>Feature sequence01 385 137 gene locus_tag LOCUS_00010 385 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 335 802 gene locus_tag LOCUS_00020 335 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00020 1858 845 gene locus_tag LOCUS_00030 1858 845 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243020.1 protein_id gnl|my_center|LOCUS_00030 3221 1869 gene locus_tag LOCUS_00040 3221 1869 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_00040 3408 4220 gene locus_tag LOCUS_00050 3408 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4266 5387 gene locus_tag LOCUS_00060 4266 5387 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243020.1 protein_id gnl|my_center|LOCUS_00060 5498 6664 gene locus_tag LOCUS_00070 5498 6664 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161951924.1 protein_id gnl|my_center|LOCUS_00070 6661 8235 gene locus_tag LOCUS_00080 6661 8235 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082910117.1 protein_id gnl|my_center|LOCUS_00080 8228 9163 gene locus_tag LOCUS_00090 8228 9163 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707197.1 protein_id gnl|my_center|LOCUS_00090 9381 11162 gene locus_tag LOCUS_00100 9381 11162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11440 12282 gene locus_tag LOCUS_00110 11440 12282 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253736.1 protein_id gnl|my_center|LOCUS_00110 12308 13615 gene locus_tag LOCUS_00120 12308 13615 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726997.1 protein_id gnl|my_center|LOCUS_00120 13679 14539 gene locus_tag LOCUS_00130 13679 14539 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530308.1 protein_id gnl|my_center|LOCUS_00130 14536 15354 gene locus_tag LOCUS_00140 14536 15354 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086175.1 protein_id gnl|my_center|LOCUS_00140 15378 16400 gene locus_tag LOCUS_00150 15378 16400 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729463.1 protein_id gnl|my_center|LOCUS_00150 16445 17515 gene locus_tag LOCUS_00160 gene ugpC 16445 17515 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061266.1 protein_id gnl|my_center|LOCUS_00160 18006 17584 gene locus_tag LOCUS_00170 18006 17584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18988 18155 gene locus_tag LOCUS_00180 gene sigJ 18988 18155 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024924750.1 protein_id gnl|my_center|LOCUS_00180 19536 19015 gene locus_tag LOCUS_00190 19536 19015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921100.1 protein_id gnl|my_center|LOCUS_00190 19906 19529 gene locus_tag LOCUS_00200 19906 19529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20462 20680 gene locus_tag LOCUS_00210 20462 20680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21931 20768 gene locus_tag LOCUS_00220 21931 20768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22218 23282 gene locus_tag LOCUS_00230 22218 23282 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369259.1 protein_id gnl|my_center|LOCUS_00230 23924 23295 gene locus_tag LOCUS_00240 23924 23295 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170138703.1 protein_id gnl|my_center|LOCUS_00240 25150 23936 gene locus_tag LOCUS_00250 25150 23936 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266421.1 protein_id gnl|my_center|LOCUS_00250 25842 25144 gene locus_tag LOCUS_00260 25842 25144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 26648 25842 gene locus_tag LOCUS_00270 26648 25842 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_00270 27680 26667 gene locus_tag LOCUS_00280 27680 26667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 27990 29045 gene locus_tag LOCUS_00290 gene ugpC 27990 29045 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969916.1 protein_id gnl|my_center|LOCUS_00290 29100 30326 gene locus_tag LOCUS_00300 29100 30326 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969913.1 protein_id gnl|my_center|LOCUS_00300 30395 31417 gene locus_tag LOCUS_00310 30395 31417 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969914.1 protein_id gnl|my_center|LOCUS_00310 31417 32568 gene locus_tag LOCUS_00320 31417 32568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 32867 33817 gene locus_tag LOCUS_00330 32867 33817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 33820 34518 gene locus_tag LOCUS_00340 33820 34518 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093405.1 protein_id gnl|my_center|LOCUS_00340 34523 35683 gene locus_tag LOCUS_00350 34523 35683 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974401.1 protein_id gnl|my_center|LOCUS_00350 35802 36194 gene locus_tag LOCUS_00360 35802 36194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 36436 36966 gene locus_tag LOCUS_00370 36436 36966 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162471704.1 protein_id gnl|my_center|LOCUS_00370 37032 38726 gene locus_tag LOCUS_00380 37032 38726 CDS product copper resistance CopC/CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529536.1 protein_id gnl|my_center|LOCUS_00380 38854 41034 gene locus_tag LOCUS_00390 38854 41034 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973814.1 protein_id gnl|my_center|LOCUS_00390 41051 42034 gene locus_tag LOCUS_00400 41051 42034 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973815.1 protein_id gnl|my_center|LOCUS_00400 42039 42848 gene locus_tag LOCUS_00410 42039 42848 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973816.1 protein_id gnl|my_center|LOCUS_00410 42845 43597 gene locus_tag LOCUS_00420 42845 43597 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973817.1 protein_id gnl|my_center|LOCUS_00420 43594 44787 gene locus_tag LOCUS_00430 43594 44787 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973818.1 protein_id gnl|my_center|LOCUS_00430 45843 44929 gene locus_tag LOCUS_00440 45843 44929 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244002.1 protein_id gnl|my_center|LOCUS_00440 49211 45840 gene locus_tag LOCUS_00450 49211 45840 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398915.1 protein_id gnl|my_center|LOCUS_00450 49596 50888 gene locus_tag LOCUS_00460 gene urtA 49596 50888 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244008.1 protein_id gnl|my_center|LOCUS_00460 51262 52881 gene locus_tag LOCUS_00470 gene urtB 51262 52881 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398880.1 protein_id gnl|my_center|LOCUS_00470 52878 54041 gene locus_tag LOCUS_00480 gene urtC 52878 54041 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244009.1 protein_id gnl|my_center|LOCUS_00480 54038 54811 gene locus_tag LOCUS_00490 gene urtD 54038 54811 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398878.1 protein_id gnl|my_center|LOCUS_00490 54814 55047 gene locus_tag LOCUS_00500 54814 55047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 55041 55736 gene locus_tag LOCUS_00510 gene urtE 55041 55736 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972304.1 protein_id gnl|my_center|LOCUS_00510 55942 56766 gene locus_tag LOCUS_00520 55942 56766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 56810 57043 gene locus_tag LOCUS_00530 56810 57043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 57604 57095 gene locus_tag LOCUS_00540 57604 57095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531938.1 protein_id gnl|my_center|LOCUS_00540 57912 58829 gene locus_tag LOCUS_00550 57912 58829 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976192.1 protein_id gnl|my_center|LOCUS_00550 58826 59707 gene locus_tag LOCUS_00560 58826 59707 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976193.1 protein_id gnl|my_center|LOCUS_00560 59737 61083 gene locus_tag LOCUS_00570 59737 61083 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976194.1 protein_id gnl|my_center|LOCUS_00570 61365 62969 gene locus_tag LOCUS_00580 61365 62969 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234705053.1 protein_id gnl|my_center|LOCUS_00580 63043 64092 gene locus_tag LOCUS_00590 gene ugpC 63043 64092 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976196.1 protein_id gnl|my_center|LOCUS_00590 64203 64559 gene locus_tag LOCUS_00600 64203 64559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 65512 64544 gene locus_tag LOCUS_00610 65512 64544 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_00610 65596 66534 gene locus_tag LOCUS_00620 65596 66534 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234705479.1 protein_id gnl|my_center|LOCUS_00620 67476 66586 gene locus_tag LOCUS_00630 67476 66586 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313706.1 protein_id gnl|my_center|LOCUS_00630 67716 68693 gene locus_tag LOCUS_00640 67716 68693 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509960.1 protein_id gnl|my_center|LOCUS_00640 69012 70406 gene locus_tag LOCUS_00650 69012 70406 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971998.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00650 70394 71425 gene locus_tag LOCUS_00660 70394 71425 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971997.1 protein_id gnl|my_center|LOCUS_00660 71497 71676 gene locus_tag LOCUS_00670 71497 71676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 73984 71810 gene locus_tag LOCUS_00680 gene katG 73984 71810 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974037.1 protein_id gnl|my_center|LOCUS_00680 74153 75052 gene locus_tag LOCUS_00690 74153 75052 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974036.1 protein_id gnl|my_center|LOCUS_00690 75371 75066 gene locus_tag LOCUS_00700 75371 75066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 77049 75652 gene locus_tag LOCUS_00710 77049 75652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 77201 77758 gene locus_tag LOCUS_00720 77201 77758 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975940.1 protein_id gnl|my_center|LOCUS_00720 77818 80337 gene locus_tag LOCUS_00730 77818 80337 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969631.1 protein_id gnl|my_center|LOCUS_00730 80539 80246 gene locus_tag LOCUS_00740 80539 80246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 80499 80747 gene locus_tag LOCUS_00750 80499 80747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844605.1 protein_id gnl|my_center|LOCUS_00750 80933 81760 gene locus_tag LOCUS_00760 80933 81760 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708389.1 protein_id gnl|my_center|LOCUS_00760 81938 83227 gene locus_tag LOCUS_00770 81938 83227 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395355.1 protein_id gnl|my_center|LOCUS_00770 84363 83356 gene locus_tag LOCUS_00780 84363 83356 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311620.1 protein_id gnl|my_center|LOCUS_00780 84662 85270 gene locus_tag LOCUS_00790 84662 85270 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084228.1 protein_id gnl|my_center|LOCUS_00790 85560 85357 gene locus_tag LOCUS_00800 85560 85357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 85884 85666 gene locus_tag LOCUS_00810 85884 85666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 86001 86918 gene locus_tag LOCUS_00820 86001 86918 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975926.1 protein_id gnl|my_center|LOCUS_00820 89185 87113 gene locus_tag LOCUS_00830 89185 87113 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153435973.1 protein_id gnl|my_center|LOCUS_00830 89542 89222 gene locus_tag LOCUS_00840 89542 89222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084435433.1 protein_id gnl|my_center|LOCUS_00840 90509 89544 gene locus_tag LOCUS_00850 90509 89544 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066873494.1 protein_id gnl|my_center|LOCUS_00850 91835 90741 gene locus_tag LOCUS_00860 91835 90741 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328733.1 protein_id gnl|my_center|LOCUS_00860 92423 91839 gene locus_tag LOCUS_00870 92423 91839 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530675.1 protein_id gnl|my_center|LOCUS_00870 92718 92416 gene locus_tag LOCUS_00880 92718 92416 CDS product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173512816.1 protein_id gnl|my_center|LOCUS_00880 93596 92829 gene locus_tag LOCUS_00890 93596 92829 CDS product formyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082912520.1 protein_id gnl|my_center|LOCUS_00890 94429 93839 gene locus_tag LOCUS_00900 94429 93839 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395377.1 protein_id gnl|my_center|LOCUS_00900 94498 94656 gene locus_tag LOCUS_00910 94498 94656 CDS product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003515706.1 protein_id gnl|my_center|LOCUS_00910 95403 94708 gene locus_tag LOCUS_00920 95403 94708 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386375.1 protein_id gnl|my_center|LOCUS_00920 95742 97325 gene locus_tag LOCUS_00930 95742 97325 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328727.1 protein_id gnl|my_center|LOCUS_00930 97433 98125 gene locus_tag LOCUS_00940 97433 98125 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066873467.1 protein_id gnl|my_center|LOCUS_00940 98179 98931 gene locus_tag LOCUS_00950 98179 98931 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969609.1 protein_id gnl|my_center|LOCUS_00950 99013 99534 gene locus_tag LOCUS_00960 99013 99534 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240574.1 protein_id gnl|my_center|LOCUS_00960 99549 101636 gene locus_tag LOCUS_00970 99549 101636 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395394.1 protein_id gnl|my_center|LOCUS_00970 102320 102021 gene locus_tag LOCUS_00980 102320 102021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 102418 103302 gene locus_tag LOCUS_00990 102418 103302 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529404.1 protein_id gnl|my_center|LOCUS_00990 103634 103287 gene locus_tag LOCUS_01000 103634 103287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240572.1 protein_id gnl|my_center|LOCUS_01000 103819 104466 gene locus_tag LOCUS_01010 103819 104466 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969608.1 protein_id gnl|my_center|LOCUS_01010 104463 105602 gene locus_tag LOCUS_01020 104463 105602 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_01020 105928 105599 gene locus_tag LOCUS_01030 105928 105599 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529383.1 protein_id gnl|my_center|LOCUS_01030 107112 106099 gene locus_tag LOCUS_01040 gene bmt 107112 106099 CDS product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240571.1 protein_id gnl|my_center|LOCUS_01040 108465 107422 gene locus_tag LOCUS_01050 108465 107422 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530709.1 protein_id gnl|my_center|LOCUS_01050 109369 108458 gene locus_tag LOCUS_01060 109369 108458 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971232.1 protein_id gnl|my_center|LOCUS_01060 110624 109626 gene locus_tag LOCUS_01070 110624 109626 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395398.1 protein_id gnl|my_center|LOCUS_01070 111531 111388 gene locus_tag LOCUS_01080 111531 111388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975904.1 protein_id gnl|my_center|LOCUS_01080 111778 113241 gene locus_tag LOCUS_01090 111778 113241 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240566.1 protein_id gnl|my_center|LOCUS_01090 113392 115266 gene locus_tag LOCUS_01100 113392 115266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 115762 115938 gene locus_tag LOCUS_01110 115762 115938 CDS product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708714.1 protein_id gnl|my_center|LOCUS_01110 115951 116745 gene locus_tag LOCUS_01120 115951 116745 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396855.1 protein_id gnl|my_center|LOCUS_01120 116747 117271 gene locus_tag LOCUS_01130 gene cobU 116747 117271 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395402.1 protein_id gnl|my_center|LOCUS_01130 117275 118324 gene locus_tag LOCUS_01140 gene cobW 117275 118324 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969596.1 protein_id gnl|my_center|LOCUS_01140 118827 122954 gene locus_tag LOCUS_01150 gene cobN 118827 122954 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066873425.1 protein_id gnl|my_center|LOCUS_01150 122954 123340 gene locus_tag LOCUS_01160 122954 123340 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102978.1 protein_id gnl|my_center|LOCUS_01160 123342 123983 gene locus_tag LOCUS_01170 gene cobO 123342 123983 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254597.1 protein_id gnl|my_center|LOCUS_01170 125019 124168 gene locus_tag LOCUS_01180 125019 124168 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975886.1 protein_id gnl|my_center|LOCUS_01180 125124 126194 gene locus_tag LOCUS_01190 125124 126194 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640075.1 protein_id gnl|my_center|LOCUS_01190 126395 126871 gene locus_tag LOCUS_01200 126395 126871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 126871 127713 gene locus_tag LOCUS_01210 gene cobA 126871 127713 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969585.1 protein_id gnl|my_center|LOCUS_01210 127710 129017 gene locus_tag LOCUS_01220 127710 129017 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328702.1 protein_id gnl|my_center|LOCUS_01220 129014 130027 gene locus_tag LOCUS_01230 gene cobD 129014 130027 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975882.1 protein_id gnl|my_center|LOCUS_01230 130024 131004 gene locus_tag LOCUS_01240 gene cbiB 130024 131004 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969582.1 protein_id gnl|my_center|LOCUS_01240 131154 131582 gene locus_tag LOCUS_01250 131154 131582 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529305.1 protein_id gnl|my_center|LOCUS_01250 132317 131592 gene locus_tag LOCUS_01260 132317 131592 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395422.1 protein_id gnl|my_center|LOCUS_01260 132528 133877 gene locus_tag LOCUS_01270 gene hemN 132528 133877 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971733.1 protein_id gnl|my_center|LOCUS_01270 134003 134287 gene locus_tag LOCUS_01280 134003 134287 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495848.1 protein_id gnl|my_center|LOCUS_01280 134404 134886 gene locus_tag LOCUS_01290 134404 134886 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316342.1 protein_id gnl|my_center|LOCUS_01290 134889 136088 gene locus_tag LOCUS_01300 134889 136088 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971732.1 protein_id gnl|my_center|LOCUS_01300 136098 137384 gene locus_tag LOCUS_01310 136098 137384 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975877.1 protein_id gnl|my_center|LOCUS_01310 137398 138426 gene locus_tag LOCUS_01320 137398 138426 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969578.1 protein_id gnl|my_center|LOCUS_01320 138437 139366 gene locus_tag LOCUS_01330 138437 139366 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844587.1 protein_id gnl|my_center|LOCUS_01330 139687 140313 gene locus_tag LOCUS_01340 139687 140313 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395427.1 protein_id gnl|my_center|LOCUS_01340 140800 140318 gene locus_tag LOCUS_01350 140800 140318 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563285.1 protein_id gnl|my_center|LOCUS_01350 141008 142630 gene locus_tag LOCUS_01360 gene ccoN 141008 142630 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967644.1 protein_id gnl|my_center|LOCUS_01360 142641 143372 gene locus_tag LOCUS_01370 gene ccoO 142641 143372 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967643.1 protein_id gnl|my_center|LOCUS_01370 143384 143536 gene locus_tag LOCUS_01380 143384 143536 CDS product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316283.1 protein_id gnl|my_center|LOCUS_01380 143539 144402 gene locus_tag LOCUS_01390 gene ccoP 143539 144402 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316282.1 protein_id gnl|my_center|LOCUS_01390 145219 144482 gene locus_tag LOCUS_01400 145219 144482 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528483.1 protein_id gnl|my_center|LOCUS_01400 145695 145339 gene locus_tag LOCUS_01410 145695 145339 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969576.1 protein_id gnl|my_center|LOCUS_01410 146108 145692 gene locus_tag LOCUS_01420 146108 145692 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975873.1 protein_id gnl|my_center|LOCUS_01420 146928 146173 gene locus_tag LOCUS_01430 146928 146173 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969574.1 protein_id gnl|my_center|LOCUS_01430 147049 148620 gene locus_tag LOCUS_01440 gene ccoG 147049 148620 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967640.1 protein_id gnl|my_center|LOCUS_01440 148620 149117 gene locus_tag LOCUS_01450 148620 149117 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971693.1 protein_id gnl|my_center|LOCUS_01450 149114 151402 gene locus_tag LOCUS_01460 149114 151402 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971692.1 protein_id gnl|my_center|LOCUS_01460 151399 151554 gene locus_tag LOCUS_01470 gene ccoS 151399 151554 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180937871.1 protein_id gnl|my_center|LOCUS_01470 151748 153184 gene locus_tag LOCUS_01480 gene gndA 151748 153184 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975871.1 protein_id gnl|my_center|LOCUS_01480 154442 153399 gene locus_tag LOCUS_01490 154442 153399 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975869.1 protein_id gnl|my_center|LOCUS_01490 154862 156091 gene locus_tag LOCUS_01500 154862 156091 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975867.1 protein_id gnl|my_center|LOCUS_01500 156231 157133 gene locus_tag LOCUS_01510 156231 157133 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972962.1 protein_id gnl|my_center|LOCUS_01510 157126 158055 gene locus_tag LOCUS_01520 157126 158055 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969569.1 protein_id gnl|my_center|LOCUS_01520 158059 159141 gene locus_tag LOCUS_01530 158059 159141 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315197.1 protein_id gnl|my_center|LOCUS_01530 159561 162020 gene locus_tag LOCUS_01540 159561 162020 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395471.1 protein_id gnl|my_center|LOCUS_01540 162036 162797 gene locus_tag LOCUS_01550 162036 162797 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395473.1 protein_id gnl|my_center|LOCUS_01550 162810 163943 gene locus_tag LOCUS_01560 162810 163943 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969565.1 protein_id gnl|my_center|LOCUS_01560 164157 165188 gene locus_tag LOCUS_01570 gene mgrA 164157 165188 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395477.1 protein_id gnl|my_center|LOCUS_01570 166440 165235 gene locus_tag LOCUS_01580 gene zigA 166440 165235 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972825.1 protein_id gnl|my_center|LOCUS_01580 167796 166771 gene locus_tag LOCUS_01590 167796 166771 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240528.1 protein_id gnl|my_center|LOCUS_01590 167896 168825 gene locus_tag LOCUS_01600 167896 168825 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844580.1 protein_id gnl|my_center|LOCUS_01600 168818 169648 gene locus_tag LOCUS_01610 gene znuB 168818 169648 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240526.1 protein_id gnl|my_center|LOCUS_01610 169645 170040 gene locus_tag LOCUS_01620 169645 170040 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536852.1 protein_id gnl|my_center|LOCUS_01620 172295 170280 gene locus_tag LOCUS_01630 172295 170280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 172923 172396 gene locus_tag LOCUS_01640 172923 172396 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975835.1 protein_id gnl|my_center|LOCUS_01640 173417 173220 gene locus_tag LOCUS_01650 173417 173220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 173693 173505 gene locus_tag LOCUS_01660 173693 173505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 173883 174068 gene locus_tag LOCUS_01670 173883 174068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244278.1 protein_id gnl|my_center|LOCUS_01670 174321 174118 gene locus_tag LOCUS_01680 174321 174118 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974103.1 protein_id gnl|my_center|LOCUS_01680 174491 175660 gene locus_tag LOCUS_01690 174491 175660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 175961 175728 gene locus_tag LOCUS_01700 175961 175728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 176073 176549 gene locus_tag LOCUS_01710 176073 176549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 177329 176805 gene locus_tag LOCUS_01720 177329 176805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 177584 178615 gene locus_tag LOCUS_01730 177584 178615 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069331975.1 protein_id gnl|my_center|LOCUS_01730 178600 179148 gene locus_tag LOCUS_01740 178600 179148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 179507 179166 gene locus_tag LOCUS_01750 179507 179166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 180976 180098 gene locus_tag LOCUS_01760 180976 180098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 181515 181348 gene locus_tag LOCUS_01770 181515 181348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 183980 181635 gene locus_tag LOCUS_01780 183980 181635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 186342 184051 gene locus_tag LOCUS_01790 186342 184051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 186622 186356 gene locus_tag LOCUS_01800 186622 186356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 187468 187043 gene locus_tag LOCUS_01810 187468 187043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 188393 187461 gene locus_tag LOCUS_01820 188393 187461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 188778 188386 gene locus_tag LOCUS_01830 188778 188386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 190288 189026 gene locus_tag LOCUS_01840 190288 189026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 190506 190736 gene locus_tag LOCUS_01850 190506 190736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 190804 190986 gene locus_tag LOCUS_01860 190804 190986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 193576 191270 gene locus_tag LOCUS_01870 193576 191270 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975506.1 protein_id gnl|my_center|LOCUS_01870 193811 193557 gene locus_tag LOCUS_01880 193811 193557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 194277 193891 gene locus_tag LOCUS_01890 194277 193891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 194600 194373 gene locus_tag LOCUS_01900 194600 194373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 195794 194715 gene locus_tag LOCUS_01910 195794 194715 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975769.1 protein_id gnl|my_center|LOCUS_01910 195948 196976 gene locus_tag LOCUS_01920 gene dusA 195948 196976 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395492.1 protein_id gnl|my_center|LOCUS_01920 197179 197784 gene locus_tag LOCUS_01930 197179 197784 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969551.1 protein_id gnl|my_center|LOCUS_01930 198222 197800 gene locus_tag LOCUS_01940 198222 197800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 198845 200845 gene locus_tag LOCUS_01950 198845 200845 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250346.1 protein_id gnl|my_center|LOCUS_01950 203937 200860 gene locus_tag LOCUS_01960 gene uvrB 203937 200860 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971990.1 protein_id gnl|my_center|LOCUS_01960 204051 204995 gene locus_tag LOCUS_01970 204051 204995 CDS product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530035.1 protein_id gnl|my_center|LOCUS_01970 205679 205047 gene locus_tag LOCUS_01980 205679 205047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 205883 206974 gene locus_tag LOCUS_01990 205883 206974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 206979 207755 gene locus_tag LOCUS_02000 206979 207755 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_02000 208668 207700 gene locus_tag LOCUS_02010 208668 207700 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967187.1 protein_id gnl|my_center|LOCUS_02010 208757 209344 gene locus_tag LOCUS_02020 208757 209344 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967186.1 protein_id gnl|my_center|LOCUS_02020 209341 209601 gene locus_tag LOCUS_02030 209341 209601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 209659 210012 gene locus_tag LOCUS_02040 209659 210012 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535339.1 protein_id gnl|my_center|LOCUS_02040 210070 211536 gene locus_tag LOCUS_02050 210070 211536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 211546 212715 gene locus_tag LOCUS_02060 211546 212715 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972739.1 protein_id gnl|my_center|LOCUS_02060 213308 212718 gene locus_tag LOCUS_02070 213308 212718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975763.1 protein_id gnl|my_center|LOCUS_02070 213718 213326 gene locus_tag LOCUS_02080 213718 213326 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975762.1 protein_id gnl|my_center|LOCUS_02080 213918 215738 gene locus_tag LOCUS_02090 213918 215738 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400568.1 protein_id gnl|my_center|LOCUS_02090 216491 217690 gene locus_tag LOCUS_02100 216491 217690 CDS product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400572.1 protein_id gnl|my_center|LOCUS_02100 218061 218882 gene locus_tag LOCUS_02110 218061 218882 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400599.1 protein_id gnl|my_center|LOCUS_02110 218974 219900 gene locus_tag LOCUS_02120 218974 219900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328581.1 protein_id gnl|my_center|LOCUS_02120 219897 220658 gene locus_tag LOCUS_02130 219897 220658 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328580.1 protein_id gnl|my_center|LOCUS_02130 221353 220655 gene locus_tag LOCUS_02140 221353 220655 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400587.1 protein_id gnl|my_center|LOCUS_02140 221571 221350 gene locus_tag LOCUS_02150 221571 221350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 222391 221609 gene locus_tag LOCUS_02160 222391 221609 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975752.1 protein_id gnl|my_center|LOCUS_02160 222811 223827 gene locus_tag LOCUS_02170 gene cobT 222811 223827 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328572.1 protein_id gnl|my_center|LOCUS_02170 223928 224305 gene locus_tag LOCUS_02180 223928 224305 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400603.1 protein_id gnl|my_center|LOCUS_02180 226022 224487 gene locus_tag LOCUS_02190 226022 224487 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400593.1 protein_id gnl|my_center|LOCUS_02190 226295 226858 gene locus_tag LOCUS_02200 226295 226858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 226940 227584 gene locus_tag LOCUS_02210 226940 227584 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969535.1 protein_id gnl|my_center|LOCUS_02210 227651 228139 gene locus_tag LOCUS_02220 227651 228139 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507846.1 protein_id gnl|my_center|LOCUS_02220 228541 228167 gene locus_tag LOCUS_02230 228541 228167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 229415 228543 gene locus_tag LOCUS_02240 229415 228543 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975744.1 protein_id gnl|my_center|LOCUS_02240 230413 229598 gene locus_tag LOCUS_02250 230413 229598 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400622.1 protein_id gnl|my_center|LOCUS_02250 230545 231273 gene