS_12740 gene rpsF 1289882 1290172 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938255.1 protein_id gnl|my_center|LOCUS_12740 1290184 1290447 gene locus_tag LOCUS_12750 gene rpsR 1290184 1290447 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938256.1 protein_id gnl|my_center|LOCUS_12750 1290460 1290996 gene locus_tag LOCUS_12760 gene rplI 1290460 1290996 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938257.1 protein_id gnl|my_center|LOCUS_12760 1290965 1292419 gene locus_tag LOCUS_12770 gene dnaB 1290965 1292419 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938258.1 protein_id gnl|my_center|LOCUS_12770 1292444 1293733 gene locus_tag LOCUS_12780 1292444 1293733 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940001.1 protein_id gnl|my_center|LOCUS_12780 1293734 1294231 gene locus_tag LOCUS_12790 1293734 1294231 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940002.1 protein_id gnl|my_center|LOCUS_12790 1294700 1295296 gene locus_tag LOCUS_12800 1294700 1295296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1295557 1295943 gene locus_tag LOCUS_12810 1295557 1295943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1295997 1296638 gene locus_tag LOCUS_12820 1295997 1296638 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096017.1 protein_id gnl|my_center|LOCUS_12820 1296929 1298377 gene locus_tag LOCUS_12830 gene thrC 1296929 1298377 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791440.1 protein_id gnl|my_center|LOCUS_12830 1298394 1299188 gene locus_tag LOCUS_12840 1298394 1299188 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940171.1 protein_id gnl|my_center|LOCUS_12840 1300068 1299286 gene locus_tag LOCUS_12850 1300068 1299286 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939259.1 protein_id gnl|my_center|LOCUS_12850 1300943 1300236 gene locus_tag LOCUS_12860 1300943 1300236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940168.1 protein_id gnl|my_center|LOCUS_12860 1301656 1300940 gene locus_tag LOCUS_12870 1301656 1300940 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940148.1 protein_id gnl|my_center|LOCUS_12870 1302985 1301780 gene locus_tag LOCUS_12880 1302985 1301780 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938556.1 protein_id gnl|my_center|LOCUS_12880 1303252 1303689 gene locus_tag LOCUS_12890 1303252 1303689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1304300 1303686 gene locus_tag LOCUS_12900 1304300 1303686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1305124 1304378 gene locus_tag LOCUS_12910 1305124 1304378 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940035.1 protein_id gnl|my_center|LOCUS_12910 1306230 1305307 gene locus_tag LOCUS_12920 1306230 1305307 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207989.1 protein_id gnl|my_center|LOCUS_12920 1306592 1306501 gene locus_tag LOCUS_t00350 1306592 1306501 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1307591 1306674 gene locus_tag LOCUS_12930 1307591 1306674 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940572.1 protein_id gnl|my_center|LOCUS_12930 1308356 1307604 gene locus_tag LOCUS_12940 1308356 1307604 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940571.1 protein_id gnl|my_center|LOCUS_12940 1308429 1308680 gene locus_tag LOCUS_12950 1308429 1308680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12950 1308677 1310386 gene locus_tag LOCUS_12960 1308677 1310386 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940570.1 protein_id gnl|my_center|LOCUS_12960 1311090 1310746 gene locus_tag LOCUS_12970 1311090 1310746 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125356.1 protein_id gnl|my_center|LOCUS_12970 1311904 1311122 gene locus_tag LOCUS_12980 1311904 1311122 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776815.1 protein_id gnl|my_center|LOCUS_12980 1314252 1311913 gene locus_tag LOCUS_12990 1314252 1311913 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937936.1 protein_id gnl|my_center|LOCUS_12990 1314827 1314264 gene locus_tag LOCUS_13000 1314827 1314264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937937.1 protein_id gnl|my_center|LOCUS_13000 1315861 1314845 gene locus_tag LOCUS_13010 1315861 1314845 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937471.1 protein_id gnl|my_center|LOCUS_13010 1317296 1315875 gene locus_tag LOCUS_13020 gene purF 1317296 1315875 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937472.1 protein_id gnl|my_center|LOCUS_13020 1320555 1317319 gene locus_tag LOCUS_13030 gene carB 1320555 1317319 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937473.1 protein_id gnl|my_center|LOCUS_13030 1321524 1320733 gene locus_tag LOCUS_13040 1321524 1320733 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911722.1 protein_id gnl|my_center|LOCUS_13040 1321723 1322001 gene locus_tag LOCUS_13050 1321723 1322001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1322075 1323031 gene locus_tag LOCUS_13060 1322075 1323031 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_13060 1325081 1323135 gene locus_tag LOCUS_13070 gene metG 1325081 1323135 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_13070 1326227 1325124 gene locus_tag LOCUS_13080 1326227 1325124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1326802 1326407 gene locus_tag LOCUS_13090 1326802 1326407 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938720.1 protein_id gnl|my_center|LOCUS_13090 1327788 1326907 gene locus_tag LOCUS_13100 1327788 1326907 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_13100 1328648 1327788 gene locus_tag LOCUS_13110 1328648 1327788 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_13110 1329314 1328658 gene locus_tag LOCUS_13120 1329314 1328658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1331181 1329340 gene locus_tag LOCUS_13130 1331181 1329340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1332536 1331280 gene locus_tag LOCUS_13140 gene murA 1332536 1331280 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940516.1 protein_id gnl|my_center|LOCUS_13140 1332617 1332692 gene locus_tag LOCUS_t00360 1332617 1332692 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1333360 1332671 gene locus_tag LOCUS_13150 1333360 1332671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1333678 1334139 gene locus_tag LOCUS_13160 1333678 1334139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1336138 1334231 gene locus_tag LOCUS_13170 gene selB 1336138 1334231 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937806.1 protein_id gnl|my_center|LOCUS_13170 1336603 1336178 gene locus_tag LOCUS_13180 1336603 1336178 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 protein_id gnl|my_center|LOCUS_13180 1338039 1336663 gene locus_tag LOCUS_13190 1338039 1336663 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940144.1 protein_id gnl|my_center|LOCUS_13190 1339450 1338050 gene locus_tag LOCUS_13200 gene selA 1339450 1338050 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940143.1 protein_id gnl|my_center|LOCUS_13200 1340685 1339462 gene locus_tag LOCUS_13210 1340685 1339462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1340808 1340884 gene locus_tag LOCUS_t00370 1340808 1340884 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1341668 1341060 gene locus_tag LOCUS_13220 1341668 1341060 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 protein_id gnl|my_center|LOCUS_13220 1341906 1341679 gene locus_tag LOCUS_13230 1341906 1341679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1342258 1343175 gene locus_tag LOCUS_13240 1342258 1343175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1343182 1344561 gene locus_tag LOCUS_13250 1343182 1344561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1345775 1344621 gene locus_tag LOCUS_13260 1345775 1344621 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705381.1 protein_id gnl|my_center|LOCUS_13260 1345971 1347542 gene locus_tag LOCUS_13270 1345971 1347542 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040799.1 protein_id gnl|my_center|LOCUS_13270 1347612 1348586 gene locus_tag LOCUS_13280 1347612 1348586 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762408.1 protein_id gnl|my_center|LOCUS_13280 1348595 1349518 gene locus_tag LOCUS_13290 1348595 1349518 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931685.1 protein_id gnl|my_center|LOCUS_13290 1349515 1350480 gene locus_tag LOCUS_13300 1349515 1350480 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064763.1 protein_id gnl|my_center|LOCUS_13300 1350525 1351526 gene locus_tag LOCUS_13310 1350525 1351526 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816041.1 protein_id gnl|my_center|LOCUS_13310 1351685 1351996 gene locus_tag LOCUS_13320 1351685 1351996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1352915 1353256 gene locus_tag LOCUS_13330 1352915 1353256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1353670 1353320 gene locus_tag LOCUS_13340 1353670 1353320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 1353789 1355579 gene locus_tag LOCUS_13350 1353789 1355579 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942985.1 protein_id gnl|my_center|LOCUS_13350 1355678 1358359 gene locus_tag LOCUS_13360 1355678 1358359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1358337 1359746 gene locus_tag LOCUS_13370 1358337 1359746 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940282.1 protein_id gnl|my_center|LOCUS_13370 1360483 1362162 gene locus_tag LOCUS_13380 1360483 1362162 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939722.1 protein_id gnl|my_center|LOCUS_13380 1363635 1362412 gene locus_tag LOCUS_13390 1363635 1362412 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974049.1 protein_id gnl|my_center|LOCUS_13390 1363743 1364990 gene locus_tag LOCUS_13400 1363743 1364990 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061490.1 protein_id gnl|my_center|LOCUS_13400 1365020 1365916 gene locus_tag LOCUS_13410 1365020 1365916 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396180.1 protein_id gnl|my_center|LOCUS_13410 1365916 1366758 gene locus_tag LOCUS_13420 1365916 1366758 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975587.1 protein_id gnl|my_center|LOCUS_13420 1366767 1367786 gene locus_tag LOCUS_13430 1366767 1367786 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396185.1 protein_id gnl|my_center|LOCUS_13430 1367797 1368744 gene locus_tag LOCUS_13440 1367797 1368744 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396187.1 protein_id gnl|my_center|LOCUS_13440 1368757 1369881 gene locus_tag LOCUS_13450 1368757 1369881 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529698.1 protein_id gnl|my_center|LOCUS_13450 1370049 1371602 gene locus_tag LOCUS_13460 1370049 1371602 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258423.1 protein_id gnl|my_center|LOCUS_13460 1371849 1371550 gene locus_tag LOCUS_13470 1371849 1371550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1372051 1372458 gene locus_tag LOCUS_13480 1372051 1372458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1372455 1372946 gene locus_tag LOCUS_13490 1372455 1372946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13490 1373924 1373019 gene locus_tag LOCUS_13500 1373924 1373019 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926866.1 protein_id gnl|my_center|LOCUS_13500 1374670 1374254 gene locus_tag LOCUS_13510 1374670 1374254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938912.1 protein_id gnl|my_center|LOCUS_13510 1374925 1375224 gene locus_tag LOCUS_13520 1374925 1375224 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357396.1 protein_id gnl|my_center|LOCUS_13520 1376343 1375327 gene locus_tag LOCUS_13530 1376343 1375327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1377171 1376362 gene locus_tag LOCUS_13540 1377171 1376362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1379128 1377269 gene locus_tag LOCUS_13550 1379128 1377269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1381416 1379359 gene locus_tag LOCUS_13560 1381416 1379359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1381697 1385212 gene locus_tag LOCUS_13570 1381697 1385212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1385145 1385510 gene locus_tag LOCUS_13580 1385145 1385510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1385593 1388919 gene locus_tag LOCUS_13590 1385593 1388919 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817313.1 protein_id gnl|my_center|LOCUS_13590 1388891 1390057 gene locus_tag LOCUS_13600 1388891 1390057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1390463 1390104 gene locus_tag LOCUS_13610 1390463 1390104 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296049.1 protein_id gnl|my_center|LOCUS_13610 1390682 1390467 gene locus_tag LOCUS_13620 1390682 1390467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1392550 1390694 gene locus_tag LOCUS_13630 1392550 1390694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1394522 1393683 gene locus_tag LOCUS_13640 1394522 1393683 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940461.1 protein_id gnl|my_center|LOCUS_13640 1395811 1394546 gene locus_tag LOCUS_13650 1395811 1394546 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940462.1 protein_id gnl|my_center|LOCUS_13650 1396292 1395927 gene locus_tag LOCUS_13660 1396292 1395927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940662.1 protein_id gnl|my_center|LOCUS_13660 1398144 1396447 gene locus_tag LOCUS_13670 1398144 1396447 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941068.1 protein_id gnl|my_center|LOCUS_13670 1398398 1399672 gene locus_tag LOCUS_13680 1398398 1399672 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_13680 1399761 1401812 gene locus_tag LOCUS_13690 1399761 1401812 CDS product ribonuclease catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940465.1 protein_id gnl|my_center|LOCUS_13690 1401849 1402904 gene locus_tag LOCUS_13700 1401849 1402904 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938904.1 protein_id gnl|my_center|LOCUS_13700 1402914 1403429 gene locus_tag LOCUS_13710 1402914 1403429 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938905.1 protein_id gnl|my_center|LOCUS_13710 1403511 1404101 gene locus_tag LOCUS_13720 1403511 1404101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1405094 1404198 gene locus_tag LOCUS_13730 1405094 1404198 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113057.1 protein_id gnl|my_center|LOCUS_13730 1405999 1405094 gene locus_tag LOCUS_13740 1405999 1405094 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106903.1 protein_id gnl|my_center|LOCUS_13740 1406725 1406003 gene locus_tag LOCUS_13750 1406725 1406003 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015842.1 protein_id gnl|my_center|LOCUS_13750 1407644 1406718 gene locus_tag LOCUS_13760 1407644 1406718 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113055.1 protein_id gnl|my_center|LOCUS_13760 1408318 1407641 gene locus_tag LOCUS_13770 1408318 1407641 CDS product DUF6162 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089625.1 protein_id gnl|my_center|LOCUS_13770 1408995 1408315 gene locus_tag LOCUS_13780 1408995 1408315 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791502.1 protein_id gnl|my_center|LOCUS_13780 1409919 1409095 gene locus_tag LOCUS_13790 1409919 1409095 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679851.1 protein_id gnl|my_center|LOCUS_13790 1410335 1410018 gene locus_tag LOCUS_13800 1410335 1410018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089624.1 protein_id gnl|my_center|LOCUS_13800 1411432 1410335 gene locus_tag LOCUS_13810 1411432 1410335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13810 1413076 1412852 gene locus_tag LOCUS_13820 1413076 1412852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1413426 1413250 gene locus_tag LOCUS_13830 1413426 1413250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1413655 1414629 gene locus_tag LOCUS_13840 1413655 1414629 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 protein_id gnl|my_center|LOCUS_13840 1416309 1414711 gene locus_tag LOCUS_13850 gene hflX 1416309 1414711 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940494.1 protein_id gnl|my_center|LOCUS_13850 1417008 1416412 gene locus_tag LOCUS_13860 1417008 1416412 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940493.1 protein_id gnl|my_center|LOCUS_13860 1417751 1417188 gene locus_tag LOCUS_13870 1417751 1417188 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937625.1 protein_id gnl|my_center|LOCUS_13870 1418221 1418631 gene locus_tag LOCUS_13880 gene flgB 1418221 1418631 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361361.1 protein_id gnl|my_center|LOCUS_13880 1418632 1419072 gene locus_tag LOCUS_13890 gene flgC 1418632 1419072 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937622.1 protein_id gnl|my_center|LOCUS_13890 1419084 1419422 gene locus_tag LOCUS_13900 gene fliE 1419084 1419422 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937621.1 protein_id gnl|my_center|LOCUS_13900 1419472 1421067 gene locus_tag LOCUS_13910 gene fliF 1419472 1421067 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937620.1 protein_id gnl|my_center|LOCUS_13910 1421072 1422073 gene locus_tag LOCUS_13920 gene fliG 1421072 1422073 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937619.1 protein_id gnl|my_center|LOCUS_13920 1422060 1422809 gene locus_tag LOCUS_13930 1422060 1422809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1422811 1424124 gene locus_tag LOCUS_13940 1422811 1424124 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937617.1 protein_id gnl|my_center|LOCUS_13940 1424543 1424121 gene locus_tag LOCUS_13950 1424543 1424121 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_13950 1424536 1424712 gene locus_tag LOCUS_13960 1424536 1424712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1426971 1424827 gene locus_tag LOCUS_13970 1426971 1424827 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337150.1 protein_id gnl|my_center|LOCUS_13970 1427303 1426995 gene locus_tag LOCUS_13980 1427303 1426995 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546816.1 protein_id gnl|my_center|LOCUS_13980 1428010 1428696 gene locus_tag LOCUS_13990 1428010 1428696 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937607.1 protein_id gnl|my_center|LOCUS_13990 1428644 1430701 gene locus_tag LOCUS_14000 1428644 1430701 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937606.1 protein_id gnl|my_center|LOCUS_14000 1432688 1431135 gene locus_tag LOCUS_14010 1432688 1431135 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_14010 1433574 1432801 gene locus_tag LOCUS_14020 1433574 1432801 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816019.1 protein_id gnl|my_center|LOCUS_14020 1433798 1434940 gene locus_tag LOCUS_14030 gene alr 1433798 1434940 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_14030 1435107 1436120 gene locus_tag LOCUS_14040 gene dctP 1435107 1436120 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113812.1 protein_id gnl|my_center|LOCUS_14040 1436123 1436638 gene locus_tag LOCUS_14050 1436123 1436638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1436635 1437918 gene locus_tag LOCUS_14060 1436635 1437918 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113810.1 protein_id gnl|my_center|LOCUS_14060 1437973 1438776 gene locus_tag LOCUS_14070 1437973 1438776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1438985 1440355 gene locus_tag LOCUS_14080 1438985 1440355 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462282.1 protein_id gnl|my_center|LOCUS_14080 1440777 1441700 gene locus_tag LOCUS_14090 1440777 1441700 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938246.1 protein_id gnl|my_center|LOCUS_14090 1441865 1442368 gene locus_tag LOCUS_14100 1441865 1442368 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163300480.1 protein_id gnl|my_center|LOCUS_14100 1442361 1444736 gene locus_tag LOCUS_14110 1442361 1444736 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041277820.1 protein_id gnl|my_center|LOCUS_14110 1444736 1445719 gene locus_tag LOCUS_14120 1444736 1445719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1445736 1446365 gene locus_tag LOCUS_14130 1445736 1446365 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256910.1 protein_id gnl|my_center|LOCUS_14130 1446362 1447177 gene locus_tag LOCUS_14140 gene yqeB 1446362 1447177 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459388.1 protein_id gnl|my_center|LOCUS_14140 1447174 1448007 gene locus_tag LOCUS_14150 1447174 1448007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1448024 1449607 gene locus_tag LOCUS_14160 1448024 1449607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1449636 1450661 gene locus_tag LOCUS_14170 1449636 1450661 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938852.1 protein_id gnl|my_center|LOCUS_14170 1451137 1452414 gene locus_tag LOCUS_14180 1451137 1452414 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791665.1 protein_id gnl|my_center|LOCUS_14180 1452768 1453400 gene locus_tag LOCUS_14190 1452768 1453400 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940068.1 protein_id gnl|my_center|LOCUS_14190 1453424 1453672 gene locus_tag LOCUS_14200 1453424 1453672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1453708 1455111 gene locus_tag LOCUS_14210 1453708 1455111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940069.1 protein_id gnl|my_center|LOCUS_14210 1455136 1456305 gene locus_tag LOCUS_14220 1455136 1456305 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940070.1 protein_id gnl|my_center|LOCUS_14220 1456368 1458191 gene locus_tag LOCUS_14230 1456368 1458191 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940071.1 protein_id gnl|my_center|LOCUS_14230 1458188 1458796 gene locus_tag LOCUS_14240 1458188 1458796 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940072.1 protein_id gnl|my_center|LOCUS_14240 1458793 1459233 gene locus_tag LOCUS_14250 1458793 1459233 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791660.1 protein_id gnl|my_center|LOCUS_14250 1459230 1459757 gene locus_tag LOCUS_14260 1459230 1459757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1460839 1459847 gene locus_tag LOCUS_14270 1460839 1459847 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227902.1 protein_id gnl|my_center|LOCUS_14270 1461490 1460852 gene locus_tag LOCUS_14280 1461490 1460852 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814882.1 protein_id gnl|my_center|LOCUS_14280 1462419 1461544 gene locus_tag LOCUS_14290 1462419 1461544 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461090.1 protein_id gnl|my_center|LOCUS_14290 1463042 1462422 gene locus_tag LOCUS_14300 gene dmsB 1463042 1462422 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213028.1 protein_id gnl|my_center|LOCUS_14300 1465494 1463056 gene locus_tag LOCUS_14310 gene dmsA 1465494 1463056 CDS product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850287.1 protein_id gnl|my_center|LOCUS_14310 1467110 1465701 gene locus_tag LOCUS_14320 1467110 1465701 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941505.1 protein_id gnl|my_center|LOCUS_14320 1469755 1467170 gene locus_tag LOCUS_14330 1469755 1467170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1471449 1469776 gene locus_tag LOCUS_14340 1471449 1469776 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937486.1 protein_id gnl|my_center|LOCUS_14340 1473305 1471788 gene locus_tag LOCUS_14350 1473305 1471788 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939555.1 protein_id gnl|my_center|LOCUS_14350 1474151 1474705 gene locus_tag LOCUS_14360 1474151 1474705 CDS product DUF4125 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939552.1 protein_id gnl|my_center|LOCUS_14360 1474731 1475465 gene locus_tag LOCUS_14370 1474731 1475465 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791965.1 protein_id gnl|my_center|LOCUS_14370 1477011 1475509 gene locus_tag LOCUS_14380 1477011 1475509 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791966.1 protein_id gnl|my_center|LOCUS_14380 1477318 1479756 gene locus_tag LOCUS_14390 1477318 1479756 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939547.1 protein_id gnl|my_center|LOCUS_14390 1479863 1480756 gene locus_tag LOCUS_14400 1479863 1480756 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939546.1 protein_id gnl|my_center|LOCUS_14400 1480766 1480897 gene locus_tag LOCUS_14410 1480766 1480897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14410 1480910 1481077 gene locus_tag LOCUS_14420 1480910 1481077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524492.1 protein_id gnl|my_center|LOCUS_14420 1481905 1481174 gene locus_tag LOCUS_14430 1481905 1481174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1482599 1482159 gene locus_tag LOCUS_14440 1482599 1482159 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939949.1 protein_id gnl|my_center|LOCUS_14440 1483562 1482711 gene locus_tag LOCUS_14450 1483562 1482711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 1483966 1484268 gene locus_tag LOCUS_14460 1483966 1484268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1484382 1484289 gene locus_tag LOCUS_t00380 1484382 1484289 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1485949 1484465 gene locus_tag LOCUS_14470 gene der 1485949 1484465 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016201.1 protein_id gnl|my_center|LOCUS_14470 1487147 1486104 gene locus_tag LOCUS_14480 gene mtnA 1487147 1486104 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937395.1 protein_id gnl|my_center|LOCUS_14480 1488745 1487312 gene locus_tag LOCUS_14490 gene gatB 1488745 1487312 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939171.1 protein_id gnl|my_center|LOCUS_14490 1489430 1488786 gene locus_tag LOCUS_14500 1489430 1488786 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939172.1 protein_id gnl|my_center|LOCUS_14500 1490610 1489423 gene locus_tag LOCUS_14510 1490610 1489423 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938186.1 protein_id gnl|my_center|LOCUS_14510 1490515 1490784 gene locus_tag LOCUS_14520 1490515 1490784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1492598 1490841 gene locus_tag LOCUS_14530 1492598 1490841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939173.1 protein_id gnl|my_center|LOCUS_14530 1493451 1492600 gene locus_tag LOCUS_14540 1493451 1492600 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939174.1 protein_id gnl|my_center|LOCUS_14540 1493614 1494027 gene locus_tag LOCUS_14550 1493614 1494027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937830.1 protein_id gnl|my_center|LOCUS_14550 1494057 1494377 gene locus_tag LOCUS_14560 1494057 1494377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1494821 1494402 gene locus_tag LOCUS_14570 gene fliW 1494821 1494402 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937828.1 protein_id gnl|my_center|LOCUS_14570 1495063 1494821 gene locus_tag LOCUS_14580 gene csrA 1495063 1494821 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937827.1 protein_id gnl|my_center|LOCUS_14580 1496837 1495164 gene locus_tag LOCUS_14590 gene flgL 1496837 1495164 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937826.1 protein_id gnl|my_center|LOCUS_14590 1498997 1496853 gene locus_tag LOCUS_14600 gene flgK 1498997 1496853 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937825.1 protein_id gnl|my_center|LOCUS_14600 1499477 1498998 gene locus_tag LOCUS_14610 1499477 1498998 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937824.1 protein_id gnl|my_center|LOCUS_14610 1500267 1499554 gene locus_tag LOCUS_14620 1500267 1499554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1501405 1500269 gene locus_tag LOCUS_14630 1501405 1500269 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937822.1 protein_id gnl|my_center|LOCUS_14630 1502140 1501448 gene locus_tag LOCUS_14640 1502140 1501448 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937821.1 protein_id gnl|my_center|LOCUS_14640 1503111 1502158 gene locus_tag LOCUS_14650 gene flgA 1503111 1502158 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294608.1 protein_id gnl|my_center|LOCUS_14650 1503969 1503187 gene locus_tag LOCUS_14660 gene flgG 1503969 1503187 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937819.1 protein_id gnl|my_center|LOCUS_14660 1504763 1503987 gene locus_tag LOCUS_14670 gene flgF 1504763 1503987 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937818.1 protein_id gnl|my_center|LOCUS_14670 1504906 1504981 gene locus_tag LOCUS_t00390 1504906 1504981 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1505084 1505545 gene locus_tag LOCUS_14680 gene rimP 1505084 1505545 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937817.1 protein_id gnl|my_center|LOCUS_14680 1505605 1506912 gene locus_tag LOCUS_14690 gene nusA 1505605 1506912 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937816.1 protein_id gnl|my_center|LOCUS_14690 1506931 1507182 gene locus_tag LOCUS_14700 1506931 1507182 CDS product DUF448 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937815.1 protein_id gnl|my_center|LOCUS_14700 1507179 1510127 gene locus_tag LOCUS_14710 1507179 1510127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1510190 1510495 gene locus_tag LOCUS_14720 1510190 1510495 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937813.1 protein_id gnl|my_center|LOCUS_14720 1510507 1510845 gene locus_tag LOCUS_14730 1510507 1510845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1510820 1511791 gene locus_tag LOCUS_14740 1510820 1511791 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937812.1 protein_id gnl|my_center|LOCUS_14740 1511791 1512738 gene locus_tag LOCUS_14750 gene truB 1511791 1512738 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792851.1 protein_id gnl|my_center|LOCUS_14750 1512794 1513063 gene locus_tag LOCUS_14760 gene rpsO 1512794 1513063 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409373.1 protein_id gnl|my_center|LOCUS_14760 1513281 1515503 gene locus_tag LOCUS_14770 gene pnp 1513281 1515503 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937809.1 protein_id gnl|my_center|LOCUS_14770 1515630 1515836 gene locus_tag LOCUS_14780 1515630 1515836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1516873 1516259 gene locus_tag LOCUS_14790 gene catB 1516873 1516259 CDS product type B chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939278.1 protein_id gnl|my_center|LOCUS_14790 1517887 1517093 gene locus_tag LOCUS_14800 1517887 1517093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1521281 1517910 gene locus_tag LOCUS_14810 1521281 1517910 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791630.1 protein_id gnl|my_center|LOCUS_14810 1522367 1521339 gene locus_tag LOCUS_14820 1522367 1521339 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940154.1 protein_id gnl|my_center|LOCUS_14820 1524051 1522651 gene locus_tag LOCUS_14830 1524051 1522651 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937940.1 protein_id gnl|my_center|LOCUS_14830 1524486 1524157 gene locus_tag LOCUS_14840 1524486 1524157 CDS product flagellar basal body rod C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940153.1 protein_id gnl|my_center|LOCUS_14840 1525411 1524635 gene locus_tag LOCUS_14850 gene folE2 1525411 1524635 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629168.1 protein_id gnl|my_center|LOCUS_14850 1525882 1525463 gene locus_tag LOCUS_14860 gene nikR 1525882 1525463 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940151.1 protein_id gnl|my_center|LOCUS_14860 1526555 1525929 gene locus_tag LOCUS_14870 1526555 1525929 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294676.1 protein_id gnl|my_center|LOCUS_14870 1526949 1527329 gene locus_tag LOCUS_14880 gene gcvH 1526949 1527329 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938719.1 protein_id gnl|my_center|LOCUS_14880 1527499 1528833 gene locus_tag LOCUS_14890 gene gcvPA 1527499 1528833 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938718.1 protein_id gnl|my_center|LOCUS_14890 1528830 1530272 gene locus_tag LOCUS_14900 gene gcvPB 1528830 1530272 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938717.1 protein_id gnl|my_center|LOCUS_14900 1530262 1531608 gene locus_tag LOCUS_14910 1530262 1531608 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938716.1 protein_id gnl|my_center|LOCUS_14910 1531605 1532153 gene locus_tag LOCUS_14920 1531605 1532153 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939932.1 protein_id gnl|my_center|LOCUS_14920 1532235 1533626 gene locus_tag LOCUS_14930 1532235 1533626 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772424.1 protein_id gnl|my_center|LOCUS_14930 1533853 1535367 gene locus_tag LOCUS_14940 1533853 1535367 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 protein_id gnl|my_center|LOCUS_14940 1537202 1535439 gene locus_tag LOCUS_14950 1537202 1535439 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227541.1 protein_id gnl|my_center|LOCUS_14950 1537584 1537333 gene locus_tag LOCUS_14960 1537584 1537333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1537523 1538041 gene locus_tag LOCUS_14970 1537523 1538041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938473.1 protein_id gnl|my_center|LOCUS_14970 1538045 1539364 gene locus_tag LOCUS_14980 1538045 1539364 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359871.1 protein_id gnl|my_center|LOCUS_14980 1539910 1539443 gene locus_tag LOCUS_14990 1539910 1539443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1540462 1539998 gene locus_tag LOCUS_15000 1540462 1539998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1542219 1540570 gene locus_tag LOCUS_15010 1542219 1540570 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938175.1 protein_id gnl|my_center|LOCUS_15010 1542951 1542220 gene locus_tag LOCUS_15020 1542951 1542220 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_15020 1545499 1543100 gene locus_tag LOCUS_15030 gene pheT 1545499 1543100 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939803.1 protein_id gnl|my_center|LOCUS_15030 1546627 1545578 gene locus_tag LOCUS_15040 gene pheS 1546627 1545578 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939804.1 protein_id gnl|my_center|LOCUS_15040 1546983 1546630 gene locus_tag LOCUS_15050 gene rplT 1546983 1546630 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939805.1 protein_id gnl|my_center|LOCUS_15050 1547272 1547075 gene locus_tag LOCUS_15060 gene rpmI 1547272 1547075 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939806.1 protein_id gnl|my_center|LOCUS_15060 1547772 1547314 gene locus_tag LOCUS_15070 gene infC 1547772 1547314 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939807.1 protein_id gnl|my_center|LOCUS_15070 1549792 1547855 gene locus_tag LOCUS_15080 gene thrS 1549792 1547855 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939808.1 protein_id gnl|my_center|LOCUS_15080 1549950 1549876 gene locus_tag LOCUS_t00400 1549950 1549876 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1551870 1550161 gene locus_tag LOCUS_15090 gene recJ 1551870 1550161 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938203.1 protein_id gnl|my_center|LOCUS_15090 1553045 1552185 gene locus_tag LOCUS_15100 1553045 1552185 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938202.1 protein_id gnl|my_center|LOCUS_15100 1553915 1553100 gene locus_tag LOCUS_15110 1553915 1553100 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938201.1 protein_id gnl|my_center|LOCUS_15110 1554628 1553927 gene locus_tag LOCUS_15120 gene pyrF 1554628 1553927 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938200.1 protein_id gnl|my_center|LOCUS_15120 1555265 1554621 gene locus_tag LOCUS_15130 gene gmk 1555265 1554621 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938199.1 protein_id gnl|my_center|LOCUS_15130 1555531 1555265 gene locus_tag LOCUS_15140 1555531 1555265 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938198.1 protein_id gnl|my_center|LOCUS_15140 1556471 1555590 gene locus_tag LOCUS_15150 1556471 1555590 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938197.1 protein_id gnl|my_center|LOCUS_15150 1557011 1556475 gene locus_tag LOCUS_15160 1557011 1556475 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544933.1 protein_id gnl|my_center|LOCUS_15160 1558309 1557008 gene locus_tag LOCUS_15170 1558309 1557008 CDS product MiaB/RimO family radical SAM methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938196.1 protein_id gnl|my_center|LOCUS_15170 1558368 1558871 gene locus_tag LOCUS_15180 1558368 1558871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1558926 1559447 gene locus_tag LOCUS_15190 1558926 1559447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1560612 1559581 gene locus_tag LOCUS_15200 gene mnmA 1560612 1559581 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938108.1 protein_id gnl|my_center|LOCUS_15200 1560759 1562546 gene locus_tag LOCUS_15210 1560759 1562546 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023304.1 protein_id gnl|my_center|LOCUS_15210 1564627 1564415 gene locus_tag LOCUS_15220 1564627 1564415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1566391 1564934 gene locus_tag LOCUS_15230 gene gatA 1566391 1564934 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938109.1 protein_id gnl|my_center|LOCUS_15230 1566697 1566413 gene locus_tag LOCUS_15240 gene gatC 1566697 1566413 