locus_tag LOCUS_02260 230545 231273 CDS product DUF2270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240630.1 protein_id gnl|my_center|LOCUS_02260 231553 231287 gene locus_tag LOCUS_02270 231553 231287 CDS product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708254.1 protein_id gnl|my_center|LOCUS_02270 232528 231698 gene locus_tag LOCUS_02280 232528 231698 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969531.1 protein_id gnl|my_center|LOCUS_02280 233328 232525 gene locus_tag LOCUS_02290 233328 232525 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975738.1 protein_id gnl|my_center|LOCUS_02290 234280 233498 gene locus_tag LOCUS_02300 234280 233498 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535100.1 protein_id gnl|my_center|LOCUS_02300 234620 236767 gene locus_tag LOCUS_02310 234620 236767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 236131 236039 gene locus_tag LOCUS_t00010 236131 236039 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 236951 238927 gene locus_tag LOCUS_02320 236951 238927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 239508 238987 gene locus_tag LOCUS_02330 gene mobB 239508 238987 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328558.1 protein_id gnl|my_center|LOCUS_02330 240140 239505 gene locus_tag LOCUS_02340 gene mobA 240140 239505 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975733.1 protein_id gnl|my_center|LOCUS_02340 241112 240204 gene locus_tag LOCUS_02350 241112 240204 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328556.1 protein_id gnl|my_center|LOCUS_02350 241497 244040 gene locus_tag LOCUS_02360 241497 244040 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396673.1 protein_id gnl|my_center|LOCUS_02360 245021 244374 gene locus_tag LOCUS_02370 245021 244374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 246090 245044 gene locus_tag LOCUS_02380 gene moaA 246090 245044 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971804.1 protein_id gnl|my_center|LOCUS_02380 246231 246605 gene locus_tag LOCUS_02390 246231 246605 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328553.1 protein_id gnl|my_center|LOCUS_02390 246663 248489 gene locus_tag LOCUS_02400 246663 248489 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971803.1 protein_id gnl|my_center|LOCUS_02400 248674 249885 gene locus_tag LOCUS_02410 248674 249885 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973428.1 protein_id gnl|my_center|LOCUS_02410 250467 249985 gene locus_tag LOCUS_02420 250467 249985 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026161061.1 protein_id gnl|my_center|LOCUS_02420 250512 251420 gene locus_tag LOCUS_02430 250512 251420 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844514.1 protein_id gnl|my_center|LOCUS_02430 251494 252102 gene locus_tag LOCUS_02440 251494 252102 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535083.1 protein_id gnl|my_center|LOCUS_02440 252181 252567 gene locus_tag LOCUS_02450 252181 252567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502648.1 protein_id gnl|my_center|LOCUS_02450 252689 253450 gene locus_tag LOCUS_02460 252689 253450 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987089.1 protein_id gnl|my_center|LOCUS_02460 254133 253486 gene locus_tag LOCUS_02470 254133 253486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 255508 254438 gene locus_tag LOCUS_02480 255508 254438 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396658.1 protein_id gnl|my_center|LOCUS_02480 257067 255676 gene locus_tag LOCUS_02490 gene fumC 257067 255676 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240627.1 protein_id gnl|my_center|LOCUS_02490 257598 259472 gene locus_tag LOCUS_02500 257598 259472 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975724.1 protein_id gnl|my_center|LOCUS_02500 261513 259585 gene locus_tag LOCUS_02510 261513 259585 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086018623.1 protein_id gnl|my_center|LOCUS_02510 261809 263506 gene locus_tag LOCUS_02520 261809 263506 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971777.1 protein_id gnl|my_center|LOCUS_02520 263510 263857 gene locus_tag LOCUS_02530 263510 263857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 264008 265468 gene locus_tag LOCUS_02540 264008 265468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 265700 266518 gene locus_tag LOCUS_02550 265700 266518 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969509.1 protein_id gnl|my_center|LOCUS_02550 266842 267534 gene locus_tag LOCUS_02560 gene bluB 266842 267534 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396627.1 protein_id gnl|my_center|LOCUS_02560 268633 267527 gene locus_tag LOCUS_02570 268633 267527 CDS product DUF2865 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975711.1 protein_id gnl|my_center|LOCUS_02570 268901 269962 gene locus_tag LOCUS_02580 268901 269962 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182165467.1 protein_id gnl|my_center|LOCUS_02580 270114 271700 gene locus_tag LOCUS_02590 270114 271700 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974107.1 protein_id gnl|my_center|LOCUS_02590 272567 271860 gene locus_tag LOCUS_02600 272567 271860 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114283.1 protein_id gnl|my_center|LOCUS_02600 272717 273040 gene locus_tag LOCUS_02610 272717 273040 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144188.1 protein_id gnl|my_center|LOCUS_02610 275466 273154 gene locus_tag LOCUS_02620 275466 273154 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534110.1 protein_id gnl|my_center|LOCUS_02620 275702 276538 gene locus_tag LOCUS_02630 275702 276538 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534112.1 protein_id gnl|my_center|LOCUS_02630 276646 277863 gene locus_tag LOCUS_02640 276646 277863 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969506.1 protein_id gnl|my_center|LOCUS_02640 278816 277833 gene locus_tag LOCUS_02650 278816 277833 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975705.1 protein_id gnl|my_center|LOCUS_02650 278948 280099 gene locus_tag LOCUS_02660 278948 280099 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240468.1 protein_id gnl|my_center|LOCUS_02660 280108 280893 gene locus_tag LOCUS_02670 280108 280893 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328527.1 protein_id gnl|my_center|LOCUS_02670 280954 282324 gene locus_tag LOCUS_02680 280954 282324 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328526.1 protein_id gnl|my_center|LOCUS_02680 282459 283076 gene locus_tag LOCUS_02690 282459 283076 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328525.1 protein_id gnl|my_center|LOCUS_02690 284275 283304 gene locus_tag LOCUS_02700 284275 283304 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975992.1 protein_id gnl|my_center|LOCUS_02700 291197 284481 gene locus_tag LOCUS_02710 291197 284481 CDS product kinesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396557.1 protein_id gnl|my_center|LOCUS_02710 291727 292095 gene locus_tag LOCUS_02720 291727 292095 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312581.1 protein_id gnl|my_center|LOCUS_02720 292420 292740 gene locus_tag LOCUS_02730 292420 292740 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532979.1 protein_id gnl|my_center|LOCUS_02730 293788 293177 gene locus_tag LOCUS_02740 293788 293177 CDS product DUF922 domain-containing Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311444.1 protein_id gnl|my_center|LOCUS_02740 294027 294899 gene locus_tag LOCUS_02750 gene folP 294027 294899 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396569.1 protein_id gnl|my_center|LOCUS_02750 294923 295291 gene locus_tag LOCUS_02760 gene folB 294923 295291 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708193.1 protein_id gnl|my_center|LOCUS_02760 295281 295799 gene locus_tag LOCUS_02770 gene folK 295281 295799 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396552.1 protein_id gnl|my_center|LOCUS_02770 296367 295792 gene locus_tag LOCUS_02780 296367 295792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396548.1 protein_id gnl|my_center|LOCUS_02780 297602 296541 gene locus_tag LOCUS_02790 297602 296541 CDS product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969485.1 protein_id gnl|my_center|LOCUS_02790 299074 297599 gene locus_tag LOCUS_02800 299074 297599 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532993.1 protein_id gnl|my_center|LOCUS_02800 299757 299233 gene locus_tag LOCUS_02810 299757 299233 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975678.1 protein_id gnl|my_center|LOCUS_02810 301801 299831 gene locus_tag LOCUS_02820 301801 299831 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918781.1 protein_id gnl|my_center|LOCUS_02820 302163 302582 gene locus_tag LOCUS_02830 gene dksA 302163 302582 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708186.1 protein_id gnl|my_center|LOCUS_02830 303748 302759 gene locus_tag LOCUS_02840 303748 302759 CDS product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396540.1 protein_id gnl|my_center|LOCUS_02840 304060 306678 gene locus_tag LOCUS_02850 304060 306678 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396539.1 protein_id gnl|my_center|LOCUS_02850 >Feature sequence02 1 77 gene locus_tag LOCUS_t00020 1 77 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 724 5262 gene locus_tag LOCUS_02860 724 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391500.1 protein_id gnl|my_center|LOCUS_02860 9973 5876 gene locus_tag LOCUS_02870 9973 5876 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074836736.1 protein_id gnl|my_center|LOCUS_02870 11365 10490 gene locus_tag LOCUS_02880 11365 10490 CDS product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862398.1 protein_id gnl|my_center|LOCUS_02880 13641 12730 gene locus_tag LOCUS_02890 13641 12730 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389912.1 protein_id gnl|my_center|LOCUS_02890 13747 14424 gene locus_tag LOCUS_02900 13747 14424 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819982.1 protein_id gnl|my_center|LOCUS_02900 15958 14615 gene locus_tag LOCUS_02910 15958 14615 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388134.1 protein_id gnl|my_center|LOCUS_02910 16726 15977 gene locus_tag LOCUS_02920 16726 15977 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086767.1 protein_id gnl|my_center|LOCUS_02920 18143 16914 gene locus_tag LOCUS_02930 18143 16914 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080850788.1 protein_id gnl|my_center|LOCUS_02930 18882 18121 gene locus_tag LOCUS_02940 18882 18121 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894390.1 protein_id gnl|my_center|LOCUS_02940 19595 18894 gene locus_tag LOCUS_02950 19595 18894 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_02950 20423 19674 gene locus_tag LOCUS_02960 20423 19674 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086767.1 protein_id gnl|my_center|LOCUS_02960 20707 21147 gene locus_tag LOCUS_02970 20707 21147 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970109.1 protein_id gnl|my_center|LOCUS_02970 22584 21316 gene locus_tag LOCUS_02980 22584 21316 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080850788.1 protein_id gnl|my_center|LOCUS_02980 23522 22632 gene locus_tag LOCUS_02990 23522 22632 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950743.1 protein_id gnl|my_center|LOCUS_02990 24675 23758 gene locus_tag LOCUS_03000 24675 23758 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530002.1 protein_id gnl|my_center|LOCUS_03000 26094 24850 gene locus_tag LOCUS_03010 26094 24850 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090111.1 protein_id gnl|my_center|LOCUS_03010 27065 26106 gene locus_tag LOCUS_03020 27065 26106 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100771272.1 protein_id gnl|my_center|LOCUS_03020 28078 27065 gene locus_tag LOCUS_03030 28078 27065 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_03030 28425 29417 gene locus_tag LOCUS_03040 28425 29417 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967019.1 protein_id gnl|my_center|LOCUS_03040 30341 29436 gene locus_tag LOCUS_03050 30341 29436 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389912.1 protein_id gnl|my_center|LOCUS_03050 31017 30424 gene locus_tag LOCUS_03060 31017 30424 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974671.1 protein_id gnl|my_center|LOCUS_03060 31839 31147 gene locus_tag LOCUS_03070 31839 31147 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531896.1 protein_id gnl|my_center|LOCUS_03070 32424 32236 gene locus_tag LOCUS_03080 32424 32236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 33722 32421 gene locus_tag LOCUS_03090 33722 32421 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337713.1 protein_id gnl|my_center|LOCUS_03090 34640 34323 gene locus_tag LOCUS_03100 gene rhaM 34640 34323 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533603.1 protein_id gnl|my_center|LOCUS_03100 35656 34652 gene locus_tag LOCUS_03110 gene rbsC 35656 34652 CDS product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 protein_id gnl|my_center|LOCUS_03110 37296 35776 gene locus_tag LOCUS_03120 gene rbsA 37296 35776 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180345411.1 protein_id gnl|my_center|LOCUS_03120 38532 37351 gene locus_tag LOCUS_03130 38532 37351 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976071.1 protein_id gnl|my_center|LOCUS_03130 39724 38606 gene locus_tag LOCUS_03140 39724 38606 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_03140 39892 40620 gene locus_tag LOCUS_03150 39892 40620 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027219.1 protein_id gnl|my_center|LOCUS_03150 40617 41393 gene locus_tag LOCUS_03160 40617 41393 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529311.1 protein_id gnl|my_center|LOCUS_03160 41390 42367 gene locus_tag LOCUS_03170 41390 42367 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208809.1 protein_id gnl|my_center|LOCUS_03170 42382 43428 gene locus_tag LOCUS_03180 42382 43428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 43431 44249 gene locus_tag LOCUS_03190 43431 44249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 44246 45052 gene locus_tag LOCUS_03200 gene fabG 44246 45052 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_03200 45049 45804 gene locus_tag LOCUS_03210 45049 45804 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338588.1 protein_id gnl|my_center|LOCUS_03210 45828 46871 gene locus_tag LOCUS_03220 45828 46871 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208631126.1 protein_id gnl|my_center|LOCUS_03220 47504 48799 gene locus_tag LOCUS_03230 47504 48799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 48796 49338 gene locus_tag LOCUS_03240 48796 49338 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338204.1 protein_id gnl|my_center|LOCUS_03240 49345 49857 gene locus_tag LOCUS_03250 49345 49857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 50706 50473 gene locus_tag LOCUS_03260 50706 50473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 52647 50770 gene locus_tag LOCUS_03270 52647 50770 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390984.1 protein_id gnl|my_center|LOCUS_03270 53142 54815 gene locus_tag LOCUS_03280 53142 54815 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967307.1 protein_id gnl|my_center|LOCUS_03280 55008 54826 gene locus_tag LOCUS_03290 55008 54826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 55439 57439 gene locus_tag LOCUS_03300 55439 57439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 57533 59590 gene locus_tag LOCUS_03310 57533 59590 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921504.1 protein_id gnl|my_center|LOCUS_03310 59617 60096 gene locus_tag LOCUS_03320 59617 60096 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705960.1 protein_id gnl|my_center|LOCUS_03320 60093 62177 gene locus_tag LOCUS_03330 60093 62177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 62230 62991 gene locus_tag LOCUS_03340 62230 62991 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246338.1 protein_id gnl|my_center|LOCUS_03340 63097 64077 gene locus_tag LOCUS_03350 63097 64077 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124894.1 protein_id gnl|my_center|LOCUS_03350 64242 65753 gene locus_tag LOCUS_03360 64242 65753 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493470.1 protein_id gnl|my_center|LOCUS_03360 65746 66753 gene locus_tag LOCUS_03370 65746 66753 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276657.1 protein_id gnl|my_center|LOCUS_03370 66757 68385 gene locus_tag LOCUS_03380 66757 68385 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921426.1 protein_id gnl|my_center|LOCUS_03380 68382 68795 gene locus_tag LOCUS_03390 68382 68795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 68808 69590 gene locus_tag LOCUS_03400 gene fabG 68808 69590 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727184.1 protein_id gnl|my_center|LOCUS_03400 69619 70800 gene locus_tag LOCUS_03410 gene rhmD 69619 70800 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427822.1 protein_id gnl|my_center|LOCUS_03410 70816 71562 gene locus_tag LOCUS_03420 70816 71562 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528170.1 protein_id gnl|my_center|LOCUS_03420 72702 71650 gene locus_tag LOCUS_03430 72702 71650 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584091.1 protein_id gnl|my_center|LOCUS_03430 73021 74298 gene locus_tag LOCUS_03440 73021 74298 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039280.1 protein_id gnl|my_center|LOCUS_03440 74383 75129 gene locus_tag LOCUS_03450 74383 75129 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532981.1 protein_id gnl|my_center|LOCUS_03450 75129 75857 gene locus_tag LOCUS_03460 75129 75857 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243768.1 protein_id gnl|my_center|LOCUS_03460 75870 76748 gene locus_tag LOCUS_03470 75870 76748 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_03470 76748 77791 gene locus_tag LOCUS_03480 76748 77791 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039247.1 protein_id gnl|my_center|LOCUS_03480 77855 78640 gene locus_tag LOCUS_03490 77855 78640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 78658 79584 gene locus_tag LOCUS_03500 78658 79584 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965199.1 protein_id gnl|my_center|LOCUS_03500 79678 80349 gene locus_tag LOCUS_03510 79678 80349 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122046.1 protein_id gnl|my_center|LOCUS_03510 80349 81227 gene locus_tag LOCUS_03520 80349 81227 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088206.1 protein_id gnl|my_center|LOCUS_03520 81259 82263 gene locus_tag LOCUS_03530 81259 82263 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085682.1 protein_id gnl|my_center|LOCUS_03530 82273 82605 gene locus_tag LOCUS_03540 82273 82605 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878703.1 protein_id gnl|my_center|LOCUS_03540 82738 83790 gene locus_tag LOCUS_03550 82738 83790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 84063 85226 gene locus_tag LOCUS_03560 84063 85226 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727702.1 protein_id gnl|my_center|LOCUS_03560 85297 86049 gene locus_tag LOCUS_03570 85297 86049 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970096.1 protein_id gnl|my_center|LOCUS_03570 86046 86996 gene locus_tag LOCUS_03580 86046 86996 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066754.1 protein_id gnl|my_center|LOCUS_03580 87045 88103 gene locus_tag LOCUS_03590 gene hpaA 87045 88103 CDS product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113010.1 protein_id gnl|my_center|LOCUS_03590 88100 88576 gene locus_tag LOCUS_03600 88100 88576 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088787.1 protein_id gnl|my_center|LOCUS_03600 88573 90672 gene locus_tag LOCUS_03610 88573 90672 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088788.1 protein_id gnl|my_center|LOCUS_03610 92747 90789 gene locus_tag LOCUS_03620 92747 90789 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309586.1 protein_id gnl|my_center|LOCUS_03620 93890 92751 gene locus_tag LOCUS_03630 93890 92751 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292789.1 protein_id gnl|my_center|LOCUS_03630 97828 93887 gene locus_tag LOCUS_03640 97828 93887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 100177 97850 gene locus_tag LOCUS_03650 100177 97850 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294438.1 protein_id gnl|my_center|LOCUS_03650 101234 100149 gene locus_tag LOCUS_03660 101234 100149 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074859.1 protein_id gnl|my_center|LOCUS_03660 103537 101537 gene locus_tag LOCUS_03670 103537 101537 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110516.1 protein_id gnl|my_center|LOCUS_03670 103959 103582 gene locus_tag LOCUS_03680 103959 103582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973163.1 protein_id gnl|my_center|LOCUS_03680 104250 104744 gene locus_tag LOCUS_03690 104250 104744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992422.1 protein_id gnl|my_center|LOCUS_03690 105101 104892 gene locus_tag LOCUS_03700 105101 104892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 106531 105458 gene locus_tag LOCUS_03710 gene ugpC 106531 105458 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061266.1 protein_id gnl|my_center|LOCUS_03710 108059 106524 gene locus_tag LOCUS_03720 108059 106524 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081159250.1 protein_id gnl|my_center|LOCUS_03720 108888 108061 gene locus_tag LOCUS_03730 108888 108061 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888075.1 protein_id gnl|my_center|LOCUS_03730 109820 108885 gene locus_tag LOCUS_03740 109820 108885 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389016.1 protein_id gnl|my_center|LOCUS_03740 111186 109831 gene locus_tag LOCUS_03750 111186 109831 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976194.1 protein_id gnl|my_center|LOCUS_03750 112844 111294 gene locus_tag LOCUS_03760 112844 111294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268198.1 protein_id gnl|my_center|LOCUS_03760 114159 112999 gene locus_tag LOCUS_03770 114159 112999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 114342 115157 gene locus_tag LOCUS_03780 114342 115157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393473.1 protein_id gnl|my_center|LOCUS_03780 115154 115945 gene locus_tag LOCUS_03790 115154 115945 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816751.1 protein_id gnl|my_center|LOCUS_03790 115942 116721 gene locus_tag LOCUS_03800 115942 116721 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086076.1 protein_id gnl|my_center|LOCUS_03800 116745 117788 gene locus_tag LOCUS_03810 116745 117788 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974852.1 protein_id gnl|my_center|LOCUS_03810 117855 118922 gene locus_tag LOCUS_03820 117855 118922 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921442.1 protein_id gnl|my_center|LOCUS_03820 118913 119938 gene locus_tag LOCUS_03830 118913 119938 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803848.1 protein_id gnl|my_center|LOCUS_03830 119949 120914 gene locus_tag LOCUS_03840 119949 120914 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337814.1 protein_id gnl|my_center|LOCUS_03840 121137 122786 gene locus_tag LOCUS_03850 121137 122786 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066549.1 protein_id gnl|my_center|LOCUS_03850 122826 123872 gene locus_tag LOCUS_03860 122826 123872 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973844.1 protein_id gnl|my_center|LOCUS_03860 123869 124786 gene locus_tag LOCUS_03870 123869 124786 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969922.1 protein_id gnl|my_center|LOCUS_03870 124783 125616 gene locus_tag LOCUS_03880 124783 125616 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969921.1 protein_id gnl|my_center|LOCUS_03880 125613 126362 gene locus_tag LOCUS_03890 125613 126362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527922.1 protein_id gnl|my_center|LOCUS_03890 126842 126369 gene locus_tag LOCUS_03900 126842 126369 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384678.1 protein_id gnl|my_center|LOCUS_03900 127094 130705 gene locus_tag LOCUS_03910 gene putA 127094 130705 CDS product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050983981.1 protein_id gnl|my_center|LOCUS_03910 131337 130759 gene locus_tag LOCUS_03920 131337 130759 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967676.1 protein_id gnl|my_center|LOCUS_03920 132845 131334 gene locus_tag LOCUS_03930 132845 131334 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970975.1 protein_id gnl|my_center|LOCUS_03930 132953 133453 gene locus_tag LOCUS_03940 132953 133453 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973810.1 protein_id gnl|my_center|LOCUS_03940 133444 134421 gene locus_tag LOCUS_03950 133444 134421 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970977.1 protein_id gnl|my_center|LOCUS_03950 134431 135366 gene locus_tag LOCUS_03960 134431 135366 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080854800.1 protein_id gnl|my_center|LOCUS_03960 135834 135373 gene locus_tag LOCUS_03970 135834 135373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 135999 135844 gene locus_tag LOCUS_03980 135999 135844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003504656.1 protein_id gnl|my_center|LOCUS_03980 136100 136660 gene locus_tag LOCUS_03990 136100 136660 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528653.1 protein_id gnl|my_center|LOCUS_03990 136668 136943 gene locus_tag LOCUS_04000 136668 136943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 137101 137553 gene locus_tag LOCUS_04010 137101 137553 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707559.1 protein_id gnl|my_center|LOCUS_04010 137638 138984 gene locus_tag LOCUS_04020 137638 138984 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327923.1 protein_id gnl|my_center|LOCUS_04020 139050 139862 gene locus_tag LOCUS_04030 139050 139862 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327924.1 protein_id gnl|my_center|LOCUS_04030 139872 141770 gene locus_tag LOCUS_04040 139872 141770 CDS product nitric oxide reductase activation protein NorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391049.1 protein_id gnl|my_center|LOCUS_04040 143190 141838 gene locus_tag LOCUS_04050 gene hemN 143190 141838 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967669.1 protein_id gnl|my_center|LOCUS_04050 143418 143696 gene locus_tag LOCUS_04060 143418 143696 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252128.1 protein_id gnl|my_center|LOCUS_04060 143730 145082 gene locus_tag LOCUS_04070 143730 145082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967665.1 protein_id gnl|my_center|LOCUS_04070 145086 145619 gene locus_tag LOCUS_04080 145086 145619 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327929.1 protein_id gnl|my_center|LOCUS_04080 145624 145923 gene locus_tag LOCUS_04090 145624 145923 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528646.1 protein_id gnl|my_center|LOCUS_04090 147178 145964 gene locus_tag LOCUS_04100 147178 145964 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327931.1 protein_id gnl|my_center|LOCUS_04100 147391 148533 gene locus_tag LOCUS_04110 gene nirK 147391 148533 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327932.1 protein_id gnl|my_center|LOCUS_04110 148667 149581 gene locus_tag LOCUS_04120 148667 149581 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970956.1 protein_id gnl|my_center|LOCUS_04120 149651 150352 gene locus_tag LOCUS_04130 149651 150352 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528645.1 protein_id gnl|my_center|LOCUS_04130 153427 150377 gene locus_tag LOCUS_04140 153427 150377 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970137.1 protein_id gnl|my_center|LOCUS_04140 153554 153988 gene locus_tag LOCUS_04150 153554 153988 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527502.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04150 154162 154944 gene locus_tag LOCUS_04160 154162 154944 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098513.1 protein_id gnl|my_center|LOCUS_04160 155041 155706 gene locus_tag LOCUS_04170 155041 155706 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016255872.1 protein_id gnl|my_center|LOCUS_04170 155732 156745 gene locus_tag LOCUS_04180 155732 156745 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213192.1 protein_id gnl|my_center|LOCUS_04180 156839 158131 gene locus_tag LOCUS_04190 156839 158131 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213190.1 protein_id gnl|my_center|LOCUS_04190 158143 159057 gene locus_tag LOCUS_04200 158143 159057 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213188.1 protein_id gnl|my_center|LOCUS_04200 159057 159866 gene locus_tag LOCUS_04210 159057 159866 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213186.1 protein_id gnl|my_center|LOCUS_04210 159871 160965 gene locus_tag LOCUS_04220 gene ugpC 159871 160965 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972369.1 protein_id gnl|my_center|LOCUS_04220 161019 161882 gene locus_tag LOCUS_04230 161019 161882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 161914 163050 gene locus_tag LOCUS_04240 161914 163050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 163818 163138 gene locus_tag LOCUS_04250 163818 163138 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972919.1 protein_id gnl|my_center|LOCUS_04250 164073 165260 gene locus_tag LOCUS_04260 164073 165260 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391418.1 protein_id gnl|my_center|LOCUS_04260 165358 166227 gene locus_tag LOCUS_04270 165358 166227 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386881.1 protein_id gnl|my_center|LOCUS_04270 166232 167203 gene locus_tag LOCUS_04280 166232 167203 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050983966.1 protein_id gnl|my_center|LOCUS_04280 167200 167982 gene locus_tag LOCUS_04290 167200 167982 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879470.1 protein_id gnl|my_center|LOCUS_04290 167986 168708 gene locus_tag LOCUS_04300 167986 168708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252483.1 protein_id gnl|my_center|LOCUS_04300 168710 169423 gene locus_tag LOCUS_04310 168710 169423 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252482.1 protein_id gnl|my_center|LOCUS_04310 169939 169481 gene locus_tag LOCUS_04320 169939 169481 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707240.1 protein_id gnl|my_center|LOCUS_04320 170717 169953 gene locus_tag LOCUS_04330 170717 169953 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243048.1 protein_id gnl|my_center|LOCUS_04330 171496 170714 gene locus_tag LOCUS_04340 171496 170714 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243143.1 protein_id gnl|my_center|LOCUS_04340 172514 171570 gene locus_tag LOCUS_04350 172514 171570 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536397.1 protein_id gnl|my_center|LOCUS_04350 173522 172587 gene locus_tag LOCUS_04360 173522 172587 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533069.1 protein_id gnl|my_center|LOCUS_04360 175042 173531 gene locus_tag LOCUS_04370 175042 173531 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533070.1 protein_id gnl|my_center|LOCUS_04370 176805 175087 gene locus_tag LOCUS_04380 176805 175087 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533071.1 protein_id gnl|my_center|LOCUS_04380 177411 178061 gene locus_tag LOCUS_04390 177411 178061 CDS product DUF2291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533075.1 protein_id gnl|my_center|LOCUS_04390 178058 179596 gene locus_tag LOCUS_04400 178058 179596 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533074.1 protein_id gnl|my_center|LOCUS_04400 179700 180740 gene locus_tag LOCUS_04410 179700 180740 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533073.1 protein_id gnl|my_center|LOCUS_04410 180858 181805 gene locus_tag LOCUS_04420 180858 181805 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533072.1 protein_id gnl|my_center|LOCUS_04420 181937 182776 gene locus_tag LOCUS_04430 181937 182776 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533078.1 protein_id gnl|my_center|LOCUS_04430 182848 184548 gene locus_tag LOCUS_04440 182848 184548 CDS product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976258.1 protein_id gnl|my_center|LOCUS_04440 184873 185700 gene locus_tag LOCUS_04450 184873 185700 CDS product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975227.1 protein_id gnl|my_center|LOCUS_04450 185805 186746 gene locus_tag LOCUS_04460 185805 186746 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975228.1 protein_id gnl|my_center|LOCUS_04460 186816 187454 gene locus_tag LOCUS_04470 186816 187454 CDS product DUF2291 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975229.1 protein_id gnl|my_center|LOCUS_04470 187456 189000 gene locus_tag LOCUS_04480 187456 189000 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398941.1 protein_id gnl|my_center|LOCUS_04480 189000 190067 gene locus_tag LOCUS_04490 189000 190067 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969403.1 protein_id gnl|my_center|LOCUS_04490 190079 191104 gene locus_tag LOCUS_04500 190079 191104 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975231.1 protein_id gnl|my_center|LOCUS_04500 191101 192969 gene locus_tag LOCUS_04510 191101 192969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398936.1 protein_id gnl|my_center|LOCUS_04510 193683 192973 gene locus_tag LOCUS_04520 193683 192973 CDS product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398931.1 protein_id gnl|my_center|LOCUS_04520 193834 195090 gene locus_tag LOCUS_04530 193834 195090 CDS product ribulose-bisphosphate carboxylase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398928.1 protein_id gnl|my_center|LOCUS_04530 195094 196395 gene locus_tag LOCUS_04540 195094 196395 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398926.1 protein_id gnl|my_center|LOCUS_04540 197240 196479 gene locus_tag LOCUS_04550 197240 196479 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972010.1 protein_id gnl|my_center|LOCUS_04550 197821 197255 gene locus_tag LOCUS_04560 197821 197255 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992320.1 protein_id gnl|my_center|LOCUS_04560 198179 197805 gene locus_tag LOCUS_04570 198179 197805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169539114.1 protein_id gnl|my_center|LOCUS_04570 198587 200296 gene locus_tag LOCUS_04580 gene kdpA 198587 200296 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968198.1 protein_id gnl|my_center|LOCUS_04580 200308 202344 gene locus_tag LOCUS_04590 gene kdpB 200308 202344 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970239.1 protein_id gnl|my_center|LOCUS_04590 202347 202916 gene locus_tag LOCUS_04600 gene kdpC 202347 202916 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968196.1 protein_id gnl|my_center|LOCUS_04600 202925 205609 gene locus_tag LOCUS_04610 202925 205609 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970241.1 protein_id gnl|my_center|LOCUS_04610 205606 206298 gene locus_tag LOCUS_04620 205606 206298 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970242.1 protein_id gnl|my_center|LOCUS_04620 207425 206406 gene locus_tag LOCUS_04630 207425 206406 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706074.1 protein_id gnl|my_center|LOCUS_04630 207698 208744 gene locus_tag LOCUS_04640 207698 208744 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723135.1 protein_id gnl|my_center|LOCUS_04640 208819 209637 gene locus_tag LOCUS_04650 208819 209637 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339543.1 protein_id gnl|my_center|LOCUS_04650 209634 210878 gene locus_tag LOCUS_04660 209634 210878 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140281.1 protein_id gnl|my_center|LOCUS_04660 210905 211633 gene locus_tag LOCUS_04670 210905 211633 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565148.1 protein_id gnl|my_center|LOCUS_04670 211699 213330 gene locus_tag LOCUS_04680 211699 213330 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339545.1 protein_id gnl|my_center|LOCUS_04680 215863 213377 gene locus_tag LOCUS_04690 215863 213377 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976275.1 protein_id gnl|my_center|LOCUS_04690 216938 216075 gene locus_tag LOCUS_04700 216938 216075 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206372.1 protein_id gnl|my_center|LOCUS_04700 217074 218261 gene locus_tag LOCUS_04710 217074 218261 CDS product cyanate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064385.1 protein_id gnl|my_center|LOCUS_04710 219146 218310 gene locus_tag LOCUS_04720 219146 218310 CDS product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976208.1 protein_id gnl|my_center|LOCUS_04720 219878 219207 gene locus_tag LOCUS_04730 219878 219207 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311533.1 protein_id gnl|my_center|LOCUS_04730 220543 220097 gene locus_tag LOCUS_04740 220543 220097 CDS product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252133.1 protein_id gnl|my_center|LOCUS_04740 221441 220728 gene locus_tag LOCUS_04750 221441 220728 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336836.1 protein_id gnl|my_center|LOCUS_04750 221574 222077 gene locus_tag LOCUS_04760 gene hpaR 221574 222077 CDS product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392276.1 protein_id gnl|my_center|LOCUS_04760 222896 222090 gene locus_tag LOCUS_04770 gene hpaI 222896 222090 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392271.1 protein_id gnl|my_center|LOCUS_04770 223709 222906 gene locus_tag LOCUS_04780 gene hpaH 223709 222906 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392273.1 protein_id gnl|my_center|LOCUS_04780 224581 223712 gene locus_tag LOCUS_04790 224581 223712 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037468009.1 protein_id gnl|my_center|LOCUS_04790 225635 224655 gene locus_tag LOCUS_04800 gene hpaD 225635 224655 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392282.1 protein_id gnl|my_center|LOCUS_04800 227213 225696 gene locus_tag LOCUS_04810 gene hpaE 227213 225696 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392284.1 protein_id gnl|my_center|LOCUS_04810 227622 227236 gene locus_tag LOCUS_04820 227622 227236 CDS product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392286.1 protein_id gnl|my_center|LOCUS_04820 228209 227697 gene locus_tag LOCUS_04830 228209 227697 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392287.1 protein_id gnl|my_center|LOCUS_04830 229779 228220 gene locus_tag LOCUS_04840 229779 228220 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392289.1 protein_id gnl|my_center|LOCUS_04840 229875 230756 gene locus_tag LOCUS_04850 229875 230756 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392292.1 protein_id gnl|my_center|LOCUS_04850 230873 231394 gene locus_tag LOCUS_04860 gene tsaA 230873 231394 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087894.1 protein_id gnl|my_center|LOCUS_04860 231660 231451 gene locus_tag LOCUS_04870 231660 231451 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531022.1 protein_id gnl|my_center|LOCUS_04870 231836 232681 gene locus_tag LOCUS_04880 231836 232681 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_04880 233287 232682 gene locus_tag LOCUS_04890 233287 232682 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252920.1 protein_id gnl|my_center|LOCUS_04890 234057 233284 gene locus_tag LOCUS_04900 234057 233284 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529413.1 protein_id gnl|my_center|LOCUS_04900 234256 234059 gene locus_tag LOCUS_04910 gene thiS 234256 234059 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972407.1 protein_id gnl|my_center|LOCUS_04910 235239 234253 gene locus_tag LOCUS_04920 gene thiO 235239 234253 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976312.1 protein_id gnl|my_center|LOCUS_04920 237065 235242 gene locus_tag LOCUS_04930 gene thiC 237065 235242 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972409.1 protein_id gnl|my_center|LOCUS_04930 >Feature sequence03 1633 113 gene locus_tag LOCUS_04940 1633 113 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066726.1 protein_id gnl|my_center|LOCUS_04940 3669 2092 gene locus_tag LOCUS_04950 3669 2092 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241846.1 protein_id gnl|my_center|LOCUS_04950 3903 3739 gene locus_tag LOCUS_04960 3903 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 3902 4291 gene locus_tag LOCUS_04970 3902 4291 CDS product DUF2780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327670.1 protein_id gnl|my_center|LOCUS_04970 5743 4550 gene locus_tag LOCUS_04980 5743 4550 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166648346.1 protein_id gnl|my_center|LOCUS_04980 6664 5777 gene locus_tag LOCUS_04990 6664 5777 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385769.1 protein_id gnl|my_center|LOCUS_04990 7615 6782 gene locus_tag LOCUS_05000 7615 6782 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971210.1 protein_id gnl|my_center|LOCUS_05000 8931 7738 gene locus_tag LOCUS_05010 8931 7738 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974993.1 protein_id gnl|my_center|LOCUS_05010 9072 9965 gene locus_tag LOCUS_05020 9072 9965 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973719.1 protein_id gnl|my_center|LOCUS_05020 10366 9974 gene locus_tag LOCUS_05030 10366 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 10575 11177 gene locus_tag LOCUS_05040 10575 11177 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532667.1 protein_id gnl|my_center|LOCUS_05040 11275 11556 gene locus_tag LOCUS_05050 11275 11556 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 protein_id gnl|my_center|LOCUS_05050 11557 11925 gene locus_tag LOCUS_05060 11557 11925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 12632 11934 gene locus_tag LOCUS_05070 12632 11934 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528368.1 protein_id gnl|my_center|LOCUS_05070 12754 13389 gene locus_tag LOCUS_05080 12754 13389 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327682.1 protein_id gnl|my_center|LOCUS_05080 13514 13957 gene locus_tag LOCUS_05090 13514 13957 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974792.1 protein_id gnl|my_center|LOCUS_05090 14076 14984 gene locus_tag LOCUS_05100 14076 14984 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327684.1 protein_id gnl|my_center|LOCUS_05100 15782 15198 gene locus_tag LOCUS_05110 15782 15198 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971226.1 protein_id gnl|my_center|LOCUS_05110 16307 15807 gene locus_tag LOCUS_05120 16307 15807 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537587.1 protein_id gnl|my_center|LOCUS_05120 16979 16530 gene locus_tag LOCUS_05130 16979 16530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 18724 17048 gene locus_tag LOCUS_05140 18724 17048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 21544 19211 gene locus_tag LOCUS_05150 21544 19211 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974797.1 protein_id gnl|my_center|LOCUS_05150 23509 21998 gene locus_tag LOCUS_05160 23509 21998 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968967.1 protein_id gnl|my_center|LOCUS_05160 23666 24145 gene locus_tag LOCUS_05170 23666 24145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 24283 26355 gene locus_tag LOCUS_05180 24283 26355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 26426 26689 gene locus_tag LOCUS_05190 26426 26689 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971270.1 protein_id gnl|my_center|LOCUS_05190 26689 27048 gene locus_tag LOCUS_05200 26689 27048 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311244.1 protein_id gnl|my_center|LOCUS_05200 29182 27089 gene locus_tag LOCUS_05210 29182 27089 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170147.1 protein_id gnl|my_center|LOCUS_05210 29685 29251 gene locus_tag LOCUS_05220 29685 29251 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967549.1 protein_id gnl|my_center|LOCUS_05220 30092 29682 gene locus_tag LOCUS_05230 30092 29682 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967550.1 protein_id gnl|my_center|LOCUS_05230 30382 30089 gene locus_tag LOCUS_05240 gene bigR 30382 30089 CDS product sulfite-sensing transcriptional repressor BigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389407.1 protein_id gnl|my_center|LOCUS_05240 31658 30531 gene locus_tag LOCUS_05250 31658 30531 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971240.1 protein_id gnl|my_center|LOCUS_05250 31824 32234 gene locus_tag LOCUS_05260 31824 32234 CDS product DUF930 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971236.1 protein_id gnl|my_center|LOCUS_05260 33824 32862 gene locus_tag LOCUS_05270 33824 32862 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327693.1 protein_id gnl|my_center|LOCUS_05270 34036 34359 gene locus_tag LOCUS_05280 34036 34359 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379501.1 protein_id gnl|my_center|LOCUS_05280 34481 35140 gene locus_tag LOCUS_05290 34481 35140 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974807.1 protein_id gnl|my_center|LOCUS_05290 35691 35191 gene locus_tag LOCUS_05300 35691 35191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974808.1 protein_id gnl|my_center|LOCUS_05300 35922 36425 gene locus_tag LOCUS_05310 35922 36425 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316616.1 protein_id gnl|my_center|LOCUS_05310 36867 36460 gene locus_tag LOCUS_05320 gene msrB 36867 36460 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968974.1 protein_id gnl|my_center|LOCUS_05320 37007 37240 gene locus_tag LOCUS_05330 37007 37240 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244189.1 protein_id gnl|my_center|LOCUS_05330 37244 37660 gene locus_tag LOCUS_05340 37244 37660 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243822.1 protein_id gnl|my_center|LOCUS_05340 37774 40098 gene locus_tag LOCUS_05350 37774 40098 CDS product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968975.1 protein_id gnl|my_center|LOCUS_05350 40334 40753 gene locus_tag LOCUS_05360 40334 40753 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974810.1 protein_id gnl|my_center|LOCUS_05360 40753 41130 gene locus_tag LOCUS_05370 40753 41130 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391284.1 protein_id gnl|my_center|LOCUS_05370 41148 42689 gene locus_tag LOCUS_05380 41148 42689 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974812.1 protein_id gnl|my_center|LOCUS_05380 42691 43164 gene locus_tag LOCUS_05390 42691 43164 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974813.1 protein_id gnl|my_center|LOCUS_05390 43164 43529 gene locus_tag LOCUS_05400 43164 43529 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327703.1 protein_id gnl|my_center|LOCUS_05400 43529 43885 gene locus_tag LOCUS_05410 gene mnhG 43529 43885 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527385.1 protein_id gnl|my_center|LOCUS_05410 44297 44731 gene locus_tag LOCUS_05420 gene mucR 44297 44731 CDS product exopolysaccharide biosynthesis transcriptional regulator MucR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527383.1 protein_id gnl|my_center|LOCUS_05420 45046 45405 gene locus_tag LOCUS_05430 45046 45405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 45398 46195 gene locus_tag LOCUS_05440 45398 46195 CDS product DUF6456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971251.1 protein_id gnl|my_center|LOCUS_05440 46955 46536 gene locus_tag LOCUS_05450 46955 46536 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971252.1 protein_id gnl|my_center|LOCUS_05450 47534 47109 gene locus_tag LOCUS_05460 47534 47109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 48047 49588 gene locus_tag LOCUS_05470 48047 49588 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391278.1 protein_id gnl|my_center|LOCUS_05470 49560 50273 gene locus_tag LOCUS_05480 49560 50273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 50396 51847 gene locus_tag LOCUS_05490 50396 51847 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389429.1 protein_id gnl|my_center|LOCUS_05490 52032 52463 gene locus_tag LOCUS_05500 52032 52463 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971254.1 protein_id gnl|my_center|LOCUS_05500 52662 54314 gene locus_tag LOCUS_05510 52662 54314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 55527 54550 gene locus_tag LOCUS_05520 55527 54550 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391296.1 protein_id gnl|my_center|LOCUS_05520 56133 56321 gene locus_tag LOCUS_05530 56133 56321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 56994 56443 gene locus_tag LOCUS_05540 56994 56443 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974826.1 protein_id gnl|my_center|LOCUS_05540 57580 56987 gene locus_tag LOCUS_05550 57580 56987 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974827.1 protein_id gnl|my_center|LOCUS_05550 59793 57610 gene locus_tag LOCUS_05560 59793 57610 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968985.1 protein_id gnl|my_center|LOCUS_05560 59971 60456 gene locus_tag LOCUS_05570 59971 60456 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968986.1 protein_id gnl|my_center|LOCUS_05570 60778 60464 gene locus_tag LOCUS_05580 60778 60464 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974830.1 protein_id gnl|my_center|LOCUS_05580 61059 61601 gene locus_tag LOCUS_05590 61059 61601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 61903 63105 gene locus_tag LOCUS_05600 61903 63105 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235776816.1 protein_id gnl|my_center|LOCUS_05600 63107 63715 gene locus_tag LOCUS_05610 63107 63715 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972645.1 protein_id gnl|my_center|LOCUS_05610 63931 65067 gene locus_tag LOCUS_05620 63931 65067 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971283.1 protein_id gnl|my_center|LOCUS_05620 65450 65758 gene locus_tag LOCUS_05630 65450 65758 CDS product DUF6107 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971284.1 protein_id gnl|my_center|LOCUS_05630 65907 66464 gene locus_tag LOCUS_05640 65907 66464 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971285.1 protein_id gnl|my_center|LOCUS_05640 66537 67781 gene locus_tag LOCUS_05650 66537 67781 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971286.1 protein_id gnl|my_center|LOCUS_05650 67978 68547 gene locus_tag LOCUS_05660 67978 68547 CDS product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975492.1 protein_id gnl|my_center|LOCUS_05660 68547 68885 gene locus_tag LOCUS_05670 68547 68885 CDS product head-tail adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383951.1 protein_id gnl|my_center|LOCUS_05670 68882 69289 gene locus_tag LOCUS_05680 68882 69289 CDS product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971288.1 protein_id gnl|my_center|LOCUS_05680 69316 69723 gene locus_tag LOCUS_05690 69316 69723 CDS product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719628.1 protein_id gnl|my_center|LOCUS_05690 69723 70085 gene locus_tag LOCUS_05700 69723 70085 CDS product gene transfer agent family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719629.1 protein_id gnl|my_center|LOCUS_05700 70142 70285 gene locus_tag LOCUS_05710 70142 70285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 70289 70822 gene locus_tag LOCUS_05720 70289 70822 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972646.1 protein_id gnl|my_center|LOCUS_05720 71223 71858 gene locus_tag LOCUS_05730 71223 71858 CDS product TIGR02217 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971292.1 protein_id gnl|my_center|LOCUS_05730 71855 72745 gene locus_tag LOCUS_05740 71855 72745 CDS product DUF2163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971293.1 protein_id gnl|my_center|LOCUS_05740 72897 73361 gene locus_tag LOCUS_05750 72897 73361 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971294.1 protein_id gnl|my_center|LOCUS_05750 73365 77198 gene locus_tag LOCUS_05760 73365 77198 CDS product glycoside hydrolase TIM-barrel-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971295.1 protein_id gnl|my_center|LOCUS_05760 77214 77423 gene locus_tag LOCUS_05770 77214 77423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214779.1 protein_id gnl|my_center|LOCUS_05770 77516 77767 gene locus_tag LOCUS_05780 gene feuN 77516 77767 CDS product two-component system FeuPQ modulator FeuN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527365.1 protein_id gnl|my_center|LOCUS_05780 77816 78487 gene locus_tag LOCUS_05790 77816 78487 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 protein_id gnl|my_center|LOCUS_05790 78477 79895 gene locus_tag LOCUS_05800 78477 79895 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391275.1 protein_id gnl|my_center|LOCUS_05800 80176 80595 gene locus_tag LOCUS_05810 80176 80595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 80752 81888 gene locus_tag LOCUS_05820 gene ccmI 80752 81888 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327725.1 protein_id gnl|my_center|LOCUS_05820 81885 82334 gene locus_tag LOCUS_05830 gene ccmE 81885 82334 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527358.1 protein_id gnl|my_center|LOCUS_05830 82331 84316 gene locus_tag LOCUS_05840 82331 84316 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391272.1 protein_id gnl|my_center|LOCUS_05840 84313 84765 gene locus_tag LOCUS_05850 84313 84765 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241025.1 protein_id gnl|my_center|LOCUS_05850 84970 86544 gene locus_tag LOCUS_05860 84970 86544 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844141.1 protein_id gnl|my_center|LOCUS_05860 86674 87342 gene locus_tag LOCUS_05870 86674 87342 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974840.1 protein_id gnl|my_center|LOCUS_05870 87347 88771 gene locus_tag LOCUS_05880 87347 88771 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391266.1 protein_id gnl|my_center|LOCUS_05880 88823 91774 gene locus_tag LOCUS_05890 88823 91774 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391265.1 protein_id gnl|my_center|LOCUS_05890 94357 92069 gene locus_tag LOCUS_05900 94357 92069 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391264.1 protein_id gnl|my_center|LOCUS_05900 97400 94752 gene locus_tag LOCUS_05910 gene pepN 97400 94752 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968995.1 protein_id gnl|my_center|LOCUS_05910 97725 98663 gene locus_tag LOCUS_05920 97725 98663 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327735.1 protein_id gnl|my_center|LOCUS_05920 99947 98667 gene locus_tag LOCUS_05930 99947 98667 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527346.1 protein_id gnl|my_center|LOCUS_05930 100463 100320 gene locus_tag LOCUS_05940 100463 100320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 100698 100522 gene locus_tag LOCUS_05950 100698 100522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527344.1 protein_id gnl|my_center|LOCUS_05950 101784 100912 gene locus_tag LOCUS_05960 101784 100912 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327738.1 protein_id gnl|my_center|LOCUS_05960 103127 101835 gene locus_tag LOCUS_05970 103127 101835 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971311.1 protein_id gnl|my_center|LOCUS_05970 104314 103526 gene locus_tag LOCUS_05980 104314 103526 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_05980 105741 104326 gene locus_tag LOCUS_05990 105741 104326 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530415.1 protein_id gnl|my_center|LOCUS_05990 106005 107669 gene locus_tag LOCUS_06000 106005 107669 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184144746.1 protein_id gnl|my_center|LOCUS_06000 108103 108585 gene locus_tag LOCUS_06010 108103 108585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 108664 109293 gene locus_tag LOCUS_06020 108664 109293 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311709.1 protein_id gnl|my_center|LOCUS_06020 109666 110664 gene locus_tag LOCUS_06030 109666 110664 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393023.1 protein_id gnl|my_center|LOCUS_06030 110810 111697 gene locus_tag LOCUS_06040 110810 111697 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393024.1 protein_id gnl|my_center|LOCUS_06040 111774 112358 gene locus_tag LOCUS_06050 111774 112358 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972243.1 protein_id gnl|my_center|LOCUS_06050 113270 112362 gene locus_tag LOCUS_06060 113270 112362 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391255.1 protein_id gnl|my_center|LOCUS_06060 113411 113881 gene locus_tag LOCUS_06070 113411 113881 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327744.1 protein_id gnl|my_center|LOCUS_06070 114405 113989 gene locus_tag LOCUS_06080 gene mexG 114405 113989 CDS product multidrug efflux RND transporter inhibitory subunit MexG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093607.1 protein_id gnl|my_center|LOCUS_06080 115855 114617 gene locus_tag LOCUS_06090 115855 114617 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050813472.1 protein_id gnl|my_center|LOCUS_06090 116210 117148 gene locus_tag LOCUS_06100 116210 117148 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327745.1 protein_id gnl|my_center|LOCUS_06100 118678 117320 gene locus_tag LOCUS_06110 118678 117320 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037491.1 protein_id gnl|my_center|LOCUS_06110 118826 120199 gene locus_tag LOCUS_06120 118826 120199 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992255.1 protein_id gnl|my_center|LOCUS_06120 120594 120205 gene locus_tag LOCUS_06130 120594 120205 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 protein_id gnl|my_center|LOCUS_06130 120821 120591 gene locus_tag LOCUS_06140 120821 120591 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971328.1 protein_id gnl|my_center|LOCUS_06140 122388 120886 gene locus_tag LOCUS_06150 122388 120886 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391249.1 protein_id gnl|my_center|LOCUS_06150 122823 122503 gene locus_tag LOCUS_06160 122823 122503 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254519.1 protein_id gnl|my_center|LOCUS_06160 123121 122945 gene locus_tag LOCUS_06170 123121 122945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441068.1 protein_id gnl|my_center|LOCUS_06170 123317 123153 gene locus_tag LOCUS_06180 123317 123153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 124004 123666 gene locus_tag LOCUS_06190 124004 123666 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311505.1 protein_id gnl|my_center|LOCUS_06190 124471 124740 gene locus_tag LOCUS_06200 124471 124740 CDS product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241004.1 protein_id gnl|my_center|LOCUS_06200 125938 124817 gene locus_tag LOCUS_06210 125938 124817 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971332.1 protein_id gnl|my_center|LOCUS_06210 126492 126064 gene locus_tag LOCUS_06220 126492 126064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 126975 126619 gene locus_tag LOCUS_06230 126975 126619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 128315 127092 gene locus_tag LOCUS_06240 128315 127092 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 protein_id gnl|my_center|LOCUS_06240 128545 129573 gene locus_tag LOCUS_06250 128545 129573 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827650.1 protein_id gnl|my_center|LOCUS_06250 130488 129694 gene locus_tag LOCUS_06260 gene iolB 130488 129694 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397477.1 protein_id gnl|my_center|LOCUS_06260 131441 130524 gene locus_tag LOCUS_06270 gene iolE 131441 130524 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528373.1 protein_id gnl|my_center|LOCUS_06270 133440 131590 gene locus_tag LOCUS_06280 gene iolD 133440 131590 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968521.1 protein_id gnl|my_center|LOCUS_06280 135456 133522 gene locus_tag LOCUS_06290 gene iolC 135456 133522 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528371.1 protein_id gnl|my_center|LOCUS_06290 136435 135578 gene locus_tag LOCUS_06300 136435 135578 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397484.1 protein_id gnl|my_center|LOCUS_06300 136649 137770 gene locus_tag LOCUS_06310 136649 137770 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973913.1 protein_id gnl|my_center|LOCUS_06310 137869 141222 gene locus_tag LOCUS_06320 137869 141222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 142707 141595 gene locus_tag LOCUS_06330 142707 141595 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844483.1 protein_id gnl|my_center|LOCUS_06330 142954 143043 gene locus_tag LOCUS_t00030 142954 143043 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 144612 143785 gene locus_tag LOCUS_06340 144612 143785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06340 144998 144609 gene locus_tag LOCUS_06350 144998 144609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06350 145057 145329 gene locus_tag LOCUS_06360 145057 145329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06360 145437 146156 gene locus_tag LOCUS_06370 145437 146156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06370 146418 146903 gene locus_tag LOCUS_06380 146418 146903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 147234 146995 gene locus_tag LOCUS_06390 147234 146995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 147716 147336 gene locus_tag LOCUS_06400 147716 147336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 148100 148933 gene locus_tag LOCUS_06410 148100 148933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 149261 148983 gene locus_tag LOCUS_06420 149261 148983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 149419 149745 gene locus_tag LOCUS_06430 149419 149745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 150705 149938 gene locus_tag LOCUS_06440 150705 149938 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114245.1 protein_id gnl|my_center|LOCUS_06440 150915 150718 gene locus_tag LOCUS_06450 150915 150718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100557208.1 protein_id gnl|my_center|LOCUS_06450 151436 152047 gene locus_tag LOCUS_06460 151436 152047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 152575 152036 gene locus_tag LOCUS_06470 152575 152036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 152958 154355 gene locus_tag LOCUS_06480 152958 154355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 154664 154278 gene locus_tag LOCUS_06490 154664 154278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 155895 155602 gene locus_tag LOCUS_06500 155895 155602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 157175 155892 gene locus_tag LOCUS_06510 157175 155892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 157679 157311 gene locus_tag LOCUS_06520 157679 157311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 157882 157679 gene locus_tag LOCUS_06530 157882 157679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 158223 157882 gene locus_tag LOCUS_06540 158223 157882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 158327 158575 gene locus_tag LOCUS_06550 158327 158575 