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938110.1 protein_id gnl|my_center|LOCUS_15240 1568770 1566725 gene locus_tag LOCUS_15250 1568770 1566725 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524277.1 protein_id gnl|my_center|LOCUS_15250 1570783 1568873 gene locus_tag LOCUS_15260 gene dnaK 1570783 1568873 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938112.1 protein_id gnl|my_center|LOCUS_15260 1571519 1570893 gene locus_tag LOCUS_15270 1571519 1570893 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938113.1 protein_id gnl|my_center|LOCUS_15270 1572888 1571683 gene locus_tag LOCUS_15280 1572888 1571683 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938060.1 protein_id gnl|my_center|LOCUS_15280 1573066 1573977 gene locus_tag LOCUS_15290 1573066 1573977 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_15290 1574863 1573997 gene locus_tag LOCUS_15300 1574863 1573997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1577601 1575004 gene locus_tag LOCUS_15310 gene clpB 1577601 1575004 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939160.1 protein_id gnl|my_center|LOCUS_15310 1578088 1577753 gene locus_tag LOCUS_15320 1578088 1577753 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939161.1 protein_id gnl|my_center|LOCUS_15320 1579065 1578097 gene locus_tag LOCUS_15330 1579065 1578097 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_15330 1579212 1579769 gene locus_tag LOCUS_15340 1579212 1579769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1580028 1579777 gene locus_tag LOCUS_15350 1580028 1579777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1580027 1580470 gene locus_tag LOCUS_15360 1580027 1580470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1580505 1581815 gene locus_tag LOCUS_15370 gene apgM2 1580505 1581815 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase ApgM2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869503.1 protein_id gnl|my_center|LOCUS_15370 1581884 1582255 gene locus_tag LOCUS_15380 1581884 1582255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1582218 1582436 gene locus_tag LOCUS_15390 1582218 1582436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1583161 1582430 gene locus_tag LOCUS_15400 1583161 1582430 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938322.1 protein_id gnl|my_center|LOCUS_15400 1584774 1583158 gene locus_tag LOCUS_15410 gene coaE 1584774 1583158 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938323.1 protein_id gnl|my_center|LOCUS_15410 1585012 1585638 gene locus_tag LOCUS_15420 gene upp 1585012 1585638 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938324.1 protein_id gnl|my_center|LOCUS_15420 1585716 1587056 gene locus_tag LOCUS_15430 1585716 1587056 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938325.1 protein_id gnl|my_center|LOCUS_15430 1587805 1587137 gene locus_tag LOCUS_15440 1587805 1587137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1587923 1588684 gene locus_tag LOCUS_15450 1587923 1588684 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938171.1 protein_id gnl|my_center|LOCUS_15450 1591335 1590646 gene locus_tag LOCUS_15460 gene hisA 1591335 1590646 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938337.1 protein_id gnl|my_center|LOCUS_15460 1592024 1591374 gene locus_tag LOCUS_15470 1592024 1591374 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938338.1 protein_id gnl|my_center|LOCUS_15470 1592611 1592024 gene locus_tag LOCUS_15480 gene hisB 1592611 1592024 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938339.1 protein_id gnl|my_center|LOCUS_15480 1593955 1592705 gene locus_tag LOCUS_15490 1593955 1592705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1594299 1593952 gene locus_tag LOCUS_15500 1594299 1593952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1595874 1594327 gene locus_tag LOCUS_15510 gene guaA 1595874 1594327 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938342.1 protein_id gnl|my_center|LOCUS_15510 1597513 1596056 gene locus_tag LOCUS_15520 gene guaB 1597513 1596056 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938343.1 protein_id gnl|my_center|LOCUS_15520 1597855 1597571 gene locus_tag LOCUS_15530 1597855 1597571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15530 1599078 1598281 gene locus_tag LOCUS_15540 1599078 1598281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937856.1 protein_id gnl|my_center|LOCUS_15540 1600354 1599068 gene locus_tag LOCUS_15550 gene livM 1600354 1599068 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937855.1 protein_id gnl|my_center|LOCUS_15550 1601325 1600423 gene locus_tag LOCUS_15560 1601325 1600423 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937854.1 protein_id gnl|my_center|LOCUS_15560 1602561 1601410 gene locus_tag LOCUS_15570 1602561 1601410 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937853.1 protein_id gnl|my_center|LOCUS_15570 1603342 1602749 gene locus_tag LOCUS_15580 1603342 1602749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1603478 1603335 gene locus_tag LOCUS_15590 1603478 1603335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1604205 1603540 gene locus_tag LOCUS_15600 gene ccsA 1604205 1603540 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_15600 1604894 1604217 gene locus_tag LOCUS_15610 1604894 1604217 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938347.1 protein_id gnl|my_center|LOCUS_15610 1605559 1604888 gene locus_tag LOCUS_15620 1605559 1604888 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938348.1 protein_id gnl|my_center|LOCUS_15620 1607453 1605552 gene locus_tag LOCUS_15630 1607453 1605552 CDS product cytochrome c-type biogenesis CcmF C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938349.1 protein_id gnl|my_center|LOCUS_15630 1608001 1607570 gene locus_tag LOCUS_15640 1608001 1607570 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938350.1 protein_id gnl|my_center|LOCUS_15640 1609087 1608035 gene locus_tag LOCUS_15650 1609087 1608035 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792562.1 protein_id gnl|my_center|LOCUS_15650 1609253 1610233 gene locus_tag LOCUS_15660 1609253 1610233 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939242.1 protein_id gnl|my_center|LOCUS_15660 1612430 1611171 gene locus_tag LOCUS_15670 1612430 1611171 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939239.1 protein_id gnl|my_center|LOCUS_15670 1612788 1613438 gene locus_tag LOCUS_15680 1612788 1613438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1613463 1615304 gene locus_tag LOCUS_15690 gene iorA 1613463 1615304 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939237.1 protein_id gnl|my_center|LOCUS_15690 1615305 1615904 gene locus_tag LOCUS_15700 1615305 1615904 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939236.1 protein_id gnl|my_center|LOCUS_15700 1615911 1617491 gene locus_tag LOCUS_15710 1615911 1617491 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939235.1 protein_id gnl|my_center|LOCUS_15710 1617607 1618269 gene locus_tag LOCUS_15720 gene nadD 1617607 1618269 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939240.1 protein_id gnl|my_center|LOCUS_15720 1618367 1620094 gene locus_tag LOCUS_15730 1618367 1620094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1620314 1622506 gene locus_tag LOCUS_15740 1620314 1622506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1622779 1624566 gene locus_tag LOCUS_15750 1622779 1624566 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975718.1 protein_id gnl|my_center|LOCUS_15750 1624570 1625916 gene locus_tag LOCUS_15760 1624570 1625916 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099712.1 protein_id gnl|my_center|LOCUS_15760 1626111 1626230 gene locus_tag LOCUS_15770 1626111 1626230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1626246 1626893 gene locus_tag LOCUS_15780 1626246 1626893 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940519.1 protein_id gnl|my_center|LOCUS_15780 1626907 1628787 gene locus_tag LOCUS_15790 1626907 1628787 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940520.1 protein_id gnl|my_center|LOCUS_15790 1628813 1629553 gene locus_tag LOCUS_15800 1628813 1629553 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940521.1 protein_id gnl|my_center|LOCUS_15800 1629555 1630394 gene locus_tag LOCUS_15810 1629555 1630394 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940522.1 protein_id gnl|my_center|LOCUS_15810 1630394 1630951 gene locus_tag LOCUS_15820 1630394 1630951 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940523.1 protein_id gnl|my_center|LOCUS_15820 1630978 1632297 gene locus_tag LOCUS_15830 1630978 1632297 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937721.1 protein_id gnl|my_center|LOCUS_15830 1632488 1633954 gene locus_tag LOCUS_15840 1632488 1633954 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_15840 1634055 1634819 gene locus_tag LOCUS_15850 1634055 1634819 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294645.1 protein_id gnl|my_center|LOCUS_15850 1634826 1635935 gene locus_tag LOCUS_15860 1634826 1635935 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940058.1 protein_id gnl|my_center|LOCUS_15860 1635938 1636888 gene locus_tag LOCUS_15870 1635938 1636888 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940059.1 protein_id gnl|my_center|LOCUS_15870 1636892 1637467 gene locus_tag LOCUS_15880 1636892 1637467 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940060.1 protein_id gnl|my_center|LOCUS_15880 1637505 1638182 gene locus_tag LOCUS_15890 1637505 1638182 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940061.1 protein_id gnl|my_center|LOCUS_15890 1638201 1638776 gene locus_tag LOCUS_15900 1638201 1638776 CDS product RnfABCDGE type electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940062.1 protein_id gnl|my_center|LOCUS_15900 1638802 1640898 gene locus_tag LOCUS_15910 1638802 1640898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1641029 1643149 gene locus_tag LOCUS_15920 gene pta 1641029 1643149 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_15920 1643150 1644358 gene locus_tag LOCUS_15930 1643150 1644358 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940289.1 protein_id gnl|my_center|LOCUS_15930 1644414 1647914 gene locus_tag LOCUS_15940 gene nifJ 1644414 1647914 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940284.1 protein_id gnl|my_center|LOCUS_15940 1648170 1649843 gene locus_tag LOCUS_15950 1648170 1649843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1650212 1649925 gene locus_tag LOCUS_15960 1650212 1649925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1652956 1650674 gene locus_tag LOCUS_15970 1652956 1650674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1653096 1654859 gene locus_tag LOCUS_15980 1653096 1654859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1655014 1656153 gene locus_tag LOCUS_15990 gene msrB 1655014 1656153 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825088.1 protein_id gnl|my_center|LOCUS_15990 1656238 1656363 gene locus_tag LOCUS_16000 1656238 1656363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1656429 1657868 gene locus_tag LOCUS_16010 1656429 1657868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1658401 1657859 gene locus_tag LOCUS_16020 1658401 1657859 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391311.1 protein_id gnl|my_center|LOCUS_16020 1659421 1658402 gene locus_tag LOCUS_16030 1659421 1658402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 1659962 1659498 gene locus_tag LOCUS_16040 1659962 1659498 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939520.1 protein_id gnl|my_center|LOCUS_16040 1661784 1660288 gene locus_tag LOCUS_16050 1661784 1660288 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939946.1 protein_id gnl|my_center|LOCUS_16050 1662561 1661956 gene locus_tag LOCUS_16060 1662561 1661956 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938551.1 protein_id gnl|my_center|LOCUS_16060 1663398 1662808 gene locus_tag LOCUS_16070 1663398 1662808 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939628.1 protein_id gnl|my_center|LOCUS_16070 1663541 1663936 gene locus_tag LOCUS_16080 1663541 1663936 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_16080 1663949 1664674 gene locus_tag LOCUS_16090 1663949 1664674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1664684 1666402 gene locus_tag LOCUS_16100 1664684 1666402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1666777 1667757 gene locus_tag LOCUS_16110 1666777 1667757 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932081.1 protein_id gnl|my_center|LOCUS_16110 1667768 1668802 gene locus_tag LOCUS_16120 1667768 1668802 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_16120 1668795 1669586 gene locus_tag LOCUS_16130 1668795 1669586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1669586 1670491 gene locus_tag LOCUS_16140 1669586 1670491 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868809.1 protein_id gnl|my_center|LOCUS_16140 1670555 1671265 gene locus_tag LOCUS_16150 gene cobI 1670555 1671265 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937949.1 protein_id gnl|my_center|LOCUS_16150 1671262 1672056 gene locus_tag LOCUS_16160 1671262 1672056 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938660.1 protein_id gnl|my_center|LOCUS_16160 1672618 1672067 gene locus_tag LOCUS_16170 1672618 1672067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1672845 1673501 gene locus_tag LOCUS_16180 1672845 1673501 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 protein_id gnl|my_center|LOCUS_16180 1673851 1673498 gene locus_tag LOCUS_16190 1673851 1673498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1673986 1675527 gene locus_tag LOCUS_16200 1673986 1675527 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792640.1 protein_id gnl|my_center|LOCUS_16200 1675517 1676644 gene locus_tag LOCUS_16210 1675517 1676644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1676647 1677309 gene locus_tag LOCUS_16220 gene lipB 1676647 1677309 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938205.1 protein_id gnl|my_center|LOCUS_16220 1677266 1678105 gene locus_tag LOCUS_16230 gene lipA 1677266 1678105 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938204.1 protein_id gnl|my_center|LOCUS_16230 1679041 1678187 gene locus_tag LOCUS_16240 1679041 1678187 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088659.1 protein_id gnl|my_center|LOCUS_16240 1681027 1682163 gene locus_tag LOCUS_16250 gene lpxB 1681027 1682163 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938656.1 protein_id gnl|my_center|LOCUS_16250 1682186 1683901 gene locus_tag LOCUS_16260 1682186 1683901 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939625.1 protein_id gnl|my_center|LOCUS_16260 1683951 1684274 gene locus_tag LOCUS_16270 1683951 1684274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792721.1 protein_id gnl|my_center|LOCUS_16270 1684613 1684383 gene locus_tag LOCUS_16280 1684613 1684383 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546429.1 protein_id gnl|my_center|LOCUS_16280 1684886 1684662 gene locus_tag LOCUS_16290 gene infA 1684886 1684662 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937325.1 protein_id gnl|my_center|LOCUS_16290 1686491 1685007 gene locus_tag LOCUS_16300 1686491 1685007 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479935.1 protein_id gnl|my_center|LOCUS_16300 1686576 1687499 gene locus_tag LOCUS_16310 1686576 1687499 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294642.1 protein_id gnl|my_center|LOCUS_16310 1687549 1689867 gene locus_tag LOCUS_16320 gene hypF 1687549 1689867 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629133.1 protein_id gnl|my_center|LOCUS_16320 1692236 1691097 gene locus_tag LOCUS_16330 1692236 1691097 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_16330 1692528 1696055 gene locus_tag LOCUS_16340 1692528 1696055 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940330.1 protein_id gnl|my_center|LOCUS_16340 1697352 1696213 gene locus_tag LOCUS_16350 1697352 1696213 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020683.1 protein_id gnl|my_center|LOCUS_16350 1697713 1697459 gene locus_tag LOCUS_16360 1697713 1697459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16360 1697892 1697710 gene locus_tag LOCUS_16370 1697892 1697710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16370 1698961 1697972 gene locus_tag LOCUS_16380 gene trpS 1698961 1697972 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937453.1 protein_id gnl|my_center|LOCUS_16380 1699605 1698982 gene locus_tag LOCUS_16390 1699605 1698982 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_16390 1700501 1699719 gene locus_tag LOCUS_16400 1700501 1699719 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704580.1 protein_id gnl|my_center|LOCUS_16400 1700964 1700593 gene locus_tag LOCUS_16410 1700964 1700593 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937449.1 protein_id gnl|my_center|LOCUS_16410 1701194 1701391 gene locus_tag LOCUS_16420 1701194 1701391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937447.1 protein_id gnl|my_center|LOCUS_16420 1701403 1702332 gene locus_tag LOCUS_16430 1701403 1702332 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937446.1 protein_id gnl|my_center|LOCUS_16430 1702340 1703359 gene locus_tag LOCUS_16440 1702340 1703359 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937445.1 protein_id gnl|my_center|LOCUS_16440 1704419 1703526 gene locus_tag LOCUS_16450 1704419 1703526 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937570.1 protein_id gnl|my_center|LOCUS_16450 1705477 1705169 gene locus_tag LOCUS_16460 1705477 1705169 CDS product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791814.1 protein_id gnl|my_center|LOCUS_16460 1705605 1706222 gene locus_tag LOCUS_16470 1705605 1706222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1706261 1707346 gene locus_tag LOCUS_16480 1706261 1707346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1707435 1707848 gene locus_tag LOCUS_16490 gene ruvX 1707435 1707848 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940329.1 protein_id gnl|my_center|LOCUS_16490 1707824 1708891 gene locus_tag LOCUS_16500 1707824 1708891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1708969 1709991 gene locus_tag LOCUS_16510 1708969 1709991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1710856 1709969 gene locus_tag LOCUS_16520 1710856 1709969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1714167 1710997 gene locus_tag LOCUS_16530 1714167 1710997 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_16530 1715247 1714177 gene locus_tag LOCUS_16540 1715247 1714177 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 protein_id gnl|my_center|LOCUS_16540 1715766 1715251 gene locus_tag LOCUS_16550 1715766 1715251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940815.1 protein_id gnl|my_center|LOCUS_16550 1716238 1715771 gene locus_tag LOCUS_16560 1716238 1715771 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461673.1 protein_id gnl|my_center|LOCUS_16560 1716334 1718622 gene locus_tag LOCUS_16570 1716334 1718622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16570 1718541 1719431 gene locus_tag LOCUS_16580 1718541 1719431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16580 1719618 1719475 gene locus_tag LOCUS_16590 1719618 1719475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524242.1 protein_id gnl|my_center|LOCUS_16590 1719790 1720518 gene locus_tag LOCUS_16600 gene cbiR 1719790 1720518 CDS product cobamide remodeling phosphodiesterase CbiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294611.1 protein_id gnl|my_center|LOCUS_16600 1720515 1721024 gene locus_tag LOCUS_16610 gene cobU 1720515 1721024 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316292.1 protein_id gnl|my_center|LOCUS_16610 1721028 1722023 gene locus_tag LOCUS_16620 1721028 1722023 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937763.1 protein_id gnl|my_center|LOCUS_16620 1722236 1724887 gene locus_tag LOCUS_16630 gene polA 1722236 1724887 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011526185.1 protein_id gnl|my_center|LOCUS_16630 1725329 1726960 gene locus_tag LOCUS_16640 1725329 1726960 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941450.1 protein_id gnl|my_center|LOCUS_16640 1726989 1727999 gene locus_tag LOCUS_16650 gene hydE 1726989 1727999 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_16650 1727996 1728763 gene locus_tag LOCUS_16660 1727996 1728763 CDS product nitrogenase iron protein NifH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948411.1 protein_id gnl|my_center|LOCUS_16660 1728784 1730088 gene locus_tag LOCUS_16670 1728784 1730088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1730098 1731300 gene locus_tag LOCUS_16680 1730098 1731300 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272909.1 protein_id gnl|my_center|LOCUS_16680 1731322 1731570 gene locus_tag LOCUS_16690 1731322 1731570 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939210.1 protein_id gnl|my_center|LOCUS_16690 1732085 1731648 gene locus_tag LOCUS_16700 1732085 1731648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1732276 1732563 gene locus_tag LOCUS_16710 1732276 1732563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1732578 1733633 gene locus_tag LOCUS_16720 gene argC 1732578 1733633 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937798.1 protein_id gnl|my_center|LOCUS_16720 1734913 1733717 gene locus_tag LOCUS_16730 gene cls 1734913 1733717 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340260.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16730 1735259 1735438 gene locus_tag LOCUS_16740 1735259 1735438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1736387 1735359 gene locus_tag LOCUS_16750 1736387 1735359 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938297.1 protein_id gnl|my_center|LOCUS_16750 1737004 1736639 gene locus_tag LOCUS_16760 1737004 1736639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1737276 1737022 gene locus_tag LOCUS_16770 1737276 1737022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1737690 1737277 gene locus_tag LOCUS_16780 gene nifU 1737690 1737277 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_16780 1738089 1737712 gene locus_tag LOCUS_16790 1738089 1737712 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388948.1 protein_id gnl|my_center|LOCUS_16790 1739010 1738117 gene locus_tag LOCUS_16800 1739010 1738117 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_16800 1739860 1739003 gene locus_tag LOCUS_16810 1739860 1739003 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_16810 1740584 1739871 gene locus_tag LOCUS_16820 1740584 1739871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1741142 1740714 gene locus_tag LOCUS_16830 1741142 1740714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1741509 1741135 gene locus_tag LOCUS_16840 1741509 1741135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1742887 1741745 gene locus_tag LOCUS_16850 1742887 1741745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1742956 1743903 gene locus_tag LOCUS_16860 1742956 1743903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1744715 1743906 gene locus_tag LOCUS_16870 1744715 1743906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1744874 1745107 gene locus_tag LOCUS_16880 1744874 1745107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1745083 1745649 gene locus_tag LOCUS_16890 1745083 1745649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1745814 1745650 gene locus_tag LOCUS_16900 1745814 1745650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1745780 1746013 gene locus_tag LOCUS_16910 1745780 1746013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1746153 1747694 gene locus_tag LOCUS_16920 1746153 1747694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939734.1 protein_id gnl|my_center|LOCUS_16920 1748886 1748005 gene locus_tag LOCUS_16930 gene purU 1748886 1748005 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228594.1 protein_id gnl|my_center|LOCUS_16930 1749076 1749696 gene locus_tag LOCUS_16940 1749076 1749696 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939175.1 protein_id gnl|my_center|LOCUS_16940 1749711 1750124 gene locus_tag LOCUS_16950 1749711 1750124 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_16950 1751237 1750131 gene locus_tag LOCUS_16960 1751237 1750131 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_16960 1751319 1752320 gene locus_tag LOCUS_16970 1751319 1752320 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942309.1 protein_id gnl|my_center|LOCUS_16970 1752432 1753211 gene locus_tag LOCUS_16980 1752432 1753211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876244.1 protein_id gnl|my_center|LOCUS_16980 1753212 1754021 gene locus_tag LOCUS_16990 1753212 1754021 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938636.1 protein_id gnl|my_center|LOCUS_16990 1754451 1754026 gene locus_tag LOCUS_17000 1754451 1754026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1754595 1754975 gene locus_tag LOCUS_17010 1754595 1754975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1755482 1755051 gene locus_tag LOCUS_17020 1755482 1755051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1756073 1755618 gene locus_tag LOCUS_17030 1756073 1755618 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407731.1 protein_id gnl|my_center|LOCUS_17030 1756943 1756212 gene locus_tag LOCUS_17040 gene cobB1 1756943 1756212 CDS product NAD-dependent protein deacylase Cob1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879172.1 protein_id gnl|my_center|LOCUS_17040 1757094 1758233 gene locus_tag LOCUS_17050 gene icd 1757094 1758233 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937784.1 protein_id gnl|my_center|LOCUS_17050 1759816 1758419 gene locus_tag LOCUS_17060 1759816 1758419 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938245.1 protein_id gnl|my_center|LOCUS_17060 1762221 1759813 gene locus_tag LOCUS_17070 1762221 1759813 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937846.1 protein_id gnl|my_center|LOCUS_17070 1762469 1764109 gene locus_tag LOCUS_17080 1762469 1764109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 1764120 1764299 gene locus_tag LOCUS_17090 1764120 1764299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1764365 1764811 gene locus_tag LOCUS_17100 1764365 1764811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1764887 1765417 gene locus_tag LOCUS_17110 1764887 1765417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1765419 1765733 gene locus_tag LOCUS_17120 1765419 1765733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1766022 1766510 gene locus_tag LOCUS_17130 1766022 1766510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1766862 1766605 gene locus_tag LOCUS_17140 1766862 1766605 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939210.1 protein_id gnl|my_center|LOCUS_17140 1767385 1766840 gene locus_tag LOCUS_17150 1767385 1766840 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939209.1 protein_id gnl|my_center|LOCUS_17150 1769175 1767457 gene locus_tag LOCUS_17160 1769175 1767457 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939208.1 protein_id gnl|my_center|LOCUS_17160 1770224 1769244 gene locus_tag LOCUS_17170 1770224 1769244 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939207.1 protein_id gnl|my_center|LOCUS_17170 1770601 1771365 gene locus_tag LOCUS_17180 1770601 1771365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1772399 1771473 gene locus_tag LOCUS_17190 1772399 1771473 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937492.1 protein_id gnl|my_center|LOCUS_17190 1772538 1772846 gene locus_tag LOCUS_17200 1772538 1772846 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938514.1 protein_id gnl|my_center|LOCUS_17200 1772926 1773579 gene locus_tag LOCUS_17210 1772926 1773579 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228681.1 protein_id gnl|my_center|LOCUS_17210 1774765 1774019 gene locus_tag LOCUS_17220 1774765 1774019 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792531.1 protein_id gnl|my_center|LOCUS_17220 1775478 1774825 gene locus_tag LOCUS_17230 1775478 1774825 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939415.1 protein_id gnl|my_center|LOCUS_17230 1775932 1776258 gene locus_tag LOCUS_17240 1775932 1776258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1776470 1778155 gene locus_tag LOCUS_17250 gene yidC 1776470 1778155 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938376.1 protein_id gnl|my_center|LOCUS_17250 1778210 1779241 gene locus_tag LOCUS_17260 1778210 1779241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1779330 1780721 gene locus_tag LOCUS_17270 gene mnmE 1779330 1780721 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938378.1 protein_id gnl|my_center|LOCUS_17270 1780724 1780990 gene locus_tag LOCUS_17280 1780724 1780990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1781774 1783072 gene locus_tag LOCUS_17290 1781774 1783072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17290 1783772 1783176 gene locus_tag LOCUS_17300 gene bioD 1783772 1783176 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257883.1 protein_id gnl|my_center|LOCUS_17300 1785100 1783772 gene locus_tag LOCUS_17310 1785100 1783772 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106128.1 protein_id gnl|my_center|LOCUS_17310 1785198 1786283 gene locus_tag LOCUS_17320 gene bioF 1785198 1786283 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_17320 1786280 1786879 gene locus_tag LOCUS_17330 1786280 1786879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1786872 1787630 gene locus_tag LOCUS_17340 1786872 1787630 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545994.1 protein_id gnl|my_center|LOCUS_17340 1788231 1787905 gene locus_tag LOCUS_17350 1788231 1787905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1789070 1788486 gene locus_tag LOCUS_17360 1789070 1788486 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_17360 1790240 1789212 gene locus_tag LOCUS_17370 1790240 1789212 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939164.1 protein_id gnl|my_center|LOCUS_17370 1790892 1790314 gene locus_tag LOCUS_17380 1790892 1790314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1791347 1790901 gene locus_tag LOCUS_17390 1791347 1790901 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767342.1 protein_id gnl|my_center|LOCUS_17390 1791397 1792140 gene locus_tag LOCUS_17400 1791397 1792140 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939178.1 protein_id gnl|my_center|LOCUS_17400 1792137 1792802 gene locus_tag LOCUS_17410 1792137 1792802 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792164.1 protein_id gnl|my_center|LOCUS_17410 1792871 1794217 gene locus_tag LOCUS_17420 gene nhaA 1792871 1794217 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_17420 1794254 1794631 gene locus_tag LOCUS_17430 1794254 1794631 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073568.1 protein_id gnl|my_center|LOCUS_17430 1796369 1794723 gene locus_tag LOCUS_17440 gene groL 1796369 1794723 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939262.1 protein_id gnl|my_center|LOCUS_17440 1796709 1796422 gene locus_tag LOCUS_17450 gene groES 1796709 1796422 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939263.1 protein_id gnl|my_center|LOCUS_17450 1797353 1796919 gene locus_tag LOCUS_17460 1797353 1796919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1797795 1799327 gene locus_tag LOCUS_17470 1797795 1799327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1799324 1800058 gene locus_tag LOCUS_17480 1799324 1800058 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_17480 1800507 1800055 gene locus_tag LOCUS_17490 1800507 1800055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1800634 1800963 gene locus_tag LOCUS_17500 1800634 1800963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 1802500 1801577 gene locus_tag LOCUS_17510 1802500 1801577 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940569.1 protein_id gnl|my_center|LOCUS_17510 1802629 1802814 gene locus_tag LOCUS_17520 1802629 1802814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1803683 1802823 gene locus_tag LOCUS_17530 1803683 1802823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1804543 1803779 gene locus_tag LOCUS_17540 1804543 1803779 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_17540 1804576 1805826 gene locus_tag LOCUS_17550 1804576 1805826 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_17550 1805857 1806387 gene locus_tag LOCUS_17560 1805857 1806387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1806481 1806984 gene locus_tag LOCUS_17570 1806481 1806984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1807004 1807507 gene locus_tag LOCUS_17580 1807004 1807507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1807552 1809204 gene locus_tag LOCUS_17590 gene pgm 1807552 1809204 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_17590 1810192 1809275 gene locus_tag LOCUS_17600 1810192 1809275 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941599.1 protein_id gnl|my_center|LOCUS_17600 1810986 1810294 gene locus_tag LOCUS_17610 1810986 1810294 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294658.1 protein_id gnl|my_center|LOCUS_17610 1811897 1811187 gene locus_tag LOCUS_17620 1811897 1811187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1812392 1811946 gene locus_tag LOCUS_17630 1812392 1811946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1812678 1814003 gene locus_tag LOCUS_17640 1812678 1814003 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939264.1 protein_id gnl|my_center|LOCUS_17640 1816073 1815021 gene locus_tag LOCUS_17650 1816073 1815021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1816210 1816944 gene locus_tag LOCUS_17660 gene modA 1816210 1816944 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798928.1 protein_id gnl|my_center|LOCUS_17660 1816948 1817604 gene locus_tag LOCUS_17670 gene modB 1816948 1817604 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172814.1 protein_id gnl|my_center|LOCUS_17670 1817601 1818296 gene locus_tag LOCUS_17680 1817601 1818296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 1818293 1819021 gene locus_tag LOCUS_17690 1818293 1819021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 1819026 1819694 gene locus_tag LOCUS_17700 gene modB 1819026 1819694 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021257.1 protein_id gnl|my_center|LOCUS_17700 1819714 1820460 gene locus_tag LOCUS_17710 1819714 1820460 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392949.1 protein_id gnl|my_center|LOCUS_17710 1821527 1820550 gene locus_tag LOCUS_17720 1821527 1820550 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861285.1 protein_id gnl|my_center|LOCUS_17720 1821833 1821675 gene locus_tag LOCUS_17730 1821833 1821675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1822662 1821985 gene locus_tag LOCUS_17740 1822662 1821985 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066132.1 protein_id gnl|my_center|LOCUS_17740 1823619 1822726 gene locus_tag LOCUS_17750 1823619 1822726 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229868.1 protein_id gnl|my_center|LOCUS_17750 1825276 1823660 gene locus_tag LOCUS_17760 1825276 1823660 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939733.1 protein_id gnl|my_center|LOCUS_17760 1826350 1825301 gene locus_tag LOCUS_17770 1826350 1825301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 1826838 1826356 gene locus_tag LOCUS_17780 1826838 1826356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1827677 1826835 gene locus_tag LOCUS_17790 1827677 1826835 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_17790 1828672 1827674 gene locus_tag LOCUS_17800 1828672 1827674 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939731.1 protein_id gnl|my_center|LOCUS_17800 1828834 1828909 gene locus_tag LOCUS_t00410 1828834 1828909 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1829608 1829303 gene locus_tag LOCUS_17810 1829608 1829303 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140812.1 protein_id gnl|my_center|LOCUS_17810 1829837 1829595 gene locus_tag LOCUS_17820 1829837 1829595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1830465 1830214 gene locus_tag LOCUS_17830 1830465 1830214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1830712 1830503 gene locus_tag LOCUS_17840 1830712 1830503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1831369 1832505 gene locus_tag LOCUS_17850 gene purT 1831369 1832505 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938024.1 protein_id gnl|my_center|LOCUS_17850 1832706 1833302 gene locus_tag LOCUS_17860 gene caiE 1832706 1833302 CDS product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122865.1 protein_id gnl|my_center|LOCUS_17860 1833803 1833402 gene locus_tag LOCUS_17870 1833803 1833402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 1834135 1835280 gene locus_tag LOCUS_17880 gene tyrP 1834135 1835280 CDS product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096036.1 protein_id gnl|my_center|LOCUS_17880 1835631 1836224 gene locus_tag LOCUS_17890 1835631 1836224 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939073.1 protein_id gnl|my_center|LOCUS_17890 1836317 1837099 gene locus_tag LOCUS_17900 1836317 