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167391325.1 protein_id gnl|my_center|LOCUS_06550 159120 158911 gene locus_tag LOCUS_06560 159120 158911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 160241 159291 gene locus_tag LOCUS_06570 160241 159291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 160813 161580 gene locus_tag LOCUS_06580 160813 161580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 161577 162020 gene locus_tag LOCUS_06590 161577 162020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 162627 162289 gene locus_tag LOCUS_06600 162627 162289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 163188 162736 gene locus_tag LOCUS_06610 163188 162736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 164035 163733 gene locus_tag LOCUS_06620 164035 163733 CDS product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243280.1 protein_id gnl|my_center|LOCUS_06620 164745 164356 gene locus_tag LOCUS_06630 164745 164356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 168188 164784 gene locus_tag LOCUS_06640 168188 164784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 169270 168191 gene locus_tag LOCUS_06650 169270 168191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 169713 169384 gene locus_tag LOCUS_06660 169713 169384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 170111 169815 gene locus_tag LOCUS_06670 170111 169815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 170286 170104 gene locus_tag LOCUS_06680 170286 170104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 171194 170283 gene locus_tag LOCUS_06690 171194 170283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 172626 171196 gene locus_tag LOCUS_06700 172626 171196 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337085.1 protein_id gnl|my_center|LOCUS_06700 173072 172623 gene locus_tag LOCUS_06710 173072 172623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 173377 173069 gene locus_tag LOCUS_06720 173377 173069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133033982.1 protein_id gnl|my_center|LOCUS_06720 173586 173374 gene locus_tag LOCUS_06730 173586 173374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 173774 173598 gene locus_tag LOCUS_06740 173774 173598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 174679 173912 gene locus_tag LOCUS_06750 174679 173912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 175880 174672 gene locus_tag LOCUS_06760 175880 174672 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973356.1 protein_id gnl|my_center|LOCUS_06760 177039 176083 gene locus_tag LOCUS_06770 177039 176083 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526650.1 protein_id gnl|my_center|LOCUS_06770 178202 177135 gene locus_tag LOCUS_06780 178202 177135 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209601357.1 protein_id gnl|my_center|LOCUS_06780 178862 179902 gene locus_tag LOCUS_06790 178862 179902 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209601357.1 protein_id gnl|my_center|LOCUS_06790 180905 180027 gene locus_tag LOCUS_06800 180905 180027 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050983961.1 protein_id gnl|my_center|LOCUS_06800 183172 181103 gene locus_tag LOCUS_06810 183172 181103 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526651.1 protein_id gnl|my_center|LOCUS_06810 183496 184380 gene locus_tag LOCUS_06820 gene dapA 183496 184380 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974875.1 protein_id gnl|my_center|LOCUS_06820 184382 184861 gene locus_tag LOCUS_06830 gene smpB 184382 184861 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974876.1 protein_id gnl|my_center|LOCUS_06830 185356 184886 gene locus_tag LOCUS_06840 185356 184886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 186153 185578 gene locus_tag LOCUS_06850 186153 185578 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311253.1 protein_id gnl|my_center|LOCUS_06850 186639 186457 gene locus_tag LOCUS_06860 186639 186457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 186565 186969 gene locus_tag LOCUS_06870 gene rpoZ 186565 186969 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311530.1 protein_id gnl|my_center|LOCUS_06870 187158 189389 gene locus_tag LOCUS_06880 187158 189389 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327768.1 protein_id gnl|my_center|LOCUS_06880 189561 189713 gene locus_tag LOCUS_06890 189561 189713 CDS product DUF3563 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064506643.1 protein_id gnl|my_center|LOCUS_06890 189861 190412 gene locus_tag LOCUS_06900 189861 190412 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655338.1 protein_id gnl|my_center|LOCUS_06900 190409 190819 gene locus_tag LOCUS_06910 gene acpS 190409 190819 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971345.1 protein_id gnl|my_center|LOCUS_06910 190979 190785 gene locus_tag LOCUS_06920 190979 190785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 191046 191816 gene locus_tag LOCUS_06930 gene lepB 191046 191816 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527287.1 protein_id gnl|my_center|LOCUS_06930 191813 192532 gene locus_tag LOCUS_06940 gene rnc 191813 192532 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969021.1 protein_id gnl|my_center|LOCUS_06940 192541 193485 gene locus_tag LOCUS_06950 gene era 192541 193485 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974885.1 protein_id gnl|my_center|LOCUS_06950 194455 193490 gene locus_tag LOCUS_06960 194455 193490 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969027.1 protein_id gnl|my_center|LOCUS_06960 196888 194525 gene locus_tag LOCUS_06970 196888 194525 CDS product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968870.1 protein_id gnl|my_center|LOCUS_06970 197969 196875 gene locus_tag LOCUS_06980 197969 196875 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392694.1 protein_id gnl|my_center|LOCUS_06980 198153 200462 gene locus_tag LOCUS_06990 198153 200462 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391213.1 protein_id gnl|my_center|LOCUS_06990 200608 201501 gene locus_tag LOCUS_07000 gene bla 200608 201501 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445499.1 protein_id gnl|my_center|LOCUS_07000 201856 201533 gene locus_tag LOCUS_07010 201856 201533 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969033.1 protein_id gnl|my_center|LOCUS_07010 201928 202416 gene locus_tag LOCUS_07020 201928 202416 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527272.1 protein_id gnl|my_center|LOCUS_07020 202431 202793 gene locus_tag LOCUS_07030 202431 202793 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974894.1 protein_id gnl|my_center|LOCUS_07030 203571 202840 gene locus_tag LOCUS_07040 203571 202840 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379663.1 protein_id gnl|my_center|LOCUS_07040 203777 204541 gene locus_tag LOCUS_07050 gene recO 203777 204541 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552519.1 protein_id gnl|my_center|LOCUS_07050 204538 205047 gene locus_tag LOCUS_07060 204538 205047 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532579.1 protein_id gnl|my_center|LOCUS_07060 206055 205150 gene locus_tag LOCUS_07070 206055 205150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 206219 209071 gene locus_tag LOCUS_07080 206219 209071 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974897.1 protein_id gnl|my_center|LOCUS_07080 209108 209761 gene locus_tag LOCUS_07090 209108 209761 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532655.1 protein_id gnl|my_center|LOCUS_07090 209841 210686 gene locus_tag LOCUS_07100 209841 210686 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391196.1 protein_id gnl|my_center|LOCUS_07100 211675 210683 gene locus_tag LOCUS_07110 gene corA 211675 210683 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968502.1 protein_id gnl|my_center|LOCUS_07110 212021 213211 gene locus_tag LOCUS_07120 212021 213211 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969038.1 protein_id gnl|my_center|LOCUS_07120 213382 214461 gene locus_tag LOCUS_07130 gene nadA 213382 214461 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974901.1 protein_id gnl|my_center|LOCUS_07130 214682 216280 gene locus_tag LOCUS_07140 214682 216280 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391192.1 protein_id gnl|my_center|LOCUS_07140 216515 216871 gene locus_tag LOCUS_07150 216515 216871 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971377.1 protein_id gnl|my_center|LOCUS_07150 216868 217773 gene locus_tag LOCUS_07160 gene nadC 216868 217773 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391199.1 protein_id gnl|my_center|LOCUS_07160 217843 218358 gene locus_tag LOCUS_07170 217843 218358 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129937.1 protein_id gnl|my_center|LOCUS_07170 219192 218362 gene locus_tag LOCUS_07180 219192 218362 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971360.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence04 <1 1143 gene locus_tag LOCUS_07190 <1 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526983.1:arginine deiminase 1160 2161 gene locus_tag LOCUS_07200 gene argF 1160 2161 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261198.1 protein_id gnl|my_center|LOCUS_07200 2163 3074 gene locus_tag LOCUS_07210 gene arcC 2163 3074 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100033.1 protein_id gnl|my_center|LOCUS_07210 3174 3995 gene locus_tag LOCUS_07220 3174 3995 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167391934.1 protein_id gnl|my_center|LOCUS_07220 4059 5132 gene locus_tag LOCUS_07230 4059 5132 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966136.1 protein_id gnl|my_center|LOCUS_07230 5129 7873 gene locus_tag LOCUS_07240 gene rbbA 5129 7873 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974059.1 protein_id gnl|my_center|LOCUS_07240 7873 8985 gene locus_tag LOCUS_07250 7873 8985 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974060.1 protein_id gnl|my_center|LOCUS_07250 9428 9126 gene locus_tag LOCUS_07260 9428 9126 CDS product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975656.1 protein_id gnl|my_center|LOCUS_07260 9786 9577 gene locus_tag LOCUS_07270 9786 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 10086 11741 gene locus_tag LOCUS_07280 10086 11741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 11734 12375 gene locus_tag LOCUS_07290 11734 12375 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_07290 12570 13580 gene locus_tag LOCUS_07300 12570 13580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 13822 14019 gene locus_tag LOCUS_07310 13822 14019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 14181 15905 gene locus_tag LOCUS_07320 14181 15905 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972752.1 protein_id gnl|my_center|LOCUS_07320 16103 16495 gene locus_tag LOCUS_07330 16103 16495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 18313 16565 gene locus_tag LOCUS_07340 18313 16565 CDS product sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970681.1 protein_id gnl|my_center|LOCUS_07340 23810 18324 gene locus_tag LOCUS_07350 23810 18324 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651396.1 protein_id gnl|my_center|LOCUS_07350 24206 25285 gene locus_tag LOCUS_07360 24206 25285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 25935 25321 gene locus_tag LOCUS_07370 25935 25321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 27714 26005 gene locus_tag LOCUS_07380 27714 26005 CDS product flotillin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087242.1 protein_id gnl|my_center|LOCUS_07380 28377 27721 gene locus_tag LOCUS_07390 28377 27721 CDS product DUF1449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087241.1 protein_id gnl|my_center|LOCUS_07390 29486 28377 gene locus_tag LOCUS_07400 29486 28377 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087240.1 protein_id gnl|my_center|LOCUS_07400 29696 29938 gene locus_tag LOCUS_07410 29696 29938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112307.1 protein_id gnl|my_center|LOCUS_07410 30078 33221 gene locus_tag LOCUS_07420 30078 33221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 34347 33268 gene locus_tag LOCUS_07430 34347 33268 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393081.1 protein_id gnl|my_center|LOCUS_07430 34478 35272 gene locus_tag LOCUS_07440 gene otsB 34478 35272 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329495.1 protein_id gnl|my_center|LOCUS_07440 36463 35330 gene locus_tag LOCUS_07450 36463 35330 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948743.1 protein_id gnl|my_center|LOCUS_07450 37638 36706 gene locus_tag LOCUS_07460 37638 36706 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969643.1 protein_id gnl|my_center|LOCUS_07460 38851 37649 gene locus_tag LOCUS_07470 38851 37649 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969644.1 protein_id gnl|my_center|LOCUS_07470 39712 38870 gene locus_tag LOCUS_07480 39712 38870 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969645.1 protein_id gnl|my_center|LOCUS_07480 40605 39709 gene locus_tag LOCUS_07490 40605 39709 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969646.1 protein_id gnl|my_center|LOCUS_07490 41916 40663 gene locus_tag LOCUS_07500 41916 40663 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969647.1 protein_id gnl|my_center|LOCUS_07500 42063 42917 gene locus_tag LOCUS_07510 42063 42917 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969648.1 protein_id gnl|my_center|LOCUS_07510 42937 43614 gene locus_tag LOCUS_07520 42937 43614 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018010902.1 protein_id gnl|my_center|LOCUS_07520 43792 45027 gene locus_tag LOCUS_07530 43792 45027 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 protein_id gnl|my_center|LOCUS_07530 45096 45968 gene locus_tag LOCUS_07540 45096 45968 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921339.1 protein_id gnl|my_center|LOCUS_07540 46977 46030 gene locus_tag LOCUS_07550 46977 46030 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 protein_id gnl|my_center|LOCUS_07550 47323 48294 gene locus_tag LOCUS_07560 gene rbsK 47323 48294 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706158.1 protein_id gnl|my_center|LOCUS_07560 48358 49455 gene locus_tag LOCUS_07570 48358 49455 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643541.1 protein_id gnl|my_center|LOCUS_07570 49604 50761 gene locus_tag LOCUS_07580 49604 50761 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480621.1 protein_id gnl|my_center|LOCUS_07580 50779 51588 gene locus_tag LOCUS_07590 50779 51588 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455010.1 protein_id gnl|my_center|LOCUS_07590 51637 52080 gene locus_tag LOCUS_07600 gene rbsD 51637 52080 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262034.1 protein_id gnl|my_center|LOCUS_07600 52080 52622 gene locus_tag LOCUS_07610 52080 52622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 52612 53694 gene locus_tag LOCUS_07620 52612 53694 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768050.1 protein_id gnl|my_center|LOCUS_07620 53747 54559 gene locus_tag LOCUS_07630 53747 54559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 55586 54777 gene locus_tag LOCUS_07640 55586 54777 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455010.1 protein_id gnl|my_center|LOCUS_07640 56868 55591 gene locus_tag LOCUS_07650 56868 55591 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113206.1 protein_id gnl|my_center|LOCUS_07650 57977 56847 gene locus_tag LOCUS_07660 57977 56847 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019995458.1 protein_id gnl|my_center|LOCUS_07660 59032 57989 gene locus_tag LOCUS_07670 59032 57989 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188909205.1 protein_id gnl|my_center|LOCUS_07670 60276 59236 gene locus_tag LOCUS_07680 60276 59236 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530581.1 protein_id gnl|my_center|LOCUS_07680 60820 61407 gene locus_tag LOCUS_07690 60820 61407 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970048.1 protein_id gnl|my_center|LOCUS_07690 61445 63073 gene locus_tag LOCUS_07700 61445 63073 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970047.1 protein_id gnl|my_center|LOCUS_07700 63077 63406 gene locus_tag LOCUS_07710 63077 63406 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970046.1 protein_id gnl|my_center|LOCUS_07710 63420 64256 gene locus_tag LOCUS_07720 63420 64256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970045.1 protein_id gnl|my_center|LOCUS_07720 64268 65131 gene locus_tag LOCUS_07730 64268 65131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970044.1 protein_id gnl|my_center|LOCUS_07730 65185 66219 gene locus_tag LOCUS_07740 65185 66219 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970043.1 protein_id gnl|my_center|LOCUS_07740 66372 67802 gene locus_tag LOCUS_07750 66372 67802 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970042.1 protein_id gnl|my_center|LOCUS_07750 68069 69310 gene locus_tag LOCUS_07760 68069 69310 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063810.1 protein_id gnl|my_center|LOCUS_07760 69397 69828 gene locus_tag LOCUS_07770 69397 69828 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529227.1 protein_id gnl|my_center|LOCUS_07770 69942 71129 gene locus_tag LOCUS_07780 69942 71129 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970063.1 protein_id gnl|my_center|LOCUS_07780 72637 71162 gene locus_tag LOCUS_07790 72637 71162 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112356.1 protein_id gnl|my_center|LOCUS_07790 72725 73300 gene locus_tag LOCUS_07800 72725 73300 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813206.1 protein_id gnl|my_center|LOCUS_07800 73666 73367 gene locus_tag LOCUS_07810 73666 73367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967267.1 protein_id gnl|my_center|LOCUS_07810 74583 73696 gene locus_tag LOCUS_07820 74583 73696 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967266.1 protein_id gnl|my_center|LOCUS_07820 75062 74580 gene locus_tag LOCUS_07830 75062 74580 CDS product gluconokinase, GntK/IdnK-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967265.1 protein_id gnl|my_center|LOCUS_07830 75840 75085 gene locus_tag LOCUS_07840 75840 75085 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970609.1 protein_id gnl|my_center|LOCUS_07840 76881 75850 gene locus_tag LOCUS_07850 76881 75850 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967263.1 protein_id gnl|my_center|LOCUS_07850 77839 76892 gene locus_tag LOCUS_07860 77839 76892 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967262.1 protein_id gnl|my_center|LOCUS_07860 78006 79502 gene locus_tag LOCUS_07870 78006 79502 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243748.1 protein_id gnl|my_center|LOCUS_07870 79520 80587 gene locus_tag LOCUS_07880 79520 80587 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613522.1 protein_id gnl|my_center|LOCUS_07880 80637 81737 gene locus_tag LOCUS_07890 80637 81737 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253048.1 protein_id gnl|my_center|LOCUS_07890 81867 82772 gene locus_tag LOCUS_07900 81867 82772 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402577.1 protein_id gnl|my_center|LOCUS_07900 82784 83203 gene locus_tag LOCUS_07910 82784 83203 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097137372.1 protein_id gnl|my_center|LOCUS_07910 83309 84319 gene locus_tag LOCUS_07920 83309 84319 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244179.1 protein_id gnl|my_center|LOCUS_07920 85155 84316 gene locus_tag LOCUS_07930 85155 84316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 85242 85886 gene locus_tag LOCUS_07940 85242 85886 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086152.1 protein_id gnl|my_center|LOCUS_07940 85925 86227 gene locus_tag LOCUS_07950 85925 86227 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087106.1 protein_id gnl|my_center|LOCUS_07950 87400 86234 gene locus_tag LOCUS_07960 gene argE 87400 86234 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530453.1 protein_id gnl|my_center|LOCUS_07960 88091 87414 gene locus_tag LOCUS_07970 88091 87414 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530450.1 protein_id gnl|my_center|LOCUS_07970 88526 88104 gene locus_tag LOCUS_07980 88526 88104 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877160.1 protein_id gnl|my_center|LOCUS_07980 89674 88658 gene locus_tag LOCUS_07990 89674 88658 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106178.1 protein_id gnl|my_center|LOCUS_07990 90502 89693 gene locus_tag LOCUS_08000 90502 89693 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106179.1 protein_id gnl|my_center|LOCUS_08000 91431 90499 gene locus_tag LOCUS_08010 91431 90499 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 protein_id gnl|my_center|LOCUS_08010 92519 91428 gene locus_tag LOCUS_08020 92519 91428 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529814.1 protein_id gnl|my_center|LOCUS_08020 94611 92530 gene locus_tag LOCUS_08030 94611 92530 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530454.1 protein_id gnl|my_center|LOCUS_08030 96395 94911 gene locus_tag LOCUS_08040 96395 94911 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530451.1 protein_id gnl|my_center|LOCUS_08040 97351 96392 gene locus_tag LOCUS_08050 97351 96392 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530452.1 protein_id gnl|my_center|LOCUS_08050 98351 97470 gene locus_tag LOCUS_08060 98351 97470 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975551.1 protein_id gnl|my_center|LOCUS_08060 98579 99553 gene locus_tag LOCUS_08070 98579 99553 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975550.1 protein_id gnl|my_center|LOCUS_08070 99558 100577 gene locus_tag LOCUS_08080 99558 100577 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975549.1 protein_id gnl|my_center|LOCUS_08080 100574 101608 gene locus_tag LOCUS_08090 100574 101608 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975548.1 protein_id gnl|my_center|LOCUS_08090 101617 102414 gene locus_tag LOCUS_08100 101617 102414 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975547.1 protein_id gnl|my_center|LOCUS_08100 103084 102386 gene locus_tag LOCUS_08110 103084 102386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 103972 103211 gene locus_tag LOCUS_08120 103972 103211 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062685931.1 protein_id gnl|my_center|LOCUS_08120 104886 103972 gene locus_tag LOCUS_08130 104886 103972 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973851.1 protein_id gnl|my_center|LOCUS_08130 106392 104896 gene locus_tag LOCUS_08140 106392 104896 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015726.1 protein_id gnl|my_center|LOCUS_08140 107200 106403 gene locus_tag LOCUS_08150 107200 106403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 107917 109146 gene locus_tag LOCUS_08160 107917 109146 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528000.1 protein_id gnl|my_center|LOCUS_08160 109536 111887 gene locus_tag LOCUS_08170 gene metE 109536 111887 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216166.1 protein_id gnl|my_center|LOCUS_08170 111911 112702 gene locus_tag LOCUS_08180 111911 112702 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973351.1 protein_id gnl|my_center|LOCUS_08180 113194 113415 gene locus_tag LOCUS_08190 gene nrdH 113194 113415 CDS product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970634.1 protein_id gnl|my_center|LOCUS_08190 113425 113823 gene locus_tag LOCUS_08200 gene nrdI 113425 113823 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309893.1 protein_id gnl|my_center|LOCUS_08200 113820 115967 gene locus_tag LOCUS_08210 gene nrdE 113820 115967 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651373.1 protein_id gnl|my_center|LOCUS_08210 116147 117136 gene locus_tag LOCUS_08220 gene nrdF 116147 117136 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970636.1 protein_id gnl|my_center|LOCUS_08220 117796 117167 gene locus_tag LOCUS_08230 117796 117167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 118584 117901 gene locus_tag LOCUS_08240 118584 117901 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013653842.1 protein_id gnl|my_center|LOCUS_08240 119641 118607 gene locus_tag LOCUS_08250 119641 118607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 120431 119634 gene locus_tag LOCUS_08260 120431 119634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_08260 121429 120428 gene locus_tag LOCUS_08270 121429 120428 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_08270 122274 121426 gene locus_tag LOCUS_08280 122274 121426 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388248.1 protein_id gnl|my_center|LOCUS_08280 124193 122274 gene locus_tag LOCUS_08290 124193 122274 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 protein_id gnl|my_center|LOCUS_08290 125455 124949 gene locus_tag LOCUS_08300 125455 124949 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976217.1 protein_id gnl|my_center|LOCUS_08300 125940 125452 gene locus_tag LOCUS_08310 125940 125452 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976218.1 protein_id gnl|my_center|LOCUS_08310 127119 126037 gene locus_tag LOCUS_08320 127119 126037 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968052.1 protein_id gnl|my_center|LOCUS_08320 127814 127164 gene locus_tag LOCUS_08330 127814 127164 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 protein_id gnl|my_center|LOCUS_08330 128079 129155 gene locus_tag LOCUS_08340 128079 129155 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968050.1 protein_id gnl|my_center|LOCUS_08340 129215 130708 gene locus_tag LOCUS_08350 129215 130708 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968049.1 protein_id gnl|my_center|LOCUS_08350 130713 131699 gene locus_tag LOCUS_08360 130713 131699 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968048.1 protein_id gnl|my_center|LOCUS_08360 131696 132652 gene locus_tag LOCUS_08370 131696 132652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968047.1 protein_id gnl|my_center|LOCUS_08370 132685 133341 gene locus_tag LOCUS_08380 132685 133341 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968046.1 protein_id gnl|my_center|LOCUS_08380 133566 134879 gene locus_tag LOCUS_08390 133566 134879 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967760.1 protein_id gnl|my_center|LOCUS_08390 135120 136082 gene locus_tag LOCUS_08400 135120 136082 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529350.1 protein_id gnl|my_center|LOCUS_08400 137367 136132 gene locus_tag LOCUS_08410 137367 136132 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530448.1 protein_id gnl|my_center|LOCUS_08410 137930 138997 gene locus_tag LOCUS_08420 137930 138997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140151.1 protein_id gnl|my_center|LOCUS_08420 138994 139866 gene locus_tag LOCUS_08430 138994 139866 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 protein_id gnl|my_center|LOCUS_08430 139863 140636 gene locus_tag LOCUS_08440 139863 140636 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112952.1 protein_id gnl|my_center|LOCUS_08440 140652 141701 gene locus_tag LOCUS_08450 140652 141701 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084365.1 protein_id gnl|my_center|LOCUS_08450 142998 141748 gene locus_tag LOCUS_08460 142998 141748 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976223.1 protein_id gnl|my_center|LOCUS_08460 144156 143026 gene locus_tag LOCUS_08470 gene alr 144156 143026 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332653.1 protein_id gnl|my_center|LOCUS_08470 144282 144746 gene locus_tag LOCUS_08480 144282 144746 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332654.1 protein_id gnl|my_center|LOCUS_08480 145511 144762 gene locus_tag LOCUS_08490 145511 144762 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392302.1 protein_id gnl|my_center|LOCUS_08490 145782 147233 gene locus_tag LOCUS_08500 145782 147233 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392306.1 protein_id gnl|my_center|LOCUS_08500 147280 148758 gene locus_tag LOCUS_08510 147280 148758 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392319.1 protein_id gnl|my_center|LOCUS_08510 150312 148900 gene locus_tag LOCUS_08520 150312 148900 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392280.1 protein_id gnl|my_center|LOCUS_08520 150894 152150 gene locus_tag LOCUS_08530 150894 152150 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392300.1 protein_id gnl|my_center|LOCUS_08530 152147 152800 gene locus_tag LOCUS_08540 152147 152800 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392298.1 protein_id gnl|my_center|LOCUS_08540 152812 154176 gene locus_tag LOCUS_08550 152812 154176 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160984.1 protein_id gnl|my_center|LOCUS_08550 154173 155456 gene locus_tag LOCUS_08560 154173 155456 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004110720.1 protein_id gnl|my_center|LOCUS_08560 155461 156450 gene locus_tag LOCUS_08570 155461 156450 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392294.1 protein_id gnl|my_center|LOCUS_08570 157471 156461 gene locus_tag LOCUS_08580 157471 156461 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820327.1 protein_id gnl|my_center|LOCUS_08580 157715 159916 gene locus_tag LOCUS_08590 157715 159916 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103467.1 protein_id gnl|my_center|LOCUS_08590 159958 161058 gene locus_tag LOCUS_08600 gene yiuA 159958 161058 CDS product iron-siderophore ABC transporter substrate-binding protein YiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 protein_id gnl|my_center|LOCUS_08600 161068 162147 gene locus_tag LOCUS_08610 161068 162147 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530811.1 protein_id gnl|my_center|LOCUS_08610 162518 162709 gene locus_tag LOCUS_08620 gene napE 162518 162709 CDS product periplasmic nitrate reductase, NapE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967656.1 protein_id gnl|my_center|LOCUS_08620 162720 163220 gene locus_tag LOCUS_08630 gene napF 162720 163220 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973820.1 protein_id gnl|my_center|LOCUS_08630 163213 163497 gene locus_tag LOCUS_08640 163213 163497 CDS product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973821.1 protein_id gnl|my_center|LOCUS_08640 163472 165976 gene locus_tag LOCUS_08650 gene napA 163472 165976 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973822.1 protein_id gnl|my_center|LOCUS_08650 166012 166437 gene locus_tag LOCUS_08660 166012 166437 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973823.1 protein_id gnl|my_center|LOCUS_08660 166437 167144 gene locus_tag LOCUS_08670 166437 167144 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327940.1 protein_id gnl|my_center|LOCUS_08670 167911 167162 gene locus_tag LOCUS_08680 167911 167162 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975570.1 protein_id gnl|my_center|LOCUS_08680 169042 168074 gene locus_tag LOCUS_08690 gene yjfF 169042 168074 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397815.1 protein_id gnl|my_center|LOCUS_08690 170064 169039 gene locus_tag LOCUS_08700 170064 169039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242089.1 protein_id gnl|my_center|LOCUS_08700 171581 170061 gene locus_tag LOCUS_08710 171581 170061 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975871.1 protein_id gnl|my_center|LOCUS_08710 172649 171687 gene locus_tag LOCUS_08720 172649 171687 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975870.1 protein_id gnl|my_center|LOCUS_08720 173915 173232 gene locus_tag LOCUS_08730 173915 173232 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311027.1 protein_id gnl|my_center|LOCUS_08730 174121 175155 gene locus_tag LOCUS_08740 174121 175155 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976261.1 protein_id gnl|my_center|LOCUS_08740 175226 176218 gene locus_tag LOCUS_08750 175226 176218 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392079.1 protein_id gnl|my_center|LOCUS_08750 176283 176783 gene locus_tag LOCUS_08760 176283 176783 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033042400.1 protein_id gnl|my_center|LOCUS_08760 176817 178355 gene locus_tag LOCUS_08770 176817 178355 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536884.1 protein_id gnl|my_center|LOCUS_08770 178395 179333 gene locus_tag LOCUS_08780 178395 179333 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976259.1 protein_id gnl|my_center|LOCUS_08780 179369 181069 gene locus_tag LOCUS_08790 179369 181069 CDS product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976258.1 protein_id gnl|my_center|LOCUS_08790 182409 181147 gene locus_tag LOCUS_08800 182409 181147 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389047.1 protein_id gnl|my_center|LOCUS_08800 183092 182406 gene locus_tag LOCUS_08810 183092 182406 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389046.1 protein_id gnl|my_center|LOCUS_08810 183559 183095 gene locus_tag LOCUS_08820 183559 183095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389045.1 protein_id gnl|my_center|LOCUS_08820 185386 183632 gene locus_tag LOCUS_08830 185386 183632 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389044.1 protein_id gnl|my_center|LOCUS_08830 186110 185484 gene locus_tag LOCUS_08840 186110 185484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088355.1 protein_id gnl|my_center|LOCUS_08840 187348 186236 gene locus_tag LOCUS_08850 187348 186236 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113368.1 protein_id gnl|my_center|LOCUS_08850 187469 187657 gene locus_tag LOCUS_08860 187469 187657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 188749 187838 gene locus_tag LOCUS_08870 188749 187838 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243788.1 protein_id gnl|my_center|LOCUS_08870 188924 190024 gene locus_tag LOCUS_08880 188924 190024 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808748.1 protein_id gnl|my_center|LOCUS_08880 190164 192185 gene locus_tag LOCUS_08890 190164 192185 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395919.1 protein_id gnl|my_center|LOCUS_08890 192347 193384 gene locus_tag LOCUS_08900 192347 193384 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243787.1 protein_id gnl|my_center|LOCUS_08900 193421 194479 gene locus_tag LOCUS_08910 193421 194479 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139076345.1 protein_id gnl|my_center|LOCUS_08910 195046 194552 gene locus_tag LOCUS_08920 gene rraA 195046 194552 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948542.1 protein_id gnl|my_center|LOCUS_08920 196020 195043 gene locus_tag LOCUS_08930 196020 195043 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064892.1 protein_id gnl|my_center|LOCUS_08930 197109 196024 gene locus_tag LOCUS_08940 197109 196024 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137395785.1 protein_id gnl|my_center|LOCUS_08940 198115 197219 gene locus_tag LOCUS_08950 198115 197219 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083249.1 protein_id gnl|my_center|LOCUS_08950 198395 198033 gene locus_tag LOCUS_08960 198395 198033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 199521 198409 gene locus_tag LOCUS_08970 199521 198409 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538073.1 protein_id gnl|my_center|LOCUS_08970 199637 200293 gene locus_tag LOCUS_08980 199637 200293 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966590.1 protein_id gnl|my_center|LOCUS_08980 201723 200326 gene locus_tag LOCUS_08990 201723 200326 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965744.1 protein_id gnl|my_center|LOCUS_08990 202874 201720 gene locus_tag LOCUS_09000 gene prpF 202874 201720 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036236.1 protein_id gnl|my_center|LOCUS_09000 203641 202904 gene locus_tag LOCUS_09010 203641 202904 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090163.