1837099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1837143 1837913 gene locus_tag LOCUS_17910 1837143 1837913 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_17910 1837910 1838332 gene locus_tag LOCUS_17920 1837910 1838332 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083908.1 protein_id gnl|my_center|LOCUS_17920 1838394 1839236 gene locus_tag LOCUS_17930 1838394 1839236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 1840263 1839247 gene locus_tag LOCUS_17940 1840263 1839247 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939785.1 protein_id gnl|my_center|LOCUS_17940 1841505 1840345 gene locus_tag LOCUS_17950 1841505 1840345 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939181.1 protein_id gnl|my_center|LOCUS_17950 1842196 1841552 gene locus_tag LOCUS_17960 gene yfcE 1842196 1841552 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264676.1 protein_id gnl|my_center|LOCUS_17960 1843385 1842258 gene locus_tag LOCUS_17970 gene proB 1843385 1842258 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938229.1 protein_id gnl|my_center|LOCUS_17970 1844577 1843468 gene locus_tag LOCUS_17980 gene obgE 1844577 1843468 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938228.1 protein_id gnl|my_center|LOCUS_17980 1844965 1844696 gene locus_tag LOCUS_17990 gene rpmA 1844965 1844696 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_17990 1845297 1844986 gene locus_tag LOCUS_18000 gene rplU 1845297 1844986 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938226.1 protein_id gnl|my_center|LOCUS_18000 1845543 1845974 gene locus_tag LOCUS_18010 1845543 1845974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 1846689 1845940 gene locus_tag LOCUS_18020 1846689 1845940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 1847296 1846691 gene locus_tag LOCUS_18030 1847296 1846691 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940033.1 protein_id gnl|my_center|LOCUS_18030 1847435 1847289 gene locus_tag LOCUS_18040 1847435 1847289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1848171 1847551 gene locus_tag LOCUS_18050 1848171 1847551 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940031.1 protein_id gnl|my_center|LOCUS_18050 1848689 1848171 gene locus_tag LOCUS_18060 1848689 1848171 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940030.1 protein_id gnl|my_center|LOCUS_18060 1848845 1849399 gene locus_tag LOCUS_18070 gene rpoE 1848845 1849399 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_18070 1849392 1849973 gene locus_tag LOCUS_18080 1849392 1849973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 1849957 1850709 gene locus_tag LOCUS_18090 1849957 1850709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 1850803 1851759 gene locus_tag LOCUS_18100 1850803 1851759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 1851779 1852720 gene locus_tag LOCUS_18110 1851779 1852720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1852996 1853142 gene locus_tag LOCUS_18120 1852996 1853142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524242.1 protein_id gnl|my_center|LOCUS_18120 1853308 1854021 gene locus_tag LOCUS_18130 1853308 1854021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 1854701 1854339 gene locus_tag LOCUS_18140 1854701 1854339 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393697.1 protein_id gnl|my_center|LOCUS_18140 1854787 1854999 gene locus_tag LOCUS_18150 1854787 1854999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1856374 1855466 gene locus_tag LOCUS_18160 gene argB 1856374 1855466 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938759.1 protein_id gnl|my_center|LOCUS_18160 1857585 1856494 gene locus_tag LOCUS_18170 1857585 1856494 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938072.1 protein_id gnl|my_center|LOCUS_18170 1857684 1858922 gene locus_tag LOCUS_18180 1857684 1858922 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925781.1 protein_id gnl|my_center|LOCUS_18180 1859008 1859856 gene locus_tag LOCUS_18190 1859008 1859856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1860637 1859903 gene locus_tag LOCUS_18200 1860637 1859903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1861104 1861535 gene locus_tag LOCUS_18210 1861104 1861535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1861562 1863652 gene locus_tag LOCUS_18220 1861562 1863652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1863649 1866459 gene locus_tag LOCUS_18230 1863649 1866459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1866473 1867954 gene locus_tag LOCUS_18240 1866473 1867954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1867968 1869374 gene locus_tag LOCUS_18250 1867968 1869374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1869409 1870416 gene locus_tag LOCUS_18260 1869409 1870416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1870413 1871912 gene locus_tag LOCUS_18270 gene pelF 1870413 1871912 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113954.1 protein_id gnl|my_center|LOCUS_18270 1871917 1873287 gene locus_tag LOCUS_18280 gene pelG 1871917 1873287 CDS product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091283.1 protein_id gnl|my_center|LOCUS_18280 1873307 1874269 gene locus_tag LOCUS_18290 1873307 1874269 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_18290 1876696 1875524 gene locus_tag LOCUS_18300 1876696 1875524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 1876925 1877374 gene locus_tag LOCUS_18310 1876925 1877374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 1878565 1877456 gene locus_tag LOCUS_18320 1878565 1877456 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_18320 1878991 1878916 gene locus_tag LOCUS_t00420 1878991 1878916 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1879123 1879046 gene locus_tag LOCUS_t00430 1879123 1879046 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1879205 1879131 gene locus_tag LOCUS_t00440 1879205 1879131 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1879617 1879267 gene locus_tag LOCUS_18330 1879617 1879267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 1880033 1879653 gene locus_tag LOCUS_18340 1880033 1879653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1881215 1880202 gene locus_tag LOCUS_18350 1881215 1880202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 1881707 1882474 gene locus_tag LOCUS_18360 1881707 1882474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18360 1882380 1882619 gene locus_tag LOCUS_18370 1882380 1882619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18370 1882743 1884173 gene locus_tag LOCUS_18380 gene ahcY 1882743 1884173 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937910.1 protein_id gnl|my_center|LOCUS_18380 1884609 1885613 gene locus_tag LOCUS_18390 1884609 1885613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1886865 1885624 gene locus_tag LOCUS_18400 1886865 1885624 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938250.1 protein_id gnl|my_center|LOCUS_18400 1887544 1889703 gene locus_tag LOCUS_18410 1887544 1889703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 1889770 1891761 gene locus_tag LOCUS_18420 1889770 1891761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 1892283 1893122 gene locus_tag LOCUS_18430 1892283 1893122 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 protein_id gnl|my_center|LOCUS_18430 1893257 1894987 gene locus_tag LOCUS_18440 1893257 1894987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1894984 1895865 gene locus_tag LOCUS_18450 1894984 1895865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1895844 1896788 gene locus_tag LOCUS_18460 1895844 1896788 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_18460 1896973 1897152 gene locus_tag LOCUS_18470 1896973 1897152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1897155 1898333 gene locus_tag LOCUS_18480 1897155 1898333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1898349 1899515 gene locus_tag LOCUS_18490 1898349 1899515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1899561 1901474 gene locus_tag LOCUS_18500 1899561 1901474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 1901654 1902256 gene locus_tag LOCUS_18510 1901654 1902256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1902253 1903494 gene locus_tag LOCUS_18520 1902253 1903494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 1903636 1904499 gene locus_tag LOCUS_18530 1903636 1904499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1906032 1904590 gene locus_tag LOCUS_18540 1906032 1904590 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_18540 1907732 1906029 gene locus_tag LOCUS_18550 1907732 1906029 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_18550 1909039 1907867 gene locus_tag LOCUS_18560 1909039 1907867 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035843.1 protein_id gnl|my_center|LOCUS_18560 1909837 1909136 gene locus_tag LOCUS_18570 1909837 1909136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 1910604 1909834 gene locus_tag LOCUS_18580 1910604 1909834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1911820 1910615 gene locus_tag LOCUS_18590 1911820 1910615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1913722 1911929 gene locus_tag LOCUS_18600 1913722 1911929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1914886 1914485 gene locus_tag LOCUS_18610 1914886 1914485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18610 1915658 1914906 gene locus_tag LOCUS_18620 1915658 1914906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18620 1916809 1915655 gene locus_tag LOCUS_18630 1916809 1915655 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765279.1 protein_id gnl|my_center|LOCUS_18630 1918050 1916818 gene locus_tag LOCUS_18640 gene xcpS 1918050 1916818 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_18640 1918420 1918055 gene locus_tag LOCUS_18650 1918420 1918055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1919109 1918417 gene locus_tag LOCUS_18660 1919109 1918417 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_18660 1920149 1919199 gene locus_tag LOCUS_18670 1920149 1919199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1921856 1920153 gene locus_tag LOCUS_18680 gene gspE 1921856 1920153 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_18680 1923850 1921856 gene locus_tag LOCUS_18690 gene gspD 1923850 1921856 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_18690 1924697 1923852 gene locus_tag LOCUS_18700 1924697 1923852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 1925650 1924685 gene locus_tag LOCUS_18710 1925650 1924685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1926144 1925659 gene locus_tag LOCUS_18720 1926144 1925659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 1926583 1926119 gene locus_tag LOCUS_18730 gene xcpT 1926583 1926119 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_18730 1928525 1926600 gene locus_tag LOCUS_18740 1928525 1926600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1929041 1928538 gene locus_tag LOCUS_18750 1929041 1928538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1930561 1929041 gene locus_tag LOCUS_18760 1930561 1929041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1931551 1930583 gene locus_tag LOCUS_18770 1931551 1930583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 1932220 1931582 gene locus_tag LOCUS_18780 1932220 1931582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1932581 1932228 gene locus_tag LOCUS_18790 1932581 1932228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 1933455 1932571 gene locus_tag LOCUS_18800 1933455 1932571 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970319.1 protein_id gnl|my_center|LOCUS_18800 1934203 1933481 gene locus_tag LOCUS_18810 1934203 1933481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1935138 1934494 gene locus_tag LOCUS_18820 1935138 1934494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1935292 1936065 gene locus_tag LOCUS_18830 1935292 1936065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1936127 1937800 gene locus_tag LOCUS_18840 1936127 1937800 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793021.1 protein_id gnl|my_center|LOCUS_18840 1937945 1939804 gene locus_tag LOCUS_18850 1937945 1939804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 1940951 1939773 gene locus_tag LOCUS_18860 1940951 1939773 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966323.1 protein_id gnl|my_center|LOCUS_18860 1941143 1941739 gene locus_tag LOCUS_18870 1941143 1941739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 1941792 1942793 gene locus_tag LOCUS_18880 1941792 1942793 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_18880 1942857 1943342 gene locus_tag LOCUS_18890 1942857 1943342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 1943342 1944655 gene locus_tag LOCUS_18900 1943342 1944655 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942699.1 protein_id gnl|my_center|LOCUS_18900 1945836 1945030 gene locus_tag LOCUS_18910 1945836 1945030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 1946657 1945836 gene locus_tag LOCUS_18920 1946657 1945836 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938516.1 protein_id gnl|my_center|LOCUS_18920 1946838 1948604 gene locus_tag LOCUS_18930 1946838 1948604 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_18930 1948697 1950058 gene locus_tag LOCUS_18940 1948697 1950058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 1950614 1950114 gene locus_tag LOCUS_18950 gene queF 1950614 1950114 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938262.1 protein_id gnl|my_center|LOCUS_18950 1950834 1951463 gene locus_tag LOCUS_18960 1950834 1951463 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080883.1 protein_id gnl|my_center|LOCUS_18960 1952061 1951543 gene locus_tag LOCUS_18970 1952061 1951543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1952291 1952902 gene locus_tag LOCUS_18980 1952291 1952902 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792236.1 protein_id gnl|my_center|LOCUS_18980 1953426 1953686 gene locus_tag LOCUS_18990 1953426 1953686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 1953919 1954398 gene locus_tag LOCUS_19000 1953919 1954398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 1954540 1956969 gene locus_tag LOCUS_19010 1954540 1956969 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792925.1 protein_id gnl|my_center|LOCUS_19010 1957014 1958207 gene locus_tag LOCUS_19020 1957014 1958207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19020 1958234 1959313 gene locus_tag LOCUS_19030 1958234 1959313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19030 1959396 1960562 gene locus_tag LOCUS_19040 1959396 1960562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1960559 1961554 gene locus_tag LOCUS_19050 1960559 1961554 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391203.1 protein_id gnl|my_center|LOCUS_19050 1961547 1963490 gene locus_tag LOCUS_19060 1961547 1963490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 1963496 1963822 gene locus_tag LOCUS_19070 1963496 1963822 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_19070 1963812 1964258 gene locus_tag LOCUS_19080 1963812 1964258 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871913.1 protein_id gnl|my_center|LOCUS_19080 1964416 1964730 gene locus_tag LOCUS_19090 1964416 1964730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939945.1 protein_id gnl|my_center|LOCUS_19090 1964890 1966155 gene locus_tag LOCUS_19100 1964890 1966155 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941850.1 protein_id gnl|my_center|LOCUS_19100 1966780 1966998 gene locus_tag LOCUS_19110 gene infA 1966780 1966998 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937325.1 protein_id gnl|my_center|LOCUS_19110 1970225 1966995 gene locus_tag LOCUS_19120 1970225 1966995 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932984.1 protein_id gnl|my_center|LOCUS_19120 1971471 1970272 gene locus_tag LOCUS_19130 1971471 1970272 CDS product trehalose 6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927019.1 protein_id gnl|my_center|LOCUS_19130 1972907 1971516 gene locus_tag LOCUS_19140 1972907 1971516 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_19140 1973352 1973191 gene locus_tag LOCUS_19150 1973352 1973191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 1974244 1973579 gene locus_tag LOCUS_19160 1974244 1973579 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792241.1 protein_id gnl|my_center|LOCUS_19160 1977737 1975557 gene locus_tag LOCUS_19170 gene rnr 1977737 1975557 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939737.1 protein_id gnl|my_center|LOCUS_19170 1978875 1977730 gene locus_tag LOCUS_19180 gene lpxK 1978875 1977730 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939738.1 protein_id gnl|my_center|LOCUS_19180 1979652 1978918 gene locus_tag LOCUS_19190 1979652 1978918 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367602.1 protein_id gnl|my_center|LOCUS_19190 1979904 1981292 gene locus_tag LOCUS_19200 1979904 1981292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 1982300 1981374 gene locus_tag LOCUS_19210 1982300 1981374 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_19210 1982913 1982362 gene locus_tag LOCUS_19220 1982913 1982362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1984212 1983157 gene locus_tag LOCUS_19230 1984212 1983157 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938390.1 protein_id gnl|my_center|LOCUS_19230 1985195 1984389 gene locus_tag LOCUS_19240 1985195 1984389 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943077.1 protein_id gnl|my_center|LOCUS_19240 1987437 1985380 gene locus_tag LOCUS_19250 1987437 1985380 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704719.1 protein_id gnl|my_center|LOCUS_19250 1987655 1988695 gene locus_tag LOCUS_19260 gene recA 1987655 1988695 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938389.1 protein_id gnl|my_center|LOCUS_19260 1988777 1991419 gene locus_tag LOCUS_19270 gene alaS 1988777 1991419 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938388.1 protein_id gnl|my_center|LOCUS_19270 1991602 1992030 gene locus_tag LOCUS_19280 gene rplM 1991602 1992030 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939788.1 protein_id gnl|my_center|LOCUS_19280 1992043 1992432 gene locus_tag LOCUS_19290 gene rpsI 1992043 1992432 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939789.1 protein_id gnl|my_center|LOCUS_19290 1992603 1993835 gene locus_tag LOCUS_19300 1992603 1993835 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938700.1 protein_id gnl|my_center|LOCUS_19300 1994175 1993957 gene locus_tag LOCUS_19310 1994175 1993957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 1995484 1994426 gene locus_tag LOCUS_19320 gene purM 1995484 1994426 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938699.1 protein_id gnl|my_center|LOCUS_19320 1995653 1995979 gene locus_tag LOCUS_19330 1995653 1995979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 1995999 1997015 gene locus_tag LOCUS_19340 gene amrS 1995999 1997015 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_19340 1997062 1997138 gene locus_tag LOCUS_t00450 1997062 1997138 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1997709 1998167 gene locus_tag LOCUS_19350 1997709 1998167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 1998291 2001329 gene locus_tag LOCUS_19360 gene fdnG 1998291 2001329 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940078.1 transl_except (pos:1998855..1998857,aa:Sec) note codon on position 189 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_19360 2001348 2002040 gene locus_tag LOCUS_19370 2001348 2002040 CDS product formate dehydrogenase 2 subunit beta (cytochrome c-553) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940077.1 protein_id gnl|my_center|LOCUS_19370 2002145 2003065 gene locus_tag LOCUS_19380 2002145 2003065 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940076.1 protein_id gnl|my_center|LOCUS_19380 2003187 2003020 gene locus_tag LOCUS_19390 2003187 2003020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2003190 2003537 gene locus_tag LOCUS_19400 2003190 2003537 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_19400 2003548 2003931 gene locus_tag LOCUS_19410 gene queD 2003548 2003931 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938647.1 protein_id gnl|my_center|LOCUS_19410 2003934 2004398 gene locus_tag LOCUS_19420 gene dtd 2003934 2004398 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938745.1 protein_id gnl|my_center|LOCUS_19420 2005564 2004614 gene locus_tag LOCUS_19430 2005564 2004614 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938694.1 protein_id gnl|my_center|LOCUS_19430 2006455 2007645 gene locus_tag LOCUS_19440 2006455 2007645 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939574.1 protein_id gnl|my_center|LOCUS_19440 2007647 2008483 gene locus_tag LOCUS_19450 2007647 2008483 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939573.1 protein_id gnl|my_center|LOCUS_19450 2008509 2009357 gene locus_tag LOCUS_19460 2008509 2009357 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939572.1 protein_id gnl|my_center|LOCUS_19460 2009615 2009472 gene locus_tag LOCUS_19470 2009615 2009472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2010234 2009851 gene locus_tag LOCUS_19480 2010234 2009851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2010339 2011028 gene locus_tag LOCUS_19490 2010339 2011028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19490 2011021 2012466 gene locus_tag LOCUS_19500 2011021 2012466 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938739.1 protein_id gnl|my_center|LOCUS_19500 2012581 2014278 gene locus_tag LOCUS_19510 2012581 2014278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 2014290 2015039 gene locus_tag LOCUS_19520 2014290 2015039 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938737.1 protein_id gnl|my_center|LOCUS_19520 2015118 2016806 gene locus_tag LOCUS_19530 2015118 2016806 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938736.1 protein_id gnl|my_center|LOCUS_19530 2017218 2018141 gene locus_tag LOCUS_19540 2017218 2018141 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938734.1 protein_id gnl|my_center|LOCUS_19540 2018362 2018138 gene locus_tag LOCUS_19550 2018362 2018138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2019766 2018369 gene locus_tag LOCUS_19560 2019766 2018369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2020490 2019804 gene locus_tag LOCUS_19570 gene rnc 2020490 2019804 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938733.1 protein_id gnl|my_center|LOCUS_19570 2020597 2022609 gene locus_tag LOCUS_19580 2020597 2022609 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_19580 2022646 2023710 gene locus_tag LOCUS_19590 2022646 2023710 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938731.1 protein_id gnl|my_center|LOCUS_19590 2023853 2025115 gene locus_tag LOCUS_19600 2023853 2025115 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391408.1 protein_id gnl|my_center|LOCUS_19600 2025112 2025663 gene locus_tag LOCUS_19610 gene amrA 2025112 2025663 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938040.1 protein_id gnl|my_center|LOCUS_19610 2025806 2026501 gene locus_tag LOCUS_19620 2025806 2026501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2026517 2027719 gene locus_tag LOCUS_19630 2026517 2027719 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937797.1 protein_id gnl|my_center|LOCUS_19630 2027778 2028209 gene locus_tag LOCUS_19640 2027778 2028209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2028311 2028961 gene locus_tag LOCUS_19650 gene fsa 2028311 2028961 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_19650 2029614 2029039 gene locus_tag LOCUS_19660 2029614 2029039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2030011 2029772 gene locus_tag LOCUS_19670 2030011 2029772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940206.1 protein_id gnl|my_center|LOCUS_19670 2032096 2030033 gene locus_tag LOCUS_19680 2032096 2030033 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940207.1 protein_id gnl|my_center|LOCUS_19680 2032756 2033298 gene locus_tag LOCUS_19690 2032756 2033298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2033308 2033526 gene locus_tag LOCUS_19700 2033308 2033526 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791339.1 protein_id gnl|my_center|LOCUS_19700 2033611 2034003 gene locus_tag LOCUS_19710 2033611 2034003 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762404.1 protein_id gnl|my_center|LOCUS_19710 2034049 2034342 gene locus_tag LOCUS_19720 2034049 2034342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 2034339 2035310 gene locus_tag LOCUS_19730 gene sppA 2034339 2035310 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941487.1 protein_id gnl|my_center|LOCUS_19730 2035457 2036662 gene locus_tag LOCUS_19740 2035457 2036662 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990816.1 protein_id gnl|my_center|LOCUS_19740 2037190 2036744 gene locus_tag LOCUS_19750 2037190 2036744 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937835.1 protein_id gnl|my_center|LOCUS_19750 2038030 2037431 gene locus_tag LOCUS_19760 2038030 2037431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938371.1 protein_id gnl|my_center|LOCUS_19760 2038652 2038047 gene locus_tag LOCUS_19770 gene cbiM 2038652 2038047 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938357.1 protein_id gnl|my_center|LOCUS_19770 2039021 2038812 gene locus_tag LOCUS_19780 2039021 2038812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2039479 2039036 gene locus_tag LOCUS_19790 2039479 2039036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2039606 2040853 gene locus_tag LOCUS_19800 2039606 2040853 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939787.1 protein_id gnl|my_center|LOCUS_19800 2041171 2041004 gene locus_tag LOCUS_19810 2041171 2041004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2041411 2042292 gene locus_tag LOCUS_19820 2041411 2042292 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808636.1 protein_id gnl|my_center|LOCUS_19820 2042417 2043067 gene locus_tag LOCUS_19830 2042417 2043067 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 protein_id gnl|my_center|LOCUS_19830 2044093 2043461 gene locus_tag LOCUS_19840 2044093 2043461 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926845.1 protein_id gnl|my_center|LOCUS_19840 2044867 2044106 gene locus_tag LOCUS_19850 2044867 2044106 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937669.1 protein_id gnl|my_center|LOCUS_19850 2046159 2044864 gene locus_tag LOCUS_19860 2046159 2044864 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792979.1 protein_id gnl|my_center|LOCUS_19860 2046676 2046131 gene locus_tag LOCUS_19870 2046676 2046131 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937671.1 protein_id gnl|my_center|LOCUS_19870 2047170 2046928 gene locus_tag LOCUS_19880 2047170 2046928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 2047060 2047887 gene locus_tag LOCUS_19890 2047060 2047887 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023369.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19890 2049328 2047952 gene locus_tag LOCUS_19900 gene rlmD 2049328 2047952 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938223.1 protein_id gnl|my_center|LOCUS_19900 2049418 2049723 gene locus_tag LOCUS_19910 2049418 2049723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938093.1 protein_id gnl|my_center|LOCUS_19910 2049725 2049994 gene locus_tag LOCUS_19920 2049725 2049994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938093.1 protein_id gnl|my_center|LOCUS_19920 2050785 2050000 gene locus_tag LOCUS_19930 2050785 2050000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2050945 2051433 gene locus_tag LOCUS_19940 2050945 2051433 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939786.1 protein_id gnl|my_center|LOCUS_19940 2051752 2052834 gene locus_tag LOCUS_19950 gene yedE 2051752 2052834 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545330.1 protein_id gnl|my_center|LOCUS_19950 2052903 2053130 gene locus_tag LOCUS_19960 2052903 2053130 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546446.1 protein_id gnl|my_center|LOCUS_19960 2053127 2053678 gene locus_tag LOCUS_19970 2053127 2053678 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545577.1 protein_id gnl|my_center|LOCUS_19970 2053666 2054523 gene locus_tag LOCUS_19980 2053666 2054523 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545741.1 protein_id gnl|my_center|LOCUS_19980 2054520 2054750 gene locus_tag LOCUS_19990 2054520 2054750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 2056248 2055235 gene locus_tag LOCUS_20000 2056248 2055235 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939785.1 protein_id gnl|my_center|LOCUS_20000 2057690 2056245 gene locus_tag LOCUS_20010 gene pyk 2057690 2056245 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939784.1 protein_id gnl|my_center|LOCUS_20010 2057948 2058394 gene locus_tag LOCUS_20020 gene mraZ 2057948 2058394 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939783.1 protein_id gnl|my_center|LOCUS_20020 2058410 2059378 gene locus_tag LOCUS_20030 gene rsmH 2058410 2059378 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939782.1 protein_id gnl|my_center|LOCUS_20030 2059375 2059656 gene locus_tag LOCUS_20040 2059375 2059656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 2059675 2061642 gene locus_tag LOCUS_20050 2059675 2061642 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939780.1 protein_id gnl|my_center|LOCUS_20050 2061671 2063143 gene locus_tag LOCUS_20060 2061671 2063143 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939779.1 protein_id gnl|my_center|LOCUS_20060 2063145 2064527 gene locus_tag LOCUS_20070 gene murF 2063145 2064527 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939778.1 protein_id gnl|my_center|LOCUS_20070 2064524 2065600 gene locus_tag LOCUS_20080 gene mraY 2064524 2065600 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939777.1 protein_id gnl|my_center|LOCUS_20080 2065606 2066907 gene locus_tag LOCUS_20090 gene murD 2065606 2066907 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939776.1 protein_id gnl|my_center|LOCUS_20090 2066904 2068022 gene locus_tag LOCUS_20100 gene ftsW 2066904 2068022 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791803.1 protein_id gnl|my_center|LOCUS_20100 2068019 2069110 gene locus_tag LOCUS_20110 gene murG 2068019 2069110 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939774.1 protein_id gnl|my_center|LOCUS_20110 2069124 2070557 gene locus_tag LOCUS_20120 gene murC 2069124 2070557 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939773.1 protein_id gnl|my_center|LOCUS_20120 2070567 2071442 gene locus_tag LOCUS_20130 gene murB 2070567 2071442 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939772.1 protein_id gnl|my_center|LOCUS_20130 2071439 2072275 gene locus_tag LOCUS_20140 2071439 2072275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 2072337 2073572 gene locus_tag LOCUS_20150 gene ftsA 2072337 2073572 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_20150 2073683 2074939 gene locus_tag LOCUS_20160 gene ftsZ 2073683 2074939 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939769.1 protein_id gnl|my_center|LOCUS_20160 2074949 2076631 gene locus_tag LOCUS_20170 2074949 2076631 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_20170 2079275 2077869 gene locus_tag LOCUS_20180 gene gltX 2079275 2077869 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939822.1 protein_id gnl|my_center|LOCUS_20180 2079606 2079385 gene locus_tag LOCUS_20190 2079606 2079385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2080752 2079685 gene locus_tag LOCUS_20200 2080752 2079685 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409361.1 protein_id gnl|my_center|LOCUS_20200 2082257 2080875 gene locus_tag LOCUS_20210 2082257 2080875 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938712.1 protein_id gnl|my_center|LOCUS_20210 2084107 2082257 gene locus_tag LOCUS_20220 2084107 2082257 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938711.1 protein_id gnl|my_center|LOCUS_20220 2084935 2084117 gene locus_tag LOCUS_20230 2084935 2084117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2085613 2085095 gene locus_tag LOCUS_20240 2085613 2085095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 2085894 2086157 gene locus_tag LOCUS_20250 2085894 2086157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 2087810 2087517 gene locus_tag LOCUS_20260 2087810 2087517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 2088574 2087972 gene locus_tag LOCUS_20270 2088574 2087972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20270 2089895 2088579 gene locus_tag LOCUS_20280 2089895 2088579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20280 2091185 2089905 gene locus_tag LOCUS_20290 2091185 2089905 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 protein_id gnl|my_center|LOCUS_20290 2091542 2091336 gene locus_tag LOCUS_20300 gene rpmB 2091542 2091336 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938507.1 protein_id gnl|my_center|LOCUS_20300 2091738 2092262 gene locus_tag LOCUS_20310 2091738 2092262 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938506.1 protein_id gnl|my_center|LOCUS_20310 2092333 2092512 gene locus_tag LOCUS_20320 gene rpmF 2092333 2092512 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938505.1 protein_id gnl|my_center|LOCUS_20320 2092542 2093546 gene locus_tag LOCUS_20330 gene plsX 2092542 2093546 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938504.1 protein_id gnl|my_center|LOCUS_20330 2093598 2094587 gene locus_tag LOCUS_20340 2093598 2094587 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938503.1 protein_id gnl|my_center|LOCUS_20340 2094682 2095425 gene locus_tag LOCUS_20350 gene fabG 2094682 2095425 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938502.1 protein_id gnl|my_center|LOCUS_20350 2095459 2095695 gene locus_tag LOCUS_20360 gene acpP 2095459 2095695 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938501.1 protein_id gnl|my_center|LOCUS_20360 2095802 2097040 gene locus_tag LOCUS_20370 gene fabF 2095802 2097040 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938500.1 protein_id gnl|my_center|LOCUS_20370 2097109 2098347 gene locus_tag LOCUS_20380 2097109 2098347 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938499.1 protein_id gnl|my_center|LOCUS_20380 2098518 2098979 gene locus_tag LOCUS_20390 2098518 2098979 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938498.1 protein_id gnl|my_center|LOCUS_20390 2098993 2100090 gene locus_tag LOCUS_20400 gene ribD 2098993 2100090 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938497.1 protein_id gnl|my_center|LOCUS_20400 2100190 2100846 gene locus_tag LOCUS_20410 2100190 2100846 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938496.1 protein_id gnl|my_center|LOCUS_20410 2101773 2100931 gene locus_tag LOCUS_20420 2101773 2100931 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938976.1 protein_id gnl|my_center|LOCUS_20420 2101985 2102368 gene locus_tag LOCUS_20430 2101985 2102368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938981.1 protein_id gnl|my_center|LOCUS_20430 2102480 2103265 gene locus_tag LOCUS_20440 2102480 2103265 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400818.1 protein_id gnl|my_center|LOCUS_20440 2103324 2104592 gene locus_tag LOCUS_20450 2103324 2104592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2104892 2106112 gene locus_tag LOCUS_20460 2104892 2106112 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938495.1 protein_id gnl|my_center|LOCUS_20460 2106150 2106617 gene locus_tag LOCUS_20470 gene ribE 2106150 2106617 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938494.1 protein_id gnl|my_center|LOCUS_20470 2106621 2107091 gene locus_tag LOCUS_20480 gene nusB 2106621 2107091 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938493.1 protein_id gnl|my_center|LOCUS_20480 2107188 2109686 gene locus_tag LOCUS_20490 gene leuS 2107188 2109686 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938492.1 protein_id gnl|my_center|LOCUS_20490 2111949 2112614 gene locus_tag LOCUS_20500 2111949 2112614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2112659 2113039 gene locus_tag LOCUS_20510 2112659 2113039 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939916.1 protein_id gnl|my_center|LOCUS_20510 2113346 2114302 gene locus_tag LOCUS_20520 2113346 2114302 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589798.1 protein_id gnl|my_center|LOCUS_20520 2114369 2114812 gene locus_tag LOCUS_20530 2114369 2114812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2114837 2116348 gene locus_tag LOCUS_20540 2114837 2116348 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_20540 2116353 2117738 gene locus_tag LOCUS_20550 2116353 2117738 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811151.1 protein_id gnl|my_center|LOCUS_20550 2117752 2119131 gene locus_tag LOCUS_20560 2117752 2119131 CDS product adenylosuccinate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018348301.1 protein_id gnl|my_center|LOCUS_20560 2119211 2120506 gene locus_tag LOCUS_20570 2119211 2120506 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937747.1 protein_id gnl|my_center|LOCUS_20570 2120610 2121302 gene locus_tag LOCUS_20580 2120610 2121302 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927021.1 protein_id gnl|my_center|LOCUS_20580 2121510 2121863 gene locus_tag LOCUS_20590 gene hypA 2121510 2121863 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_20590 2121887 2122546 gene locus_tag LOCUS_20600 gene hypB 2121887 2122546 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939602.1 protein_id gnl|my_center|LOCUS_20600 2123015 2122815 gene locus_tag LOCUS_20610 2123015 2122815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2123395 2123135 gene locus_tag LOCUS_20620 gene cdd1 2123395 2123135 CDS product protein Cdd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888450.1 protein_id gnl|my_center|LOCUS_20620 2124326 2123397 gene locus_tag LOCUS_20630 gene hemC 2124326 2123397 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939176.1 protein_id gnl|my_center|LOCUS_20630 2124643 2124383 gene locus_tag LOCUS_20640 2124643 2124383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2124636 2124929 gene locus_tag LOCUS_20650 2124636 2124929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2124896 2125921 gene locus_tag LOCUS_20660 2124896 2125921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2125918 2126520 gene locus_tag LOCUS_20670 2125918 2126520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2126621 2127499 gene locus_tag LOCUS_20680 2126621 2127499 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_20680 2127592 2128089 gene locus_tag LOCUS_20690 gene lptE 2127592 2128089 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938491.1 protein_id gnl|my_center|LOCUS_20690 2128092 2129081 gene locus_tag LOCUS_20700 2128092 2129081 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792509.1 protein_id gnl|my_center|LOCUS_20700 2129130 2129813 gene locus_tag LOCUS_20710 gene radC 2129130 2129813 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938489.1 protein_id gnl|my_center|LOCUS_20710 2129836 2130189 gene locus_tag LOCUS_20720 2129836 2130189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2130201 2132711 gene locus_tag LOCUS_20730 gene lon 2130201 2132711 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938487.1 protein_id gnl|my_center|LOCUS_20730 2135479 2132783 gene locus_tag LOCUS_20740 2135479 2132783 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_20740 2135984 2137321 gene locus_tag LOCUS_20750 gene orpR 2135984 2137321 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_20750 2137488 2137904 gene locus_tag LOCUS_20760 2137488 2137904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2137991 2138857 gene locus_tag LOCUS_20770 2137991 2138857 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939603.1 protein_id gnl|my_center|LOCUS_20770 2138939 2140306 gene locus_tag LOCUS_20780 2138939 2140306 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986686.1 protein_id gnl|my_center|LOCUS_20780 2140688 2141500 gene locus_tag LOCUS_20790 2140688 2141500 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544947.1 protein_id gnl|my_center|LOCUS_20790 2142046 2142981 gene locus_tag LOCUS_20800 2142046 2142981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20800 2143326 2143964 gene locus_tag LOCUS_20810 gene ribB 2143326 2143964 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939063.1 protein_id gnl|my_center|LOCUS_20810 2146159 2144030 gene locus_tag LOCUS_20820 2146159 2144030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2147681 2146338 gene locus_tag LOCUS_20830 2147681 2146338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2148662 2147706 gene locus_tag LOCUS_20840 2148662 2147706 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792065.1 protein_id gnl|my_center|LOCUS_20840 2149790 2148822 gene locus_tag LOCUS_20850 2149790 2148822 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939400.1 protein_id gnl|my_center|LOCUS_20850 2151217 2149793 gene locus_tag LOCUS_20860 2151217 2149793 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294683.1 protein_id gnl|my_center|LOCUS_20860 2152398 2151214 gene locus_tag LOCUS_20870 2152398 2151214 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939398.1 protein_id gnl|my_center|LOCUS_20870 2152694 2152410 gene locus_tag LOCUS_20880 2152694 2152410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2154130 2152709 gene locus_tag LOCUS_20890 2154130 2152709 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939396.1 protein_id gnl|my_center|LOCUS_20890 2154952 2154140 gene locus_tag LOCUS_20900 gene cpaB 2154952 2154140 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939395.1 protein_id gnl|my_center|LOCUS_20900 2155513 2154968 gene locus_tag LOCUS_20910 2155513 2154968 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939394.1 protein_id gnl|my_center|LOCUS_20910 2155858 2155664 gene locus_tag LOCUS_20920 2155858 2155664 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939393.1 protein_id gnl|my_center|LOCUS_20920 2156081 2155839 gene locus_tag LOCUS_20930 2156081 2155839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2157750 2156374 gene locus_tag LOCUS_20940 2157750 2156374 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939391.1 protein_id gnl|my_center|LOCUS_20940 2158019 2158378 gene locus_tag LOCUS_20950 2158019 2158378 CDS product TadE/TadG family type IV pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939403.1 protein_id gnl|my_center|LOCUS_20950 2158410 2159615 gene locus_tag LOCUS_20960 2158410 2159615 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792063.1 protein_id gnl|my_center|LOCUS_20960 2159732 2160178 gene locus_tag LOCUS_20970 2159732 2160178 CDS product TadE/TadG family type IV pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939405.1 protein_id gnl|my_center|LOCUS_20970 2160283 2161017 gene locus_tag LOCUS_20980 2160283 2161017 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938201.1 protein_id gnl|my_center|LOCUS_20980 2161799 2161056 gene locus_tag LOCUS_20990 2161799 2161056 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791502.1 protein_id gnl|my_center|LOCUS_20990 2162047 2161799 gene locus_tag LOCUS_21000 2162047 2161799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2162441 2163202 gene locus_tag LOCUS_21010 2162441 2163202 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389906.1 protein_id gnl|my_center|LOCUS_21010 2163851 2163282 gene locus_tag LOCUS_21020 2163851 2163282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 2164315 2164677 gene locus_tag LOCUS_21030 2164315 2164677 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870086.1 protein_id gnl|my_center|LOCUS_21030 2164872 2165258 gene locus_tag LOCUS_21040 2164872 2165258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2167094 2165319 gene locus_tag LOCUS_21050 2167094 2165319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 2168113 2167166 gene locus_tag LOCUS_21060 2168113 2167166 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940332.1 protein_id gnl|my_center|LOCUS_21060 2168996 2168888 gene locus_tag LOCUS_r00040 2168996 2168888 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2171983 2169048 gene locus_tag LOCUS_r00050 2171983 2169048 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2172138 2172063 gene locus_tag LOCUS_t00460 2172138 2172063 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2172227 2172151 gene locus_tag LOCUS_t00470 2172227 2172151 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2173847 2172294 gene locus_tag LOCUS_r00060 2173847 2172294 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2174912 2176474 gene locus_tag LOCUS_21070 2174912 2176474 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_21070 2176661 2177875 gene locus_tag LOCUS_21080 2176661 2177875 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162518500.1 protein_id gnl|my_center|LOCUS_21080 2178708 2179331 gene locus_tag LOCUS_21090 2178708 2179331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2181826 2182776 gene locus_tag LOCUS_21100 2181826 2182776 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937858.1 protein_id gnl|my_center|LOCUS_21100 2182858 2183325 gene locus_tag LOCUS_21110 gene ybaK 2182858 2183325 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481362.1 protein_id gnl|my_center|LOCUS_21110 2183905 2183333 gene locus_tag LOCUS_21120 2183905 2183333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 2184263 2184787 gene locus_tag LOCUS_21130 2184263 2184787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 2185742 2185666 gene locus_tag LOCUS_t00480 2185742 2185666 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2185861 2185786 gene locus_tag LOCUS_t00490 2185861 2185786 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2187296 2186028 gene locus_tag LOCUS_21140 2187296 2186028 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940447.1 protein_id gnl|my_center|LOCUS_21140 2187504 2189171 gene locus_tag LOCUS_21150 2187504 2189171 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940448.1 protein_id gnl|my_center|LOCUS_21150 2189305 2189703 gene locus_tag LOCUS_21160 2189305 2189703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2189743 2189913 gene locus_tag LOCUS_21170 2189743 2189913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 2190824 2190003 gene locus_tag LOCUS_21180 2190824 2190003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2190963 2191991 gene locus_tag LOCUS_21190 2190963 2191991 CDS product DUF1786 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940672.1 protein_id gnl|my_center|LOCUS_21190 2192514 2192089 gene locus_tag LOCUS_21200 2192514 2192089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 2195794 2192696 gene locus_tag LOCUS_21210 2195794 2192696 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937745.1 protein_id gnl|my_center|LOCUS_21210 2196969 2195791 gene locus_tag LOCUS_21220 2196969 2195791 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942255.1 protein_id gnl|my_center|LOCUS_21220 2197971 2197213 gene locus_tag LOCUS_21230 2197971 2197213 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868883.1 protein_id gnl|my_center|LOCUS_21230 2198616 2198143 gene locus_tag LOCUS_21240 gene greA 2198616 2198143 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940503.1 protein_id gnl|my_center|LOCUS_21240 2199820 2198930 gene locus_tag LOCUS_21250 2199820 2198930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2202053 2199810 gene locus_tag LOCUS_21260 2202053 2199810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2202634 2202526 gene locus_tag LOCUS_r00070 2202634 2202526 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2205620 2202686 gene locus_tag LOCUS_r00080 2205620 2202686 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2205775 2205700 gene locus_tag LOCUS_t00500 2205775 2205700 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2205864 2205788 gene locus_tag LOCUS_t00510 2205864 2205788 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2207485 2205931 gene locus_tag LOCUS_r00090 2207485 2205931 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2208447 2208184 gene locus_tag LOCUS_21270 2208447 2208184 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965739.1 protein_id gnl|my_center|LOCUS_21270 2208764 2208450 gene locus_tag LOCUS_21280 2208764 2208450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2208866 2209099 gene locus_tag LOCUS_21290 2208866 2209099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 2209295 2209119 gene locus_tag LOCUS_21300 2209295 2209119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2209629 2210333 gene locus_tag LOCUS_21310 gene purN 2209629 2210333 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_21310 2210377 2210919 gene locus_tag LOCUS_21320 2210377 2210919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2210919 2211692 gene locus_tag LOCUS_21330 gene cobM 2210919 2211692 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791695.1 protein_id gnl|my_center|LOCUS_21330 2211702 2212100 gene locus_tag LOCUS_21340 2211702 2212100 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937805.1 protein_id gnl|my_center|LOCUS_21340 2213202 2212204 gene locus_tag LOCUS_21350 2213202 2212204 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705178.1 protein_id gnl|my_center|LOCUS_21350 2214051 2213215 gene locus_tag LOCUS_21360 2214051 2213215 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_21360 2214609 2215241 gene locus_tag LOCUS_21370 2214609 2215241 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939415.1 protein_id gnl|my_center|LOCUS_21370 2215342 2215800 gene locus_tag LOCUS_21380 2215342 2215800 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948692.1 protein_id gnl|my_center|LOCUS_21380 2215845 2216855 gene locus_tag LOCUS_21390 2215845 2216855 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065518.1 protein_id gnl|my_center|LOCUS_21390 2217579 2216908 gene locus_tag LOCUS_21400 2217579 2216908 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978021.1 protein_id gnl|my_center|LOCUS_21400 2218189 2217857 gene locus_tag LOCUS_21410 2218189 2217857 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083241.1 protein_id gnl|my_center|LOCUS_21410 2219568 2218213 gene locus_tag LOCUS_21420 2219568 2218213 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405103.1 protein_id gnl|my_center|LOCUS_21420 2220109 2220906 gene locus_tag LOCUS_21430 2220109 2220906 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937767.1 protein_id gnl|my_center|LOCUS_21430 2220933 2221916 gene locus_tag LOCUS_21440 2220933 2221916 CDS product 3-dehydroquinate synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937768.1 protein_id gnl|my_center|LOCUS_21440 2221921 2223030 gene locus_tag LOCUS_21450 gene pheA 2221921 2223030 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937769.1 protein_id gnl|my_center|LOCUS_21450 2223027 2224367 gene locus_tag LOCUS_21460 2223027 2224367 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937770.1 protein_id gnl|my_center|LOCUS_21460 2224368 2225165 gene locus_tag LOCUS_21470 2224368 2225165 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792876.1 protein_id gnl|my_center|LOCUS_21470 2225258 2226709 gene locus_tag LOCUS_21480 2225258 2226709 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937772.1 protein_id gnl|my_center|LOCUS_21480 2226690 2227274 gene locus_tag LOCUS_21490 2226690 2227274 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937773.1 protein_id gnl|my_center|LOCUS_21490 2227271 2228281 gene locus_tag LOCUS_21500 gene trpD 2227271 2228281 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937774.1 protein_id gnl|my_center|LOCUS_21500 2228271 2229041 gene locus_tag LOCUS_21510 2228271 2229041 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937775.1 protein_id gnl|my_center|LOCUS_21510 2229041 2229667 gene locus_tag LOCUS_21520 2229041 2229667 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_21520 2229669 2230877 gene locus_tag LOCUS_21530 gene trpB 2229669 2230877 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937777.1 protein_id gnl|my_center|LOCUS_21530 2230874 2231638 gene locus_tag LOCUS_21540 gene trpA 2230874 2231638 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937778.1 protein_id gnl|my_center|LOCUS_21540 2232074 2233036 gene locus_tag LOCUS_21550 2232074 2233036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 2233039 2233530 gene locus_tag LOCUS_21560 2233039 2233530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2234437 2233688 gene locus_tag LOCUS_21570 2234437 2233688 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938559.1 protein_id gnl|my_center|LOCUS_21570 2234680 2235966 gene locus_tag LOCUS_21580 2234680 2235966 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937796.1 protein_id gnl|my_center|LOCUS_21580 2236162 2237025 gene locus_tag LOCUS_21590 2236162 2237025 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791673.1 protein_id gnl|my_center|LOCUS_21590 2237952 2237167 gene locus_tag LOCUS_21600 2237952 2237167 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938210.1 protein_id gnl|my_center|LOCUS_21600 2238654 2237953 gene locus_tag LOCUS_21610 2238654 2237953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629479.1 protein_id gnl|my_center|LOCUS_21610 2239021 2238581 gene locus_tag LOCUS_21620 gene fliJ 2239021 2238581 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938212.1 protein_id gnl|my_center|LOCUS_21620 2239210 2239037 gene locus_tag LOCUS_21630 2239210 2239037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 2240594 2239290 gene locus_tag LOCUS_21640 2240594 2239290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792214.1 protein_id gnl|my_center|LOCUS_21640 2241886 2240699 gene locus_tag LOCUS_21650 gene dinB 2241886 2240699 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_21650 2243627 2242227 gene locus_tag LOCUS_21660 2243627 2242227 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_21660 2244401 2243655 gene locus_tag LOCUS_21670 2244401 2243655 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938201.1 protein_id gnl|my_center|LOCUS_21670 2247137 2244570 gene locus_tag LOCUS_21680 2247137 2244570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2248432 2247134 gene locus_tag LOCUS_21690 2248432 2247134 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842634.1 protein_id gnl|my_center|LOCUS_21690 2248502 2248915 gene locus_tag LOCUS_21700 2248502 2248915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 2249321 2249124 gene locus_tag LOCUS_21710 2249321 2249124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2249843 2249358 gene locus_tag LOCUS_21720 2249843 2249358 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945236.1 protein_id gnl|my_center|LOCUS_21720 2249776 2250432 gene locus_tag LOCUS_21730 2249776 2250432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 2251282 2250800 gene locus_tag LOCUS_21740 gene rfaE2 2251282 2250800 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937455.1 protein_id gnl|my_center|LOCUS_21740 2252052 2251282 gene locus_tag LOCUS_21750 2252052 2251282 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937454.1 protein_id gnl|my_center|LOCUS_21750 2253902 2252232 gene locus_tag LOCUS_21760 2253902 2252232 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939625.1 protein_id gnl|my_center|LOCUS_21760 2255997 2253883 gene locus_tag LOCUS_21770 2255997 2253883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2256141 2256983 gene locus_tag LOCUS_21780 2256141 2256983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2257334 2258002 gene locus_tag LOCUS_21790 2257334 2258002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 2258008 2258874 gene locus_tag LOCUS_21800 2258008 2258874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 2258862 2260289 gene locus_tag LOCUS_21810 2258862 2260289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2260371 2261438 gene locus_tag LOCUS_21820 2260371 2261438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 2261440 2262150 gene locus_tag LOCUS_21830 gene pseF 2261440 2262150 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002777693.1 protein_id gnl|my_center|LOCUS_21830 2262173 2263180 gene locus_tag LOCUS_21840 2262173 2263180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2263164 2264492 gene locus_tag LOCUS_21850 2263164 2264492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2264492 2265460 gene locus_tag LOCUS_21860 2264492 2265460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2265447 2266415 gene locus_tag LOCUS_21870 2265447 2266415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 2266412 2267710 gene locus_tag LOCUS_21880 2266412 2267710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 2268850 2267723 gene locus_tag LOCUS_21890 2268850 2267723 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015749.1 protein_id gnl|my_center|LOCUS_21890 2270268 2268850 gene locus_tag LOCUS_21900 2270268 2268850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2271517 2270255 gene locus_tag LOCUS_21910 2271517 2270255 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869425.1 protein_id gnl|my_center|LOCUS_21910 2272514 2271522 gene locus_tag LOCUS_21920 2272514 2271522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2273911 2272541 gene locus_tag LOCUS_21930 2273911 2272541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2274609 2273908 gene locus_tag LOCUS_21940 2274609 2273908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2275940 2274600 gene locus_tag LOCUS_21950 2275940 2274600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21950 2276463 2275828 gene locus_tag LOCUS_21960 2276463 2275828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21960 2277236 2276463 gene locus_tag LOCUS_21970 2277236 2276463 CDS product CTP:phosphoglutamine cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858404.1 protein_id gnl|my_center|LOCUS_21970 2277883 2277251 gene locus_tag LOCUS_21980 2277883 2277251 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201881088.1 protein_id gnl|my_center|LOCUS_21980 2278657 2277929 gene locus_tag LOCUS_21990 2278657 2277929 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707813.1 protein_id gnl|my_center|LOCUS_21990 2279352 2278645 gene locus_tag LOCUS_22000 2279352 2278645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 2279858 2279349 gene locus_tag LOCUS_22010 2279858 2279349 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707815.1 protein_id gnl|my_center|LOCUS_22010 2282251 2279867 gene locus_tag LOCUS_22020 2282251 2279867 CDS product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707812.1 protein_id gnl|my_center|LOCUS_22020 2282554 2283270 gene locus_tag LOCUS_22030 gene hisH 2282554 2283270 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817212.1 protein_id gnl|my_center|LOCUS_22030 2283264 2284130 gene locus_tag LOCUS_22040 2283264 2284130 CDS product imidazole glycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869427.1 protein_id gnl|my_center|LOCUS_22040 2284942 2284193 gene locus_tag LOCUS_22050 2284942 2284193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2287506 2284942 gene locus_tag LOCUS_22060 2287506 2284942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2288600 2287506 gene locus_tag LOCUS_22070 2288600 2287506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 2289536 2288634 gene locus_tag LOCUS_22080 2289536 2288634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 2290288 2289533 gene locus_tag LOCUS_22090 2290288 2289533 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143772.1 protein_id gnl|my_center|LOCUS_22090 2291955 2290288 gene locus_tag LOCUS_22100 2291955 2290288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22100 2292397 2294418 gene locus_tag LOCUS_22110 2292397 2294418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2294349 2294546 gene locus_tag LOCUS_22120 2294349 2294546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 2294543 2295631 gene locus_tag LOCUS_22130 gene gmd 2294543 2295631 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_22130 2295634 2296575 gene locus_tag LOCUS_22140 2295634 2296575 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937401.1 protein_id gnl|my_center|LOCUS_22140 2296796 2297578 gene locus_tag LOCUS_22150 2296796 2297578 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937650.1 protein_id gnl|my_center|LOCUS_22150 2297581 2298528 gene locus_tag LOCUS_22160 2297581 2298528 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937646.1 protein_id gnl|my_center|LOCUS_22160 2298525 2299421 gene locus_tag LOCUS_22170 2298525 2299421 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937649.1 protein_id gnl|my_center|LOCUS_22170 2299424 2300077 gene locus_tag LOCUS_22180 2299424 2300077 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937645.1 protein_id gnl|my_center|LOCUS_22180 2300471 2300740 gene locus_tag LOCUS_22190 2300471 2300740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22190 2300743 2301723 gene locus_tag LOCUS_22200 gene galE 2300743 2301723 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876270.1 protein_id gnl|my_center|LOCUS_22200 2301814 2303229 gene locus_tag LOCUS_22210 2301814 2303229 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792552.1 protein_id gnl|my_center|LOCUS_22210 2303632 2303279 gene locus_tag LOCUS_22220 2303632 2303279 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524184.1 protein_id gnl|my_center|LOCUS_22220 2303751 2304230 gene locus_tag LOCUS_22230 2303751 2304230 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940309.1 protein_id gnl|my_center|LOCUS_22230 2304314 2305177 gene locus_tag LOCUS_22240 gene ubiA 2304314 2305177 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792606.1 protein_id gnl|my_center|LOCUS_22240 2305207 2306520 gene locus_tag LOCUS_22250 2305207 2306520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2307549 2306884 gene locus_tag LOCUS_22260 gene phoU 2307549 2306884 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938384.1 protein_id gnl|my_center|LOCUS_22260 2308352 2307591 gene locus_tag LOCUS_22270 gene pstB 2308352 2307591 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938383.1 protein_id gnl|my_center|LOCUS_22270 2309302 2308481 gene locus_tag LOCUS_22280 2309302 2308481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 2310326 2309442 gene locus_tag LOCUS_22290 gene folD 2310326 2309442 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937630.1 protein_id gnl|my_center|LOCUS_22290 2311607 2310396 gene locus_tag LOCUS_22300 2311607 2310396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2312408 2311692 gene locus_tag LOCUS_22310 2312408 2311692 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932386.1 protein_id gnl|my_center|LOCUS_22310 2312805 2312398 gene locus_tag LOCUS_22320 2312805 2312398 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937348.1 protein_id gnl|my_center|LOCUS_22320 2312939 2314105 gene locus_tag LOCUS_22330 2312939 2314105 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938041.1 protein_id gnl|my_center|LOCUS_22330 2314116 2314718 gene locus_tag LOCUS_22340 2314116 2314718 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941805.1 protein_id gnl|my_center|LOCUS_22340 2314721 2315527 gene locus_tag LOCUS_22350 gene budA 2314721 2315527 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705051.1 protein_id gnl|my_center|LOCUS_22350 2315524 2315826 gene locus_tag LOCUS_22360 2315524 2315826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 2315836 2316798 gene locus_tag LOCUS_22370 2315836 2316798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 2316894 2318945 gene locus_tag LOCUS_22380 2316894 2318945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2321803 2319035 gene locus_tag LOCUS_22390 gene uvrA 2321803 2319035 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_22390 2322482 2321862 gene locus_tag LOCUS_22400 2322482 2321862 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792236.1 protein_id gnl|my_center|LOCUS_22400 2322652 2323710 gene locus_tag LOCUS_22410 2322652 2323710 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938360.1 protein_id gnl|my_center|LOCUS_22410 2323918 2324919 gene locus_tag LOCUS_22420 2323918 2324919 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792769.1 protein_id gnl|my_center|LOCUS_22420 2326268 2324997 gene locus_tag LOCUS_22430 gene tyrS 2326268 2324997 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_22430 2327061 2326288 gene locus_tag LOCUS_22440 2327061 2326288 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938251.1 protein_id gnl|my_center|LOCUS_22440 2328068 2327154 gene locus_tag LOCUS_22450 2328068 2327154 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_22450 2329785 2328229 gene locus_tag LOCUS_22460 gene rny 2329785 2328229 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939940.1 protein_id gnl|my_center|LOCUS_22460 2330430 2330176 gene locus_tag LOCUS_22470 gene zapA 2330430 2330176 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939939.1 protein_id gnl|my_center|LOCUS_22470 2330625 2330443 gene locus_tag LOCUS_22480 2330625 2330443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2332024 2330651 gene locus_tag LOCUS_22490 gene glmU 2332024 2330651 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939937.1 protein_id gnl|my_center|LOCUS_22490 2332980 2332246 gene locus_tag LOCUS_22500 2332980 2332246 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940003.1 protein_id gnl|my_center|LOCUS_22500 2333199 2334230 gene locus_tag LOCUS_22510 2333199 2334230 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256666.1 protein_id gnl|my_center|LOCUS_22510 2334687 2336006 gene locus_tag LOCUS_22520 2334687 2336006 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937721.1 protein_id gnl|my_center|LOCUS_22520 2337333 2336440 gene locus_tag LOCUS_22530 gene sppA 2337333 2336440 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940407.1 protein_id gnl|my_center|LOCUS_22530 2339093 2337345 gene locus_tag LOCUS_22540 2339093 2337345 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940408.1 protein_id gnl|my_center|LOCUS_22540 2340263 2339541 gene locus_tag LOCUS_22550 2340263 2339541 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_22550 2341499 2340276 gene locus_tag LOCUS_22560 2341499 2340276 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764931.1 protein_id gnl|my_center|LOCUS_22560 2342382 2341480 gene locus_tag LOCUS_22570 gene livH 2342382 2341480 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523160.1 protein_id gnl|my_center|LOCUS_22570 2343573 2342449 gene locus_tag LOCUS_22580 2343573 2342449 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082136.1 protein_id gnl|my_center|LOCUS_22580 2344368 2343613 gene locus_tag LOCUS_22590 2344368 2343613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 protein_id gnl|my_center|LOCUS_22590 2344732 2345208 gene locus_tag LOCUS_22600 2344732 2345208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 2345205 2345387 gene locus_tag LOCUS_22610 2345205 2345387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2347713 2345815 gene locus_tag LOCUS_22620 2347713 2345815 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_22620 2349664 2347739 gene locus_tag LOCUS_22630 2349664 2347739 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938363.1 protein_id gnl|my_center|LOCUS_22630 2350216 2349905 gene locus_tag LOCUS_22640 2350216 2349905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2351798 2350182 gene locus_tag LOCUS_22650 2351798 2350182 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938144.1 protein_id gnl|my_center|LOCUS_22650 2353511 2352216 gene locus_tag LOCUS_22660 gene sat 2353511 2352216 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938590.1 protein_id gnl|my_center|LOCUS_22660 2354118 2354612 gene locus_tag LOCUS_22670 gene aprB 2354118 2354612 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938146.1 protein_id gnl|my_center|LOCUS_22670 2354683 2356674 gene locus_tag LOCUS_22680 gene aprA 2354683 2356674 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938147.1 protein_id gnl|my_center|LOCUS_22680 2356831 2358078 gene locus_tag LOCUS_22690 2356831 2358078 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938148.1 protein_id gnl|my_center|LOCUS_22690 2358082 2360337 gene locus_tag LOCUS_22700 2358082 2360337 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938149.1 protein_id gnl|my_center|LOCUS_22700 2360350 2361615 gene locus_tag LOCUS_22710 gene qmoC 2360350 2361615 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938150.1 protein_id gnl|my_center|LOCUS_22710 2361668 2362318 gene locus_tag LOCUS_22720 2361668 2362318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 2364974 2363652 gene locus_tag LOCUS_22730 2364974 2363652 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940163.1 protein_id gnl|my_center|LOCUS_22730 2366329 2365046 gene locus_tag LOCUS_22740 2366329 2365046 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940162.1 protein_id gnl|my_center|LOCUS_22740 2367355 2366426 gene locus_tag LOCUS_22750 2367355 2366426 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940161.1 protein_id gnl|my_center|LOCUS_22750 2368684 2367551 gene locus_tag LOCUS_22760 2368684 2367551 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940160.1 protein_id gnl|my_center|LOCUS_22760 2369872 2368790 gene locus_tag LOCUS_22770 2369872 2368790 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937701.1 protein_id gnl|my_center|LOCUS_22770 2370822 2369824 gene locus_tag LOCUS_22780 gene galE 2370822 2369824 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876270.1 protein_id gnl|my_center|LOCUS_22780 2370974 2372626 gene locus_tag LOCUS_22790 2370974 2372626 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_22790 2373324 2372623 gene locus_tag LOCUS_22800 2373324 2372623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22800 2373209 2373688 gene locus_tag LOCUS_22810 2373209 2373688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 2373779 2375008 gene locus_tag LOCUS_22820 2373779 2375008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2375025 2376302 gene locus_tag LOCUS_22830 2375025 2376302 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940618.1 protein_id gnl|my_center|LOCUS_22830 2376461 2378863 gene locus_tag LOCUS_22840 2376461 2378863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2381245 2378876 gene locus_tag LOCUS_22850 2381245 2378876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2382036 2381404 gene locus_tag LOCUS_22860 2382036 2381404 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938215.1 protein_id gnl|my_center|LOCUS_22860 2382445 2382140 gene locus_tag LOCUS_22870 gene atpE 2382445 2382140 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792634.1 protein_id gnl|my_center|LOCUS_22870 2383208 2382516 gene locus_tag LOCUS_22880 gene atpB 2383208 2382516 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938217.1 protein_id gnl|my_center|LOCUS_22880 2383654 2383235 gene locus_tag LOCUS_22890 2383654 2383235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 2383937 2383644 gene locus_tag LOCUS_22900 2383937 2383644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 2385507 2384239 gene locus_tag LOCUS_22910 2385507 2384239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 2386068 2385535 gene locus_tag LOCUS_22920 gene hpt 2386068 2385535 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938879.1 protein_id gnl|my_center|LOCUS_22920 2386548 2386087 gene locus_tag LOCUS_22930 2386548 2386087 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938878.1 protein_id gnl|my_center|LOCUS_22930 2387044 2386550 gene locus_tag LOCUS_22940 2387044 2386550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 2389572 2387155 gene locus_tag LOCUS_22950 2389572 2387155 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938876.1 protein_id gnl|my_center|LOCUS_22950 2389959 2391005 gene locus_tag LOCUS_22960 2389959 2391005 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_22960 2391221 2392960 gene locus_tag LOCUS_22970 2391221 2392960 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938874.1 protein_id gnl|my_center|LOCUS_22970 2392957 2393817 gene locus_tag LOCUS_22980 2392957 2393817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 2393814 2394128 gene locus_tag LOCUS_22990 2393814 2394128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 2394138 2394578 gene locus_tag LOCUS_23000 gene rpiB 2394138 2394578 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938871.1 protein_id gnl|my_center|LOCUS_23000 2394605 2396584 gene locus_tag LOCUS_23010 gene tkt 2394605 2396584 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_23010 2396595 2397578 gene locus_tag LOCUS_23020 gene glpX 2396595 2397578 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938831.1 protein_id gnl|my_center|LOCUS_23020 2397761 2400175 gene locus_tag LOCUS_23030 2397761 2400175 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939179.1 protein_id gnl|my_center|LOCUS_23030 2400175 2400945 gene locus_tag LOCUS_23040 2400175 2400945 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937706.1 protein_id gnl|my_center|LOCUS_23040 2400996 2401463 gene locus_tag LOCUS_23050 2400996 2401463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2404530 2401846 gene locus_tag LOCUS_23060 2404530 2401846 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052877.1 protein_id gnl|my_center|LOCUS_23060 2404709 2405443 gene locus_tag LOCUS_23070 2404709 2405443 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_23070 2405543 2406442 gene locus_tag LOCUS_23080 2405543 2406442 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_23080 2406547 2407950 gene locus_tag LOCUS_23090 2406547 2407950 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_23090 2408743 2408054 gene locus_tag LOCUS_23100 2408743 2408054 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938543.1 protein_id gnl|my_center|LOCUS_23100 2410408 2408765 gene locus_tag LOCUS_23110 gene argS 2410408 2408765 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938544.1 protein_id gnl|my_center|LOCUS_23110 2410706 2411680 gene locus_tag LOCUS_23120 2410706 2411680 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392003.1 protein_id gnl|my_center|LOCUS_23120 2411682 2412461 gene locus_tag LOCUS_23130 2411682 2412461 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530487.1 protein_id