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence05 530 1003 gene locus_tag LOCUS_09020 gene ybaK 530 1003 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067704.1 protein_id gnl|my_center|LOCUS_09020 1072 2325 gene locus_tag LOCUS_09030 1072 2325 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968487.1 protein_id gnl|my_center|LOCUS_09030 2322 3110 gene locus_tag LOCUS_09040 2322 3110 CDS product pyrroline-5-carboxylate reductase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384670.1 protein_id gnl|my_center|LOCUS_09040 3975 3061 gene locus_tag LOCUS_09050 3975 3061 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161951947.1 protein_id gnl|my_center|LOCUS_09050 4059 4541 gene locus_tag LOCUS_09060 4059 4541 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968485.1 protein_id gnl|my_center|LOCUS_09060 5191 4601 gene locus_tag LOCUS_09070 5191 4601 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067696.1 protein_id gnl|my_center|LOCUS_09070 6785 5199 gene locus_tag LOCUS_09080 gene xseA 6785 5199 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067695.1 protein_id gnl|my_center|LOCUS_09080 8624 6867 gene locus_tag LOCUS_09090 8624 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 8810 9799 gene locus_tag LOCUS_09100 8810 9799 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_09100 9817 10524 gene locus_tag LOCUS_09110 9817 10524 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545096.1 protein_id gnl|my_center|LOCUS_09110 10521 10886 gene locus_tag LOCUS_09120 10521 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 11662 10889 gene locus_tag LOCUS_09130 11662 10889 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067694.1 protein_id gnl|my_center|LOCUS_09130 11790 12200 gene locus_tag LOCUS_09140 11790 12200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 12354 13379 gene locus_tag LOCUS_09150 12354 13379 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398799.1 protein_id gnl|my_center|LOCUS_09150 13533 14438 gene locus_tag LOCUS_09160 13533 14438 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929952.1 protein_id gnl|my_center|LOCUS_09160 14512 15177 gene locus_tag LOCUS_09170 14512 15177 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330705.1 protein_id gnl|my_center|LOCUS_09170 16029 15205 gene locus_tag LOCUS_09180 16029 15205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 protein_id gnl|my_center|LOCUS_09180 16251 17234 gene locus_tag LOCUS_09190 16251 17234 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968471.1 protein_id gnl|my_center|LOCUS_09190 19921 17495 gene locus_tag LOCUS_09200 gene pheT 19921 17495 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968474.1 protein_id gnl|my_center|LOCUS_09200 21029 19944 gene locus_tag LOCUS_09210 gene pheS 21029 19944 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435478.1 protein_id gnl|my_center|LOCUS_09210 21885 21022 gene locus_tag LOCUS_09220 21885 21022 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970767.1 protein_id gnl|my_center|LOCUS_09220 22390 21986 gene locus_tag LOCUS_09230 gene rplT 22390 21986 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067682.1 protein_id gnl|my_center|LOCUS_09230 22633 22430 gene locus_tag LOCUS_09240 gene rpmI 22633 22430 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710090.1 protein_id gnl|my_center|LOCUS_09240 23522 22851 gene locus_tag LOCUS_09250 gene infC 23522 22851 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909774.1 protein_id gnl|my_center|LOCUS_09250 23620 24438 gene locus_tag LOCUS_09260 23620 24438 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970765.1 protein_id gnl|my_center|LOCUS_09260 24646 25164 gene locus_tag LOCUS_09270 24646 25164 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310099.1 protein_id gnl|my_center|LOCUS_09270 25775 25239 gene locus_tag LOCUS_09280 25775 25239 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398796.1 protein_id gnl|my_center|LOCUS_09280 26374 25790 gene locus_tag LOCUS_09290 26374 25790 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047143.1 protein_id gnl|my_center|LOCUS_09290 26509 27759 gene locus_tag LOCUS_09300 26509 27759 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241670.1 protein_id gnl|my_center|LOCUS_09300 27821 29653 gene locus_tag LOCUS_09310 gene lepA 27821 29653 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173515202.1 protein_id gnl|my_center|LOCUS_09310 31215 30499 gene locus_tag LOCUS_09320 31215 30499 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501624.1 protein_id gnl|my_center|LOCUS_09320 31259 32689 gene locus_tag LOCUS_09330 31259 32689 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530751.1 protein_id gnl|my_center|LOCUS_09330 33467 32703 gene locus_tag LOCUS_09340 33467 32703 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310073.1 protein_id gnl|my_center|LOCUS_09340 33732 33556 gene locus_tag LOCUS_09350 33732 33556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 34257 33829 gene locus_tag LOCUS_09360 34257 33829 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968602.1 protein_id gnl|my_center|LOCUS_09360 35487 34258 gene locus_tag LOCUS_09370 35487 34258 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970632.1 protein_id gnl|my_center|LOCUS_09370 35776 36801 gene locus_tag LOCUS_09380 35776 36801 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531511.1 protein_id gnl|my_center|LOCUS_09380 37062 38171 gene locus_tag LOCUS_09390 37062 38171 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309889.1 protein_id gnl|my_center|LOCUS_09390 38171 38950 gene locus_tag LOCUS_09400 38171 38950 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391834.1 protein_id gnl|my_center|LOCUS_09400 38947 39570 gene locus_tag LOCUS_09410 38947 39570 CDS product nucleoside triphosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970633.1 protein_id gnl|my_center|LOCUS_09410 39693 40733 gene locus_tag LOCUS_09420 gene pyrC 39693 40733 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970870.1 protein_id gnl|my_center|LOCUS_09420 41553 40792 gene locus_tag LOCUS_09430 41553 40792 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311539.1 protein_id gnl|my_center|LOCUS_09430 41721 42140 gene locus_tag LOCUS_09440 41721 42140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 42580 42131 gene locus_tag LOCUS_09450 42580 42131 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968461.1 protein_id gnl|my_center|LOCUS_09450 42759 43061 gene locus_tag LOCUS_09460 42759 43061 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067663.1 protein_id gnl|my_center|LOCUS_09460 43443 43102 gene locus_tag LOCUS_09470 43443 43102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 43606 45036 gene locus_tag LOCUS_09480 43606 45036 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049733735.1 protein_id gnl|my_center|LOCUS_09480 45173 45257 gene locus_tag LOCUS_t00040 45173 45257 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45369 46172 gene locus_tag LOCUS_09490 45369 46172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 46209 48449 gene locus_tag LOCUS_09500 46209 48449 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388583.1 protein_id gnl|my_center|LOCUS_09500 48509 49177 gene locus_tag LOCUS_09510 gene cas5c 48509 49177 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384678.1 protein_id gnl|my_center|LOCUS_09510 49174 50943 gene locus_tag LOCUS_09520 gene cas8c 49174 50943 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384679.1 protein_id gnl|my_center|LOCUS_09520 50940 51890 gene locus_tag LOCUS_09530 gene cas7c 50940 51890 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384680.1 protein_id gnl|my_center|LOCUS_09530 53231 52194 gene locus_tag LOCUS_09540 53231 52194 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973989.1 protein_id gnl|my_center|LOCUS_09540 53512 53243 gene locus_tag LOCUS_09550 53512 53243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 53792 53607 gene locus_tag LOCUS_09560 53792 53607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 54100 55005 gene locus_tag LOCUS_09570 54100 55005 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973990.1 protein_id gnl|my_center|LOCUS_09570 55494 55015 gene locus_tag LOCUS_09580 55494 55015 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165023455.1 protein_id gnl|my_center|LOCUS_09580 55976 55533 gene locus_tag LOCUS_09590 55976 55533 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970037.1 protein_id gnl|my_center|LOCUS_09590 57291 56140 gene locus_tag LOCUS_09600 57291 56140 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063665.1 protein_id gnl|my_center|LOCUS_09600 57415 58386 gene locus_tag LOCUS_09610 57415 58386 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529113.1 protein_id gnl|my_center|LOCUS_09610 58791 58426 gene locus_tag LOCUS_09620 58791 58426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 58793 59938 gene locus_tag LOCUS_09630 58793 59938 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970244.1 protein_id gnl|my_center|LOCUS_09630 60028 61383 gene locus_tag LOCUS_09640 gene gdhA 60028 61383 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967123.1 protein_id gnl|my_center|LOCUS_09640 61925 61401 gene locus_tag LOCUS_09650 61925 61401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 62512 62087 gene locus_tag LOCUS_09660 gene rnk 62512 62087 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067665.1 protein_id gnl|my_center|LOCUS_09660 62874 62509 gene locus_tag LOCUS_09670 62874 62509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 62873 63508 gene locus_tag LOCUS_09680 62873 63508 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921398.1 protein_id gnl|my_center|LOCUS_09680 63480 63827 gene locus_tag LOCUS_09690 63480 63827 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188847581.1 protein_id gnl|my_center|LOCUS_09690 63947 65113 gene locus_tag LOCUS_09700 gene metB 63947 65113 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844963.1 protein_id gnl|my_center|LOCUS_09700 65171 65884 gene locus_tag LOCUS_09710 65171 65884 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536308.1 protein_id gnl|my_center|LOCUS_09710 67125 65848 gene locus_tag LOCUS_09720 67125 65848 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531179.1 protein_id gnl|my_center|LOCUS_09720 67811 67122 gene locus_tag LOCUS_09730 67811 67122 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531178.1 protein_id gnl|my_center|LOCUS_09730 69040 68009 gene locus_tag LOCUS_09740 69040 68009 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114965.1 protein_id gnl|my_center|LOCUS_09740 69197 69898 gene locus_tag LOCUS_09750 69197 69898 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114953.1 protein_id gnl|my_center|LOCUS_09750 72044 70008 gene locus_tag LOCUS_09760 72044 70008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 72200 72925 gene locus_tag LOCUS_09770 72200 72925 CDS product sulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533444.1 protein_id gnl|my_center|LOCUS_09770 73333 72908 gene locus_tag LOCUS_09780 73333 72908 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530166.1 protein_id gnl|my_center|LOCUS_09780 73473 74048 gene locus_tag LOCUS_09790 73473 74048 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968400.1 protein_id gnl|my_center|LOCUS_09790 74793 74038 gene locus_tag LOCUS_09800 gene nth 74793 74038 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973867.1 protein_id gnl|my_center|LOCUS_09800 74869 75369 gene locus_tag LOCUS_09810 74869 75369 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398290.1 protein_id gnl|my_center|LOCUS_09810 75493 76365 gene locus_tag LOCUS_09820 75493 76365 CDS product bifunctional helix-turn-helix domain-containing protein/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531939.1 protein_id gnl|my_center|LOCUS_09820 77185 76550 gene locus_tag LOCUS_09830 77185 76550 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531941.1 protein_id gnl|my_center|LOCUS_09830 78086 77268 gene locus_tag LOCUS_09840 gene dapB 78086 77268 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398299.1 protein_id gnl|my_center|LOCUS_09840 79962 78166 gene locus_tag LOCUS_09850 79962 78166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398302.1 protein_id gnl|my_center|LOCUS_09850 81108 80083 gene locus_tag LOCUS_09860 81108 80083 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968393.1 protein_id gnl|my_center|LOCUS_09860 81539 81159 gene locus_tag LOCUS_09870 81539 81159 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390623.1 protein_id gnl|my_center|LOCUS_09870 82851 81796 gene locus_tag LOCUS_09880 gene mepA 82851 81796 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968392.1 protein_id gnl|my_center|LOCUS_09880 83049 84899 gene locus_tag LOCUS_09890 83049 84899 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531957.1 protein_id gnl|my_center|LOCUS_09890 85052 86131 gene locus_tag LOCUS_09900 85052 86131 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330521.1 protein_id gnl|my_center|LOCUS_09900 86131 87270 gene locus_tag LOCUS_09910 86131 87270 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241780.1 protein_id gnl|my_center|LOCUS_09910 87267 88901 gene locus_tag LOCUS_09920 87267 88901 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330519.1 protein_id gnl|my_center|LOCUS_09920 88972 89931 gene locus_tag LOCUS_09930 88972 89931 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067564.1 protein_id gnl|my_center|LOCUS_09930 90835 89969 gene locus_tag LOCUS_09940 90835 89969 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311310.1 protein_id gnl|my_center|LOCUS_09940 91221 90871 gene locus_tag LOCUS_09950 91221 90871 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014766585.1 protein_id gnl|my_center|LOCUS_09950 92681 91290 gene locus_tag LOCUS_09960 92681 91290 CDS product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067561.1 protein_id gnl|my_center|LOCUS_09960 92895 93632 gene locus_tag LOCUS_09970 92895 93632 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330514.1 protein_id gnl|my_center|LOCUS_09970 94750 93767 gene locus_tag LOCUS_09980 94750 93767 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968386.1 protein_id gnl|my_center|LOCUS_09980 95772 94762 gene locus_tag LOCUS_09990 95772 94762 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968385.1 protein_id gnl|my_center|LOCUS_09990 97254 95782 gene locus_tag LOCUS_10000 97254 95782 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398328.1 protein_id gnl|my_center|LOCUS_10000 98580 97291 gene locus_tag LOCUS_10010 98580 97291 CDS product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398331.1 protein_id gnl|my_center|LOCUS_10010 99353 98637 gene locus_tag LOCUS_10020 99353 98637 CDS product CpaD family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241792.1 protein_id gnl|my_center|LOCUS_10020 100912 99365 gene locus_tag LOCUS_10030 100912 99365 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968381.1 protein_id gnl|my_center|LOCUS_10030 101732 100926 gene locus_tag LOCUS_10040 gene cpaB 101732 100926 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968380.1 protein_id gnl|my_center|LOCUS_10040 102426 101923 gene locus_tag LOCUS_10050 102426 101923 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255090.1 protein_id gnl|my_center|LOCUS_10050 102726 102547 gene locus_tag LOCUS_10060 102726 102547 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209602232.1 protein_id gnl|my_center|LOCUS_10060 103049 103462 gene locus_tag LOCUS_10070 103049 103462 CDS product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536154.1 protein_id gnl|my_center|LOCUS_10070 103587 104189 gene locus_tag LOCUS_10080 103587 104189 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398349.1 protein_id gnl|my_center|LOCUS_10080 104189 104800 gene locus_tag LOCUS_10090 104189 104800 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255094.1 protein_id gnl|my_center|LOCUS_10090 104899 106128 gene locus_tag LOCUS_10100 104899 106128 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968375.1 protein_id gnl|my_center|LOCUS_10100 106125 107093 gene locus_tag LOCUS_10110 106125 107093 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067546.1 protein_id gnl|my_center|LOCUS_10110 107199 107828 gene locus_tag LOCUS_10120 gene upp 107199 107828 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536149.1 protein_id gnl|my_center|LOCUS_10120 108095 108631 gene locus_tag LOCUS_10130 108095 108631 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398365.1 protein_id gnl|my_center|LOCUS_10130 109934 108621 gene locus_tag LOCUS_10140 gene deoA 109934 108621 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067544.1 protein_id gnl|my_center|LOCUS_10140 110709 109936 gene locus_tag LOCUS_10150 gene deoC 110709 109936 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309955.1 protein_id gnl|my_center|LOCUS_10150 111514 110702 gene locus_tag LOCUS_10160 111514 110702 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398371.1 protein_id gnl|my_center|LOCUS_10160 111903 111511 gene locus_tag LOCUS_10170 111903 111511 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970669.1 protein_id gnl|my_center|LOCUS_10170 112877 111906 gene locus_tag LOCUS_10180 112877 111906 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255101.1 protein_id gnl|my_center|LOCUS_10180 114016 112883 gene locus_tag LOCUS_10190 114016 112883 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968370.1 protein_id gnl|my_center|LOCUS_10190 115548 114013 gene locus_tag LOCUS_10200 115548 114013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067539.1 protein_id gnl|my_center|LOCUS_10200 115704 115934 gene locus_tag LOCUS_10210 115704 115934 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970665.1 protein_id gnl|my_center|LOCUS_10210 117033 116041 gene locus_tag LOCUS_10220 117033 116041 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968424.1 protein_id gnl|my_center|LOCUS_10220 117901 117251 gene locus_tag LOCUS_10230 gene msrA 117901 117251 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968425.1 protein_id gnl|my_center|LOCUS_10230 118304 117984 gene locus_tag LOCUS_10240 118304 117984 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067620.1 protein_id gnl|my_center|LOCUS_10240 118539 118628 gene locus_tag LOCUS_t00050 118539 118628 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 120426 118744 gene locus_tag LOCUS_10250 120426 118744 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975159.1 protein_id gnl|my_center|LOCUS_10250 121884 120631 gene locus_tag LOCUS_10260 121884 120631 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975157.1 protein_id gnl|my_center|LOCUS_10260 122611 121889 gene locus_tag LOCUS_10270 122611 121889 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975156.1 protein_id gnl|my_center|LOCUS_10270 123254 122604 gene locus_tag LOCUS_10280 123254 122604 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528591.1 protein_id gnl|my_center|LOCUS_10280 123932 123267 gene locus_tag LOCUS_10290 123932 123267 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975155.1 protein_id gnl|my_center|LOCUS_10290 124807 123998 gene locus_tag LOCUS_10300 124807 123998 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969502.1 protein_id gnl|my_center|LOCUS_10300 126503 124986 gene locus_tag LOCUS_10310 126503 124986 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975153.1 protein_id gnl|my_center|LOCUS_10310 126653 127690 gene locus_tag LOCUS_10320 126653 127690 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969504.1 protein_id gnl|my_center|LOCUS_10320 128931 127969 gene locus_tag LOCUS_10330 128931 127969 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974065.1 protein_id gnl|my_center|LOCUS_10330 129758 129054 gene locus_tag LOCUS_10340 129758 129054 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969508.1 protein_id gnl|my_center|LOCUS_10340 131049 129988 gene locus_tag LOCUS_10350 131049 129988 CDS product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968467.1 protein_id gnl|my_center|LOCUS_10350 132101 131046 gene locus_tag LOCUS_10360 gene epmA 132101 131046 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330707.1 protein_id gnl|my_center|LOCUS_10360 132263 132832 gene locus_tag LOCUS_10370 gene efp 132263 132832 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067676.1 protein_id gnl|my_center|LOCUS_10370 133111 134103 gene locus_tag LOCUS_10380 133111 134103 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241768.1 protein_id gnl|my_center|LOCUS_10380 134635 134096 gene locus_tag LOCUS_10390 134635 134096 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014529993.1 protein_id gnl|my_center|LOCUS_10390 134555 134785 gene locus_tag LOCUS_10400 134555 134785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 134816 135820 gene locus_tag LOCUS_10410 134816 135820 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311306.1 protein_id gnl|my_center|LOCUS_10410 136775 136002 gene locus_tag LOCUS_10420 136775 136002 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255075.1 protein_id gnl|my_center|LOCUS_10420 137896 136772 gene locus_tag LOCUS_10430 gene recF 137896 136772 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234781892.1 protein_id gnl|my_center|LOCUS_10430 138288 138962 gene locus_tag LOCUS_10440 138288 138962 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529016.1 protein_id gnl|my_center|LOCUS_10440 140274 139144 gene locus_tag LOCUS_10450 gene dnaJ 140274 139144 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309945.1 protein_id gnl|my_center|LOCUS_10450 142432 140516 gene locus_tag LOCUS_10460 gene dnaK 142432 140516 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241760.1 protein_id gnl|my_center|LOCUS_10460 143232 143600 gene locus_tag LOCUS_10470 143232 143600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 143950 144126 gene locus_tag LOCUS_10480 143950 144126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 146253 144136 gene locus_tag LOCUS_10490 146253 144136 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241759.1 protein_id gnl|my_center|LOCUS_10490 146987 146559 gene locus_tag LOCUS_10500 146987 146559 CDS product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969615.1 protein_id gnl|my_center|LOCUS_10500 148036 147089 gene locus_tag LOCUS_10510 148036 147089 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531919.1 protein_id gnl|my_center|LOCUS_10510 147984 148172 gene locus_tag LOCUS_10520 147984 148172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 149624 148233 gene locus_tag LOCUS_10530 149624 148233 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968407.1 protein_id gnl|my_center|LOCUS_10530 150182 149742 gene locus_tag LOCUS_10540 150182 149742 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398241.1 protein_id gnl|my_center|LOCUS_10540 150616 153603 gene locus_tag LOCUS_10550 gene polA 150616 153603 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398238.1 protein_id gnl|my_center|LOCUS_10550 155583 153778 gene locus_tag LOCUS_10560 155583 153778 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_10560 155899 156900 gene locus_tag LOCUS_10570 155899 156900 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035286.1 protein_id gnl|my_center|LOCUS_10570 157189 157001 gene locus_tag LOCUS_10580 157189 157001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 157343 157924 gene locus_tag LOCUS_10590 157343 157924 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313743.1 protein_id gnl|my_center|LOCUS_10590 158233 158892 gene locus_tag LOCUS_10600 158233 158892 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331493.1 protein_id gnl|my_center|LOCUS_10600 160020 159034 gene locus_tag LOCUS_10610 160020 159034 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435452.1 protein_id gnl|my_center|LOCUS_10610 160281 161231 gene locus_tag LOCUS_10620 160281 161231 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397288.1 protein_id gnl|my_center|LOCUS_10620 161235 161678 gene locus_tag LOCUS_10630 161235 161678 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970772.1 protein_id gnl|my_center|LOCUS_10630 162590 161700 gene locus_tag LOCUS_10640 162590 161700 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970771.1 protein_id gnl|my_center|LOCUS_10640 162743 163741 gene locus_tag LOCUS_10650 162743 163741 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970770.1 protein_id gnl|my_center|LOCUS_10650 165198 163930 gene locus_tag LOCUS_10660 165198 163930 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969938.1 protein_id gnl|my_center|LOCUS_10660 166330 165446 gene locus_tag LOCUS_10670 166330 165446 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969937.1 protein_id gnl|my_center|LOCUS_10670 167153 166374 gene locus_tag LOCUS_10680 gene hyi 167153 166374 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976204.1 protein_id gnl|my_center|LOCUS_10680 168957 167173 gene locus_tag LOCUS_10690 gene gcl 168957 167173 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969935.1 protein_id gnl|my_center|LOCUS_10690 169223 170044 gene locus_tag LOCUS_10700 169223 170044 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392225.1 protein_id gnl|my_center|LOCUS_10700 171568 170228 gene locus_tag LOCUS_10710 gene guaD 171568 170228 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242239.1 protein_id gnl|my_center|LOCUS_10710 172806 171565 gene locus_tag LOCUS_10720 172806 171565 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061555.1 protein_id gnl|my_center|LOCUS_10720 172948 173913 gene locus_tag LOCUS_10730 172948 173913 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061554.1 protein_id gnl|my_center|LOCUS_10730 173939 174205 gene locus_tag LOCUS_10740 173939 174205 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370228.1 protein_id gnl|my_center|LOCUS_10740 174205 174633 gene locus_tag LOCUS_10750 174205 174633 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_10750 175485 174640 gene locus_tag LOCUS_10760 gene xdhC 175485 174640 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391572.1 protein_id gnl|my_center|LOCUS_10760 177900 175534 gene locus_tag LOCUS_10770 gene xdhB 177900 175534 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528240.1 protein_id gnl|my_center|LOCUS_10770 179388 177904 gene locus_tag LOCUS_10780 gene xdhA 179388 177904 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528241.1 protein_id gnl|my_center|LOCUS_10780 179757 179392 gene locus_tag LOCUS_10790 gene uraH 179757 179392 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061550.1 protein_id gnl|my_center|LOCUS_10790 179920 181338 gene locus_tag LOCUS_10800 gene puuE 179920 181338 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975644.1 protein_id gnl|my_center|LOCUS_10800 181349 182365 gene locus_tag LOCUS_10810 gene alc 181349 182365 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975643.1 protein_id gnl|my_center|LOCUS_10810 182419 182847 gene locus_tag LOCUS_10820 182419 182847 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392232.1 protein_id gnl|my_center|LOCUS_10820 182945 183556 gene locus_tag LOCUS_10830 182945 183556 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742088.1 protein_id gnl|my_center|LOCUS_10830 183582 184337 gene locus_tag LOCUS_10840 183582 184337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 185687 184395 gene locus_tag LOCUS_10850 185687 184395 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527246.1 protein_id gnl|my_center|LOCUS_10850 186538 186080 gene locus_tag LOCUS_10860 186538 186080 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532225.