gnl|my_center|LOCUS_23130 2412534 2413295 gene locus_tag LOCUS_23140 2412534 2413295 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975298.1 protein_id gnl|my_center|LOCUS_23140 2414375 2413446 gene locus_tag LOCUS_23150 gene selD 2414375 2413446 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:B8DNL1 protein_id gnl|my_center|LOCUS_23150 2417419 2414600 gene locus_tag LOCUS_23160 2417419 2414600 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463958.1 protein_id gnl|my_center|LOCUS_23160 2418027 2417593 gene locus_tag LOCUS_23170 2418027 2417593 CDS product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704738.1 protein_id gnl|my_center|LOCUS_23170 2418866 2418102 gene locus_tag LOCUS_23180 2418866 2418102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2419688 2418921 gene locus_tag LOCUS_23190 2419688 2418921 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707450.1 protein_id gnl|my_center|LOCUS_23190 2420562 2419699 gene locus_tag LOCUS_23200 2420562 2419699 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_23200 2421035 2420559 gene locus_tag LOCUS_23210 2421035 2420559 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080666.1 protein_id gnl|my_center|LOCUS_23210 2421224 2422606 gene locus_tag LOCUS_23220 2421224 2422606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2423921 2422680 gene locus_tag LOCUS_23230 2423921 2422680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 2425640 2424390 gene locus_tag LOCUS_23240 2425640 2424390 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963645.1 protein_id gnl|my_center|LOCUS_23240 2425862 2429410 gene locus_tag LOCUS_23250 gene dnaE 2425862 2429410 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938648.1 protein_id gnl|my_center|LOCUS_23250 2431391 2429505 gene locus_tag LOCUS_23260 2431391 2429505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2432811 2431567 gene locus_tag LOCUS_23270 2432811 2431567 CDS product BPL-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294597.1 protein_id gnl|my_center|LOCUS_23270 2432932 2435598 gene locus_tag LOCUS_23280 2432932 2435598 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938033.1 protein_id gnl|my_center|LOCUS_23280 2435832 2437340 gene locus_tag LOCUS_23290 gene cobA 2435832 2437340 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_23290 2438636 2437953 gene locus_tag LOCUS_23300 2438636 2437953 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_23300 2441598 2438725 gene locus_tag LOCUS_23310 2441598 2438725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 2442574 2441738 gene locus_tag LOCUS_23320 2442574 2441738 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681808.1 protein_id gnl|my_center|LOCUS_23320 2442623 2442808 gene locus_tag LOCUS_23330 2442623 2442808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2444180 2442837 gene locus_tag LOCUS_23340 2444180 2442837 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940646.1 protein_id gnl|my_center|LOCUS_23340 2445382 2444438 gene locus_tag LOCUS_23350 2445382 2444438 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930636.1 protein_id gnl|my_center|LOCUS_23350 2445786 2447768 gene locus_tag LOCUS_23360 gene acs 2445786 2447768 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940228.1 protein_id gnl|my_center|LOCUS_23360 2447922 2449256 gene locus_tag LOCUS_23370 2447922 2449256 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400962.1 protein_id gnl|my_center|LOCUS_23370 2449283 2450605 gene locus_tag LOCUS_23380 gene radA 2449283 2450605 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938881.1 protein_id gnl|my_center|LOCUS_23380 2450659 2451426 gene locus_tag LOCUS_23390 2450659 2451426 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950478.1 protein_id gnl|my_center|LOCUS_23390 2451802 2451518 gene locus_tag LOCUS_23400 2451802 2451518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 2451954 2452047 gene locus_tag LOCUS_t00520 2451954 2452047 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 2453173 2452232 gene locus_tag LOCUS_23410 2453173 2452232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 2453958 2453533 gene locus_tag LOCUS_23420 2453958 2453533 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_23420 2455368 2453971 gene locus_tag LOCUS_23430 gene atpD 2455368 2453971 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938076.1 protein_id gnl|my_center|LOCUS_23430 2456266 2455385 gene locus_tag LOCUS_23440 2456266 2455385 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938077.1 protein_id gnl|my_center|LOCUS_23440 2457791 2456283 gene locus_tag LOCUS_23450 gene atpA 2457791 2456283 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938078.1 protein_id gnl|my_center|LOCUS_23450 2458347 2457796 gene locus_tag LOCUS_23460 gene atpH 2458347 2457796 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938079.1 protein_id gnl|my_center|LOCUS_23460 2458919 2458344 gene locus_tag LOCUS_23470 2458919 2458344 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792710.1 protein_id gnl|my_center|LOCUS_23470 2459366 2458944 gene locus_tag LOCUS_23480 2459366 2458944 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792709.1 protein_id gnl|my_center|LOCUS_23480 2459865 2459491 gene locus_tag LOCUS_23490 2459865 2459491 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938085.1 protein_id gnl|my_center|LOCUS_23490 2461020 2459914 gene locus_tag LOCUS_23500 gene rodA 2461020 2459914 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938086.1 protein_id gnl|my_center|LOCUS_23500 2462887 2461010 gene locus_tag LOCUS_23510 gene mrdA 2462887 2461010 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938087.1 protein_id gnl|my_center|LOCUS_23510 2463359 2462871 gene locus_tag LOCUS_23520 2463359 2462871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938088.1 protein_id gnl|my_center|LOCUS_23520 2464161 2463340 gene locus_tag LOCUS_23530 gene mreC 2464161 2463340 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938089.1 protein_id gnl|my_center|LOCUS_23530 2465247 2464204 gene locus_tag LOCUS_23540 2465247 2464204 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_23540 2465415 2466395 gene locus_tag LOCUS_23550 2465415 2466395 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938091.1 protein_id gnl|my_center|LOCUS_23550 2466421 2466918 gene locus_tag LOCUS_23560 2466421 2466918 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938092.1 protein_id gnl|my_center|LOCUS_23560 2467380 2468495 gene locus_tag LOCUS_23570 2467380 2468495 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625896.1 protein_id gnl|my_center|LOCUS_23570 2468495 2469088 gene locus_tag LOCUS_23580 2468495 2469088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 2469088 2470257 gene locus_tag LOCUS_23590 2469088 2470257 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141066.1 protein_id gnl|my_center|LOCUS_23590 2470293 2470919 gene locus_tag LOCUS_23600 gene rhtB 2470293 2470919 CDS product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099249.1 protein_id gnl|my_center|LOCUS_23600 2471562 2471293 gene locus_tag LOCUS_23610 gene fliQ 2471562 2471293 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937354.1 protein_id gnl|my_center|LOCUS_23610 2472362 2471598 gene locus_tag LOCUS_23620 gene fliP 2472362 2471598 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524186.1 protein_id gnl|my_center|LOCUS_23620 2472738 2472340 gene locus_tag LOCUS_23630 2472738 2472340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 2473255 2472731 gene locus_tag LOCUS_23640 gene fliN 2473255 2472731 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937357.1 protein_id gnl|my_center|LOCUS_23640 2473786 2473343 gene locus_tag LOCUS_23650 2473786 2473343 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793169.1 protein_id gnl|my_center|LOCUS_23650 2474630 2473911 gene locus_tag LOCUS_23660 2474630 2473911 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937359.1 protein_id gnl|my_center|LOCUS_23660 2475451 2474633 gene locus_tag LOCUS_23670 2475451 2474633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 2475904 2475479 gene locus_tag LOCUS_23680 2475904 2475479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23680 2476282 2475920 gene locus_tag LOCUS_23690 2476282 2475920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23690 2476998 2476306 gene locus_tag LOCUS_23700 2476998 2476306 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937362.1 protein_id gnl|my_center|LOCUS_23700 2477257 2480220 gene locus_tag LOCUS_23710 2477257 2480220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 2482288 2480765 gene locus_tag LOCUS_23720 2482288 2480765 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704053.1 protein_id gnl|my_center|LOCUS_23720 2483042 2482338 gene locus_tag LOCUS_23730 2483042 2482338 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939817.1 protein_id gnl|my_center|LOCUS_23730 2483271 2483642 gene locus_tag LOCUS_23740 2483271 2483642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23740 2483649 2484992 gene locus_tag LOCUS_23750 2483649 2484992 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23750 2484996 2485652 gene locus_tag LOCUS_23760 2484996 2485652 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_23760 2486352 2485735 gene locus_tag LOCUS_23770 gene lepB 2486352 2485735 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938005.1 protein_id gnl|my_center|LOCUS_23770 2488224 2486419 gene locus_tag LOCUS_23780 gene lepA 2488224 2486419 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938004.1 protein_id gnl|my_center|LOCUS_23780 2489413 2488487 gene locus_tag LOCUS_23790 gene fabD 2489413 2488487 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938545.1 protein_id gnl|my_center|LOCUS_23790 2489733 2492519 gene locus_tag LOCUS_23800 gene yapF 2489733 2492519 CDS product autotransporter YapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210389.1 protein_id gnl|my_center|LOCUS_23800 2493099 2495015 gene locus_tag LOCUS_23810 2493099 2495015 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938902.1 protein_id gnl|my_center|LOCUS_23810 2495080 2495238 gene locus_tag LOCUS_23820 2495080 2495238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2495397 2496545 gene locus_tag LOCUS_23830 2495397 2496545 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_23830 2497332 2496553 gene locus_tag LOCUS_23840 gene fetB 2497332 2496553 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926980.1 protein_id gnl|my_center|LOCUS_23840 2497976 2497329 gene locus_tag LOCUS_23850 2497976 2497329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792861.1 protein_id gnl|my_center|LOCUS_23850 2498791 2497973 gene locus_tag LOCUS_23860 2498791 2497973 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938201.1 protein_id gnl|my_center|LOCUS_23860 2499090 2499650 gene locus_tag LOCUS_23870 2499090 2499650 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940325.1 protein_id gnl|my_center|LOCUS_23870 2500289 2501308 gene locus_tag LOCUS_23880 2500289 2501308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23880 2501516 2502064 gene locus_tag LOCUS_23890 2501516 2502064 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939526.1 protein_id gnl|my_center|LOCUS_23890 2502157 2503794 gene locus_tag LOCUS_23900 2502157 2503794 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939525.1 protein_id gnl|my_center|LOCUS_23900 2505152 2504496 gene locus_tag LOCUS_23910 2505152 2504496 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 protein_id gnl|my_center|LOCUS_23910 2509029 2507500 gene locus_tag LOCUS_23920 2509029 2507500 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420103.1 protein_id gnl|my_center|LOCUS_23920 2509384 2509674 gene locus_tag LOCUS_23930 2509384 2509674 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869489.1 protein_id gnl|my_center|LOCUS_23930 2510156 2511064 gene locus_tag LOCUS_23940 gene era 2510156 2511064 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937363.1 protein_id gnl|my_center|LOCUS_23940 2512172 2511534 gene locus_tag LOCUS_23950 2512172 2511534 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880277.1 protein_id gnl|my_center|LOCUS_23950 2512389 2515301 gene locus_tag LOCUS_23960 2512389 2515301 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938240.1 protein_id gnl|my_center|LOCUS_23960 2517491 2515677 gene locus_tag LOCUS_23970 2517491 2515677 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723553.1 protein_id gnl|my_center|LOCUS_23970 2518956 2518096 gene locus_tag LOCUS_23980 2518956 2518096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 2519735 2518953 gene locus_tag LOCUS_23990 2519735 2518953 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331956.1 protein_id gnl|my_center|LOCUS_23990 2519850 2520959 gene locus_tag LOCUS_24000 2519850 2520959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2521344 2522294 gene locus_tag LOCUS_24010 2521344 2522294 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310733.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24010 2522291 2523571 gene locus_tag LOCUS_24020 2522291 2523571 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992353.1 protein_id gnl|my_center|LOCUS_24020 2523777 2524823 gene locus_tag LOCUS_24030 2523777 2524823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 2525569 2524952 gene locus_tag LOCUS_24040 2525569 2524952 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940031.1 protein_id gnl|my_center|LOCUS_24040 2526521 2525814 gene locus_tag LOCUS_24050 2526521 2525814 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903848.1 protein_id gnl|my_center|LOCUS_24050 2526798 2526616 gene locus_tag LOCUS_24060 2526798 2526616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 2528450 2526981 gene locus_tag LOCUS_24070 gene panF 2528450 2526981 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937399.1 protein_id gnl|my_center|LOCUS_24070 2528770 2528447 gene locus_tag LOCUS_24080 2528770 2528447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 2529319 2529032 gene locus_tag LOCUS_24090 2529319 2529032 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081081.1 protein_id gnl|my_center|LOCUS_24090 2530602 2529316 gene locus_tag LOCUS_24100 2530602 2529316 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461742.1 protein_id gnl|my_center|LOCUS_24100 2532333 2530744 gene locus_tag LOCUS_24110 2532333 2530744 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878469.1 protein_id gnl|my_center|LOCUS_24110 2534088 2533147 gene locus_tag LOCUS_24120 2534088 2533147 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032189.1 protein_id gnl|my_center|LOCUS_24120 2534872 2534099 gene locus_tag LOCUS_24130 2534872 2534099 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692225.1 protein_id gnl|my_center|LOCUS_24130 2535839 2534988 gene locus_tag LOCUS_24140 2535839 2534988 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494241.1 protein_id gnl|my_center|LOCUS_24140 2537575 2535959 gene locus_tag LOCUS_24150 gene caiC 2537575 2535959 CDS product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309938.1 protein_id gnl|my_center|LOCUS_24150 2539074 2537842 gene locus_tag LOCUS_24160 gene caiB 2539074 2537842 CDS product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349942.1 protein_id gnl|my_center|LOCUS_24160 2540256 2539120 gene locus_tag LOCUS_24170 gene caiA 2540256 2539120 CDS product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 protein_id gnl|my_center|LOCUS_24170 2541825 2540311 gene locus_tag LOCUS_24180 gene caiT 2541825 2540311 CDS product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787104.1 protein_id gnl|my_center|LOCUS_24180 2543570 2542554 gene locus_tag LOCUS_24190 2543570 2542554 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879724.1 protein_id gnl|my_center|LOCUS_24190 2544484 2543651 gene locus_tag LOCUS_24200 2544484 2543651 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940619.1 protein_id gnl|my_center|LOCUS_24200 2545453 2544491 gene locus_tag LOCUS_24210 gene fmt 2545453 2544491 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940620.1 protein_id gnl|my_center|LOCUS_24210 2546010 2545441 gene locus_tag LOCUS_24220 gene def 2546010 2545441 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940621.1 protein_id gnl|my_center|LOCUS_24220 2546156 2546986 gene locus_tag LOCUS_24230 2546156 2546986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 2547108 2547773 gene locus_tag LOCUS_24240 2547108 2547773 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879601.1 protein_id gnl|my_center|LOCUS_24240 2548298 2547858 gene locus_tag LOCUS_24250 2548298 2547858 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 protein_id gnl|my_center|LOCUS_24250 2549388 2548282 gene locus_tag LOCUS_24260 2549388 2548282 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036848.1 protein_id gnl|my_center|LOCUS_24260 2550063 2549581 gene locus_tag LOCUS_24270 gene purE 2550063 2549581 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937794.1 protein_id gnl|my_center|LOCUS_24270 2551449 2550172 gene locus_tag LOCUS_24280 gene purD 2551449 2550172 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937795.1 protein_id gnl|my_center|LOCUS_24280 2552689 2551655 gene locus_tag LOCUS_24290 2552689 2551655 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_24290 2553785 2552691 gene locus_tag LOCUS_24300 2553785 2552691 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146644.1 protein_id gnl|my_center|LOCUS_24300 2554773 2553850 gene locus_tag LOCUS_24310 2554773 2553850 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081440.1 protein_id gnl|my_center|LOCUS_24310 2555816 2554785 gene locus_tag LOCUS_24320 2555816 2554785 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081437.1 protein_id gnl|my_center|LOCUS_24320 2557623 2555890 gene locus_tag LOCUS_24330 2557623 2555890 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081506.1 protein_id gnl|my_center|LOCUS_24330 2558022 2558378 gene locus_tag LOCUS_24340 2558022 2558378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2558382 2558567 gene locus_tag LOCUS_24350 2558382 2558567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2559723 2558860 gene locus_tag LOCUS_24360 2559723 2558860 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454103.1 protein_id gnl|my_center|LOCUS_24360 2559899 2560630 gene locus_tag LOCUS_24370 2559899 2560630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2562010 2561237 gene locus_tag LOCUS_24380 2562010 2561237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2562881 2562015 gene locus_tag LOCUS_24390 2562881 2562015 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_24390 2563839 2563045 gene locus_tag LOCUS_24400 2563839 2563045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 2566422 2563978 gene locus_tag LOCUS_24410 gene gyrA 2566422 2563978 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524181.1 protein_id gnl|my_center|LOCUS_24410 2568964 2566571 gene locus_tag LOCUS_24420 gene gyrB 2568964 2566571 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937314.1 protein_id gnl|my_center|LOCUS_24420 2570131 2568968 gene locus_tag LOCUS_24430 gene dnaN 2570131 2568968 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937313.1 protein_id gnl|my_center|LOCUS_24430 2571578 2570280 gene locus_tag LOCUS_24440 2571578 2570280 CDS product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937312.1 protein_id gnl|my_center|LOCUS_24440 2571830 2572999 gene locus_tag LOCUS_24450 2571830 2572999 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940198.1 protein_id gnl|my_center|LOCUS_24450 2575557 2573074 gene locus_tag LOCUS_24460 2575557 2573074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 2576504 2575704 gene locus_tag LOCUS_24470 2576504 2575704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2577851 2576562 gene locus_tag LOCUS_24480 gene eno 2577851 2576562 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937629.1 protein_id gnl|my_center|LOCUS_24480 2578738 2577965 gene locus_tag LOCUS_24490 2578738 2577965 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937628.1 protein_id gnl|my_center|LOCUS_24490 2578886 2579926 gene locus_tag LOCUS_24500 2578886 2579926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939755.1 protein_id gnl|my_center|LOCUS_24500 2579930 2582416 gene locus_tag LOCUS_24510 2579930 2582416 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015774797.1 protein_id gnl|my_center|LOCUS_24510 2583442 2582567 gene locus_tag LOCUS_24520 2583442 2582567 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217633758.1 protein_id gnl|my_center|LOCUS_24520 2583695 2583620 gene locus_tag LOCUS_t00530 2583695 2583620 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2585522 2583759 gene locus_tag LOCUS_24530 2585522 2583759 CDS product aldehyde ferredoxin oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792756.1 protein_id gnl|my_center|LOCUS_24530 2585962 2585519 gene locus_tag LOCUS_24540 2585962 2585519 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792757.1 protein_id gnl|my_center|LOCUS_24540 2587637 2585982 gene locus_tag LOCUS_24550 2587637 2585982 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939091.1 protein_id gnl|my_center|LOCUS_24550 2587858 2589354 gene locus_tag LOCUS_24560 2587858 2589354 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939092.1 protein_id gnl|my_center|LOCUS_24560 2589875 2589675 gene locus_tag LOCUS_24570 2589875 2589675 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939599.1 protein_id gnl|my_center|LOCUS_24570 2589956 2590996 gene locus_tag LOCUS_24580 2589956 2590996 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940459.1 protein_id gnl|my_center|LOCUS_24580 2591118 2592302 gene locus_tag LOCUS_24590 2591118 2592302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 2592299 2592844 gene locus_tag LOCUS_24600 2592299 2592844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2592937 2593551 gene locus_tag LOCUS_24610 2592937 2593551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2594543 2593665 gene locus_tag LOCUS_24620 gene hisG 2594543 2593665 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937425.1 protein_id gnl|my_center|LOCUS_24620 2594917 2594543 gene locus_tag LOCUS_24630 gene hisI 2594917 2594543 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_24630 2596292 2595129 gene locus_tag LOCUS_24640 2596292 2595129 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021990.1 protein_id gnl|my_center|LOCUS_24640 2597674 2596295 gene locus_tag LOCUS_24650 2597674 2596295 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_24650 2599167 2597743 gene locus_tag LOCUS_24660 2599167 2597743 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791433.1 protein_id gnl|my_center|LOCUS_24660 2600511 2599171 gene locus_tag LOCUS_24670 2600511 2599171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940480.1 protein_id gnl|my_center|LOCUS_24670 2600798 2601607 gene locus_tag LOCUS_24680 gene aroE 2600798 2601607 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937426.1 protein_id gnl|my_center|LOCUS_24680 2601650 2602294 gene locus_tag LOCUS_24690 gene ppiA 2601650 2602294 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099061.1 protein_id gnl|my_center|LOCUS_24690 2603802 2602465 gene locus_tag LOCUS_24700 2603802 2602465 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939416.1 protein_id gnl|my_center|LOCUS_24700 2605513 2603807 gene locus_tag LOCUS_24710 2605513 2603807 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939515.1 protein_id gnl|my_center|LOCUS_24710 2605722 2607542 gene locus_tag LOCUS_24720 2605722 2607542 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_24720 2607885 2607520 gene locus_tag LOCUS_24730 2607885 2607520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 2608074 2608730 gene locus_tag LOCUS_24740 2608074 2608730 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629591.1 protein_id gnl|my_center|LOCUS_24740 2608837 2609307 gene locus_tag LOCUS_24750 2608837 2609307 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938550.1 protein_id gnl|my_center|LOCUS_24750 2610606 2609335 gene locus_tag LOCUS_24760 2610606 2609335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 2611372 2610608 gene locus_tag LOCUS_24770 2611372 2610608 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938095.1 protein_id gnl|my_center|LOCUS_24770 2611439 2612056 gene locus_tag LOCUS_24780 2611439 2612056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2612136 2613047 gene locus_tag LOCUS_24790 2612136 2613047 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_24790 2615447 2613132 gene locus_tag LOCUS_24800 2615447 2613132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2615597 2616061 gene locus_tag LOCUS_24810 2615597 2616061 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021181.1 protein_id gnl|my_center|LOCUS_24810 2616605 2616069 gene locus_tag LOCUS_24820 gene mobB 2616605 2616069 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393319.1 protein_id gnl|my_center|LOCUS_24820 2616700 2617509 gene locus_tag LOCUS_24830 gene fdhD 2616700 2617509 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227709.1 protein_id gnl|my_center|LOCUS_24830 2617514 2618728 gene locus_tag LOCUS_24840 2617514 2618728 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337145.1 protein_id gnl|my_center|LOCUS_24840 2618897 2619844 gene locus_tag LOCUS_24850 2618897 2619844 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937880.1 protein_id gnl|my_center|LOCUS_24850 2619856 2620800 gene locus_tag LOCUS_24860 2619856 2620800 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792819.1 protein_id gnl|my_center|LOCUS_24860 2620892 2623288 gene locus_tag LOCUS_24870 2620892 2623288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 2623847 2625718 gene locus_tag LOCUS_24880 2623847 2625718 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164561900.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24880 2626196 2627395 gene locus_tag LOCUS_24890 gene rocD 2626196 2627395 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391213.1 protein_id gnl|my_center|LOCUS_24890 2627447 2628775 gene locus_tag LOCUS_24900 2627447 2628775 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_24900 2629507 2628791 gene locus_tag LOCUS_24910 2629507 2628791 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940624.1 protein_id gnl|my_center|LOCUS_24910 2630438 2629593 gene locus_tag LOCUS_24920 2630438 2629593 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_24920 2630750 2630469 gene locus_tag LOCUS_24930 2630750 2630469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939234.1 protein_id gnl|my_center|LOCUS_24930 2630929 2630735 gene locus_tag LOCUS_24940 2630929 2630735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 2630941 2631489 gene locus_tag LOCUS_24950 2630941 2631489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 2631486 2631986 gene locus_tag LOCUS_24960 2631486 2631986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 2631998 2632738 gene locus_tag LOCUS_24970 2631998 2632738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 2633644 2632760 gene locus_tag LOCUS_24980 2633644 2632760 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808636.1 protein_id gnl|my_center|LOCUS_24980 2633791 2633955 gene locus_tag LOCUS_24990 2633791 2633955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2635334 2634141 gene locus_tag LOCUS_25000 2635334 2634141 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938142.1 protein_id gnl|my_center|LOCUS_25000 2635492 2636067 gene locus_tag LOCUS_25010 2635492 2636067 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792977.1 protein_id gnl|my_center|LOCUS_25010 2636055 2636819 gene locus_tag LOCUS_25020 2636055 2636819 CDS product polyphenol oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937672.1 protein_id gnl|my_center|LOCUS_25020 2636822 2636998 gene locus_tag LOCUS_25030 2636822 2636998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2637426 2637004 gene locus_tag LOCUS_25040 2637426 2637004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2639128 2637953 gene locus_tag LOCUS_25050 2639128 2637953 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940481.1 protein_id gnl|my_center|LOCUS_25050 2639890 2639255 gene locus_tag LOCUS_25060 2639890 2639255 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937896.1 protein_id gnl|my_center|LOCUS_25060 2639994 2640884 gene locus_tag LOCUS_25070 2639994 2640884 CDS product ArgP/LysG family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937897.1 protein_id gnl|my_center|LOCUS_25070 2641879 2640959 gene locus_tag LOCUS_25080 gene pstA 2641879 2640959 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939749.1 protein_id gnl|my_center|LOCUS_25080 2642852 2641929 gene locus_tag LOCUS_25090 gene pstC 2642852 2641929 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791822.1 protein_id gnl|my_center|LOCUS_25090 2643746 2642937 gene locus_tag LOCUS_25100 2643746 2642937 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_25100 2643944 2645305 gene locus_tag LOCUS_25110 2643944 2645305 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937602.1 protein_id gnl|my_center|LOCUS_25110 2645313 2646383 gene locus_tag LOCUS_25120 2645313 2646383 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937603.1 protein_id gnl|my_center|LOCUS_25120 2648255 2646627 gene locus_tag LOCUS_25130 2648255 2646627 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937974.1 protein_id gnl|my_center|LOCUS_25130 2651130 2648929 gene locus_tag LOCUS_25140 gene recQ 2651130 2648929 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245677.1 protein_id gnl|my_center|LOCUS_25140 2652363 2651317 gene locus_tag LOCUS_25150 2652363 2651317 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938354.1 protein_id gnl|my_center|LOCUS_25150 2652483 2652722 gene locus_tag LOCUS_25160 2652483 2652722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940344.1 protein_id gnl|my_center|LOCUS_25160 2655502 2653094 gene locus_tag LOCUS_25170 gene topA 2655502 2653094 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940644.1 protein_id gnl|my_center|LOCUS_25170 2656279 2655674 gene locus_tag LOCUS_25180 gene metW 2656279 2655674 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_25180 2657464 2656280 gene locus_tag LOCUS_25190 2657464 2656280 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_25190 2657896 2657498 gene locus_tag LOCUS_25200 2657896 2657498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 2659878 2657962 gene locus_tag LOCUS_25210 gene acs 2659878 2657962 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938049.1 protein_id gnl|my_center|LOCUS_25210 2660853 2659987 gene locus_tag LOCUS_25220 2660853 2659987 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938050.1 protein_id gnl|my_center|LOCUS_25220 2661032 2661619 gene locus_tag LOCUS_25230 2661032 2661619 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791612.1 protein_id gnl|my_center|LOCUS_25230 2661621 2663813 gene locus_tag LOCUS_25240 2661621 2663813 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940191.1 protein_id gnl|my_center|LOCUS_25240 2663898 2664134 gene locus_tag LOCUS_25250 2663898 2664134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2664186 2664812 gene locus_tag LOCUS_25260 gene pnuC 2664186 2664812 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_25260 2664809 2665321 gene locus_tag LOCUS_25270 2664809 2665321 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268153.1 protein_id gnl|my_center|LOCUS_25270 2666809 2665328 gene locus_tag LOCUS_25280 2666809 2665328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 2667228 2666818 gene locus_tag LOCUS_25290 gene tolR 2667228 2666818 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940359.1 protein_id gnl|my_center|LOCUS_25290 2667945 2667238 gene locus_tag LOCUS_25300 gene tolQ 2667945 2667238 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940358.1 protein_id gnl|my_center|LOCUS_25300 2668198 2668680 gene locus_tag LOCUS_25310 2668198 2668680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 2668832 2669053 gene locus_tag LOCUS_25320 2668832 2669053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2669067 2670032 gene locus_tag LOCUS_25330 2669067 2670032 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937323.1 protein_id gnl|my_center|LOCUS_25330 2670867 2670133 gene locus_tag LOCUS_25340 2670867 2670133 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294685.1 protein_id gnl|my_center|LOCUS_25340 2673492 2671537 gene locus_tag LOCUS_25350 2673492 2671537 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184203568.1 protein_id gnl|my_center|LOCUS_25350 2676107 2674113 gene locus_tag LOCUS_25360 2676107 2674113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 2681053 2676104 gene locus_tag LOCUS_25370 2681053 2676104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 2681821 2681057 gene locus_tag LOCUS_25380 2681821 2681057 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_25380 2682566 2681850 gene locus_tag LOCUS_25390 2682566 2681850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 2683098 2682928 gene locus_tag LOCUS_25400 2683098 2682928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2685206 2683107 gene locus_tag LOCUS_25410 2685206 2683107 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937911.1 protein_id gnl|my_center|LOCUS_25410 2686659 2685559 gene locus_tag LOCUS_25420 gene ychF 2686659 2685559 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938722.1 protein_id gnl|my_center|LOCUS_25420 2687783 2686731 gene locus_tag LOCUS_25430 2687783 2686731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444437.1 protein_id gnl|my_center|LOCUS_25430 2688078 2687785 gene locus_tag LOCUS_25440 2688078 2687785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 2688257 2688679 gene locus_tag LOCUS_25450 2688257 2688679 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940617.1 protein_id gnl|my_center|LOCUS_25450 2689304 2688756 gene locus_tag LOCUS_25460 2689304 2688756 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940603.1 protein_id gnl|my_center|LOCUS_25460 2690074 2689304 gene locus_tag LOCUS_25470 2690074 2689304 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940604.1 protein_id gnl|my_center|LOCUS_25470 2691145 2690075 gene locus_tag LOCUS_25480 2691145 2690075 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940605.1 protein_id gnl|my_center|LOCUS_25480 2691376 2691146 gene locus_tag LOCUS_25490 2691376 2691146 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940606.1 protein_id gnl|my_center|LOCUS_25490 2692495 2691380 gene locus_tag LOCUS_25500 gene queA 2692495 2691380 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940607.1 protein_id gnl|my_center|LOCUS_25500 2692652 2693341 gene locus_tag LOCUS_25510 2692652 2693341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 2693623 2693381 gene locus_tag LOCUS_25520 2693623 2693381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 2693505 2693975 gene locus_tag LOCUS_25530 2693505 2693975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 2693981 2695195 gene locus_tag LOCUS_25540 gene coaBC 2693981 2695195 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940609.1 protein_id gnl|my_center|LOCUS_25540 2695426 2695926 gene locus_tag LOCUS_25550 2695426 2695926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 2696259 2696044 gene locus_tag LOCUS_25560 2696259 2696044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 2697031 2696375 gene locus_tag LOCUS_25570 2697031 2696375 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 protein_id gnl|my_center|LOCUS_25570 2697245 2697934 gene locus_tag LOCUS_25580 2697245 2697934 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_25580 2699595 2697916 gene locus_tag LOCUS_25590 2699595 2697916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 2700716 2699592 gene locus_tag LOCUS_25600 2700716 2699592 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392213.1 protein_id gnl|my_center|LOCUS_25600 2701091 2700804 gene locus_tag LOCUS_25610 2701091 2700804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 2701217 2701636 gene locus_tag LOCUS_25620 2701217 2701636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2702787 2701633 gene locus_tag LOCUS_25630 2702787 2701633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 2703157 2703582 gene locus_tag LOCUS_25640 2703157 2703582 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937702.1 protein_id gnl|my_center|LOCUS_25640 2703610 2703897 gene locus_tag LOCUS_25650 2703610 2703897 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937703.1 protein_id gnl|my_center|LOCUS_25650 2704552 2703884 gene locus_tag LOCUS_25660 2704552 2703884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2704832 2706187 gene locus_tag LOCUS_25670 2704832 2706187 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545411.1 protein_id gnl|my_center|LOCUS_25670 2706664 2706215 gene locus_tag LOCUS_25680 2706664 2706215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 2706863 2707252 gene locus_tag LOCUS_25690 2706863 2707252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 2708648 2707575 gene locus_tag LOCUS_25700 2708648 2707575 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939090.1 protein_id gnl|my_center|LOCUS_25700 2711351 2708652 