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence06 512 805 gene locus_tag LOCUS_10870 512 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 839 1717 gene locus_tag LOCUS_10880 gene dapA 839 1717 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401366.1 protein_id gnl|my_center|LOCUS_10880 1781 3013 gene locus_tag LOCUS_10890 1781 3013 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401363.1 protein_id gnl|my_center|LOCUS_10890 3050 4519 gene locus_tag LOCUS_10900 3050 4519 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401360.1 protein_id gnl|my_center|LOCUS_10900 4516 5547 gene locus_tag LOCUS_10910 4516 5547 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401358.1 protein_id gnl|my_center|LOCUS_10910 5544 6296 gene locus_tag LOCUS_10920 5544 6296 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401354.1 protein_id gnl|my_center|LOCUS_10920 6302 7054 gene locus_tag LOCUS_10930 6302 7054 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401353.1 protein_id gnl|my_center|LOCUS_10930 7328 8287 gene locus_tag LOCUS_10940 gene rbsB 7328 8287 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759000.1 protein_id gnl|my_center|LOCUS_10940 8328 9317 gene locus_tag LOCUS_10950 8328 9317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971942.1 protein_id gnl|my_center|LOCUS_10950 9317 10075 gene locus_tag LOCUS_10960 9317 10075 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892760.1 protein_id gnl|my_center|LOCUS_10960 10089 10748 gene locus_tag LOCUS_10970 gene hxlA 10089 10748 CDS product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776031.1 protein_id gnl|my_center|LOCUS_10970 10733 11239 gene locus_tag LOCUS_10980 gene hxlB 10733 11239 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065105.1 protein_id gnl|my_center|LOCUS_10980 11247 12128 gene locus_tag LOCUS_10990 11247 12128 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091889128.1 protein_id gnl|my_center|LOCUS_10990 12250 13284 gene locus_tag LOCUS_11000 12250 13284 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974273.1 protein_id gnl|my_center|LOCUS_11000 13498 13698 gene locus_tag LOCUS_11010 13498 13698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 13757 14050 gene locus_tag LOCUS_11020 13757 14050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 15012 14122 gene locus_tag LOCUS_11030 15012 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 15783 15025 gene locus_tag LOCUS_11040 gene kduD 15783 15025 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393179.1 protein_id gnl|my_center|LOCUS_11040 16843 15797 gene locus_tag LOCUS_11050 gene ugpC 16843 15797 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973468.1 protein_id gnl|my_center|LOCUS_11050 17905 16853 gene locus_tag LOCUS_11060 17905 16853 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092773148.1 protein_id gnl|my_center|LOCUS_11060 18921 17902 gene locus_tag LOCUS_11070 18921 17902 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316520.1 protein_id gnl|my_center|LOCUS_11070 20404 19136 gene locus_tag LOCUS_11080 20404 19136 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973466.1 protein_id gnl|my_center|LOCUS_11080 22965 20482 gene locus_tag LOCUS_11090 22965 20482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973963.1 protein_id gnl|my_center|LOCUS_11090 23798 22962 gene locus_tag LOCUS_11100 gene kduI 23798 22962 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210829.1 protein_id gnl|my_center|LOCUS_11100 24895 23795 gene locus_tag LOCUS_11110 24895 23795 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393209.1 protein_id gnl|my_center|LOCUS_11110 25006 26052 gene locus_tag LOCUS_11120 25006 26052 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047175.1 protein_id gnl|my_center|LOCUS_11120 26169 27404 gene locus_tag LOCUS_11130 26169 27404 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532103.1 protein_id gnl|my_center|LOCUS_11130 27465 28286 gene locus_tag LOCUS_11140 27465 28286 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338992.1 protein_id gnl|my_center|LOCUS_11140 29435 28323 gene locus_tag LOCUS_11150 29435 28323 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528916.1 protein_id gnl|my_center|LOCUS_11150 29622 30434 gene locus_tag LOCUS_11160 29622 30434 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967254.1 protein_id gnl|my_center|LOCUS_11160 30501 31196 gene locus_tag LOCUS_11170 30501 31196 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967253.1 protein_id gnl|my_center|LOCUS_11170 31193 31885 gene locus_tag LOCUS_11180 31193 31885 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967252.1 protein_id gnl|my_center|LOCUS_11180 31885 32622 gene locus_tag LOCUS_11190 31885 32622 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193736.1 protein_id gnl|my_center|LOCUS_11190 32631 33413 gene locus_tag LOCUS_11200 gene hisN 32631 33413 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528764.1 protein_id gnl|my_center|LOCUS_11200 33862 33557 gene locus_tag LOCUS_11210 33862 33557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970158.1 protein_id gnl|my_center|LOCUS_11210 34008 34538 gene locus_tag LOCUS_11220 34008 34538 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106726554.1 protein_id gnl|my_center|LOCUS_11220 35665 34598 gene locus_tag LOCUS_11230 35665 34598 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973985.1 protein_id gnl|my_center|LOCUS_11230 36182 35742 gene locus_tag LOCUS_11240 36182 35742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 36066 37256 gene locus_tag LOCUS_11250 36066 37256 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 protein_id gnl|my_center|LOCUS_11250 37347 38114 gene locus_tag LOCUS_11260 37347 38114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973986.1 protein_id gnl|my_center|LOCUS_11260 39748 38243 gene locus_tag LOCUS_11270 39748 38243 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339389.1 protein_id gnl|my_center|LOCUS_11270 40558 39770 gene locus_tag LOCUS_11280 40558 39770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 41435 40569 gene locus_tag LOCUS_11290 41435 40569 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565322.1 protein_id gnl|my_center|LOCUS_11290 42541 41432 gene locus_tag LOCUS_11300 42541 41432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532860.1 protein_id gnl|my_center|LOCUS_11300 43675 42617 gene locus_tag LOCUS_11310 43675 42617 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532971.1 protein_id gnl|my_center|LOCUS_11310 45103 43703 gene locus_tag LOCUS_11320 45103 43703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 46269 45100 gene locus_tag LOCUS_11330 46269 45100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 46140 46233 gene locus_tag LOCUS_t00060 46140 46233 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 46653 47882 gene locus_tag LOCUS_11340 gene aztD 46653 47882 CDS product zinc metallochaperone AztD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969726.1 protein_id gnl|my_center|LOCUS_11340 49046 48024 gene locus_tag LOCUS_11350 49046 48024 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209518.1 protein_id gnl|my_center|LOCUS_11350 50074 49043 gene locus_tag LOCUS_11360 50074 49043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 50865 50098 gene locus_tag LOCUS_11370 50865 50098 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230844.1 protein_id gnl|my_center|LOCUS_11370 51851 50865 gene locus_tag LOCUS_11380 51851 50865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731544.1 protein_id gnl|my_center|LOCUS_11380 52958 51945 gene locus_tag LOCUS_11390 52958 51945 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731545.1 protein_id gnl|my_center|LOCUS_11390 53365 54609 gene locus_tag LOCUS_11400 53365 54609 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868921.1 protein_id gnl|my_center|LOCUS_11400 56423 54954 gene locus_tag LOCUS_11410 gene gabD 56423 54954 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968294.1 protein_id gnl|my_center|LOCUS_11410 57190 56420 gene locus_tag LOCUS_11420 57190 56420 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810210.1 protein_id gnl|my_center|LOCUS_11420 59184 57193 gene locus_tag LOCUS_11430 59184 57193 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972911.1 protein_id gnl|my_center|LOCUS_11430 59954 59196 gene locus_tag LOCUS_11440 59954 59196 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201787933.1 protein_id gnl|my_center|LOCUS_11440 60848 59964 gene locus_tag LOCUS_11450 60848 59964 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703193.1 protein_id gnl|my_center|LOCUS_11450 61662 60859 gene locus_tag LOCUS_11460 gene hpaI 61662 60859 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704294.1 protein_id gnl|my_center|LOCUS_11460 63407 61674 gene locus_tag LOCUS_11470 gene araD 63407 61674 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083210.1 protein_id gnl|my_center|LOCUS_11470 64258 63404 gene locus_tag LOCUS_11480 64258 63404 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314872.1 protein_id gnl|my_center|LOCUS_11480 65197 64262 gene locus_tag LOCUS_11490 65197 64262 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992469.1 protein_id gnl|my_center|LOCUS_11490 66513 65278 gene locus_tag LOCUS_11500 66513 65278 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972909.1 protein_id gnl|my_center|LOCUS_11500 67630 66554 gene locus_tag LOCUS_11510 gene ugpC 67630 66554 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972908.1 protein_id gnl|my_center|LOCUS_11510 67871 68911 gene locus_tag LOCUS_11520 67871 68911 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530862.1 protein_id gnl|my_center|LOCUS_11520 70191 69082 gene locus_tag LOCUS_11530 70191 69082 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391635.1 protein_id gnl|my_center|LOCUS_11530 70453 71700 gene locus_tag LOCUS_11540 70453 71700 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972909.1 protein_id gnl|my_center|LOCUS_11540 71953 72978 gene locus_tag LOCUS_11550 71953 72978 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402907.1 protein_id gnl|my_center|LOCUS_11550 73103 74629 gene locus_tag LOCUS_11560 73103 74629 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402890.1 protein_id gnl|my_center|LOCUS_11560 74619 75668 gene locus_tag LOCUS_11570 74619 75668 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402893.1 protein_id gnl|my_center|LOCUS_11570 75671 76612 gene locus_tag LOCUS_11580 75671 76612 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402896.1 protein_id gnl|my_center|LOCUS_11580 76609 77901 gene locus_tag LOCUS_11590 76609 77901 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528035.1 protein_id gnl|my_center|LOCUS_11590 78795 77914 gene locus_tag LOCUS_11600 78795 77914 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969619.1 protein_id gnl|my_center|LOCUS_11600 80441 78822 gene locus_tag LOCUS_11610 80441 78822 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969618.1 protein_id gnl|my_center|LOCUS_11610 81363 80434 gene locus_tag LOCUS_11620 81363 80434 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969617.1 protein_id gnl|my_center|LOCUS_11620 82316 81369 gene locus_tag LOCUS_11630 82316 81369 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532054.1 protein_id gnl|my_center|LOCUS_11630 83871 82372 gene locus_tag LOCUS_11640 83871 82372 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170059.1 protein_id gnl|my_center|LOCUS_11640 84209 85402 gene locus_tag LOCUS_11650 84209 85402 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969614.1 protein_id gnl|my_center|LOCUS_11650 85399 86355 gene locus_tag LOCUS_11660 gene pdxA 85399 86355 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969613.1 protein_id gnl|my_center|LOCUS_11660 86360 87478 gene locus_tag LOCUS_11670 86360 87478 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969612.1 protein_id gnl|my_center|LOCUS_11670 88344 87643 gene locus_tag LOCUS_11680 88344 87643 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969611.1 protein_id gnl|my_center|LOCUS_11680 89376 88348 gene locus_tag LOCUS_11690 89376 88348 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974341.1 protein_id gnl|my_center|LOCUS_11690 90321 89866 gene locus_tag LOCUS_11700 90321 89866 CDS product DUF3597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973558.1 protein_id gnl|my_center|LOCUS_11700 91408 90500 gene locus_tag LOCUS_11710 91408 90500 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975547.1 protein_id gnl|my_center|LOCUS_11710 91533 92987 gene locus_tag LOCUS_11720 gene argH 91533 92987 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061896.1 protein_id gnl|my_center|LOCUS_11720 92984 93850 gene locus_tag LOCUS_11730 92984 93850 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061895.1 protein_id gnl|my_center|LOCUS_11730 93865 94635 gene locus_tag LOCUS_11740 93865 94635 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975550.1 protein_id gnl|my_center|LOCUS_11740 94665 95492 gene locus_tag LOCUS_11750 94665 95492 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975551.1 protein_id gnl|my_center|LOCUS_11750 95554 96963 gene locus_tag LOCUS_11760 95554 96963 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243160.1 protein_id gnl|my_center|LOCUS_11760 96976 97845 gene locus_tag LOCUS_11770 96976 97845 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061891.1 protein_id gnl|my_center|LOCUS_11770 98171 98995 gene locus_tag LOCUS_11780 98171 98995 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975551.1 protein_id gnl|my_center|LOCUS_11780 99010 99987 gene locus_tag LOCUS_11790 99010 99987 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_11790 100529 100029 gene locus_tag LOCUS_11800 100529 100029 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061898.1 protein_id gnl|my_center|LOCUS_11800 101202 100645 gene locus_tag LOCUS_11810 101202 100645 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975991.1 protein_id gnl|my_center|LOCUS_11810 102525 101527 gene locus_tag LOCUS_11820 102525 101527 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968428.1 protein_id gnl|my_center|LOCUS_11820 102633 103889 gene locus_tag LOCUS_11830 102633 103889 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014530006.1 protein_id gnl|my_center|LOCUS_11830 103886 105883 gene locus_tag LOCUS_11840 103886 105883 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968430.1 protein_id gnl|my_center|LOCUS_11840 105894 107048 gene locus_tag LOCUS_11850 105894 107048 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968431.1 protein_id gnl|my_center|LOCUS_11850 107145 107999 gene locus_tag LOCUS_11860 107145 107999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 108108 110213 gene locus_tag LOCUS_11870 108108 110213 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_11870 110215 111477 gene locus_tag LOCUS_11880 110215 111477 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115085.1 protein_id gnl|my_center|LOCUS_11880 111490 112122 gene locus_tag LOCUS_11890 111490 112122 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401654.1 protein_id gnl|my_center|LOCUS_11890 112119 112400 gene locus_tag LOCUS_11900 112119 112400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 113859 112420 gene locus_tag LOCUS_11910 113859 112420 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 protein_id gnl|my_center|LOCUS_11910 115828 113876 gene locus_tag LOCUS_11920 115828 113876 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339391.1 protein_id gnl|my_center|LOCUS_11920 117131 115872 gene locus_tag LOCUS_11930 117131 115872 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528134.1 protein_id gnl|my_center|LOCUS_11930 118162 117128 gene locus_tag LOCUS_11940 118162 117128 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528135.1 protein_id gnl|my_center|LOCUS_11940 119145 118159 gene locus_tag LOCUS_11950 119145 118159 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528136.1 protein_id gnl|my_center|LOCUS_11950 119990 119154 gene locus_tag LOCUS_11960 119990 119154 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528137.1 protein_id gnl|my_center|LOCUS_11960 121008 119995 gene locus_tag LOCUS_11970 121008 119995 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528138.1 protein_id gnl|my_center|LOCUS_11970 121193 122050 gene locus_tag LOCUS_11980 121193 122050 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173527.1 protein_id gnl|my_center|LOCUS_11980 122074 123372 gene locus_tag LOCUS_11990 122074 123372 CDS product acetoin dehydrogenase dihydrolipoyllysine-residue acetyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067244.1 protein_id gnl|my_center|LOCUS_11990 124035 123376 gene locus_tag LOCUS_12000 124035 123376 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528133.1 protein_id gnl|my_center|LOCUS_12000 125288 124020 gene locus_tag LOCUS_12010 125288 124020 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494209.1 protein_id gnl|my_center|LOCUS_12010 126438 125299 gene locus_tag LOCUS_12020 126438 125299 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097850.1 protein_id gnl|my_center|LOCUS_12020 126587 128761 gene locus_tag LOCUS_12030 126587 128761 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528128.1 protein_id gnl|my_center|LOCUS_12030 128807 130405 gene locus_tag LOCUS_12040 128807 130405 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167355196.1 protein_id gnl|my_center|LOCUS_12040 130458 131702 gene locus_tag LOCUS_12050 130458 131702 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_12050 131787 132764 gene locus_tag LOCUS_12060 131787 132764 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 protein_id gnl|my_center|LOCUS_12060 132985 134238 gene locus_tag LOCUS_12070 132985 134238 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_12070 134460 135683 gene locus_tag LOCUS_12080 gene repA 134460 135683 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215636.1 protein_id gnl|my_center|LOCUS_12080 135680 136699 gene locus_tag LOCUS_12090 gene repB 135680 136699 CDS product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974268.1 protein_id gnl|my_center|LOCUS_12090 136942 138114 gene locus_tag LOCUS_12100 gene repC 136942 138114 CDS product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313545.1 protein_id gnl|my_center|LOCUS_12100 138600 138283 gene locus_tag LOCUS_12110 138600 138283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 140259 139147 gene locus_tag LOCUS_12120 140259 139147 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525333.1 protein_id gnl|my_center|LOCUS_12120 141211 140429 gene locus_tag LOCUS_12130 141211 140429 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973483.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence07 1250 105 gene locus_tag LOCUS_12140 1250 105 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810308.1 protein_id gnl|my_center|LOCUS_12140 2127 1255 gene locus_tag LOCUS_12150 2127 1255 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810306.1 protein_id gnl|my_center|LOCUS_12150 3203 2244 gene locus_tag LOCUS_12160 3203 2244 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971233.1 protein_id gnl|my_center|LOCUS_12160 4355 3351 gene locus_tag LOCUS_12170 4355 3351 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969988.1 protein_id gnl|my_center|LOCUS_12170 4938 4366 gene locus_tag LOCUS_12180 4938 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 6629 4935 gene locus_tag LOCUS_12190 6629 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 7621 6626 gene locus_tag LOCUS_12200 7621 6626 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 protein_id gnl|my_center|LOCUS_12200 9077 7626 gene locus_tag LOCUS_12210 9077 7626 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929684.1 protein_id gnl|my_center|LOCUS_12210 9168 10070 gene locus_tag LOCUS_12220 9168 10070 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130010930.1 protein_id gnl|my_center|LOCUS_12220 11070 10090 gene locus_tag LOCUS_12230 11070 10090 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536327.1 protein_id gnl|my_center|LOCUS_12230 11169 12419 gene locus_tag LOCUS_12240 11169 12419 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067492.1 protein_id gnl|my_center|LOCUS_12240 12432 12701 gene locus_tag LOCUS_12250 12432 12701 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973656.1 protein_id gnl|my_center|LOCUS_12250 12698 15661 gene locus_tag LOCUS_12260 12698 15661 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973655.1 protein_id gnl|my_center|LOCUS_12260 15654 16181 gene locus_tag LOCUS_12270 15654 16181 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612973.1 protein_id gnl|my_center|LOCUS_12270 17113 16178 gene locus_tag LOCUS_12280 17113 16178 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528698.1 protein_id gnl|my_center|LOCUS_12280 18104 17202 gene locus_tag LOCUS_12290 18104 17202 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967768.1 protein_id gnl|my_center|LOCUS_12290 19137 18130 gene locus_tag LOCUS_12300 19137 18130 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967766.1 protein_id gnl|my_center|LOCUS_12300 20258 19134 gene locus_tag LOCUS_12310 20258 19134 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969989.1 protein_id gnl|my_center|LOCUS_12310 21288 20398 gene locus_tag LOCUS_12320 21288 20398 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967768.1 protein_id gnl|my_center|LOCUS_12320 22070 21312 gene locus_tag LOCUS_12330 22070 21312 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969991.1 protein_id gnl|my_center|LOCUS_12330 23182 22067 gene locus_tag LOCUS_12340 23182 22067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967770.1 protein_id gnl|my_center|LOCUS_12340 23841 23179 gene locus_tag LOCUS_12350 23841 23179 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967771.1 protein_id gnl|my_center|LOCUS_12350 24534 23866 gene locus_tag LOCUS_12360 24534 23866 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967772.1 protein_id gnl|my_center|LOCUS_12360 25850 24546 gene locus_tag LOCUS_12370 25850 24546 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969995.1 protein_id gnl|my_center|LOCUS_12370 26934 25942 gene locus_tag LOCUS_12380 26934 25942 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014990157.1 protein_id gnl|my_center|LOCUS_12380 28486 26951 gene locus_tag LOCUS_12390 28486 26951 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967775.1 protein_id gnl|my_center|LOCUS_12390 28715 29602 gene locus_tag LOCUS_12400 28715 29602 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527002.1 protein_id gnl|my_center|LOCUS_12400 29825 32245 gene locus_tag LOCUS_12410 29825 32245 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967776.1 protein_id gnl|my_center|LOCUS_12410 33156 32269 gene locus_tag LOCUS_12420 gene mmsB 33156 32269 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331270.1 protein_id gnl|my_center|LOCUS_12420 34815 33220 gene locus_tag LOCUS_12430 34815 33220 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973582.1 protein_id gnl|my_center|LOCUS_12430 35919 34915 gene locus_tag LOCUS_12440 35919 34915 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313874.1 protein_id gnl|my_center|LOCUS_12440 36808 35921 gene locus_tag LOCUS_12450 36808 35921 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313872.1 protein_id gnl|my_center|LOCUS_12450 37514 36813 gene locus_tag LOCUS_12460 37514 36813 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970327.1 protein_id gnl|my_center|LOCUS_12460 38259 37516 gene locus_tag LOCUS_12470 38259 37516 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329982.1 protein_id gnl|my_center|LOCUS_12470 39522 38317 gene locus_tag LOCUS_12480 39522 38317 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397986.1 protein_id gnl|my_center|LOCUS_12480 39697 40680 gene locus_tag LOCUS_12490 39697 40680 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435265.1 protein_id gnl|my_center|LOCUS_12490 41912 40650 gene locus_tag LOCUS_12500 41912 40650 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 protein_id gnl|my_center|LOCUS_12500 42994 41936 gene locus_tag LOCUS_12510 42994 41936 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173056.1 protein_id gnl|my_center|LOCUS_12510 43840 43007 gene locus_tag LOCUS_12520 43840 43007 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228342.1 protein_id gnl|my_center|LOCUS_12520 44688 43837 gene locus_tag LOCUS_12530 44688 43837 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228343.1 protein_id gnl|my_center|LOCUS_12530 46089 44812 gene locus_tag LOCUS_12540 46089 44812 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065231.1 protein_id gnl|my_center|LOCUS_12540 47131 46121 gene locus_tag LOCUS_12550 47131 46121 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523134.1 protein_id gnl|my_center|LOCUS_12550 48515 47646 gene locus_tag LOCUS_12560 48515 47646 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207989.1 protein_id gnl|my_center|LOCUS_12560 49631 49098 gene locus_tag LOCUS_12570 49631 49098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12570 49918 50982 gene locus_tag LOCUS_12580 49918 50982 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559340.1 protein_id gnl|my_center|LOCUS_12580 51430 51110 gene locus_tag LOCUS_12590 51430 51110 CDS product DUF4112 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967229.1 protein_id gnl|my_center|LOCUS_12590 52348 51932 gene locus_tag LOCUS_12600 52348 51932 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083032.1 protein_id gnl|my_center|LOCUS_12600 52883 52359 gene locus_tag LOCUS_12610 52883 52359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 52869 53699 gene locus_tag LOCUS_12620 52869 53699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 54014 55231 gene locus_tag LOCUS_12630 54014 55231 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974749.1 protein_id gnl|my_center|LOCUS_12630 55298 56164 gene locus_tag LOCUS_12640 gene urtB 55298 56164 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532993.1 protein_id gnl|my_center|LOCUS_12640 56161 57198 gene locus_tag LOCUS_12650 56161 57198 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532994.1 protein_id gnl|my_center|LOCUS_12650 57195 57917 gene locus_tag LOCUS_12660 gene urtD 57195 57917 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_12660 57907 58620 gene locus_tag LOCUS_12670 gene urtE 57907 58620 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013985.1 protein_id gnl|my_center|LOCUS_12670 58653 58952 gene locus_tag LOCUS_12680 58653 58952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 58978 60477 gene locus_tag LOCUS_12690 gene dhaS 58978 60477 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080288.1 protein_id gnl|my_center|LOCUS_12690 60548 61774 gene locus_tag LOCUS_12700 60548 61774 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085703.1 protein_id gnl|my_center|LOCUS_12700 62365 61805 gene locus_tag LOCUS_12710 62365 61805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 63663 62407 gene locus_tag LOCUS_12720 63663 62407 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530650.1 protein_id gnl|my_center|LOCUS_12720 65047 63965 gene locus_tag LOCUS_12730 65047 63965 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969480.1 protein_id gnl|my_center|LOCUS_12730 65249 66292 gene locus_tag LOCUS_12740 65249 66292 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974668.1 protein_id gnl|my_center|LOCUS_12740 66294 67394 gene locus_tag LOCUS_12750 66294 67394 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975172.1 protein_id gnl|my_center|LOCUS_12750 67467 68447 gene locus_tag LOCUS_12760 67467 68447 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975171.1 protein_id gnl|my_center|LOCUS_12760 68458 69249 gene locus_tag LOCUS_12770 68458 69249 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969484.1 protein_id gnl|my_center|LOCUS_12770 69249 70325 gene locus_tag LOCUS_12780 69249 70325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975169.1 protein_id gnl|my_center|LOCUS_12780 70342 71814 gene locus_tag LOCUS_12790 70342 71814 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969486.1 protein_id gnl|my_center|LOCUS_12790 71842 72342 gene locus_tag LOCUS_12800 71842 72342 CDS product CMD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969487.1 protein_id gnl|my_center|LOCUS_12800 72344 72922 gene locus_tag LOCUS_12810 72344 72922 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974674.1 protein_id gnl|my_center|LOCUS_12810 72923 74263 gene locus_tag LOCUS_12820 72923 74263 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974675.1 protein_id gnl|my_center|LOCUS_12820 74491 74270 gene locus_tag LOCUS_12830 74491 74270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12830 76381 74948 gene locus_tag LOCUS_12840 76381 74948 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163901150.1 protein_id gnl|my_center|LOCUS_12840 77981 76398 gene locus_tag LOCUS_12850 77981 76398 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972360.1 protein_id gnl|my_center|LOCUS_12850 78963 78163 gene locus_tag LOCUS_12860 78963 78163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816301.1 protein_id gnl|my_center|LOCUS_12860 79784 79014 gene locus_tag LOCUS_12870 79784 79014 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728490.1 protein_id gnl|my_center|LOCUS_12870 80844 79849 gene locus_tag LOCUS_12880 80844 79849 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973995.1 protein_id gnl|my_center|LOCUS_12880 82174 81176 gene locus_tag LOCUS_12890 82174 81176 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764786.1 protein_id gnl|my_center|LOCUS_12890 82665 82177 gene locus_tag LOCUS_12900 82665 82177 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 protein_id gnl|my_center|LOCUS_12900 83427 82666 gene locus_tag LOCUS_12910 83427 82666 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384591.1 protein_id gnl|my_center|LOCUS_12910 83631 85004 gene locus_tag LOCUS_12920 83631 85004 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_12920 86070 85081 gene locus_tag LOCUS_12930 86070 85081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 86267 86070 gene locus_tag LOCUS_12940 86267 86070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 86952 86269 gene locus_tag LOCUS_12950 86952 86269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 88298 86949 gene locus_tag LOCUS_12960 88298 86949 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_12960 89185 88295 gene locus_tag LOCUS_12970 89185 88295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 90270 89182 gene locus_tag LOCUS_12980 90270 89182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 92357 90918 gene locus_tag LOCUS_12990 92357 90918 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455014.1 protein_id gnl|my_center|LOCUS_12990 93642 92470 gene locus_tag LOCUS_13000 93642 92470 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256149.1 protein_id gnl|my_center|LOCUS_13000 94839 93679 gene locus_tag LOCUS_13010 94839 93679 CDS product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090843.1 protein_id gnl|my_center|LOCUS_13010 94979 95290 gene locus_tag LOCUS_13020 94979 95290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 95915 97027 gene locus_tag LOCUS_13030 95915 97027 