gene locus_tag LOCUS_25710 2711351 2708652 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940229.1 protein_id gnl|my_center|LOCUS_25710 2711550 2712020 gene locus_tag LOCUS_25720 2711550 2712020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 2713168 2712395 gene locus_tag LOCUS_25730 2713168 2712395 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331956.1 protein_id gnl|my_center|LOCUS_25730 2714034 2713171 gene locus_tag LOCUS_25740 2714034 2713171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 2714276 2716408 gene locus_tag LOCUS_25750 2714276 2716408 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 protein_id gnl|my_center|LOCUS_25750 2716791 2716477 gene locus_tag LOCUS_25760 2716791 2716477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 2718814 2716877 gene locus_tag LOCUS_25770 2718814 2716877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 2720412 2718901 gene locus_tag LOCUS_25780 2720412 2718901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 2720656 2722167 gene locus_tag LOCUS_25790 2720656 2722167 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_25790 2722250 2723572 gene locus_tag LOCUS_25800 2722250 2723572 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_25800 2723589 2724350 gene locus_tag LOCUS_25810 2723589 2724350 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940610.1 protein_id gnl|my_center|LOCUS_25810 2724364 2725371 gene locus_tag LOCUS_25820 2724364 2725371 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_25820 2725786 2726562 gene locus_tag LOCUS_25830 2725786 2726562 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791341.1 protein_id gnl|my_center|LOCUS_25830 2727033 2726611 gene locus_tag LOCUS_25840 2727033 2726611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940614.1 protein_id gnl|my_center|LOCUS_25840 2727131 2728060 gene locus_tag LOCUS_25850 2727131 2728060 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940615.1 protein_id gnl|my_center|LOCUS_25850 2728215 2729231 gene locus_tag LOCUS_25860 2728215 2729231 CDS product bifunctional ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940616.1 protein_id gnl|my_center|LOCUS_25860 2729348 2730664 gene locus_tag LOCUS_25870 2729348 2730664 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939339.1 protein_id gnl|my_center|LOCUS_25870 2731021 2732091 gene locus_tag LOCUS_25880 2731021 2732091 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939074.1 protein_id gnl|my_center|LOCUS_25880 2732257 2733282 gene locus_tag LOCUS_25890 2732257 2733282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 2733450 2733265 gene locus_tag LOCUS_25900 2733450 2733265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 2734098 2733691 gene locus_tag LOCUS_25910 2734098 2733691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 2734363 2734109 gene locus_tag LOCUS_25920 2734363 2734109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2736187 2734553 gene locus_tag LOCUS_25930 2736187 2734553 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937938.1 protein_id gnl|my_center|LOCUS_25930 2736973 2736197 gene locus_tag LOCUS_25940 2736973 2736197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 2737552 2737049 gene locus_tag LOCUS_25950 2737552 2737049 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943224.1 protein_id gnl|my_center|LOCUS_25950 2737645 2738481 gene locus_tag LOCUS_25960 2737645 2738481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 2738980 2739636 gene locus_tag LOCUS_25970 2738980 2739636 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 protein_id gnl|my_center|LOCUS_25970 2739706 2740686 gene locus_tag LOCUS_25980 2739706 2740686 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_25980 2740802 2742220 gene locus_tag LOCUS_25990 2740802 2742220 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_25990 2742235 2742993 gene locus_tag LOCUS_26000 gene larE 2742235 2742993 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_26000 2742990 2743742 gene locus_tag LOCUS_26010 gene larB 2742990 2743742 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_26010 2743806 2744582 gene locus_tag LOCUS_26020 2743806 2744582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 2744575 2745252 gene locus_tag LOCUS_26030 2744575 2745252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 2745252 2746472 gene locus_tag LOCUS_26040 2745252 2746472 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939709.1 protein_id gnl|my_center|LOCUS_26040 2746529 2747311 gene locus_tag LOCUS_26050 2746529 2747311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 2747400 2748827 gene locus_tag LOCUS_26060 2747400 2748827 CDS product DNA integrity scanning protein DisA nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791846.1 protein_id gnl|my_center|LOCUS_26060 2748864 2749094 gene locus_tag LOCUS_26070 2748864 2749094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 2749179 2750216 gene locus_tag LOCUS_26080 2749179 2750216 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939785.1 protein_id gnl|my_center|LOCUS_26080 2750603 2750385 gene locus_tag LOCUS_26090 2750603 2750385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 2750651 2752039 gene locus_tag LOCUS_26100 2750651 2752039 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937957.1 protein_id gnl|my_center|LOCUS_26100 2754287 2752461 gene locus_tag LOCUS_26110 gene aspS 2754287 2752461 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940622.1 protein_id gnl|my_center|LOCUS_26110 2755602 2754361 gene locus_tag LOCUS_26120 gene hisS 2755602 2754361 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940623.1 protein_id gnl|my_center|LOCUS_26120 2756670 2755846 gene locus_tag LOCUS_26130 2756670 2755846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2758517 2756673 gene locus_tag LOCUS_26140 2758517 2756673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2759037 2758531 gene locus_tag LOCUS_26150 2759037 2758531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2759337 2760383 gene locus_tag LOCUS_26160 2759337 2760383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 2760380 2763661 gene locus_tag LOCUS_26170 2760380 2763661 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479332.1 protein_id gnl|my_center|LOCUS_26170 2763737 2764540 gene locus_tag LOCUS_26180 2763737 2764540 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941184.1 protein_id gnl|my_center|LOCUS_26180 2764607 2765035 gene locus_tag LOCUS_26190 gene trxC 2764607 2765035 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_26190 2765127 2765879 gene locus_tag LOCUS_26200 gene cobB 2765127 2765879 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_26200 2766622 2765957 gene locus_tag LOCUS_26210 2766622 2765957 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943846.1 protein_id gnl|my_center|LOCUS_26210 2769086 2766624 gene locus_tag LOCUS_26220 2769086 2766624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 2769267 2770070 gene locus_tag LOCUS_26230 2769267 2770070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 2770910 2770260 gene locus_tag LOCUS_26240 2770910 2770260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016106.1 protein_id gnl|my_center|LOCUS_26240 2771662 2770910 gene locus_tag LOCUS_26250 2771662 2770910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 2771558 2771788 gene locus_tag LOCUS_26260 2771558 2771788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 2772387 2771785 gene locus_tag LOCUS_26270 2772387 2771785 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942123.1 protein_id gnl|my_center|LOCUS_26270 2772931 2772470 gene locus_tag LOCUS_26280 2772931 2772470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 2773662 2773051 gene locus_tag LOCUS_26290 2773662 2773051 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939589.1 protein_id gnl|my_center|LOCUS_26290 2774482 2773694 gene locus_tag LOCUS_26300 2774482 2773694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 2775985 2774720 gene locus_tag LOCUS_26310 2775985 2774720 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940511.1 protein_id gnl|my_center|LOCUS_26310 2776180 2776255 gene locus_tag LOCUS_t00540 2776180 2776255 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2776259 2776334 gene locus_tag LOCUS_t00550 2776259 2776334 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2776388 2776465 gene locus_tag LOCUS_t00560 2776388 2776465 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2777284 2776628 gene locus_tag LOCUS_26320 2777284 2776628 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 protein_id gnl|my_center|LOCUS_26320 2778709 2777363 gene locus_tag LOCUS_26330 2778709 2777363 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403127.1 protein_id gnl|my_center|LOCUS_26330 2779279 2778710 gene locus_tag LOCUS_26340 2779279 2778710 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_26340 2779388 2782312 gene locus_tag LOCUS_26350 2779388 2782312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 2783060 2782416 gene locus_tag LOCUS_26360 2783060 2782416 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_26360 2783257 2784525 gene locus_tag LOCUS_26370 2783257 2784525 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967039.1 protein_id gnl|my_center|LOCUS_26370 2786212 2784611 gene locus_tag LOCUS_26380 2786212 2784611 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937352.1 protein_id gnl|my_center|LOCUS_26380 2786395 2787159 gene locus_tag LOCUS_26390 2786395 2787159 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294689.1 protein_id gnl|my_center|LOCUS_26390 2787772 2787182 gene locus_tag LOCUS_26400 2787772 2787182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2787792 2788472 gene locus_tag LOCUS_26410 2787792 2788472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 2788997 2788500 gene locus_tag LOCUS_26420 2788997 2788500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 2789149 2790027 gene locus_tag LOCUS_26430 2789149 2790027 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940039.1 protein_id gnl|my_center|LOCUS_26430 2790027 2790839 gene locus_tag LOCUS_26440 2790027 2790839 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938214.1 protein_id gnl|my_center|LOCUS_26440 2790836 2791573 gene locus_tag LOCUS_26450 2790836 2791573 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938213.1 protein_id gnl|my_center|LOCUS_26450 2791595 2792209 gene locus_tag LOCUS_26460 2791595 2792209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 2792283 2792705 gene locus_tag LOCUS_26470 2792283 2792705 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792648.1 protein_id gnl|my_center|LOCUS_26470 2795979 2793076 gene locus_tag LOCUS_26480 2795979 2793076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 2796103 2796288 gene locus_tag LOCUS_26490 2796103 2796288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 2796279 2796566 gene locus_tag LOCUS_26500 2796279 2796566 CDS product DUF4911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294687.1 protein_id gnl|my_center|LOCUS_26500 2796792 2797409 gene locus_tag LOCUS_26510 2796792 2797409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939921.1 protein_id gnl|my_center|LOCUS_26510 2799166 2797514 gene locus_tag LOCUS_26520 gene nhaB 2799166 2797514 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482404.1 protein_id gnl|my_center|LOCUS_26520 2799451 2800032 gene locus_tag LOCUS_26530 2799451 2800032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 2800092 2801204 gene locus_tag LOCUS_26540 2800092 2801204 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625967.1 protein_id gnl|my_center|LOCUS_26540 2801201 2804236 gene locus_tag LOCUS_26550 2801201 2804236 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261805.1 protein_id gnl|my_center|LOCUS_26550 2806363 2804615 gene locus_tag LOCUS_26560 2806363 2804615 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791909.1 protein_id gnl|my_center|LOCUS_26560 2806647 2808404 gene locus_tag LOCUS_26570 2806647 2808404 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938960.1 protein_id gnl|my_center|LOCUS_26570 2808416 2809351 gene locus_tag LOCUS_26580 2808416 2809351 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_26580 2809450 2810160 gene locus_tag LOCUS_26590 2809450 2810160 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925340.1 protein_id gnl|my_center|LOCUS_26590 2810338 2811945 gene locus_tag LOCUS_26600 gene hcp 2810338 2811945 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791786.1 protein_id gnl|my_center|LOCUS_26600 2812105 2815395 gene locus_tag LOCUS_26610 2812105 2815395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 2815403 2815714 gene locus_tag LOCUS_26620 2815403 2815714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 2815919 2815764 gene locus_tag LOCUS_26630 2815919 2815764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 2815941 2816549 gene locus_tag LOCUS_26640 2815941 2816549 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080615.1 protein_id gnl|my_center|LOCUS_26640 2816546 2817727 gene locus_tag LOCUS_26650 2816546 2817727 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940512.1 protein_id gnl|my_center|LOCUS_26650 2818905 2818051 gene locus_tag LOCUS_26660 2818905 2818051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 2819487 2819032 gene locus_tag LOCUS_26670 2819487 2819032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2820258 2819488 gene locus_tag LOCUS_26680 2820258 2819488 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938248.1 protein_id gnl|my_center|LOCUS_26680 2820393 2821442 gene locus_tag LOCUS_26690 2820393 2821442 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294604.1 protein_id gnl|my_center|LOCUS_26690 2821456 2822091 gene locus_tag LOCUS_26700 2821456 2822091 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_26700 2822181 2823590 gene locus_tag LOCUS_26710 2822181 2823590 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938056.1 protein_id gnl|my_center|LOCUS_26710 2824713 2823598 gene locus_tag LOCUS_26720 2824713 2823598 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202097.1 protein_id gnl|my_center|LOCUS_26720 2824833 2825984 gene locus_tag LOCUS_26730 2824833 2825984 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870223.1 protein_id gnl|my_center|LOCUS_26730 2826128 2828533 gene locus_tag LOCUS_26740 2826128 2828533 CDS product Cache 3/Cache 2 fusion domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294650.1 protein_id gnl|my_center|LOCUS_26740 2829949 2828948 gene locus_tag LOCUS_26750 2829949 2828948 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965021.1 protein_id gnl|my_center|LOCUS_26750 2830828 2830049 gene locus_tag LOCUS_26760 gene zupT 2830828 2830049 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176713.1 protein_id gnl|my_center|LOCUS_26760 2831083 2831493 gene locus_tag LOCUS_26770 2831083 2831493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 2831490 2831705 gene locus_tag LOCUS_26780 2831490 2831705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 2832715 2831711 gene locus_tag LOCUS_26790 2832715 2831711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 2832770 2834053 gene locus_tag LOCUS_26800 2832770 2834053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 2834040 2834396 gene locus_tag LOCUS_26810 2834040 2834396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 2834523 2841152 gene locus_tag LOCUS_26820 2834523 2841152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 2841414 2842247 gene locus_tag LOCUS_26830 2841414 2842247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 2842280 2842528 gene locus_tag LOCUS_26840 2842280 2842528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 2842665 2843540 gene locus_tag LOCUS_26850 2842665 2843540 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_26850 2843625 2844416 gene locus_tag LOCUS_26860 2843625 2844416 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294658.1 protein_id gnl|my_center|LOCUS_26860 2844490 2845035 gene locus_tag LOCUS_26870 2844490 2845035 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940315.1 protein_id gnl|my_center|LOCUS_26870 2845037 2845417 gene locus_tag LOCUS_26880 2845037 2845417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 2845421 2846656 gene locus_tag LOCUS_26890 2845421 2846656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 2846754 2847263 gene locus_tag LOCUS_26900 2846754 2847263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 2847260 2847715 gene locus_tag LOCUS_26910 gene rnhA 2847260 2847715 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937992.1 protein_id gnl|my_center|LOCUS_26910 2847810 2849063 gene locus_tag LOCUS_26920 2847810 2849063 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387846.1 protein_id gnl|my_center|LOCUS_26920 2849139 2849345 gene locus_tag LOCUS_26930 2849139 2849345 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694169.1 protein_id gnl|my_center|LOCUS_26930 2849397 2849906 gene locus_tag LOCUS_26940 2849397 2849906 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_26940 2850160 2851380 gene locus_tag LOCUS_26950 2850160 2851380 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937886.1 protein_id gnl|my_center|LOCUS_26950 2851383 2853383 gene locus_tag LOCUS_26960 2851383 2853383 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937885.1 protein_id gnl|my_center|LOCUS_26960 2853391 2854110 gene locus_tag LOCUS_26970 2853391 2854110 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937884.1 protein_id gnl|my_center|LOCUS_26970 2855438 2854458 gene locus_tag LOCUS_26980 2855438 2854458 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792769.1 protein_id gnl|my_center|LOCUS_26980 2856357 2855521 gene locus_tag LOCUS_26990 2856357 2855521 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937428.1 protein_id gnl|my_center|LOCUS_26990 2860733 2856360 gene locus_tag LOCUS_27000 2860733 2856360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 2860892 2861653 gene locus_tag LOCUS_27010 2860892 2861653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 2862173 2861805 gene locus_tag LOCUS_27020 2862173 2861805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 2864607 2862151 gene locus_tag LOCUS_27030 2864607 2862151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 2865854 2864769 gene locus_tag LOCUS_27040 2865854 2864769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 2866821 2865952 gene locus_tag LOCUS_27050 2866821 2865952 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433836.1 protein_id gnl|my_center|LOCUS_27050 2868093 2866837 gene locus_tag LOCUS_27060 2868093 2866837 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459079.1 protein_id gnl|my_center|LOCUS_27060 2868937 2868221 gene locus_tag LOCUS_27070 2868937 2868221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 2869698 2870501 gene locus_tag LOCUS_27080 2869698 2870501 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937767.1 protein_id gnl|my_center|LOCUS_27080 2870744 2870556 gene locus_tag LOCUS_27090 2870744 2870556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2871439 2871026 gene locus_tag LOCUS_27100 2871439 2871026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 2872428 2871463 gene locus_tag LOCUS_27110 2872428 2871463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 2873192 2872446 gene locus_tag LOCUS_27120 2873192 2872446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 2873357 2873758 gene locus_tag LOCUS_27130 2873357 2873758 CDS product DUF5675 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964411.1 protein_id gnl|my_center|LOCUS_27130 2873769 2873993 gene locus_tag LOCUS_27140 2873769 2873993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 2874793 2873963 gene locus_tag LOCUS_27150 2874793 2873963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 2876262 2874886 gene locus_tag LOCUS_27160 2876262 2874886 CDS product NlpC/P60 family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524287.1 protein_id gnl|my_center|LOCUS_27160 2876838 2876266 gene locus_tag LOCUS_27170 2876838 2876266 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022274.1 protein_id gnl|my_center|LOCUS_27170 2876949 2877848 gene locus_tag LOCUS_27180 2876949 2877848 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582643.1 protein_id gnl|my_center|LOCUS_27180 2879076 2878402 gene locus_tag LOCUS_27190 2879076 2878402 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_27190 2880183 2879323 gene locus_tag LOCUS_27200 2880183 2879323 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_27200 2880323 2880850 gene locus_tag LOCUS_27210 2880323 2880850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 2880887 2881075 gene locus_tag LOCUS_27220 2880887 2881075 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937959.1 protein_id gnl|my_center|LOCUS_27220 2881258 2881737 gene locus_tag LOCUS_27230 gene ilvN 2881258 2881737 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937929.1 protein_id gnl|my_center|LOCUS_27230 2881740 2882669 gene locus_tag LOCUS_27240 2881740 2882669 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937930.1 protein_id gnl|my_center|LOCUS_27240 2882673 2883770 gene locus_tag LOCUS_27250 gene buk 2882673 2883770 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937931.1 protein_id gnl|my_center|LOCUS_27250 2883985 2884863 gene locus_tag LOCUS_27260 2883985 2884863 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939354.1 protein_id gnl|my_center|LOCUS_27260 2884930 2886144 gene locus_tag LOCUS_27270 2884930 2886144 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868912.1 protein_id gnl|my_center|LOCUS_27270 2886337 2886732 gene locus_tag LOCUS_27280 2886337 2886732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 2888848 2886806 gene locus_tag LOCUS_27290 2888848 2886806 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941958.1 protein_id gnl|my_center|LOCUS_27290 2891094 2889037 gene locus_tag LOCUS_27300 2891094 2889037 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941958.1 protein_id gnl|my_center|LOCUS_27300 2891259 2892509 gene locus_tag LOCUS_27310 2891259 2892509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 2892958 2894295 gene locus_tag LOCUS_27320 2892958 2894295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 2894544 2894864 gene locus_tag LOCUS_27330 2894544 2894864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 2894861 2895970 gene locus_tag LOCUS_27340 2894861 2895970 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331459.1 protein_id gnl|my_center|LOCUS_27340 2896065 2896427 gene locus_tag LOCUS_27350 2896065 2896427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 2897417 2896473 gene locus_tag LOCUS_27360 2897417 2896473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 2898888 2897428 gene locus_tag LOCUS_27370 2898888 2897428 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876425.1 protein_id gnl|my_center|LOCUS_27370 2899024 2899854 gene locus_tag LOCUS_27380 gene murI 2899024 2899854 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938069.1 protein_id gnl|my_center|LOCUS_27380 2900285 2900662 gene locus_tag LOCUS_27390 2900285 2900662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2900855 2901682 gene locus_tag LOCUS_27400 2900855 2901682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 2901897 2901712 gene locus_tag LOCUS_27410 2901897 2901712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 2901977 2903512 gene locus_tag LOCUS_27420 gene murJ 2901977 2903512 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_27420 2903509 2904237 gene locus_tag LOCUS_27430 2903509 2904237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 2904331 2905677 gene locus_tag LOCUS_27440 2904331 2905677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2905670 2906632 gene locus_tag LOCUS_27450 2905670 2906632 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155366946.1 protein_id gnl|my_center|LOCUS_27450 2906622 2906942 gene locus_tag LOCUS_27460 2906622 2906942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 2906946 2907599 gene locus_tag LOCUS_27470 2906946 2907599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 2908038 2907673 gene locus_tag LOCUS_27480 2908038 2907673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 2908467 2908054 gene locus_tag LOCUS_27490 2908467 2908054 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939712.1 protein_id gnl|my_center|LOCUS_27490 2909755 2909495 gene locus_tag LOCUS_27500 2909755 2909495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 2910695 2909853 gene locus_tag LOCUS_27510 2910695 2909853 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_27510 2910802 2911401 gene locus_tag LOCUS_27520 2910802 2911401 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_27520 2912847 2911597 gene locus_tag LOCUS_27530 2912847 2911597 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938271.1 protein_id gnl|my_center|LOCUS_27530 2913033 2913620 gene locus_tag LOCUS_27540 2913033 2913620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939003.1 protein_id gnl|my_center|LOCUS_27540 2913726 2914757 gene locus_tag LOCUS_27550 gene rlmN 2913726 2914757 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940164.1 protein_id gnl|my_center|LOCUS_27550 2915273 2914869 gene locus_tag LOCUS_27560 2915273 2914869 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937534.1 protein_id gnl|my_center|LOCUS_27560 2915745 2915401 gene locus_tag LOCUS_27570 2915745 2915401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 2916763 2915756 gene locus_tag LOCUS_27580 2916763 2915756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 2917994 2916768 gene locus_tag LOCUS_27590 2917994 2916768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 2918473 2917997 gene locus_tag LOCUS_27600 2918473 2917997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 2920599 2918503 gene locus_tag LOCUS_27610 2920599 2918503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 2921086 2920823 gene locus_tag LOCUS_27620 2921086 2920823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 2922422 2921310 gene locus_tag LOCUS_27630 gene ald 2922422 2921310 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_27630 2922952 2922458 gene locus_tag LOCUS_27640 2922952 2922458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 2923664 2923206 gene locus_tag LOCUS_27650 2923664 2923206 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791692.1 protein_id gnl|my_center|LOCUS_27650 2923957 2924559 gene locus_tag LOCUS_27660 2923957 2924559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 2924699 2926588 gene locus_tag LOCUS_27670 gene htpG 2924699 2926588 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939912.1 protein_id gnl|my_center|LOCUS_27670 2926770 2928779 gene locus_tag LOCUS_27680 2926770 2928779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 2929011 2931086 gene locus_tag LOCUS_27690 2929011 2931086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 2931228 2931614 gene locus_tag LOCUS_27700 2931228 2931614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 2931624 2931773 gene locus_tag LOCUS_27710 2931624 2931773 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975331.1 protein_id gnl|my_center|LOCUS_27710 2931784 2933142 gene locus_tag LOCUS_27720 2931784 2933142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27720 2933058 2933639 gene locus_tag LOCUS_27730 2933058 2933639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27730 2933648 2934796 gene locus_tag LOCUS_27740 2933648 2934796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 2935712 2934879 gene locus_tag LOCUS_27750 2935712 2934879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 2935936 2935709 gene locus_tag LOCUS_27760 2935936 2935709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2937695 2935929 gene locus_tag LOCUS_27770 2937695 2935929 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063619.1 protein_id gnl|my_center|LOCUS_27770 2938005 2937697 gene locus_tag LOCUS_27780 2938005 2937697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2938615 2939562 gene locus_tag LOCUS_27790 2938615 2939562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 2939541 2940833 gene locus_tag LOCUS_27800 2939541 2940833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 2941615 2941004 gene locus_tag LOCUS_27810 2941615 2941004 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392977.1 protein_id gnl|my_center|LOCUS_27810 2942440 2941625 gene locus_tag LOCUS_27820 2942440 2941625 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023550.1 protein_id gnl|my_center|LOCUS_27820 2943507 2942437 gene locus_tag LOCUS_27830 2943507 2942437 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020989.1 protein_id gnl|my_center|LOCUS_27830 2944701 2943520 gene locus_tag LOCUS_27840 2944701 2943520 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023548.1 protein_id gnl|my_center|LOCUS_27840 2945731 2944841 gene locus_tag LOCUS_27850 2945731 2944841 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 protein_id gnl|my_center|LOCUS_27850 2945913 2946902 gene locus_tag LOCUS_27860 2945913 2946902 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_27860 2947849 2946986 gene locus_tag LOCUS_27870 2947849 2946986 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940312.1 protein_id gnl|my_center|LOCUS_27870 2948145 2949095 gene locus_tag LOCUS_27880 2948145 2949095 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940313.1 protein_id gnl|my_center|LOCUS_27880 2949144 2950610 gene locus_tag LOCUS_27890 2949144 2950610 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940314.1 protein_id gnl|my_center|LOCUS_27890 2951932 2950679 gene locus_tag LOCUS_27900 2951932 2950679 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948210.1 protein_id gnl|my_center|LOCUS_27900 2952897 2951977 gene locus_tag LOCUS_27910 2952897 2951977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 2954138 2952909 gene locus_tag LOCUS_27920 2954138 2952909 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673537.1 protein_id gnl|my_center|LOCUS_27920 2954797 2954300 gene locus_tag LOCUS_27930 2954797 2954300 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939592.1 protein_id gnl|my_center|LOCUS_27930 2956504 2954879 gene locus_tag LOCUS_27940 2956504 2954879 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937486.1 protein_id gnl|my_center|LOCUS_27940 2957944 2956712 gene locus_tag LOCUS_27950 2957944 2956712 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_27950 2958675 2957962 gene locus_tag LOCUS_27960 2958675 2957962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_27960 2959765 2958677 gene locus_tag LOCUS_27970 2959765 2958677 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939710.1 protein_id gnl|my_center|LOCUS_27970 2960253 2959762 gene locus_tag LOCUS_27980 2960253 2959762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 2961663 2960296 gene locus_tag LOCUS_27990 2961663 2960296 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937988.1 protein_id gnl|my_center|LOCUS_27990 2961747 2962823 gene locus_tag LOCUS_28000 gene hflK 2961747 2962823 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_28000 2962836 2963687 gene locus_tag LOCUS_28010 2962836 2963687 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_28010 2963961 2964683 gene locus_tag LOCUS_28020 2963961 2964683 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792760.1 protein_id gnl|my_center|LOCUS_28020 2965587 2965105 gene locus_tag LOCUS_28030 2965587 2965105 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435609.1 protein_id gnl|my_center|LOCUS_28030 2966400 2965600 gene locus_tag LOCUS_28040 2966400 2965600 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938538.1 protein_id gnl|my_center|LOCUS_28040 2967070 2966411 gene locus_tag LOCUS_28050 2967070 2966411 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938539.1 protein_id gnl|my_center|LOCUS_28050 2967517 2967074 gene locus_tag LOCUS_28060 gene mlaD 2967517 2967074 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938540.1 protein_id gnl|my_center|LOCUS_28060 2968384 2967551 gene locus_tag LOCUS_28070 2968384 2967551 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938541.1 protein_id gnl|my_center|LOCUS_28070 2969196 2968390 gene locus_tag LOCUS_28080 2969196 2968390 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938542.1 protein_id gnl|my_center|LOCUS_28080 2969975 2969367 gene locus_tag LOCUS_28090 2969975 2969367 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939708.1 protein_id gnl|my_center|LOCUS_28090 2970266 2970066 gene locus_tag LOCUS_28100 2970266 2970066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 2971463 2970282 gene locus_tag LOCUS_28110 gene argJ 2971463 2970282 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938124.1 protein_id gnl|my_center|LOCUS_28110 2972296 2971532 gene locus_tag LOCUS_28120 2972296 2971532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 2972431 2972907 gene locus_tag LOCUS_28130 2972431 2972907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 2973010 2974428 gene locus_tag LOCUS_28140 2973010 2974428 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940219.1 protein_id gnl|my_center|LOCUS_28140 2974436 2974777 gene locus_tag LOCUS_28150 2974436 2974777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 2975240 2974938 gene locus_tag LOCUS_28160 2975240 2974938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 2975142 2975417 gene locus_tag LOCUS_28170 2975142 2975417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 2975414 2975956 gene locus_tag LOCUS_28180 2975414 2975956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 2975990 2977465 gene locus_tag LOCUS_28190 2975990 2977465 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546144.1 protein_id gnl|my_center|LOCUS_28190 2977549 2978976 gene locus_tag LOCUS_28200 2977549 2978976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 2979033 2980655 gene locus_tag LOCUS_28210 gene nhaB 2979033 2980655 CDS product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113594.1 protein_id gnl|my_center|LOCUS_28210 2980824 2982455 gene locus_tag LOCUS_28220 2980824 2982455 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937450.1 protein_id gnl|my_center|LOCUS_28220 2982464 2982910 gene locus_tag LOCUS_28230 2982464 2982910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 2982907 2983296 gene locus_tag LOCUS_28240 2982907 2983296 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937451.1 protein_id gnl|my_center|LOCUS_28240 2983299 2983700 gene locus_tag LOCUS_28250 2983299 2983700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 2984281 2983727 gene locus_tag LOCUS_28260 gene thpR 2984281 2983727 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762325.1 protein_id gnl|my_center|LOCUS_28260 2984763 2984521 gene locus_tag LOCUS_28270 2984763 2984521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 2986687 2984969 gene locus_tag LOCUS_28280 2986687 2984969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 2987717 2986839 gene locus_tag LOCUS_28290 2987717 2986839 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940028.1 protein_id gnl|my_center|LOCUS_28290 2988530 2987718 gene locus_tag LOCUS_28300 gene sfsA 2988530 2987718 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940482.1 protein_id gnl|my_center|LOCUS_28300 2988683 2989960 gene locus_tag LOCUS_28310 gene serS 2988683 2989960 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937547.1 protein_id gnl|my_center|LOCUS_28310 2990522 2990040 gene locus_tag LOCUS_28320 2990522 2990040 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_28320 2990765 2990523 gene locus_tag LOCUS_28330 2990765 2990523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 2990940 2991248 gene locus_tag LOCUS_28340 2990940 2991248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 2992485 2991259 gene locus_tag LOCUS_28350 gene nrfD 2992485 2991259 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938582.1 protein_id gnl|my_center|LOCUS_28350 2993268 2992498 gene locus_tag LOCUS_28360 2993268 2992498 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938583.1 protein_id gnl|my_center|LOCUS_28360 2993651 2993268 gene locus_tag LOCUS_28370 gene dsrJ 2993651 2993268 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938584.1 protein_id gnl|my_center|LOCUS_28370 2995322 2993652 gene locus_tag LOCUS_28380 gene dsrK 2995322 2993652 CDS product [DsrC]-trisulfide reductase DsrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938585.1 protein_id gnl|my_center|LOCUS_28380 2996400 2995372 gene locus_tag LOCUS_28390 gene dsrM 2996400 2995372 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938586.1 protein_id gnl|my_center|LOCUS_28390 2996983 2996423 gene locus_tag LOCUS_28400 2996983 2996423 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810499.1 protein_id gnl|my_center|LOCUS_28400 3000128 2997252 gene locus_tag LOCUS_28410 3000128 2997252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 3000265 3000900 gene locus_tag LOCUS_28420 3000265 3000900 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940338.1 protein_id gnl|my_center|LOCUS_28420 3001746 3001288 gene locus_tag LOCUS_28430 3001746 3001288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938331.1 protein_id gnl|my_center|LOCUS_28430 3002058 3002498 gene locus_tag LOCUS_28440 3002058 3002498 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938329.1 protein_id gnl|my_center|LOCUS_28440 3002591 3003688 gene locus_tag LOCUS_28450 gene hisC 3002591 3003688 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938328.1 protein_id gnl|my_center|LOCUS_28450 3003681 3004346 gene locus_tag LOCUS_28460 gene cmk 3003681 3004346 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938327.1 protein_id gnl|my_center|LOCUS_28460 3004532 3006523 gene locus_tag LOCUS_28470 3004532 3006523 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259283.1 protein_id gnl|my_center|LOCUS_28470 3006582 3008018 gene locus_tag LOCUS_28480 3006582 3008018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 3008938 3008099 gene locus_tag LOCUS_28490 3008938 3008099 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021957.1 protein_id gnl|my_center|LOCUS_28490 3008977 3009495 gene locus_tag LOCUS_28500 3008977 3009495 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545903.1 protein_id gnl|my_center|LOCUS_28500 3011990 3009492 gene locus_tag LOCUS_28510 3011990 3009492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 3015196 3012080 gene locus_tag LOCUS_28520 3015196 3012080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 3015972 3015193 gene locus_tag LOCUS_28530 3015972 3015193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3016517 3016059 gene locus_tag LOCUS_28540 3016517 3016059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 3016636 3017049 gene locus_tag LOCUS_28550 3016636 3017049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 3017060 3017617 gene locus_tag LOCUS_28560 3017060 3017617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 3017680 3018483 gene locus_tag LOCUS_28570 3017680 3018483 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938516.1 protein_id gnl|my_center|LOCUS_28570 3019065 3018568 gene locus_tag LOCUS_28580 3019065 3018568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 3019637 3019984 gene locus_tag LOCUS_28590 3019637 3019984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 3020630 3020064 gene locus_tag LOCUS_28600 3020630 3020064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 3020911 3022500 gene locus_tag LOCUS_28610 3020911 3022500 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937614.1 protein_id gnl|my_center|LOCUS_28610 3022870 3024078 gene locus_tag LOCUS_28620 gene serB 3022870 3024078 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010528670.1 protein_id gnl|my_center|LOCUS_28620 3024087 3024770 gene locus_tag LOCUS_28630 3024087 3024770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 3026333 3025002 gene locus_tag LOCUS_28640 gene rimO 3026333 3025002 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940409.1 protein_id gnl|my_center|LOCUS_28640 3026440 3027921 gene locus_tag LOCUS_28650 3026440 3027921 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940410.1 protein_id gnl|my_center|LOCUS_28650 3027993 3028595 gene locus_tag LOCUS_28660 gene rdgB 3027993 3028595 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940412.1 protein_id gnl|my_center|LOCUS_28660 3029025 3029918 gene locus_tag LOCUS_28670 gene panB 3029025 3029918 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939717.1 protein_id gnl|my_center|LOCUS_28670 3029919 3030884 gene locus_tag LOCUS_28680 3029919 3030884 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937994.1 protein_id gnl|my_center|LOCUS_28680 3031687 3031373 gene locus_tag LOCUS_28690 3031687 3031373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 3031945 3031784 gene locus_tag LOCUS_28700 3031945 3031784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 3032442 3031966 gene locus_tag LOCUS_28710 3032442 3031966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 3032708 3033877 gene locus_tag LOCUS_28720 3032708 3033877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 3033874 3034647 gene locus_tag LOCUS_28730 3033874 3034647 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393241.1 protein_id gnl|my_center|LOCUS_28730 3034660 3035385 gene locus_tag LOCUS_28740 gene motD 3034660 3035385 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947506.1 protein_id gnl|my_center|LOCUS_28740 3035581 3036837 gene locus_tag LOCUS_28750 3035581 3036837 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091472.1 protein_id gnl|my_center|LOCUS_28750 3036917 3037819 gene locus_tag LOCUS_28760 3036917 3037819 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091471.1 protein_id gnl|my_center|LOCUS_28760 3037812 3038687 gene locus_tag LOCUS_28770 3037812 3038687 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185577.1 protein_id gnl|my_center|LOCUS_28770 3038699 3039814 gene locus_tag LOCUS_28780 gene ugpC 3038699 3039814 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527557.1 protein_id gnl|my_center|LOCUS_28780 3039836 3040507 gene locus_tag LOCUS_28790 3039836 3040507 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830337.1 protein_id gnl|my_center|LOCUS_28790 3041258 3040854 gene locus_tag LOCUS_28800 3041258 3040854 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389771.1 protein_id gnl|my_center|LOCUS_28800 3041514 3042704 gene locus_tag LOCUS_28810 3041514 3042704 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937749.1 protein_id gnl|my_center|LOCUS_28810 3042757 3043845 gene locus_tag LOCUS_28820 3042757 3043845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 3044217 3043861 gene locus_tag LOCUS_28830 3044217 3043861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938073.1 protein_id gnl|my_center|LOCUS_28830 3044216 3044461 gene locus_tag LOCUS_28840 3044216 3044461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 3044376 3045032 gene locus_tag LOCUS_28850 3044376 3045032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 3045376 3045029 gene locus_tag LOCUS_28860 3045376 3045029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 3046325 3045423 gene locus_tag LOCUS_28870 3046325 3045423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 3046927 3046328 gene locus_tag LOCUS_28880 3046927 3046328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 3047166 3048593 gene locus_tag LOCUS_28890 3047166 3048593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 3050556 3048616 gene locus_tag LOCUS_28900 3050556 3048616 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924824.1 protein_id gnl|my_center|LOCUS_28900 3050980 3050642 gene locus_tag LOCUS_28910 3050980 3050642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 3051437 3050952 gene locus_tag LOCUS_28920 3051437 3050952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 3052093 3051434 gene locus_tag LOCUS_28930 3052093 3051434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 3052242 3053150 gene locus_tag LOCUS_28940 3052242 3053150 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019697.1 protein_id gnl|my_center|LOCUS_28940 3053616 3054173 gene locus_tag LOCUS_28950 3053616 3054173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 3054182 3054700 gene locus_tag LOCUS_28960 3054182 3054700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 3055530 3054781 gene locus_tag LOCUS_28970 3055530 3054781 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939585.1 protein_id gnl|my_center|LOCUS_28970 3055836 3056294 gene locus_tag LOCUS_28980 3055836 3056294 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937609.1 protein_id gnl|my_center|LOCUS_28980 3056329 3057912 gene locus_tag LOCUS_28990 3056329 3057912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 3058317 3057985 gene locus_tag LOCUS_29000 3058317 3057985 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820087.1 protein_id gnl|my_center|LOCUS_29000 3058785 3058330 gene locus_tag LOCUS_29010 3058785 3058330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 3060925 3058790 gene locus_tag LOCUS_29020 3060925 3058790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 3061088 3063613 gene locus_tag LOCUS_29030 3061088 3063613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310719.1 protein_id gnl|my_center|LOCUS_29030 3063588 3064079 gene locus_tag LOCUS_29040 3063588 3064079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 3064463 3064789 gene locus_tag LOCUS_29050 3064463 3064789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 3064849 3065460 gene locus_tag LOCUS_29060 3064849 3065460 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938652.1 protein_id gnl|my_center|LOCUS_29060 3065465 3066289 gene locus_tag LOCUS_29070 gene ftsE 3065465 3066289 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940630.1 protein_id gnl|my_center|LOCUS_29070 3066286 3067161 gene locus_tag LOCUS_29080 3066286 3067161 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791332.1 protein_id gnl|my_center|LOCUS_29080 3068219 3067185 gene locus_tag LOCUS_29090 3068219 3067185 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937797.1 protein_id gnl|my_center|LOCUS_29090 3068940 3068275 gene locus_tag LOCUS_29100 3068940 3068275 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792434.1 protein_id gnl|my_center|LOCUS_29100 3070217 3069063 gene locus_tag LOCUS_29110 3070217 3069063 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938391.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29110 3070117 3070443 gene locus_tag LOCUS_29120 3070117 3070443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 3070987 3071310 gene locus_tag LOCUS_29130 3070987 3071310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 3073763 3071319 gene locus_tag LOCUS_29140 3073763 3071319 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 protein_id gnl|my_center|LOCUS_29140 3073938 3074852 gene locus_tag LOCUS_29150 3073938 3074852 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938246.1 protein_id gnl|my_center|LOCUS_29150 3075287 3074859 gene locus_tag LOCUS_29160 3075287 3074859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 3075755 3076603 gene locus_tag LOCUS_29170 3075755 3076603 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939745.1 protein_id gnl|my_center|LOCUS_29170 3076611 3078020 gene locus_tag LOCUS_29180 gene gltA 3076611 3078020 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939746.1 protein_id gnl|my_center|LOCUS_29180 3078036 3078860 gene locus_tag LOCUS_29190 3078036 3078860 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940460.1 protein_id gnl|my_center|LOCUS_29190 3078938 3080602 gene locus_tag LOCUS_29200 gene ilvD 3078938 3080602 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940628.1 protein_id gnl|my_center|LOCUS_29200 3082460 3080790 gene locus_tag LOCUS_29210 3082460 3080790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 3082553 3082807 gene locus_tag LOCUS_29220 3082553 3082807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 3082743 3082955 gene locus_tag LOCUS_29230 3082743 3082955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 3083607 3083038 gene locus_tag LOCUS_29240 3083607 3083038 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065091.1 protein_id gnl|my_center|LOCUS_29240 3084761 3083724 gene locus_tag LOCUS_29250 3084761 3083724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29250 3085904 3085053 gene locus_tag LOCUS_29260 3085904 3085053 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939764.1 protein_id gnl|my_center|LOCUS_29260 3086788 3086063 gene locus_tag LOCUS_29270 3086788 3086063 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707741.1 protein_id gnl|my_center|LOCUS_29270 3087606 3086860 gene locus_tag LOCUS_29280 3087606 3086860 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707741.1 protein_id gnl|my_center|LOCUS_29280 3088058 3087660 gene locus_tag LOCUS_29290 3088058 3087660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 3088162 3089505 gene locus_tag LOCUS_29300 3088162 3089505 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939339.1 protein_id gnl|my_center|LOCUS_29300 3089635 3090942 gene locus_tag LOCUS_29310 3089635 3090942 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940529.1 protein_id gnl|my_center|LOCUS_29310 3090973 3092007 gene locus_tag LOCUS_29320 gene cydB 3090973 3092007 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940528.1 protein_id gnl|my_center|LOCUS_29320 3092169 3093371 gene locus_tag LOCUS_29330 3092169 3093371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 3093374 3093706 gene locus_tag LOCUS_29340 3093374 3093706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 3093706 3094890 gene locus_tag LOCUS_29350 3093706 3094890 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_29350 3096456 3095260 gene locus_tag LOCUS_29360 3096456 3095260 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266455.1 protein_id gnl|my_center|LOCUS_29360 3096739 3097506 gene locus_tag LOCUS_29370 3096739 3097506 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940517.1 protein_id gnl|my_center|LOCUS_29370 3098955 3097591 gene locus_tag LOCUS_29380 3098955 3097591 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793125.1 protein_id gnl|my_center|LOCUS_29380 3099081 3099356 gene locus_tag LOCUS_29390 3099081 3099356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 3100838 3099495 gene locus_tag LOCUS_29400 3100838 3099495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 3102222 3100882 gene locus_tag LOCUS_29410 3102222 3100882 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940197.1 protein_id gnl|my_center|LOCUS_29410 3102657 3117017 gene locus_tag LOCUS_29420 3102657 3117017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 3117124 3118452 gene locus_tag LOCUS_29430 3117124 3118452 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938312.1 protein_id gnl|my_center|LOCUS_29430 3118616 3119344 gene locus_tag LOCUS_29440 gene pgl 3118616 3119344 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838435.1 protein_id gnl|my_center|LOCUS_29440 3119507 3121741 gene locus_tag LOCUS_29450 3119507 3121741 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938316.1 protein_id gnl|my_center|LOCUS_29450 3121748 3123082 gene locus_tag LOCUS_29460 3121748 3123082 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938317.1 protein_id gnl|my_center|LOCUS_29460 3123433 3124125 gene locus_tag LOCUS_29470 3123433 3124125 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294588.1 protein_id gnl|my_center|LOCUS_29470 3124149 3126227 gene locus_tag LOCUS_29480 3124149 3126227 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938319.1 protein_id gnl|my_center|LOCUS_29480 3128241 3126784 gene locus_tag LOCUS_29490 gene cysS 3128241 3126784 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938870.1 protein_id gnl|my_center|LOCUS_29490 3129163 3128285 gene locus_tag LOCUS_29500 3129163 3128285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 3129432 3129166 gene locus_tag LOCUS_29510 3129432 3129166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29510 3130154 3129354 gene locus_tag LOCUS_29520 3130154 3129354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29520 3131548 3130823 gene locus_tag LOCUS_29530 3131548 3130823 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938748.1 protein_id gnl|my_center|LOCUS_29530 3132595 3131600 gene locus_tag LOCUS_29540 3132595 3131600 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938749.1 protein_id gnl|my_center|LOCUS_29540 3132837 3132762 gene locus_tag LOCUS_t00570 3132837 3132762 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3134078 3132891 gene locus_tag LOCUS_29550 3134078 3132891 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195471.1 protein_id gnl|my_center|LOCUS_29550 3134899 3134129 gene locus_tag LOCUS_29560 3134899 3134129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 3135899 3135012 gene locus_tag LOCUS_29570 3135899 3135012 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403892.1 protein_id gnl|my_center|LOCUS_29570 3137164 3136016 gene locus_tag LOCUS_29580 3137164 3136016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 3138559 3137279 gene locus_tag LOCUS_29590 3138559 3137279 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941677.1 protein_id gnl|my_center|LOCUS_29590 3138737 3139198 gene locus_tag LOCUS_29600 3138737 3139198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938521.1 protein_id gnl|my_center|LOCUS_29600 3142334 3139272 gene locus_tag LOCUS_29610 3142334 3139272 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937745.1 protein_id gnl|my_center|LOCUS_29610 3143554 3142334 gene locus_tag LOCUS_29620 3143554 3142334 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546440.1 protein_id gnl|my_center|LOCUS_29620 3144219 3143662 gene locus_tag LOCUS_29630 gene maa 3144219 3143662 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704609.1 protein_id gnl|my_center|LOCUS_29630 3144766 3144239 gene locus_tag LOCUS_29640 3144766 3144239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 3145171 3144932 gene locus_tag LOCUS_29650 3145171 3144932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 3145186 3146835 gene locus_tag LOCUS_29660 3145186 3146835 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942831.1 protein_id gnl|my_center|LOCUS_29660 3146947 3148113 gene locus_tag LOCUS_29670 3146947 3148113 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942830.1 protein_id gnl|my_center|LOCUS_29670 3148811 3148236 gene locus_tag LOCUS_29680 3148811 3148236 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_29680 3149140 3148940 gene locus_tag LOCUS_29690 3149140 3148940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 3149643 3149125 gene locus_tag LOCUS_29700 3149643 3149125 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939694.1 protein_id gnl|my_center|LOCUS_29700 3149821 3150198 gene locus_tag LOCUS_29710 3149821 3150198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 3150293 3152284 gene locus_tag LOCUS_29720 3150293 3152284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 3152382 3152927 gene locus_tag LOCUS_29730 3152382 3152927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 3152924 3153340 gene locus_tag LOCUS_29740 3152924 3153340 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_29740 3153546 3154097 gene locus_tag LOCUS_29750 3153546 3154097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791841.1 protein_id gnl|my_center|LOCUS_29750 3155478 3154591 gene locus_tag LOCUS_29760 3155478 3154591 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045008.1 protein_id gnl|my_center|LOCUS_29760 3157246 3155507 gene locus_tag LOCUS_29770 gene ade 3157246 3155507 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_29770 3157387 3158274 gene locus_tag LOCUS_29780 3157387 3158274 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792899.1 protein_id gnl|my_center|LOCUS_29780 3158360 3160663 gene locus_tag LOCUS_29790 3158360 3160663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 3161524 3160742 gene locus_tag LOCUS_29800 gene map 3161524 3160742 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_29800 3161724 3163097 gene locus_tag LOCUS_29810 3161724 3163097 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930455.1 protein_id gnl|my_center|LOCUS_29810 3163558 3163094 gene locus_tag LOCUS_29820 3163558 3163094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 3164886 3163627 gene locus_tag LOCUS_29830 gene hemL 3164886 3163627 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940426.1 protein_id gnl|my_center|LOCUS_29830 3165370 3164888 gene locus_tag LOCUS_29840 gene ahbB 3165370 3164888 CDS product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940425.1 protein_id gnl|my_center|LOCUS_29840 3165987 3166979 gene locus_tag LOCUS_29850 3165987 3166979 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940417.1 protein_id gnl|my_center|LOCUS_29850 3167001 3167267 gene locus_tag LOCUS_29860 3167001 3167267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 3167308 3168816 gene locus_tag LOCUS_29870 3167308 3168816 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937393.1 protein_id gnl|my_center|LOCUS_29870 3168813 3169319 gene locus_tag LOCUS_29880 3168813 3169319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 3169309 3170433 gene locus_tag LOCUS_29890 gene cbiD 3169309 3170433 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940016.1 protein_id gnl|my_center|LOCUS_29890 3170480 3171508 gene locus_tag LOCUS_29900 3170480 3171508 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229228.1 protein_id gnl|my_center|LOCUS_29900 3171502 3172254 gene locus_tag LOCUS_29910 gene cobJ 3171502 3172254 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940428.1 protein_id gnl|my_center|LOCUS_29910 3172414 3172809 gene locus_tag LOCUS_29920 3172414 3172809 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940429.1 protein_id gnl|my_center|LOCUS_29920 3172895 3174598 gene locus_tag LOCUS_29930 3172895 3174598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 3174732 3175895 gene locus_tag LOCUS_29940 3174732 3175895 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933049.1 protein_id gnl|my_center|LOCUS_29940 3175888 3176223 gene locus_tag LOCUS_29950 3175888 3176223 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937600.1 protein_id gnl|my_center|LOCUS_29950 3178171 3176564 gene locus_tag LOCUS_29960 3178171 3176564 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 protein_id gnl|my_center|LOCUS_29960 3178966 3178184 gene locus_tag LOCUS_29970 3178966 3178184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 3179253 3180800 gene locus_tag LOCUS_29980 gene ffh 3179253 3180800 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938141.1 protein_id gnl|my_center|LOCUS_29980 3180911 3181150 gene locus_tag LOCUS_29990 gene rpsP 3180911 3181150 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938140.1 protein_id gnl|my_center|LOCUS_29990 3181234 3181467 gene locus_tag LOCUS_30000 3181234 3181467 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_30000 3181482 3182162 gene locus_tag LOCUS_30010 gene rimM 3181482 3182162 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938138.1 protein_id gnl|my_center|LOCUS_30010 3182167 3183462 gene locus_tag LOCUS_30020 gene trmD 3182167 3183462 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938137.1 protein_id gnl|my_center|LOCUS_30020 3183492 3183842 gene locus_tag LOCUS_30030 gene rplS 3183492 3183842 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938136.1 protein_id gnl|my_center|LOCUS_30030 3184005 3184646 gene locus_tag LOCUS_30040 3184005 3184646 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938135.1 protein_id gnl|my_center|LOCUS_30040 3184903 3187356 gene locus_tag LOCUS_30050 gene dmsA 3184903 3187356 CDS product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850260.1 protein_id gnl|my_center|LOCUS_30050 3187350 3187970 gene locus_tag LOCUS_30060 gene dmsB 3187350 3187970 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392898.1 protein_id gnl|my_center|LOCUS_30060 3188018 3188401 gene locus_tag LOCUS_30070 3188018 3188401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 3188406 3188663 gene locus_tag LOCUS_30080 3188406 3188663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 3191185 3188681 gene locus_tag LOCUS_30090 3191185 3188681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 3191379 3191744 gene locus_tag LOCUS_30100 3191379 3191744 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938134.1 protein_id gnl|my_center|LOCUS_30100 3191751 3192584 gene locus_tag LOCUS_30110 gene rsmI 3191751 3192584 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938133.1 protein_id gnl|my_center|LOCUS_30110 3192581 3193549 gene locus_tag LOCUS_30120 gene bioB 3192581 3193549 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_30120 3193595 3194140 gene locus_tag LOCUS_30130 3193595 3194140 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940149.1 protein_id gnl|my_center|LOCUS_30130 3194214 3194960 gene locus_tag LOCUS_30140 3194214 3194960 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938132.1 protein_id gnl|my_center|LOCUS_30140 3195071 3195316 gene locus_tag LOCUS_30150 3195071 3195316 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792685.1 protein_id gnl|my_center|LOCUS_30150 3195326 3197107 gene locus_tag LOCUS_30160 gene ptsP 3195326 3197107 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092157593.1 protein_id gnl|my_center|LOCUS_30160 3198618 3198809 gene locus_tag LOCUS_30170 3198618 3198809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 3198810 3199646 gene locus_tag LOCUS_30180 3198810 3199646 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940432.1 protein_id gnl|my_center|LOCUS_30180 3199821 3199612 gene locus_tag LOCUS_30190 3199821 3199612 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940433.1 protein_id gnl|my_center|LOCUS_30190 3199891 3201210 gene locus_tag LOCUS_30200 3199891 3201210 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940434.1 protein_id gnl|my_center|LOCUS_30200 3201223 3201918 gene locus_tag LOCUS_30210 gene mqnB 3201223 3201918 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791464.1 protein_id gnl|my_center|LOCUS_30210 3202189 3201989 gene locus_tag LOCUS_30220 3202189 3201989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 3202106 3202933 gene locus_tag LOCUS_30230 3202106 3202933 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940437.1 protein_id gnl|my_center|LOCUS_30230 3203006 3206005 gene locus_tag LOCUS_30240 3203006 3206005 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940439.1 protein_id gnl|my_center|LOCUS_30240 3206276 3206761 gene locus_tag LOCUS_30250 3206276 3206761 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524292.1 protein_id gnl|my_center|LOCUS_30250 3206774 3208789 gene locus_tag LOCUS_30260 3206774 3208789 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940440.1 protein_id gnl|my_center|LOCUS_30260 3209160 3209558 gene locus_tag LOCUS_30270 3209160 3209558 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_30270 3209676 3210251 gene locus_tag LOCUS_30280 3209676 3210251 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392800.1 protein_id gnl|my_center|LOCUS_30280 3210278 3210664 gene locus_tag LOCUS_30290 3210278 3210664 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_30290 3210733 3211182 gene locus_tag LOCUS_30300 3210733 3211182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 3211190 3212353 gene locus_tag LOCUS_30310 3211190 3212353 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940443.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30310 3212238 3212480 gene locus_tag LOCUS_30320 3212238 3212480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30320 3214982 3212559 gene locus_tag LOCUS_30330 3214982 3212559 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791682.1 protein_id gnl|my_center|LOCUS_30330 3215176 3216024 gene locus_tag LOCUS_30340 gene panC 3215176 3216024 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939719.1 protein_id gnl|my_center|LOCUS_30340 3216047 3216406 gene locus_tag LOCUS_30350 3216047 3216406 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688909.1 protein_id gnl|my_center|LOCUS_30350 3216444 3217616 gene locus_tag LOCUS_30360 gene metK 3216444 3217616 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939720.1 protein_id gnl|my_center|LOCUS_30360 3217830 3218621 gene locus_tag LOCUS_30370 3217830 3218621 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042382595.1 protein_id gnl|my_center|LOCUS_30370 3218618 3219880 gene locus_tag LOCUS_30380 3218618 3219880 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530416.1 protein_id gnl|my_center|LOCUS_30380 3219843 3220967 gene locus_tag LOCUS_30390 3219843 3220967 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938127.1 protein_id gnl|my_center|LOCUS_30390 3221184 3221035 gene locus_tag LOCUS_30400 3221184 3221035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 3221216 3223756 gene locus_tag LOCUS_30410 gene secA 3221216 3223756 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938126.1 protein_id gnl|my_center|LOCUS_30410 3223915 3224358 gene locus_tag LOCUS_30420 gene creA 3223915 3224358 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875811.1 protein_id gnl|my_center|LOCUS_30420 3224440 3224916 gene locus_tag LOCUS_30430 gene smpB 3224440 3224916 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938129.1 protein_id gnl|my_center|LOCUS_30430 3224961 3226352 gene locus_tag LOCUS_30440 3224961 3226352 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938128.1 protein_id gnl|my_center|LOCUS_30440 3226566 3228308 gene locus_tag LOCUS_30450 3226566 3228308 CDS product bifunctional aspartate transaminase/aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073522.1 protein_id gnl|my_center|LOCUS_30450 3229268 3228372 gene locus_tag LOCUS_30460 3229268 3228372 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 protein_id gnl|my_center|LOCUS_30460 3229563 3230465 gene locus_tag LOCUS_30470 3229563 3230465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 3230480 3231049 gene locus_tag LOCUS_30480 3230480 3231049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 3231575 3231063 gene locus_tag LOCUS_30490 3231575 3231063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 3232193 3231669 gene locus_tag LOCUS_30500 3232193 3231669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30500 3232717 3232157 gene locus_tag LOCUS_30510 3232717 3232157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30510 3232965 3233969 gene locus_tag LOCUS_30520 gene rfaD 3232965 3233969 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937788.1 protein_id gnl|my_center|LOCUS_30520 3233966 3236344 gene locus_tag LOCUS_30530 gene lptD 3233966 3236344 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792614.1 protein_id gnl|my_center|LOCUS_30530 3236346 3238175 gene locus_tag LOCUS_30540 3236346 3238175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 3238296 3238499 gene locus_tag LOCUS_30550 3238296 3238499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 3238969 3240762 gene locus_tag LOCUS_30560 3238969 3240762 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937324.1 protein_id gnl|my_center|LOCUS_30560 3240786 3242021 gene locus_tag LOCUS_30570 3240786 3242021 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868516.1 protein_id gnl|my_center|LOCUS_30570 3242119 3242745 gene locus_tag LOCUS_30580 3242119 3242745 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883319.1 protein_id gnl|my_center|LOCUS_30580 3243823 3242825 gene locus_tag LOCUS_30590 3243823 3242825 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629424.1 protein_id gnl|my_center|LOCUS_30590 3244647 3243820 gene locus_tag LOCUS_30600 3244647 3243820 CDS product WcbI family polysaccharide biosynthesis putative acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791626.1 protein_id gnl|my_center|LOCUS_30600 3244800 3245876 gene locus_tag LOCUS_30610 gene cobT 3244800 3245876 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940537.1 protein_id gnl|my_center|LOCUS_30610 3246963 3245905 gene locus_tag LOCUS_30620 gene corA 3246963 3245905 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_30620 3248071 3246956 gene locus_tag LOCUS_30630 3248071 3246956 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143858.1 protein_id gnl|my_center|LOCUS_30630 3248753 3248139 gene locus_tag LOCUS_30640 3248753 3248139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939792.1 protein_id gnl|my_center|LOCUS_30640 3249286 3248750 gene locus_tag LOCUS_30650 gene thrB 3249286 3248750 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939791.1 protein_id gnl|my_center|LOCUS_30650 3249829 3249290 gene locus_tag LOCUS_30660 gene pyrR 3249829 3249290 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938679.1 protein_id gnl|my_center|LOCUS_30660 3250226 3250357 gene locus_tag LOCUS_30670 3250226 3250357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 3250470 3250787 gene locus_tag LOCUS_30680 3250470 3250787 CDS product IscA/HesB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938677.1 protein_id gnl|my_center|LOCUS_30680 3252378 3250909 gene locus_tag LOCUS_30690 3252378 3250909 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940824.1 protein_id gnl|my_center|LOCUS_30690 3254378 3253221 gene locus_tag LOCUS_30700 3254378 3253221 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391253.1 protein_id gnl|my_center|LOCUS_30700 3255208 3254552 gene locus_tag LOCUS_30710 3255208 3254552 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_30710 3256356 3255367 gene locus_tag LOCUS_30720 3256356 3255367 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791810.1 protein_id gnl|my_center|LOCUS_30720 3257345 3256458 gene locus_tag LOCUS_30730 3257345 3256458 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340302.1 protein_id gnl|my_center|LOCUS_30730 3258901 3257345 gene locus_tag LOCUS_30740 3258901 3257345 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_30740 3259638 3258898 gene locus_tag LOCUS_30750 3259638 3258898 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_30750 3259921 3259643 gene locus_tag LOCUS_30760 3259921 3259643 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_30760 3260641 3259925 gene locus_tag LOCUS_30770 3260641 3259925 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328512.1 protein_id gnl|my_center|LOCUS_30770 3260956 3260654 gene locus_tag LOCUS_30780 3260956 3260654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 3261260 3260934 gene locus_tag LOCUS_30790 3261260 3260934 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120167.1 protein_id gnl|my_center|LOCUS_30790 3261640 3261257 gene locus_tag LOCUS_30800 3261640 3261257 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120166.1 protein_id gnl|my_center|LOCUS_30800 3262044 3261637 gene locus_tag LOCUS_30810 3262044 3261637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30810 3263992 3263018 gene locus_tag LOCUS_30820 3263992 3263018 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938043.1 protein_id gnl|my_center|LOCUS_30820 3265420 3264152 gene locus_tag LOCUS_30830 3265420 3264152 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895459.1 protein_id gnl|my_center|LOCUS_30830 3265593 3266084 gene locus_tag LOCUS_30840 3265593 3266084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 3266154 3267119 gene locus_tag LOCUS_30850 3266154 3267119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 3267179 3267676 gene locus_tag LOCUS_30860 3267179 3267676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 3268119 3269777 gene locus_tag LOCUS_30870 gene sulP 3268119 3269777 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937588.1 protein_id gnl|my_center|LOCUS_30870 3270582 3269899 gene locus_tag LOCUS_30880 3270582 3269899 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939274.1 protein_id gnl|my_center|LOCUS_30880 3270723 3270809 gene locus_tag LOCUS_t00580 3270723 3270809 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3271547 3273022 gene locus_tag LOCUS_30890 3271547 3273022 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461268.1 protein_id gnl|my_center|LOCUS_30890 3273369 3273082 gene locus_tag LOCUS_30900 3273369 3273082 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461741.1 protein_id gnl|my_center|LOCUS_30900 3274505 3273366 gene locus_tag LOCUS_30910 3274505 3273366 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278514.1 protein_id gnl|my_center|LOCUS_30910 3274654 3274517 gene locus_tag LOCUS_30920 3274654 3274517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30920 3275511 3274726 gene locus_tag LOCUS_30930 3275511 3274726 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231526.1 protein_id gnl|my_center|LOCUS_30930 3276775 3275522 gene locus_tag LOCUS_30940 gene caiB 3276775 3275522 CDS product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016209.1 protein_id gnl|my_center|LOCUS_30940 3278034 3276895 gene locus_tag LOCUS_30950 gene caiA 3278034 3276895 CDS product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 protein_id gnl|my_center|LOCUS_30950 3279253 3280803 gene locus_tag LOCUS_30960 3279253 3280803 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816517.1 protein_id gnl|my_center|LOCUS_30960 3281386 3282912 gene locus_tag LOCUS_30970 3281386 3282912 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462305.1 protein_id gnl|my_center|LOCUS_30970 3282990 3283607 gene locus_tag LOCUS_30980 3282990 3283607 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940031.1 protein_id gnl|my_center|LOCUS_30980 3283687 3284112 gene locus_tag LOCUS_30990 3283687 3284112 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276952.1 protein_id gnl|my_center|LOCUS_30990 3284330 3285079 gene locus_tag LOCUS_31000 3284330 3285079 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461748.1 protein_id gnl|my_center|LOCUS_31000 3285231 3285404 gene locus_tag LOCUS_31010 3285231 3285404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 3285433 3286143 gene locus_tag LOCUS_31020 3285433 3286143 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461383.