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525333.1 protein_id gnl|my_center|LOCUS_13030 97242 97706 gene locus_tag LOCUS_13040 97242 97706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 98950 97730 gene locus_tag LOCUS_13050 gene repC 98950 97730 CDS product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244395.1 protein_id gnl|my_center|LOCUS_13050 100080 99106 gene locus_tag LOCUS_13060 gene repB 100080 99106 CDS product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858028.1 protein_id gnl|my_center|LOCUS_13060 101359 100151 gene locus_tag LOCUS_13070 gene repA 101359 100151 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858029.1 protein_id gnl|my_center|LOCUS_13070 101808 102809 gene locus_tag LOCUS_13080 101808 102809 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968073.1 protein_id gnl|my_center|LOCUS_13080 102983 104017 gene locus_tag LOCUS_13090 102983 104017 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243941.1 protein_id gnl|my_center|LOCUS_13090 104014 104325 gene locus_tag LOCUS_13100 104014 104325 CDS product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968075.1 protein_id gnl|my_center|LOCUS_13100 104404 105348 gene locus_tag LOCUS_13110 104404 105348 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243939.1 protein_id gnl|my_center|LOCUS_13110 105397 106602 gene locus_tag LOCUS_13120 105397 106602 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878467.1 protein_id gnl|my_center|LOCUS_13120 106602 107450 gene locus_tag LOCUS_13130 106602 107450 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782017.1 protein_id gnl|my_center|LOCUS_13130 110113 107462 gene locus_tag LOCUS_13140 110113 107462 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243656.1 protein_id gnl|my_center|LOCUS_13140 110518 110147 gene locus_tag LOCUS_13150 110518 110147 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396390.1 protein_id gnl|my_center|LOCUS_13150 112295 110544 gene locus_tag LOCUS_13160 gene treZ 112295 110544 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061346.1 protein_id gnl|my_center|LOCUS_13160 112594 114678 gene locus_tag LOCUS_13170 gene glgX 112594 114678 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396397.1 protein_id gnl|my_center|LOCUS_13170 114688 115713 gene locus_tag LOCUS_13180 114688 115713 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242618.1 protein_id gnl|my_center|LOCUS_13180 116026 115724 gene locus_tag LOCUS_13190 116026 115724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 116277 116011 gene locus_tag LOCUS_13200 116277 116011 CDS product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976125.1 protein_id gnl|my_center|LOCUS_13200 116666 116274 gene locus_tag LOCUS_13210 116666 116274 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061317.1 protein_id gnl|my_center|LOCUS_13210 116886 116680 gene locus_tag LOCUS_13220 116886 116680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 117023 117805 gene locus_tag LOCUS_13230 117023 117805 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061320.1 protein_id gnl|my_center|LOCUS_13230 117990 121715 gene locus_tag LOCUS_13240 117990 121715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 121803 121994 gene locus_tag LOCUS_13250 121803 121994 CDS product DUF3008 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014762197.1 protein_id gnl|my_center|LOCUS_13250 122017 122394 gene locus_tag LOCUS_13260 122017 122394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 124065 122482 gene locus_tag LOCUS_13270 124065 122482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 124850 124263 gene locus_tag LOCUS_13280 124850 124263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13280 125200 124784 gene locus_tag LOCUS_13290 125200 124784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 127076 125316 gene locus_tag LOCUS_13300 127076 125316 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971373.1 protein_id gnl|my_center|LOCUS_13300 127343 128296 gene locus_tag LOCUS_13310 127343 128296 CDS product DUF1403 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525334.1 protein_id gnl|my_center|LOCUS_13310 128299 128985 gene locus_tag LOCUS_13320 128299 128985 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525335.1 protein_id gnl|my_center|LOCUS_13320 130468 129023 gene locus_tag LOCUS_13330 130468 129023 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970007.1 protein_id gnl|my_center|LOCUS_13330 132143 130599 gene locus_tag LOCUS_13340 132143 130599 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970008.1 protein_id gnl|my_center|LOCUS_13340 133036 132173 gene locus_tag LOCUS_13350 133036 132173 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170158.1 protein_id gnl|my_center|LOCUS_13350 134666 133038 gene locus_tag LOCUS_13360 134666 133038 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972985.1 protein_id gnl|my_center|LOCUS_13360 135481 134663 gene locus_tag LOCUS_13370 135481 134663 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066662.1 protein_id gnl|my_center|LOCUS_13370 136422 135478 gene locus_tag LOCUS_13380 136422 135478 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066663.1 protein_id gnl|my_center|LOCUS_13380 137504 136599 gene locus_tag LOCUS_13390 137504 136599 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972988.1 protein_id gnl|my_center|LOCUS_13390 138851 137718 gene locus_tag LOCUS_13400 gene tcuB 138851 137718 CDS product tricarballylate utilization 4Fe-4S protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085110.1 protein_id gnl|my_center|LOCUS_13400 140269 138848 gene locus_tag LOCUS_13410 gene tcuA 140269 138848 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence08 1029 169 gene locus_tag LOCUS_13420 1029 169 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529066.1 protein_id gnl|my_center|LOCUS_13420 1109 2119 gene locus_tag LOCUS_13430 gene obgE 1109 2119 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067217.1 protein_id gnl|my_center|LOCUS_13430 2121 3293 gene locus_tag LOCUS_13440 gene proB 2121 3293 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330090.1 protein_id gnl|my_center|LOCUS_13440 3286 4563 gene locus_tag LOCUS_13450 3286 4563 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393804.1 protein_id gnl|my_center|LOCUS_13450 4565 5209 gene locus_tag LOCUS_13460 4565 5209 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393806.1 protein_id gnl|my_center|LOCUS_13460 5319 5723 gene locus_tag LOCUS_13470 gene rsfS 5319 5723 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330094.1 protein_id gnl|my_center|LOCUS_13470 5803 6285 gene locus_tag LOCUS_13480 gene rlmH 5803 6285 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067222.1 protein_id gnl|my_center|LOCUS_13480 6425 7855 gene locus_tag LOCUS_13490 6425 7855 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844910.1 protein_id gnl|my_center|LOCUS_13490 7884 9167 gene locus_tag LOCUS_13500 7884 9167 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330097.1 protein_id gnl|my_center|LOCUS_13500 9367 9083 gene locus_tag LOCUS_13510 9367 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 9354 10556 gene locus_tag LOCUS_13520 9354 10556 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330098.1 protein_id gnl|my_center|LOCUS_13520 10566 11093 gene locus_tag LOCUS_13530 10566 11093 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330099.1 protein_id gnl|my_center|LOCUS_13530 11640 11155 gene locus_tag LOCUS_13540 gene bfr 11640 11155 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330100.1 protein_id gnl|my_center|LOCUS_13540 11917 11606 gene locus_tag LOCUS_13550 11917 11606 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531270.1 protein_id gnl|my_center|LOCUS_13550 12287 12721 gene locus_tag LOCUS_13560 12287 12721 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310993.1 protein_id gnl|my_center|LOCUS_13560 13055 12849 gene locus_tag LOCUS_13570 13055 12849 CDS product DUF1737 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393782.1 protein_id gnl|my_center|LOCUS_13570 13963 13052 gene locus_tag LOCUS_13580 13963 13052 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018209276.1 protein_id gnl|my_center|LOCUS_13580 14126 14374 gene locus_tag LOCUS_13590 14126 14374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067235.1 protein_id gnl|my_center|LOCUS_13590 14534 15139 gene locus_tag LOCUS_13600 gene leuD 14534 15139 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531292.1 protein_id gnl|my_center|LOCUS_13600 15145 15525 gene locus_tag LOCUS_13610 15145 15525 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531294.1 protein_id gnl|my_center|LOCUS_13610 15735 16844 gene locus_tag LOCUS_13620 gene leuB 15735 16844 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535893.1 protein_id gnl|my_center|LOCUS_13620 16960 17664 gene locus_tag LOCUS_13630 16960 17664 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398638.1 protein_id gnl|my_center|LOCUS_13630 19611 17722 gene locus_tag LOCUS_13640 19611 17722 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970564.1 protein_id gnl|my_center|LOCUS_13640 20094 21128 gene locus_tag LOCUS_13650 20094 21128 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531790.1 protein_id gnl|my_center|LOCUS_13650 21360 22181 gene locus_tag LOCUS_13660 21360 22181 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970568.1 protein_id gnl|my_center|LOCUS_13660 22936 22295 gene locus_tag LOCUS_13670 22936 22295 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242643.1 protein_id gnl|my_center|LOCUS_13670 23910 23035 gene locus_tag LOCUS_13680 gene pdxY 23910 23035 CDS product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563606.1 protein_id gnl|my_center|LOCUS_13680 24187 28968 gene locus_tag LOCUS_13690 24187 28968 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398663.1 protein_id gnl|my_center|LOCUS_13690 29172 30548 gene locus_tag LOCUS_13700 29172 30548 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970572.1 protein_id gnl|my_center|LOCUS_13700 32329 30719 gene locus_tag LOCUS_13710 gene purH 32329 30719 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970573.1 protein_id gnl|my_center|LOCUS_13710 34111 32429 gene locus_tag LOCUS_13720 34111 32429 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242378.1 protein_id gnl|my_center|LOCUS_13720 35634 34228 gene locus_tag LOCUS_13730 35634 34228 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970575.1 protein_id gnl|my_center|LOCUS_13730 36596 35631 gene locus_tag LOCUS_13740 gene htpX 36596 35631 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876568.1 protein_id gnl|my_center|LOCUS_13740 36808 37005 gene locus_tag LOCUS_13750 36808 37005 CDS product DUF1674 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067398.1 protein_id gnl|my_center|LOCUS_13750 39142 37187 gene locus_tag LOCUS_13760 gene acs 39142 37187 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972535.1 protein_id gnl|my_center|LOCUS_13760 39375 40076 gene locus_tag LOCUS_13770 39375 40076 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390453.1 protein_id gnl|my_center|LOCUS_13770 42164 40248 gene locus_tag LOCUS_13780 42164 40248 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398676.1 protein_id gnl|my_center|LOCUS_13780 42946 42287 gene locus_tag LOCUS_13790 42946 42287 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398678.1 protein_id gnl|my_center|LOCUS_13790 43145 45775 gene locus_tag LOCUS_13800 gene leuS 43145 45775 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067403.1 protein_id gnl|my_center|LOCUS_13800 45762 46286 gene locus_tag LOCUS_13810 gene lptE 45762 46286 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398682.1 protein_id gnl|my_center|LOCUS_13810 46294 47328 gene locus_tag LOCUS_13820 gene holA 46294 47328 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398683.1 protein_id gnl|my_center|LOCUS_13820 48244 47354 gene locus_tag LOCUS_13830 48244 47354 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330363.1 protein_id gnl|my_center|LOCUS_13830 49063 48269 gene locus_tag LOCUS_13840 49063 48269 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330364.1 protein_id gnl|my_center|LOCUS_13840 49712 49077 gene locus_tag LOCUS_13850 gene rsmG 49712 49077 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970584.1 protein_id gnl|my_center|LOCUS_13850 51598 49709 gene locus_tag LOCUS_13860 gene mnmG 51598 49709 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398688.1 protein_id gnl|my_center|LOCUS_13860 52990 51665 gene locus_tag LOCUS_13870 gene mnmE 52990 51665 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398690.1 protein_id gnl|my_center|LOCUS_13870 54380 53115 gene locus_tag LOCUS_13880 gene rho 54380 53115 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970587.1 protein_id gnl|my_center|LOCUS_13880 55106 54567 gene locus_tag LOCUS_13890 gene hemJ 55106 54567 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311068.1 protein_id gnl|my_center|LOCUS_13890 56065 55103 gene locus_tag LOCUS_13900 gene hemE 56065 55103 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398694.1 protein_id gnl|my_center|LOCUS_13900 56543 57364 gene locus_tag LOCUS_13910 56543 57364 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067414.1 protein_id gnl|my_center|LOCUS_13910 57389 57985 gene locus_tag LOCUS_13920 57389 57985 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508611.1 protein_id gnl|my_center|LOCUS_13920 57978 58838 gene locus_tag LOCUS_13930 57978 58838 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398698.1 protein_id gnl|my_center|LOCUS_13930 58835 59425 gene locus_tag LOCUS_13940 gene coaE 58835 59425 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067417.1 protein_id gnl|my_center|LOCUS_13940 59425 60129 gene locus_tag LOCUS_13950 gene dnaQ 59425 60129 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067418.1 protein_id gnl|my_center|LOCUS_13950 60689 60213 gene locus_tag LOCUS_13960 gene secB 60689 60213 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067419.1 protein_id gnl|my_center|LOCUS_13960 61217 60759 gene locus_tag LOCUS_13970 gene fxsA 61217 60759 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528723.1 protein_id gnl|my_center|LOCUS_13970 61372 62076 gene locus_tag LOCUS_13980 61372 62076 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067421.1 protein_id gnl|my_center|LOCUS_13980 62091 63206 gene locus_tag LOCUS_13990 62091 63206 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398216.1 protein_id gnl|my_center|LOCUS_13990 63193 63759 gene locus_tag LOCUS_14000 63193 63759 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242350.1 protein_id gnl|my_center|LOCUS_14000 63756 64136 gene locus_tag LOCUS_14010 63756 64136 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531717.1 protein_id gnl|my_center|LOCUS_14010 64270 66702 gene locus_tag LOCUS_14020 gene gyrB 64270 66702 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531714.1 protein_id gnl|my_center|LOCUS_14020 67429 66836 gene locus_tag LOCUS_14030 67429 66836 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968293.1 protein_id gnl|my_center|LOCUS_14030 67590 69041 gene locus_tag LOCUS_14040 gene gabD 67590 69041 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067427.1 protein_id gnl|my_center|LOCUS_14040 69105 69905 gene locus_tag LOCUS_14050 gene hpaI 69105 69905 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067428.1 protein_id gnl|my_center|LOCUS_14050 71088 69982 gene locus_tag LOCUS_14060 71088 69982 CDS product D-mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336877.1 protein_id gnl|my_center|LOCUS_14060 71977 71099 gene locus_tag LOCUS_14070 71977 71099 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330385.1 protein_id gnl|my_center|LOCUS_14070 72171 73190 gene locus_tag LOCUS_14080 72171 73190 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067431.1 protein_id gnl|my_center|LOCUS_14080 73217 73663 gene locus_tag LOCUS_14090 73217 73663 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532181.1 protein_id gnl|my_center|LOCUS_14090 73873 74859 gene locus_tag LOCUS_14100 73873 74859 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968299.1 protein_id gnl|my_center|LOCUS_14100 74948 76501 gene locus_tag LOCUS_14110 74948 76501 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251839.1 protein_id gnl|my_center|LOCUS_14110 76530 77504 gene locus_tag LOCUS_14120 76530 77504 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067434.1 protein_id gnl|my_center|LOCUS_14120 77587 78528 gene locus_tag LOCUS_14130 77587 78528 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330392.1 protein_id gnl|my_center|LOCUS_14130 78707 79999 gene locus_tag LOCUS_14140 gene phaZ 78707 79999 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390504.1 protein_id gnl|my_center|LOCUS_14140 80128 80562 gene locus_tag LOCUS_14150 80128 80562 CDS product DUF2852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067439.1 protein_id gnl|my_center|LOCUS_14150 80782 81543 gene locus_tag LOCUS_14160 80782 81543 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968304.1 protein_id gnl|my_center|LOCUS_14160 81765 81568 gene locus_tag LOCUS_14170 81765 81568 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812201.1 protein_id gnl|my_center|LOCUS_14170 81896 82579 gene locus_tag LOCUS_14180 81896 82579 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330397.1 protein_id gnl|my_center|LOCUS_14180 82576 83796 gene locus_tag LOCUS_14190 gene trpB 82576 83796 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067442.1 protein_id gnl|my_center|LOCUS_14190 83798 84637 gene locus_tag LOCUS_14200 gene trpA 83798 84637 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970607.1 protein_id gnl|my_center|LOCUS_14200 84727 85629 gene locus_tag LOCUS_14210 gene accD 84727 85629 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536448.1 protein_id gnl|my_center|LOCUS_14210 85652 86995 gene locus_tag LOCUS_14220 85652 86995 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968306.1 protein_id gnl|my_center|LOCUS_14220 87370 87050 gene locus_tag LOCUS_14230 gene trxA 87370 87050 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067446.1 protein_id gnl|my_center|LOCUS_14230 91046 87489 gene locus_tag LOCUS_14240 gene addA 91046 87489 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968308.1 protein_id gnl|my_center|LOCUS_14240 94221 91039 gene locus_tag LOCUS_14250 gene addB 94221 91039 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968309.1 protein_id gnl|my_center|LOCUS_14250 94952 94218 gene locus_tag LOCUS_14260 94952 94218 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067449.1 protein_id gnl|my_center|LOCUS_14260 96462 94966 gene locus_tag LOCUS_14270 96462 94966 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067450.1 protein_id gnl|my_center|LOCUS_14270 98922 96469 gene locus_tag LOCUS_14280 98922 96469 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330406.1 protein_id gnl|my_center|LOCUS_14280 100613 99213 gene locus_tag LOCUS_14290 gene ahcY 100613 99213 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330407.1 protein_id gnl|my_center|LOCUS_14290 101041 100769 gene locus_tag LOCUS_14300 101041 100769 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330408.1 protein_id gnl|my_center|LOCUS_14300 101458 101057 gene locus_tag LOCUS_14310 101458 101057 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067454.1 protein_id gnl|my_center|LOCUS_14310 102070 101609 gene locus_tag LOCUS_14320 102070 101609 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532002.1 protein_id gnl|my_center|LOCUS_14320 104081 102273 gene locus_tag LOCUS_14330 104081 102273 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398169.1 protein_id gnl|my_center|LOCUS_14330 104898 104167 gene locus_tag LOCUS_14340 gene chvI 104898 104167 CDS product two-component system response regulator ChvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330412.1 protein_id gnl|my_center|LOCUS_14340 105211 106821 gene locus_tag LOCUS_14350 105211 106821 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067458.1 protein_id gnl|my_center|LOCUS_14350 106949 107383 gene locus_tag LOCUS_14360 gene arfB 106949 107383 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970617.1 protein_id gnl|my_center|LOCUS_14360 107491 108006 gene locus_tag LOCUS_14370 gene lysM 107491 108006 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067460.1 protein_id gnl|my_center|LOCUS_14370 108013 108630 gene locus_tag LOCUS_14380 108013 108630 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528341.1 protein_id gnl|my_center|LOCUS_14380 109690 108695 gene locus_tag LOCUS_14390 gene coaA 109690 108695 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968317.1 protein_id gnl|my_center|LOCUS_14390 110010 109690 gene locus_tag LOCUS_14400 110010 109690 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876448.1 protein_id gnl|my_center|LOCUS_14400 110797 110021 gene locus_tag LOCUS_14410 gene hisF 110797 110021 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970619.1 protein_id gnl|my_center|LOCUS_14410 111131 111688 gene locus_tag LOCUS_14420 111131 111688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 112564 111824 gene locus_tag LOCUS_14430 gene hisA 112564 111824 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531989.1 protein_id gnl|my_center|LOCUS_14430 112843 113124 gene locus_tag LOCUS_14440 112843 113124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 113762 113121 gene locus_tag LOCUS_14450 gene hisH 113762 113121 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242309.1 protein_id gnl|my_center|LOCUS_14450 114235 113765 gene locus_tag LOCUS_14460 114235 113765 CDS product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531987.1 protein_id gnl|my_center|LOCUS_14460 114900 114307 gene locus_tag LOCUS_14470 gene hisB 114900 114307 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390535.1 protein_id gnl|my_center|LOCUS_14470 115990 116547 gene locus_tag LOCUS_14480 gene hslV 115990 116547 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709882.1 protein_id gnl|my_center|LOCUS_14480 116537 117079 gene locus_tag LOCUS_14490 116537 117079 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968321.1 protein_id gnl|my_center|LOCUS_14490 117076 118386 gene locus_tag LOCUS_14500 gene hslU 117076 118386 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330426.1 protein_id gnl|my_center|LOCUS_14500 118563 119510 gene locus_tag LOCUS_14510 118563 119510 CDS product DUF1402 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531977.1 protein_id gnl|my_center|LOCUS_14510 120211 119657 gene locus_tag LOCUS_14520 120211 119657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 120352 122358 gene locus_tag LOCUS_14530 120352 122358 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398133.1 protein_id gnl|my_center|LOCUS_14530 122544 124706 gene locus_tag LOCUS_14540 122544 124706 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968325.1 protein_id gnl|my_center|LOCUS_14540 125450 124788 gene locus_tag LOCUS_14550 125450 124788 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531973.1 protein_id gnl|my_center|LOCUS_14550 125818 126348 gene locus_tag LOCUS_14560 125818 126348 CDS product MmcB family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067477.1 protein_id gnl|my_center|LOCUS_14560 127024 126455 gene locus_tag LOCUS_14570 gene actR 127024 126455 CDS product global response regulator transcription factor ActR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067478.1 protein_id gnl|my_center|LOCUS_14570 128403 127102 gene locus_tag LOCUS_14580 128403 127102 CDS product ActS/PrrB/RegB family redox-sensitive histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398122.1 protein_id gnl|my_center|LOCUS_14580 131097 128629 gene locus_tag LOCUS_14590 gene hrpB 131097 128629 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968330.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence09 940 137 gene locus_tag LOCUS_14600 940 137 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655294.1 protein_id gnl|my_center|LOCUS_14600 3797 1179 gene locus_tag LOCUS_14610 3797 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 4038 4301 gene locus_tag LOCUS_14620 4038 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 5586 4576 gene locus_tag LOCUS_14630 5586 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 6995 5583 gene locus_tag LOCUS_14640 6995 5583 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 protein_id gnl|my_center|LOCUS_14640 7564 7340 gene locus_tag LOCUS_14650 7564 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 8174 7752 gene locus_tag LOCUS_14660 8174 7752 CDS product type II toxin-antitoxin system HigA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527219.1 protein_id gnl|my_center|LOCUS_14660 8463 8182 gene locus_tag LOCUS_14670 8463 8182 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 protein_id gnl|my_center|LOCUS_14670 8521 8736 gene locus_tag LOCUS_14680 8521 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 9224 8631 gene locus_tag LOCUS_14690 9224 8631 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836185.1 protein_id gnl|my_center|LOCUS_14690 9418 11013 gene locus_tag LOCUS_14700 9418 11013 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974405.1 protein_id gnl|my_center|LOCUS_14700 11010 12275 gene locus_tag LOCUS_14710 11010 12275 CDS product capsule biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252603.1 protein_id gnl|my_center|LOCUS_14710 12661 19995 gene locus_tag LOCUS_14720 12661 19995 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563188.1 protein_id gnl|my_center|LOCUS_14720 20001 21386 gene locus_tag LOCUS_14730 20001 21386 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391972.1 protein_id gnl|my_center|LOCUS_14730 21388 22203 gene locus_tag LOCUS_14740 21388 22203 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974406.1 protein_id gnl|my_center|LOCUS_14740 22289 23116 gene locus_tag LOCUS_14750 22289 23116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 23155 24204 gene locus_tag LOCUS_14760 23155 24204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 24217 25464 gene locus_tag LOCUS_14770 24217 25464 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811220.1 protein_id gnl|my_center|LOCUS_14770 25472 26125 gene locus_tag LOCUS_14780 25472 26125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975455.1 protein_id gnl|my_center|LOCUS_14780 26154 27425 gene locus_tag LOCUS_14790 26154 27425 CDS product RkpR, polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867747.1 protein_id gnl|my_center|LOCUS_14790 27435 28553 gene locus_tag LOCUS_14800 27435 28553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 28543 29340 gene locus_tag LOCUS_14810 28543 29340 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811217.1 protein_id gnl|my_center|LOCUS_14810 29347 31533 gene locus_tag LOCUS_14820 29347 31533 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120706319.1 protein_id gnl|my_center|LOCUS_14820 31874 32995 gene locus_tag LOCUS_14830 gene wecB 31874 32995 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706035.1 protein_id gnl|my_center|LOCUS_14830 32992 34293 gene locus_tag LOCUS_14840 gene wecC 32992 34293 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011236.1 protein_id gnl|my_center|LOCUS_14840 34488 37784 gene locus_tag LOCUS_14850 34488 37784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 37878 39308 gene locus_tag LOCUS_14860 37878 39308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 41125 39317 gene locus_tag LOCUS_14870 41125 39317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 42456 41122 gene locus_tag LOCUS_14880 42456 41122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 43531 42893 gene locus_tag LOCUS_14890 43531 42893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 45114 43549 gene locus_tag LOCUS_14900 45114 43549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 45509 46144 gene locus_tag LOCUS_14910 45509 46144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 46148 48892 gene locus_tag LOCUS_14920 46148 48892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 49116 51023 gene locus_tag LOCUS_14930 49116 51023 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776746.1 protein_id gnl|my_center|LOCUS_14930 51149 53047 gene locus_tag LOCUS_14940 51149 53047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 52977 53720 gene locus_tag LOCUS_14950 52977 53720 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112407.1 protein_id gnl|my_center|LOCUS_14950 54606 53701 gene locus_tag LOCUS_14960 gene rfbD 54606 53701 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974013.1 protein_id gnl|my_center|LOCUS_14960 55680 54613 gene locus_tag LOCUS_14970 gene rfbB 55680 54613 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077983494.1 protein_id gnl|my_center|LOCUS_14970 55851 56735 gene locus_tag LOCUS_14980 gene rfbA 55851 56735 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532727.1 protein_id gnl|my_center|LOCUS_14980 56732 57292 gene locus_tag LOCUS_14990 gene rfbC 56732 57292 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061738.1 protein_id gnl|my_center|LOCUS_14990 59696 57300 gene locus_tag LOCUS_15000 59696 57300 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975444.1 protein_id gnl|my_center|LOCUS_15000 62593 59906 gene locus_tag LOCUS_15010 62593 59906 CDS product galactosyltransferase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061911.1 protein_id gnl|my_center|LOCUS_15010 63888 62611 gene locus_tag LOCUS_15020 63888 62611 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975457.1 protein_id gnl|my_center|LOCUS_15020 65835 63934 gene locus_tag LOCUS_15030 gene nodQ 65835 63934 CDS product bifunctional sulfate adenylyltransferase/adenylyl-sulfate kinase NodQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970895.1 protein_id gnl|my_center|LOCUS_15030 66764 65835 gene locus_tag LOCUS_15040 gene cysD 66764 65835 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532711.1 protein_id gnl|my_center|LOCUS_15040 66943 68163 gene locus_tag LOCUS_15050 66943 68163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 68784 69098 gene locus_tag LOCUS_15060 68784 69098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 71905 69173 gene locus_tag LOCUS_15070 71905 69173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 74597 72288 gene locus_tag LOCUS_15080 74597 72288 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975444.1 protein_id gnl|my_center|LOCUS_15080 75094 74759 gene locus_tag LOCUS_15090 75094 74759 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969345.1 protein_id gnl|my_center|LOCUS_15090 76731 75145 gene locus_tag LOCUS_15100 76731 75145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 77450 76818 gene locus_tag LOCUS_15110 77450 76818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 77684 78847 gene locus_tag LOCUS_15120 77684 78847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 79232 78924 gene locus_tag LOCUS_15130 79232 78924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 79915 79232 gene locus_tag LOCUS_15140 79915 79232 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074390.1 protein_id gnl|my_center|LOCUS_15140 80803 80985 gene locus_tag LOCUS_15150 80803 80985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 81046 81396 gene locus_tag LOCUS_15160 81046 81396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 82191 81508 gene locus_tag LOCUS_15170 82191 81508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 82703 83704 gene locus_tag LOCUS_15180 82703 83704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 84049 85737 gene locus_tag