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31020 3286266 3287813 gene locus_tag LOCUS_31030 gene caiC 3286266 3287813 CDS product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355790.1 protein_id gnl|my_center|LOCUS_31030 3288197 3288922 gene locus_tag LOCUS_31040 3288197 3288922 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903848.1 protein_id gnl|my_center|LOCUS_31040 3289743 3289057 gene locus_tag LOCUS_31050 3289743 3289057 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941217.1 protein_id gnl|my_center|LOCUS_31050 3289853 3290077 gene locus_tag LOCUS_31060 3289853 3290077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 3290189 3292384 gene locus_tag LOCUS_31070 gene katG 3290189 3292384 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942744.1 protein_id gnl|my_center|LOCUS_31070 3292739 3292473 gene locus_tag LOCUS_31080 3292739 3292473 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_31080 3293181 3293921 gene locus_tag LOCUS_31090 3293181 3293921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 3295156 3293945 gene locus_tag LOCUS_31100 gene hydF 3295156 3293945 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925770.1 protein_id gnl|my_center|LOCUS_31100 3296099 3295074 gene locus_tag LOCUS_31110 gene hydE 3296099 3295074 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073670.1 protein_id gnl|my_center|LOCUS_31110 3296397 3296155 gene locus_tag LOCUS_31120 3296397 3296155 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393237.1 protein_id gnl|my_center|LOCUS_31120 3297131 3296793 gene locus_tag LOCUS_31130 3297131 3296793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 3298402 3297143 gene locus_tag LOCUS_31140 3298402 3297143 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939057.1 protein_id gnl|my_center|LOCUS_31140 3299534 3298701 gene locus_tag LOCUS_31150 3299534 3298701 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939671.1 protein_id gnl|my_center|LOCUS_31150 3300573 3299521 gene locus_tag LOCUS_31160 3300573 3299521 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791853.1 protein_id gnl|my_center|LOCUS_31160 3301522 3300578 gene locus_tag LOCUS_31170 3301522 3300578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31170 3301983 3301519 gene locus_tag LOCUS_31180 3301983 3301519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31180 3303974 3301992 gene locus_tag LOCUS_31190 3303974 3301992 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939674.1 protein_id gnl|my_center|LOCUS_31190 3305089 3304211 gene locus_tag LOCUS_31200 3305089 3304211 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939675.1 protein_id gnl|my_center|LOCUS_31200 3305643 3305086 gene locus_tag LOCUS_31210 3305643 3305086 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939676.1 protein_id gnl|my_center|LOCUS_31210 3306585 3306328 gene locus_tag LOCUS_31220 3306585 3306328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792913.1 protein_id gnl|my_center|LOCUS_31220 3307265 3306582 gene locus_tag LOCUS_31230 3307265 3306582 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294610.1 protein_id gnl|my_center|LOCUS_31230 3307644 3308963 gene locus_tag LOCUS_31240 gene dsrA 3307644 3308963 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937709.1 protein_id gnl|my_center|LOCUS_31240 3308981 3310126 gene locus_tag LOCUS_31250 gene dsrB 3308981 3310126 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937710.1 protein_id gnl|my_center|LOCUS_31250 3310190 3310438 gene locus_tag LOCUS_31260 3310190 3310438 CDS product dissimilatory sulfite reductase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937711.1 protein_id gnl|my_center|LOCUS_31260 3310507 3311901 gene locus_tag LOCUS_31270 3310507 3311901 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937712.1 protein_id gnl|my_center|LOCUS_31270 3312163 3313293 gene locus_tag LOCUS_31280 3312163 3313293 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933143.1 protein_id gnl|my_center|LOCUS_31280 3313303 3313626 gene locus_tag LOCUS_31290 3313303 3313626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 3313667 3314158 gene locus_tag LOCUS_31300 3313667 3314158 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792177.1 protein_id gnl|my_center|LOCUS_31300 3316272 3315535 gene locus_tag LOCUS_31310 3316272 3315535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940006.1 protein_id gnl|my_center|LOCUS_31310 3317036 3316269 gene locus_tag LOCUS_31320 3317036 3316269 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940007.1 protein_id gnl|my_center|LOCUS_31320 3318117 3317047 gene locus_tag LOCUS_31330 3318117 3317047 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940008.1 protein_id gnl|my_center|LOCUS_31330 3319047 3318127 gene locus_tag LOCUS_31340 3319047 3318127 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940009.1 protein_id gnl|my_center|LOCUS_31340 3320353 3319175 gene locus_tag LOCUS_31350 3320353 3319175 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940010.1 protein_id gnl|my_center|LOCUS_31350 3321197 3320604 gene locus_tag LOCUS_31360 gene cysC 3321197 3320604 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524672.1 protein_id gnl|my_center|LOCUS_31360 3322902 3321205 gene locus_tag LOCUS_31370 3322902 3321205 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792381.1 protein_id gnl|my_center|LOCUS_31370 3323366 3324025 gene locus_tag LOCUS_31380 3323366 3324025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 3324025 3325119 gene locus_tag LOCUS_31390 3324025 3325119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 3325298 3326254 gene locus_tag LOCUS_31400 3325298 3326254 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937367.1 protein_id gnl|my_center|LOCUS_31400 3326539 3326261 gene locus_tag LOCUS_31410 3326539 3326261 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937611.1 protein_id gnl|my_center|LOCUS_31410 3326678 3326839 gene locus_tag LOCUS_31420 3326678 3326839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 3328168 3326939 gene locus_tag LOCUS_31430 3328168 3326939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 3328836 3328291 gene locus_tag LOCUS_31440 3328836 3328291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 3330549 3328963 gene locus_tag LOCUS_31450 gene groL 3330549 3328963 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939262.1 protein_id gnl|my_center|LOCUS_31450 3330840 3330580 gene locus_tag LOCUS_31460 gene groES 3330840 3330580 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939263.1 protein_id gnl|my_center|LOCUS_31460 3331101 3332573 gene locus_tag LOCUS_31470 3331101 3332573 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869048.1 protein_id gnl|my_center|LOCUS_31470 3332609 3332842 gene locus_tag LOCUS_31480 3332609 3332842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 3333786 3332848 gene locus_tag LOCUS_31490 3333786 3332848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 3333982 3334428 gene locus_tag LOCUS_31500 3333982 3334428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 3334460 3335404 gene locus_tag LOCUS_31510 3334460 3335404 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939269.1 protein_id gnl|my_center|LOCUS_31510 3336121 3337221 gene locus_tag LOCUS_31520 gene dndB 3336121 3337221 CDS product DNA sulfur modification protein DndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134924.1 protein_id gnl|my_center|LOCUS_31520 3337223 3338632 gene locus_tag LOCUS_31530 gene dndC 3337223 3338632 CDS product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 protein_id gnl|my_center|LOCUS_31530 3338629 3340629 gene locus_tag LOCUS_31540 gene dndD 3338629 3340629 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_31540 3340676 3340960 gene locus_tag LOCUS_31550 3340676 3340960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 3342647 3340950 gene locus_tag LOCUS_31560 3342647 3340950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 3344936 3342657 gene locus_tag LOCUS_31570 3344936 3342657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 3347053 3346220 gene locus_tag LOCUS_31580 3347053 3346220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 3350095 3349337 gene locus_tag LOCUS_31590 3350095 3349337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 3353074 3350987 gene locus_tag LOCUS_31600 3353074 3350987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 3353882 3353058 gene locus_tag LOCUS_31610 3353882 3353058 CDS product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097953302.1 protein_id gnl|my_center|LOCUS_31610 3356826 3354004 gene locus_tag LOCUS_31620 3356826 3354004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 3357072 3358622 gene locus_tag LOCUS_31630 3357072 3358622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31630 3358513 3359748 gene locus_tag LOCUS_31640 3358513 3359748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31640 3359839 3361101 gene locus_tag LOCUS_31650 3359839 3361101 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842634.1 protein_id gnl|my_center|LOCUS_31650 3361098 3363647 gene locus_tag LOCUS_31660 3361098 3363647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 3363739 3364119 gene locus_tag LOCUS_31670 3363739 3364119 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546622.1 protein_id gnl|my_center|LOCUS_31670 3364127 3365866 gene locus_tag LOCUS_31680 3364127 3365866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 3367352 3365856 gene locus_tag LOCUS_31690 3367352 3365856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 3368205 3367357 gene locus_tag LOCUS_31700 3368205 3367357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 3369891 3368308 gene locus_tag LOCUS_31710 3369891 3368308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 3370865 3369888 gene locus_tag LOCUS_31720 3370865 3369888 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938291.1 protein_id gnl|my_center|LOCUS_31720 3371347 3371072 gene locus_tag LOCUS_31730 3371347 3371072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 3374042 3371433 gene locus_tag LOCUS_31740 3374042 3371433 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940472.1 protein_id gnl|my_center|LOCUS_31740 3374790 3374083 gene locus_tag LOCUS_31750 3374790 3374083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937444.1 protein_id gnl|my_center|LOCUS_31750 3375729 3374794 gene locus_tag LOCUS_31760 3375729 3374794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31760 3376532 3376125 gene locus_tag LOCUS_31770 3376532 3376125 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_31770 3376929 3376558 gene locus_tag LOCUS_31780 3376929 3376558 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937451.1 protein_id gnl|my_center|LOCUS_31780 3378628 3376943 gene locus_tag LOCUS_31790 3378628 3376943 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937450.1 protein_id gnl|my_center|LOCUS_31790 3379040 3378633 gene locus_tag LOCUS_31800 3379040 3378633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 3379318 3380823 gene locus_tag LOCUS_31810 3379318 3380823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 3380808 3382226 gene locus_tag LOCUS_31820 3380808 3382226 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_31820 3383671 3382631 gene locus_tag LOCUS_31830 3383671 3382631 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261916.1 protein_id gnl|my_center|LOCUS_31830 3384435 3383668 gene locus_tag LOCUS_31840 gene potC 3384435 3383668 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937407.1 protein_id gnl|my_center|LOCUS_31840 3385295 3384432 gene locus_tag LOCUS_31850 3385295 3384432 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937408.1 protein_id gnl|my_center|LOCUS_31850 3386385 3385288 gene locus_tag LOCUS_31860 gene potA 3386385 3385288 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937409.1 protein_id gnl|my_center|LOCUS_31860 3388257 3386578 gene locus_tag LOCUS_31870 3388257 3386578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 3389092 3388388 gene locus_tag LOCUS_31880 3389092 3388388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 3390351 3389089 gene locus_tag LOCUS_31890 3390351 3389089 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940204.1 protein_id gnl|my_center|LOCUS_31890 3390932 3390375 gene locus_tag LOCUS_31900 gene pyrE 3390932 3390375 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940203.1 protein_id gnl|my_center|LOCUS_31900 3392235 3390940 gene locus_tag LOCUS_31910 gene purB 3392235 3390940 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940202.1 protein_id gnl|my_center|LOCUS_31910 3392666 3392355 gene locus_tag LOCUS_31920 3392666 3392355 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940201.1 protein_id gnl|my_center|LOCUS_31920 3392895 3392719 gene locus_tag LOCUS_31930 3392895 3392719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 3393156 3393659 gene locus_tag LOCUS_31940 3393156 3393659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940538.1 protein_id gnl|my_center|LOCUS_31940 3394026 3395225 gene locus_tag LOCUS_31950 gene acrA 3394026 3395225 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386618.1 protein_id gnl|my_center|LOCUS_31950 3395232 3398381 gene locus_tag LOCUS_31960 3395232 3398381 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972354.1 protein_id gnl|my_center|LOCUS_31960 3398794 3398513 gene locus_tag LOCUS_31970 3398794 3398513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 3398829 3399440 gene locus_tag LOCUS_31980 3398829 3399440 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022152.1 protein_id gnl|my_center|LOCUS_31980 3401280 3399538 gene locus_tag LOCUS_31990 3401280 3399538 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938640.1 protein_id gnl|my_center|LOCUS_31990 3402354 3401281 gene locus_tag LOCUS_32000 gene ispG 3402354 3401281 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629734.1 protein_id gnl|my_center|LOCUS_32000 3403095 3402523 gene locus_tag LOCUS_32010 3403095 3402523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 3404190 3403108 gene locus_tag LOCUS_32020 3404190 3403108 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_32020 3404569 3404201 gene locus_tag LOCUS_32030 3404569 3404201 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937738.1 protein_id gnl|my_center|LOCUS_32030 3405038 3404595 gene locus_tag LOCUS_32040 3405038 3404595 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_32040 3405892 3405044 gene locus_tag LOCUS_32050 3405892 3405044 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937740.1 protein_id gnl|my_center|LOCUS_32050 3407790 3405892 gene locus_tag LOCUS_32060 3407790 3405892 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937741.1 protein_id gnl|my_center|LOCUS_32060 3408845 3408162 gene locus_tag LOCUS_32070 3408845 3408162 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792348.1 protein_id gnl|my_center|LOCUS_32070 3408940 3409395 gene locus_tag LOCUS_32080 3408940 3409395 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792349.1 protein_id gnl|my_center|LOCUS_32080 3409446 3409522 gene locus_tag LOCUS_t00590 3409446 3409522 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3409601 3409677 gene locus_tag LOCUS_t00600 3409601 3409677 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3409911 3411711 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccacgtgtgtggggatgaaccg 3411851 3413275 gene locus_tag LOCUS_32090 gene xseA 3411851 3413275 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938641.1 protein_id gnl|my_center|LOCUS_32090 3413283 3414275 gene locus_tag LOCUS_32100 3413283 3414275 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792442.1 protein_id gnl|my_center|LOCUS_32100 3414312 3414551 gene locus_tag LOCUS_32110 3414312 3414551 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938643.1 protein_id gnl|my_center|LOCUS_32110 3414548 3415441 gene locus_tag LOCUS_32120 3414548 3415441 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792441.1 protein_id gnl|my_center|LOCUS_32120 3415463 3417355 gene locus_tag LOCUS_32130 gene dxs 3415463 3417355 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938645.1 protein_id gnl|my_center|LOCUS_32130 3418073 3417462 gene locus_tag LOCUS_32140 3418073 3417462 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524311.1 protein_id gnl|my_center|LOCUS_32140 3418866 3418207 gene locus_tag LOCUS_32150 3418866 3418207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 3419638 3418892 gene locus_tag LOCUS_32160 3419638 3418892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938238.1 protein_id gnl|my_center|LOCUS_32160 3419763 3420548 gene locus_tag LOCUS_32170 gene lgt 3419763 3420548 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937326.1 protein_id gnl|my_center|LOCUS_32170 3421331 3420465 gene locus_tag LOCUS_32180 3421331 3420465 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 protein_id gnl|my_center|LOCUS_32180 3422108 3421458 gene locus_tag LOCUS_32190 3422108 3421458 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_32190 3422266 3423114 gene locus_tag LOCUS_32200 gene ispH 3422266 3423114 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937366.1 protein_id gnl|my_center|LOCUS_32200 3423540 3423902 gene locus_tag LOCUS_32210 3423540 3423902 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939487.1 protein_id gnl|my_center|LOCUS_32210 3423985 3424989 gene locus_tag LOCUS_32220 gene moaA 3423985 3424989 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937883.1 protein_id gnl|my_center|LOCUS_32220 3425173 3428085 gene locus_tag LOCUS_32230 3425173 3428085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 3428525 3428079 gene locus_tag LOCUS_32240 gene arfB 3428525 3428079 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776269.1 protein_id gnl|my_center|LOCUS_32240 3428649 3429140 gene locus_tag LOCUS_32250 3428649 3429140 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937552.1 protein_id gnl|my_center|LOCUS_32250 3430688 3429270 gene locus_tag LOCUS_32260 3430688 3429270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 3430856 3432640 gene locus_tag LOCUS_32270 3430856 3432640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 3432644 3433855 gene locus_tag LOCUS_32280 3432644 3433855 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294622.1 protein_id gnl|my_center|LOCUS_32280 3433852 3435012 gene locus_tag LOCUS_32290 3433852 3435012 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388450.1 protein_id gnl|my_center|LOCUS_32290 3438736 3435023 gene locus_tag LOCUS_32300 3438736 3435023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 3440102 3438894 gene locus_tag LOCUS_32310 gene trpB 3440102 3438894 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937396.1 protein_id gnl|my_center|LOCUS_32310 3441393 3440296 gene locus_tag LOCUS_32320 gene gluQRS 3441393 3440296 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_32320 3443130 3441520 gene locus_tag LOCUS_32330 3443130 3441520 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791517.1 protein_id gnl|my_center|LOCUS_32330 3443447 3443214 gene locus_tag LOCUS_32340 3443447 3443214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 3444327 3444485 gene locus_tag LOCUS_32350 3444327 3444485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 3444815 3444504 gene locus_tag LOCUS_32360 3444815 3444504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 3445432 3445695 gene locus_tag LOCUS_32370 3445432 3445695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 3446538 3447335 gene locus_tag LOCUS_32380 3446538 3447335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 3447337 3448176 gene locus_tag LOCUS_32390 3447337 3448176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 3448176 3448421 gene locus_tag LOCUS_32400 3448176 3448421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 3448424 3449482 gene locus_tag LOCUS_32410 3448424 3449482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 3450491 3450231 gene locus_tag LOCUS_32420 3450491 3450231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 3452117 3451743 gene locus_tag LOCUS_32430 3452117 3451743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 3452953 3452261 gene locus_tag LOCUS_32440 3452953 3452261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 3454103 3452994 gene locus_tag LOCUS_32450 3454103 3452994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 3454346 3455248 gene locus_tag LOCUS_32460 3454346 3455248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 3456341 3455346 gene locus_tag LOCUS_32470 3456341 3455346 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035961988.1 protein_id gnl|my_center|LOCUS_32470 3456529 3456454 gene locus_tag LOCUS_t00610 3456529 3456454 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3456746 3460033 gene locus_tag LOCUS_32480 3456746 3460033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 3462040 3460040 gene locus_tag LOCUS_32490 3462040 3460040 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_32490 3462145 3462495 gene locus_tag LOCUS_32500 3462145 3462495 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871037.1 protein_id gnl|my_center|LOCUS_32500 3464632 3462521 gene locus_tag LOCUS_32510 3464632 3462521 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_32510 3466981 3464729 gene locus_tag LOCUS_32520 3466981 3464729 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445413.1 protein_id gnl|my_center|LOCUS_32520 3468448 3467057 gene locus_tag LOCUS_32530 3468448 3467057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 3469118 3470680 gene locus_tag LOCUS_32540 3469118 3470680 CDS product high-molecular-weight cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524248.1 protein_id gnl|my_center|LOCUS_32540 3470714 3471817 gene locus_tag LOCUS_32550 3470714 3471817 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937841.1 protein_id gnl|my_center|LOCUS_32550 3471817 3472986 gene locus_tag LOCUS_32560 gene nrfD 3471817 3472986 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937840.1 protein_id gnl|my_center|LOCUS_32560 3473004 3473135 gene locus_tag LOCUS_32570 3473004 3473135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 3473167 3473844 gene locus_tag LOCUS_32580 3473167 3473844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937838.1 protein_id gnl|my_center|LOCUS_32580 3473876 3475267 gene locus_tag LOCUS_32590 3473876 3475267 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937837.1 protein_id gnl|my_center|LOCUS_32590 3475332 3476237 gene locus_tag LOCUS_32600 3475332 3476237 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937570.1 protein_id gnl|my_center|LOCUS_32600 3476338 3476694 gene locus_tag LOCUS_32610 3476338 3476694 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937568.1 protein_id gnl|my_center|LOCUS_32610 3476785 3478332 gene locus_tag LOCUS_32620 3476785 3478332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 3478369 3478773 gene locus_tag LOCUS_32630 3478369 3478773 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937578.1 protein_id gnl|my_center|LOCUS_32630 3479316 3480569 gene locus_tag LOCUS_32640 3479316 3480569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937575.1 protein_id gnl|my_center|LOCUS_32640 3480583 3481245 gene locus_tag LOCUS_32650 3480583 3481245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937574.1 protein_id gnl|my_center|LOCUS_32650 3481267 3482607 gene locus_tag LOCUS_32660 3481267 3482607 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937573.1 protein_id gnl|my_center|LOCUS_32660 3482617 3482991 gene locus_tag LOCUS_32670 3482617 3482991 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937572.1 protein_id gnl|my_center|LOCUS_32670 3483678 3484697 gene locus_tag LOCUS_32680 3483678 3484697 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722552.1 protein_id gnl|my_center|LOCUS_32680 3484814 3485932 gene locus_tag LOCUS_32690 3484814 3485932 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 protein_id gnl|my_center|LOCUS_32690 3485934 3487046 gene locus_tag LOCUS_32700 3485934 3487046 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266808.1 protein_id gnl|my_center|LOCUS_32700 3487059 3487805 gene locus_tag LOCUS_32710 3487059 3487805 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193736.1 protein_id gnl|my_center|LOCUS_32710 3489244 3488180 gene locus_tag LOCUS_32720 3489244 3488180 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937555.1 protein_id gnl|my_center|LOCUS_32720 3491693 3489225 gene locus_tag LOCUS_32730 3491693 3489225 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793045.1 protein_id gnl|my_center|LOCUS_32730 3492059 3491700 gene locus_tag LOCUS_32740 3492059 3491700 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937557.1 protein_id gnl|my_center|LOCUS_32740 3494135 3492063 gene locus_tag LOCUS_32750 3494135 3492063 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937885.1 protein_id gnl|my_center|LOCUS_32750 3495082 3494138 gene locus_tag LOCUS_32760 3495082 3494138 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793043.1 protein_id gnl|my_center|LOCUS_32760 3495266 3495739 gene locus_tag LOCUS_32770 3495266 3495739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 3496583 3495960 gene locus_tag LOCUS_32780 3496583 3495960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 3497753 3496626 gene locus_tag LOCUS_32790 3497753 3496626 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793041.1 protein_id gnl|my_center|LOCUS_32790 3498276 3497824 gene locus_tag LOCUS_32800 3498276 3497824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 3498613 3500703 gene locus_tag LOCUS_32810 3498613 3500703 CDS product thiosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937484.1 protein_id gnl|my_center|LOCUS_32810 3500934 3501756 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccacacgtgtggggatgaaccg 3504061 3502697 gene locus_tag LOCUS_32820 gene hslU 3504061 3502697 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938760.1 protein_id gnl|my_center|LOCUS_32820 3504634 3504095 gene locus_tag LOCUS_32830 gene hslV 3504634 3504095 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938868.1 protein_id gnl|my_center|LOCUS_32830 3505201 3504635 gene locus_tag LOCUS_32840 3505201 3504635 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_32840 3506332 3505322 gene locus_tag LOCUS_32850 3506332 3505322 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973985.1 protein_id gnl|my_center|LOCUS_32850 3506517 3506783 gene locus_tag LOCUS_32860 3506517 3506783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32860 3507062 3507604 gene locus_tag LOCUS_32870 3507062 3507604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 3511229 3509367 gene locus_tag LOCUS_32880 3511229 3509367 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937758.1 protein_id gnl|my_center|LOCUS_32880 3512209 3511232 gene locus_tag LOCUS_32890 3512209 3511232 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937757.1 protein_id gnl|my_center|LOCUS_32890 3513838 3512435 gene locus_tag LOCUS_32900 3513838 3512435 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938869.1 protein_id gnl|my_center|LOCUS_32900 3515306 3513999 gene locus_tag LOCUS_32910 gene rho 3515306 3513999 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049758073.1 protein_id gnl|my_center|LOCUS_32910 3516120 3515605 gene locus_tag LOCUS_32920 3516120 3515605 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_32920 3516821 3516189 gene locus_tag LOCUS_32930 gene pth 3516821 3516189 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938864.1 protein_id gnl|my_center|LOCUS_32930 3517563 3516952 gene locus_tag LOCUS_32940 3517563 3516952 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938865.1 protein_id gnl|my_center|LOCUS_32940 3518568 3517630 gene locus_tag LOCUS_32950 3518568 3517630 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938866.1 protein_id gnl|my_center|LOCUS_32950 3518680 3518606 gene locus_tag LOCUS_t00620 3518680 3518606 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3519570 3518692 gene locus_tag LOCUS_32960 gene ispE 3519570 3518692 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938867.1 protein_id gnl|my_center|LOCUS_32960 3521026 3519614 gene locus_tag LOCUS_32970 3521026 3519614 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938761.1 protein_id gnl|my_center|LOCUS_32970 3521443 3521519 gene locus_tag LOCUS_t00630 3521443 3521519 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3522651 3521665 gene locus_tag LOCUS_32980 3522651 3521665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207298.1 protein_id gnl|my_center|LOCUS_32980 3522947 3523492 gene locus_tag LOCUS_32990 3522947 3523492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 3523520 3524902 gene locus_tag LOCUS_33000 3523520 3524902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 3525864 3525136 gene locus_tag LOCUS_33010 3525864 3525136 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 protein_id gnl|my_center|LOCUS_33010 3526540 3525872 gene locus_tag LOCUS_33020 3526540 3525872 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937417.1 protein_id gnl|my_center|LOCUS_33020 3527365 3526619 gene locus_tag LOCUS_33030 gene glnH 3527365 3526619 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937418.1 protein_id gnl|my_center|LOCUS_33030 3529016 3527601 gene locus_tag LOCUS_33040 3529016 3527601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 3529173 3532412 gene locus_tag LOCUS_33050 3529173 3532412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 3533041 3532400 gene locus_tag LOCUS_33060 3533041 3532400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 3533878 3533123 gene locus_tag LOCUS_33070 3533878 3533123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 3536976 3533875 gene locus_tag LOCUS_33080 gene vmeI 3536976 3533875 CDS product efflux RND transporter permease subunit VmeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 protein_id gnl|my_center|LOCUS_33080 3538070 3536979 gene locus_tag LOCUS_33090 3538070 3536979 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392398.1 protein_id gnl|my_center|LOCUS_33090 3538759 3538067 gene locus_tag LOCUS_33100 3538759 3538067 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084541.1 protein_id gnl|my_center|LOCUS_33100 3541573 3539030 gene locus_tag LOCUS_33110 3541573 3539030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 3541712 3543481 gene locus_tag LOCUS_33120 3541712 3543481 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937450.1 protein_id gnl|my_center|LOCUS_33120 3545032 3543566 gene locus_tag LOCUS_33130 3545032 3543566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 3545692 3545042 gene locus_tag LOCUS_33140 3545692 3545042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 3547789 3545747 gene locus_tag LOCUS_33150 3547789 3545747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 3548982 3547780 gene locus_tag LOCUS_33160 3548982 3547780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 3549956 3550408 gene locus_tag LOCUS_33170 3549956 3550408 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_33170 3550411 3551313 gene locus_tag LOCUS_33180 3550411 3551313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 3551338 3553188 gene locus_tag LOCUS_33190 3551338 3553188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 3553257 3553406 gene locus_tag LOCUS_33200 3553257 3553406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 3553434 3553982 gene locus_tag LOCUS_33210 3553434 3553982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 3554113 3554496 gene locus_tag LOCUS_33220 3554113 3554496 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_33220 3554513 3557152 gene locus_tag LOCUS_33230 3554513 3557152 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940472.1 protein_id gnl|my_center|LOCUS_33230 3557149 3558822 gene locus_tag LOCUS_33240 3557149 3558822 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_33240 3558819 3560141 gene locus_tag LOCUS_33250 3558819 3560141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 3560110 3560532 gene locus_tag LOCUS_33260 3560110 3560532 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937456.1 protein_id gnl|my_center|LOCUS_33260 3560601 3562247 gene locus_tag LOCUS_33270 gene nhaB 3560601 3562247 CDS product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113594.1 protein_id gnl|my_center|LOCUS_33270 3562303 3563808 gene locus_tag LOCUS_33280 3562303 3563808 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940410.1 protein_id gnl|my_center|LOCUS_33280 3566443 3564074 gene locus_tag LOCUS_33290 3566443 3564074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 3568775 3566499 gene locus_tag LOCUS_33300 3568775 3566499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 3569560 3568796 gene locus_tag LOCUS_33310 3569560 3568796 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096156.1 protein_id gnl|my_center|LOCUS_33310 3569690 3571513 gene locus_tag LOCUS_33320 3569690 3571513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 3572058 3571498 gene locus_tag LOCUS_33330 3572058 3571498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 3573843 3572164 gene locus_tag LOCUS_33340 3573843 3572164 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_33340 3576298 3574025 gene locus_tag LOCUS_33350 3576298 3574025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 3576423 3576605 gene locus_tag LOCUS_33360 3576423 3576605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 3576720 3576893 gene locus_tag LOCUS_33370 3576720 3576893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 3576927 3577508 gene locus_tag LOCUS_33380 3576927 3577508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 3578138 3577812 gene locus_tag LOCUS_33390 3578138 3577812 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937343.1 protein_id gnl|my_center|LOCUS_33390 3578836 3578114 gene locus_tag LOCUS_33400 3578836 3578114 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793177.1 protein_id gnl|my_center|LOCUS_33400 3578964 3580409 gene locus_tag LOCUS_33410 3578964 3580409 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937341.1 protein_id gnl|my_center|LOCUS_33410 3580552 3581430 gene locus_tag LOCUS_33420 gene rarD 3580552 3581430 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791842.1 protein_id gnl|my_center|LOCUS_33420 3581435 3582337 gene locus_tag LOCUS_33430 3581435 3582337 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939517.1 protein_id gnl|my_center|LOCUS_33430 3582495 3584300 gene locus_tag LOCUS_33440 3582495 3584300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 3584549 3584905 gene locus_tag LOCUS_33450 3584549 3584905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 3584908 3585294 gene locus_tag LOCUS_33460 3584908 3585294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 3585305 3586471 gene locus_tag LOCUS_33470 3585305 3586471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 3587109 3586555 gene locus_tag LOCUS_33480 3587109 3586555 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087459.1 protein_id gnl|my_center|LOCUS_33480 3588386 3587106 gene locus_tag LOCUS_33490 3588386 3587106 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075901854.1 protein_id gnl|my_center|LOCUS_33490 3588878 3588498 gene locus_tag LOCUS_33500 3588878 3588498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 3589337 3589095 gene locus_tag LOCUS_33510 3589337 3589095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 3589505 3592375 gene locus_tag LOCUS_33520 3589505 3592375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 3592531 3592866 gene locus_tag LOCUS_33530 3592531 3592866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 3593050 3594312 gene locus_tag LOCUS_33540 3593050 3594312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 3595680 3594313 gene locus_tag LOCUS_33550 3595680 3594313 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937786.1 protein_id gnl|my_center|LOCUS_33550 3596012 3597718 gene locus_tag LOCUS_33560 3596012 3597718 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948187.1 protein_id gnl|my_center|LOCUS_33560 3598556 3598140 gene locus_tag LOCUS_33570 3598556 3598140 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072119.1 protein_id gnl|my_center|LOCUS_33570 3599291 3598572 gene locus_tag LOCUS_33580 3599291 3598572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 3599607 3599377 gene locus_tag LOCUS_33590 3599607 3599377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 3599773 3600420 gene locus_tag LOCUS_33600 3599773 3600420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 3601689 3600454 gene locus_tag LOCUS_33610 3601689 3600454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 3602151 3601879 gene locus_tag LOCUS_33620 3602151 3601879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 3602221 3602400 gene locus_tag LOCUS_33630 3602221 3602400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 3602569 3602375 gene locus_tag LOCUS_33640 3602569 3602375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 3602991 3603281 gene locus_tag LOCUS_33650 3602991 3603281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 3604531 3604094 gene locus_tag LOCUS_33660 3604531 3604094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 3605094 3604750 gene locus_tag LOCUS_33670 3605094 3604750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 3606768 3606445 gene locus_tag LOCUS_33680 3606768 3606445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 3607559 3607431 gene locus_tag LOCUS_33690 3607559 3607431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 3607971 3608213 gene locus_tag LOCUS_33700 3607971 3608213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700