LOCUS_15190 84049 85737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 85747 87126 gene locus_tag LOCUS_15200 85747 87126 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329916.1 protein_id gnl|my_center|LOCUS_15200 87217 88443 gene locus_tag LOCUS_15210 87217 88443 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075901854.1 protein_id gnl|my_center|LOCUS_15210 90057 88516 gene locus_tag LOCUS_15220 90057 88516 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387742.1 protein_id gnl|my_center|LOCUS_15220 90306 92153 gene locus_tag LOCUS_15230 90306 92153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 92227 92820 gene locus_tag LOCUS_15240 92227 92820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 94051 92795 gene locus_tag LOCUS_15250 94051 92795 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338425.1 protein_id gnl|my_center|LOCUS_15250 95122 94115 gene locus_tag LOCUS_15260 95122 94115 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984085.1 protein_id gnl|my_center|LOCUS_15260 96836 95115 gene locus_tag LOCUS_15270 96836 95115 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538035.1 protein_id gnl|my_center|LOCUS_15270 96950 97945 gene locus_tag LOCUS_15280 96950 97945 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175783.1 protein_id gnl|my_center|LOCUS_15280 98046 98198 gene locus_tag LOCUS_15290 98046 98198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence10 203 781 gene locus_tag LOCUS_15300 203 781 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967619.1 protein_id gnl|my_center|LOCUS_15300 2015 798 gene locus_tag LOCUS_15310 2015 798 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 protein_id gnl|my_center|LOCUS_15310 4561 2195 gene locus_tag LOCUS_15320 4561 2195 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965926.1 protein_id gnl|my_center|LOCUS_15320 4975 4637 gene locus_tag LOCUS_15330 4975 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 5183 6583 gene locus_tag LOCUS_15340 5183 6583 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524980.1 protein_id gnl|my_center|LOCUS_15340 6580 7761 gene locus_tag LOCUS_15350 6580 7761 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540302.1 protein_id gnl|my_center|LOCUS_15350 7820 8686 gene locus_tag LOCUS_15360 7820 8686 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815215.1 protein_id gnl|my_center|LOCUS_15360 8712 11447 gene locus_tag LOCUS_15370 8712 11447 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207762468.1 protein_id gnl|my_center|LOCUS_15370 12330 11500 gene locus_tag LOCUS_15380 12330 11500 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967600.1 protein_id gnl|my_center|LOCUS_15380 12530 13033 gene locus_tag LOCUS_15390 gene arsC 12530 13033 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971663.1 protein_id gnl|my_center|LOCUS_15390 13444 13118 gene locus_tag LOCUS_15400 13444 13118 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529048.1 protein_id gnl|my_center|LOCUS_15400 14210 13455 gene locus_tag LOCUS_15410 gene kduD 14210 13455 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919366.1 protein_id gnl|my_center|LOCUS_15410 15049 14207 gene locus_tag LOCUS_15420 gene kduI 15049 14207 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967114.1 protein_id gnl|my_center|LOCUS_15420 15811 15080 gene locus_tag LOCUS_15430 15811 15080 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525223.1 protein_id gnl|my_center|LOCUS_15430 16758 15811 gene locus_tag LOCUS_15440 16758 15811 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311331.1 protein_id gnl|my_center|LOCUS_15440 17850 16900 gene locus_tag LOCUS_15450 17850 16900 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967117.1 protein_id gnl|my_center|LOCUS_15450 19489 17975 gene locus_tag LOCUS_15460 19489 17975 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970125.1 protein_id gnl|my_center|LOCUS_15460 19613 20314 gene locus_tag LOCUS_15470 19613 20314 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845097.1 protein_id gnl|my_center|LOCUS_15470 21501 20425 gene locus_tag LOCUS_15480 21501 20425 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018012849.1 protein_id gnl|my_center|LOCUS_15480 21676 22656 gene locus_tag LOCUS_15490 21676 22656 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975769.1 protein_id gnl|my_center|LOCUS_15490 22790 24280 gene locus_tag LOCUS_15500 22790 24280 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061669.1 protein_id gnl|my_center|LOCUS_15500 24282 25292 gene locus_tag LOCUS_15510 24282 25292 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975767.1 protein_id gnl|my_center|LOCUS_15510 25304 26287 gene locus_tag LOCUS_15520 25304 26287 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527174.1 protein_id gnl|my_center|LOCUS_15520 26750 26307 gene locus_tag LOCUS_15530 gene rirA 26750 26307 CDS product iron-responsive transcriptional regulator RirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310047.1 protein_id gnl|my_center|LOCUS_15530 27828 26863 gene locus_tag LOCUS_15540 27828 26863 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928494.1 protein_id gnl|my_center|LOCUS_15540 29141 27909 gene locus_tag LOCUS_15550 29141 27909 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390089.1 protein_id gnl|my_center|LOCUS_15550 31499 29211 gene locus_tag LOCUS_15560 31499 29211 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470621.1 protein_id gnl|my_center|LOCUS_15560 32573 31647 gene locus_tag LOCUS_15570 32573 31647 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446272.1 protein_id gnl|my_center|LOCUS_15570 33564 32848 gene locus_tag LOCUS_15580 33564 32848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 35366 33561 gene locus_tag LOCUS_15590 35366 33561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387947.1 protein_id gnl|my_center|LOCUS_15590 37132 35363 gene locus_tag LOCUS_15600 37132 35363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140326.1 protein_id gnl|my_center|LOCUS_15600 37494 46586 gene locus_tag LOCUS_15610 37494 46586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 46586 49933 gene locus_tag LOCUS_15620 46586 49933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 49930 50700 gene locus_tag LOCUS_15630 49930 50700 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267336.1 protein_id gnl|my_center|LOCUS_15630 50715 51980 gene locus_tag LOCUS_15640 50715 51980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104612.1 protein_id gnl|my_center|LOCUS_15640 51961 53292 gene locus_tag LOCUS_15650 gene megL 51961 53292 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_15650 53289 54335 gene locus_tag LOCUS_15660 53289 54335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 55032 54298 gene locus_tag LOCUS_15670 55032 54298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 55298 59632 gene locus_tag LOCUS_15680 55298 59632 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973237.1 protein_id gnl|my_center|LOCUS_15680 59644 63669 gene locus_tag LOCUS_15690 59644 63669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 63666 66968 gene locus_tag LOCUS_15700 63666 66968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 66968 68185 gene locus_tag LOCUS_15710 gene dhbC 66968 68185 CDS product isochorismate synthase DhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243699.1 protein_id gnl|my_center|LOCUS_15710 68189 69841 gene locus_tag LOCUS_15720 68189 69841 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205428.1 protein_id gnl|my_center|LOCUS_15720 69845 70192 gene locus_tag LOCUS_15730 gene pchB 69845 70192 CDS product isochorismate lyase PchB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106950.1 protein_id gnl|my_center|LOCUS_15730 70196 73741 gene locus_tag LOCUS_15740 70196 73741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 74834 73785 gene locus_tag LOCUS_15750 74834 73785 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 protein_id gnl|my_center|LOCUS_15750 75487 74849 gene locus_tag LOCUS_15760 75487 74849 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976190.1 protein_id gnl|my_center|LOCUS_15760 76746 75484 gene locus_tag LOCUS_15770 76746 75484 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765391.1 protein_id gnl|my_center|LOCUS_15770 77431 76766 gene locus_tag LOCUS_15780 77431 76766 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 protein_id gnl|my_center|LOCUS_15780 78654 77578 gene locus_tag LOCUS_15790 78654 77578 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198096.1 protein_id gnl|my_center|LOCUS_15790 80407 78647 gene locus_tag LOCUS_15800 80407 78647 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205449.1 protein_id gnl|my_center|LOCUS_15800 81578 80472 gene locus_tag LOCUS_15810 81578 80472 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198094.1 protein_id gnl|my_center|LOCUS_15810 82745 81708 gene locus_tag LOCUS_15820 82745 81708 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139076345.1 protein_id gnl|my_center|LOCUS_15820 83815 82889 gene locus_tag LOCUS_15830 83815 82889 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016558605.1 protein_id gnl|my_center|LOCUS_15830 83997 86567 gene locus_tag LOCUS_15840 gene acnA 83997 86567 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974570.1 protein_id gnl|my_center|LOCUS_15840 86757 87137 gene locus_tag LOCUS_15850 86757 87137 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464385.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence11 567 875 gene locus_tag LOCUS_15860 567 875 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400478.1 protein_id gnl|my_center|LOCUS_15860 1025 2071 gene locus_tag LOCUS_15870 gene pdhA 1025 2071 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975252.1 protein_id gnl|my_center|LOCUS_15870 2089 3486 gene locus_tag LOCUS_15880 2089 3486 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975253.1 protein_id gnl|my_center|LOCUS_15880 3502 4860 gene locus_tag LOCUS_15890 3502 4860 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874322.1 protein_id gnl|my_center|LOCUS_15890 4989 5381 gene locus_tag LOCUS_15900 4989 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 5378 6019 gene locus_tag LOCUS_15910 5378 6019 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328148.1 protein_id gnl|my_center|LOCUS_15910 6080 6346 gene locus_tag LOCUS_15920 6080 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 6435 7880 gene locus_tag LOCUS_15930 gene lpdA 6435 7880 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312480.1 protein_id gnl|my_center|LOCUS_15930 8098 9075 gene locus_tag LOCUS_15940 gene lipA 8098 9075 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971620.1 protein_id gnl|my_center|LOCUS_15940 9134 10195 gene locus_tag LOCUS_15950 9134 10195 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182165467.1 protein_id gnl|my_center|LOCUS_15950 10376 10942 gene locus_tag LOCUS_15960 10376 10942 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971624.1 protein_id gnl|my_center|LOCUS_15960 10952 11401 gene locus_tag LOCUS_15970 10952 11401 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315362.1 protein_id gnl|my_center|LOCUS_15970 11459 12322 gene locus_tag LOCUS_15980 11459 12322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 12827 12324 gene locus_tag LOCUS_15990 12827 12324 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975261.1 protein_id gnl|my_center|LOCUS_15990 14035 12824 gene locus_tag LOCUS_16000 14035 12824 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033044475.1 protein_id gnl|my_center|LOCUS_16000 14206 15207 gene locus_tag LOCUS_16010 gene dusB 14206 15207 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383211.1 protein_id gnl|my_center|LOCUS_16010 15204 16352 gene locus_tag LOCUS_16020 15204 16352 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393483.1 protein_id gnl|my_center|LOCUS_16020 16352 17806 gene locus_tag LOCUS_16030 gene ntrC 16352 17806 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975265.1 protein_id gnl|my_center|LOCUS_16030 18005 20287 gene locus_tag LOCUS_16040 18005 20287 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244644.1 protein_id gnl|my_center|LOCUS_16040 20277 21641 gene locus_tag LOCUS_16050 gene ntrX 20277 21641 CDS product two-component system response regulator NtrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328161.1 protein_id gnl|my_center|LOCUS_16050 21666 23048 gene locus_tag LOCUS_16060 gene trkA 21666 23048 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535437.1 protein_id gnl|my_center|LOCUS_16060 23087 23950 gene locus_tag LOCUS_16070 23087 23950 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969239.1 protein_id gnl|my_center|LOCUS_16070 24048 24290 gene locus_tag LOCUS_16080 gene hfq 24048 24290 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535434.1 protein_id gnl|my_center|LOCUS_16080 24368 25690 gene locus_tag LOCUS_16090 gene hflX 24368 25690 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244647.1 protein_id gnl|my_center|LOCUS_16090 26714 25878 gene locus_tag LOCUS_16100 gene mazG 26714 25878 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383231.1 protein_id gnl|my_center|LOCUS_16100 27310 26723 gene locus_tag LOCUS_16110 27310 26723 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971632.1 protein_id gnl|my_center|LOCUS_16110 27508 28947 gene locus_tag LOCUS_16120 gene cysG 27508 28947 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393480.1 protein_id gnl|my_center|LOCUS_16120 28949 29266 gene locus_tag LOCUS_16130 28949 29266 CDS product DUF2849 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328167.1 protein_id gnl|my_center|LOCUS_16130 29276 30949 gene locus_tag LOCUS_16140 29276 30949 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244652.1 protein_id gnl|my_center|LOCUS_16140 30961 31461 gene locus_tag LOCUS_16150 30961 31461 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969243.1 protein_id gnl|my_center|LOCUS_16150 31674 32489 gene locus_tag LOCUS_16160 31674 32489 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393477.1 protein_id gnl|my_center|LOCUS_16160 33164 32544 gene locus_tag LOCUS_16170 33164 32544 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244654.1 protein_id gnl|my_center|LOCUS_16170 34670 33315 gene locus_tag LOCUS_16180 34670 33315 CDS product M10 family metallopeptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392401.1 protein_id gnl|my_center|LOCUS_16180 34857 35078 gene locus_tag LOCUS_16190 34857 35078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 35276 36577 gene locus_tag LOCUS_16200 35276 36577 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 protein_id gnl|my_center|LOCUS_16200 36683 40036 gene locus_tag LOCUS_16210 36683 40036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 40104 40997 gene locus_tag LOCUS_16220 40104 40997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 41144 42676 gene locus_tag LOCUS_16230 41144 42676 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086389.1 protein_id gnl|my_center|LOCUS_16230 42676 44229 gene locus_tag LOCUS_16240 42676 44229 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388622.1 protein_id gnl|my_center|LOCUS_16240 44789 44448 gene locus_tag LOCUS_16250 44789 44448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 44981 44906 gene locus_tag LOCUS_t00070 44981 44906 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 45211 45960 gene locus_tag LOCUS_16260 45211 45960 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401893.1 protein_id gnl|my_center|LOCUS_16260 46101 47063 gene locus_tag LOCUS_16270 46101 47063 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401896.1 protein_id gnl|my_center|LOCUS_16270 48239 47031 gene locus_tag LOCUS_16280 48239 47031 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844473.1 protein_id gnl|my_center|LOCUS_16280 48482 49204 gene locus_tag LOCUS_16290 gene pcs 48482 49204 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401899.1 protein_id gnl|my_center|LOCUS_16290 49229 50200 gene locus_tag LOCUS_16300 49229 50200 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401901.1 protein_id gnl|my_center|LOCUS_16300 50282 51820 gene locus_tag LOCUS_16310 50282 51820 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401904.1 protein_id gnl|my_center|LOCUS_16310 51810 52904 gene locus_tag LOCUS_16320 51810 52904 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328321.1 protein_id gnl|my_center|LOCUS_16320 52904 53824 gene locus_tag LOCUS_16330 52904 53824 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328322.1 protein_id gnl|my_center|LOCUS_16330 53876 54946 gene locus_tag LOCUS_16340 53876 54946 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314293.1 protein_id gnl|my_center|LOCUS_16340 55213 55956 gene locus_tag LOCUS_16350 55213 55956 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401907.1 protein_id gnl|my_center|LOCUS_16350 57780 55996 gene locus_tag LOCUS_16360 gene ybaL 57780 55996 CDS product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529559.1 protein_id gnl|my_center|LOCUS_16360 58207 57860 gene locus_tag LOCUS_16370 58207 57860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 58496 58233 gene locus_tag LOCUS_16380 58496 58233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328763.1 protein_id gnl|my_center|LOCUS_16380 59103 58579 gene locus_tag LOCUS_16390 59103 58579 CDS product DUF992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973508.1 protein_id gnl|my_center|LOCUS_16390 59506 59294 gene locus_tag LOCUS_16400 59506 59294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313906.1 protein_id gnl|my_center|LOCUS_16400 59898 59987 gene locus_tag LOCUS_t00080 59898 59987 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 62311 60194 gene locus_tag LOCUS_16410 62311 60194 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974935.1 protein_id gnl|my_center|LOCUS_16410 62540 63439 gene locus_tag LOCUS_16420 62540 63439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528199.1 protein_id gnl|my_center|LOCUS_16420 64665 63580 gene locus_tag LOCUS_16430 64665 63580 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140099.1 protein_id gnl|my_center|LOCUS_16430 64955 65920 gene locus_tag LOCUS_16440 64955 65920 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061685.1 protein_id gnl|my_center|LOCUS_16440 65986 66180 gene locus_tag LOCUS_16450 65986 66180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 66255 66467 gene locus_tag LOCUS_16460 66255 66467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 66540 67517 gene locus_tag LOCUS_16470 66540 67517 CDS product HWE histidine kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336896.1 protein_id gnl|my_center|LOCUS_16470 67526 67900 gene locus_tag LOCUS_16480 67526 67900 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336897.1 protein_id gnl|my_center|LOCUS_16480 68115 67912 gene locus_tag LOCUS_16490 68115 67912 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035216621.1 protein_id gnl|my_center|LOCUS_16490 68460 69233 gene locus_tag LOCUS_16500 68460 69233 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920133.1 protein_id gnl|my_center|LOCUS_16500 69398 72529 gene locus_tag LOCUS_16510 69398 72529 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189169828.1 protein_id gnl|my_center|LOCUS_16510 72667 73008 gene locus_tag LOCUS_16520 72667 73008 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257518.1 protein_id gnl|my_center|LOCUS_16520 73005 73928 gene locus_tag LOCUS_16530 73005 73928 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972680.1 protein_id gnl|my_center|LOCUS_16530 74528 74088 gene locus_tag LOCUS_16540 74528 74088 CDS product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975918.1 protein_id gnl|my_center|LOCUS_16540 74817 75791 gene locus_tag LOCUS_16550 74817 75791 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984186.1 protein_id gnl|my_center|LOCUS_16550 76532 75933 gene locus_tag LOCUS_16560 76532 75933 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328111.1 protein_id gnl|my_center|LOCUS_16560 77629 77018 gene locus_tag LOCUS_16570 77629 77018 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534682.1 protein_id gnl|my_center|LOCUS_16570 78410 77775 gene locus_tag LOCUS_16580 78410 77775 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577809.1 protein_id gnl|my_center|LOCUS_16580 78703 79443 gene locus_tag LOCUS_16590 78703 79443 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534691.1 protein_id gnl|my_center|LOCUS_16590 79630 80058 gene locus_tag LOCUS_16600 79630 80058 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975223.1 protein_id gnl|my_center|LOCUS_16600 81101 80139 gene locus_tag LOCUS_16610 81101 80139 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328117.1 protein_id gnl|my_center|LOCUS_16610 81352 81095 gene locus_tag LOCUS_16620 81352 81095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 81915 81463 gene locus_tag LOCUS_16630 gene hisI 81915 81463 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534698.1 protein_id gnl|my_center|LOCUS_16630 82603 81992 gene locus_tag LOCUS_16640 gene folE 82603 81992 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026613810.1 protein_id gnl|my_center|LOCUS_16640 82998 83444 gene locus_tag LOCUS_16650 82998 83444 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328120.1 protein_id gnl|my_center|LOCUS_16650 83451 83816 gene locus_tag LOCUS_16660 gene yidD 83451 83816 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534704.1 protein_id gnl|my_center|LOCUS_16660 83821 84240 gene locus_tag LOCUS_16670 83821 84240 CDS product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534706.1 protein_id gnl|my_center|LOCUS_16670 84237 84764 gene locus_tag LOCUS_16680 84237 84764 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314347.1 protein_id gnl|my_center|LOCUS_16680 85351 84767 gene locus_tag LOCUS_16690 85351 84767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 86299 85472 gene locus_tag LOCUS_16700 86299 85472 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395831.1 protein_id gnl|my_center|LOCUS_16700 86498 87415 gene locus_tag LOCUS_16710 gene prmB 86498 87415 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090207.1 protein_id gnl|my_center|LOCUS_16710 87697 89394 gene locus_tag LOCUS_16720 87697 89394 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929046.1 protein_id gnl|my_center|LOCUS_16720 89632 91602 gene locus_tag LOCUS_16730 gene thrS 89632 91602 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534711.1 protein_id gnl|my_center|LOCUS_16730 91730 92578 gene locus_tag LOCUS_16740 91730 92578 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531975.1 protein_id gnl|my_center|LOCUS_16740 93651 92659 gene locus_tag LOCUS_16750 93651 92659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534713.1 protein_id gnl|my_center|LOCUS_16750 93753 94337 gene locus_tag LOCUS_16760 93753 94337 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328127.1 protein_id gnl|my_center|LOCUS_16760 94327 94950 gene locus_tag LOCUS_16770 94327 94950 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971839.1 protein_id gnl|my_center|LOCUS_16770 95633 94989 gene locus_tag LOCUS_16780 95633 94989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 95832 96890 gene locus_tag LOCUS_16790 95832 96890 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328130.1 protein_id gnl|my_center|LOCUS_16790 97457 97032 gene locus_tag LOCUS_16800 97457 97032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400454.1 protein_id gnl|my_center|LOCUS_16800 99668 97611 gene locus_tag LOCUS_16810 gene parE 99668 97611 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534725.1 protein_id gnl|my_center|LOCUS_16810 99947 100831 gene locus_tag LOCUS_16820 99947 100831 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018011123.1 protein_id gnl|my_center|LOCUS_16820 101521 100925 gene locus_tag LOCUS_16830 101521 100925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 103133 101547 gene locus_tag LOCUS_16840 103133 101547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 103284 104054 gene locus_tag LOCUS_16850 gene tpiA 103284 104054 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400467.1 protein_id gnl|my_center|LOCUS_16850 104320 104802 gene locus_tag LOCUS_16860 gene secG 104320 104802 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975245.1 protein_id gnl|my_center|LOCUS_16860 104941 106578 gene locus_tag LOCUS_16870 104941 106578 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975246.1 protein_id gnl|my_center|LOCUS_16870 108081 106858 gene locus_tag LOCUS_16880 108081 106858 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401429.1 protein_id gnl|my_center|LOCUS_16880 108201 108791 gene locus_tag LOCUS_16890 108201 108791 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782279.1 protein_id gnl|my_center|LOCUS_16890 109950 108799 gene locus_tag LOCUS_16900 109950 108799 CDS product ceramide glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533639.1 protein_id gnl|my_center|LOCUS_16900 110880 110335 gene locus_tag LOCUS_16910 110880 110335 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066818.1 protein_id gnl|my_center|LOCUS_16910 110982 111935 gene locus_tag LOCUS_16920 110982 111935 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537828.1 protein_id gnl|my_center|LOCUS_16920 113576 112155 gene locus_tag LOCUS_16930 113576 112155 CDS product bifunctional serine/threonine-protein kinase/universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088428.1 protein_id gnl|my_center|LOCUS_16930 114316 113576 gene locus_tag LOCUS_16940 114316 113576 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088429.1 protein_id gnl|my_center|LOCUS_16940 115501 114416 gene locus_tag LOCUS_16950 115501 114416 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973590.1 protein_id gnl|my_center|LOCUS_16950 115732 116697 gene locus_tag LOCUS_16960 115732 116697 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328141.1 protein_id gnl|my_center|LOCUS_16960 116699 117538 gene locus_tag LOCUS_16970 gene kdsA 116699 117538 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534735.1 protein_id gnl|my_center|LOCUS_16970 117669 118943 gene locus_tag LOCUS_16980 gene eno 117669 118943 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975249.1 protein_id gnl|my_center|LOCUS_16980 119321 119223 gene locus_tag LOCUS_t00090 119321 119223 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 120185 119259 gene locus_tag LOCUS_16990 120185 119259 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969480.1 protein_id gnl|my_center|LOCUS_16990 121167 120220 gene locus_tag LOCUS_17000 121167 120220 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396535.1 protein_id gnl|my_center|LOCUS_17000 121445 122494 gene locus_tag LOCUS_17010 gene recA 121445 122494 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708181.1 protein_id gnl|my_center|LOCUS_17010 122808 125468 gene locus_tag LOCUS_17020 gene alaS 122808 125468 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240440.1 protein_id gnl|my_center|LOCUS_17020 125840 127033 gene locus_tag LOCUS_17030 125840 127033 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971503.1 protein_id gnl|my_center|LOCUS_17030 128775 127102 gene locus_tag LOCUS_17040 128775 127102 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969476.1 protein_id gnl|my_center|LOCUS_17040 128960 129829 gene locus_tag LOCUS_17050 128960 129829 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396530.1 protein_id gnl|my_center|LOCUS_17050 130493 129858 gene locus_tag LOCUS_17060 130493 129858 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314066.1 protein_id gnl|my_center|LOCUS_17060 131819 130605 gene locus_tag LOCUS_17070 131819 130605 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037385982.1 protein_id gnl|my_center|LOCUS_17070 132035 132616 gene locus_tag LOCUS_17080 132035 132616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992313.1 protein_id gnl|my_center|LOCUS_17080 132686 133519 gene locus_tag LOCUS_17090 132686 133519 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240436.1 protein_id gnl|my_center|LOCUS_17090 133557 134318 gene locus_tag LOCUS_17100 gene murI 133557 134318 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975669.1 protein_id gnl|my_center|LOCUS_17100 134439 135950 gene locus_tag LOCUS_17110 134439 135950 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969467.1 protein_id gnl|my_center|LOCUS_17110 136170 136787 gene locus_tag LOCUS_17120 gene rpsD 136170 136787 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533017.1 protein_id gnl|my_center|LOCUS_17120 137036 137956 gene locus_tag LOCUS_17130 137036 137956 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328488.1 protein_id gnl|my_center|LOCUS_17130 137988 138869 gene locus_tag LOCUS_17140 gene ttcA 137988 138869 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240432.1 protein_id gnl|my_center|LOCUS_17140 138856 139677 gene locus_tag LOCUS_17150 138856 139677 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975664.1 protein_id gnl|my_center|LOCUS_17150 141180 139933 gene locus_tag LOCUS_17160 141180 139933 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971915.1 protein_id gnl|my_center|LOCUS_17160 141604 141269 gene locus_tag LOCUS_17170 gene grxD 141604 141269 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708163.1 protein_id gnl|my_center|LOCUS_17170 142137 141721 gene locus_tag LOCUS_17180 142137 141721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 142443 142180 gene locus_tag LOCUS_17190 142443 142180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173516618.1 protein_id gnl|my_center|LOCUS_17190 142684 142451 gene locus_tag LOCUS_17200 142684 142451 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531391.1 protein_id gnl|my_center|LOCUS_17200 144940 142703 gene locus_tag LOCUS_17210 gene purL 144940 142703 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251802.1 protein_id gnl|my_center|LOCUS_17210 144828 145100 gene locus_tag LOCUS_17220 144828 145100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 146462 145044 gene locus_tag LOCUS_17230 146462 145044 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396508.1 protein_id gnl|my_center|LOCUS_17230 146558 146773 gene locus_tag LOCUS_17240 146558 146773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 147199 146783 gene locus_tag LOCUS_17250 147199 146783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314093.1 protein_id gnl|my_center|LOCUS_17250 147894 147223 gene locus_tag LOCUS_17260 gene purQ 147894 147223 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396502.1 protein_id gnl|my_center|LOCUS_17260 148148 147891 gene locus_tag LOCUS_17270 148148 147891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 148410 148168 gene locus_tag LOCUS_17280 gene purS 148410 148168 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531405.1 protein_id gnl|my_center|LOCUS_17280 149203 148439 gene locus_tag LOCUS_17290 149203 148439 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975652.1 protein_id gnl|my_center|LOCUS_17290 149419 149739 gene locus_tag LOCUS_17300 149419 149739 CDS product ATPase inhibitor subunit zeta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531408.1 protein_id gnl|my_center|LOCUS_17300 152393 149805 gene locus_tag LOCUS_17310 152393 149805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 153039 152479 gene locus_tag LOCUS_17320 153039 152479 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240413.1 protein_id gnl|my_center|LOCUS_17320 153209 154012 gene locus_tag LOCUS_17330 153209 154012 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383546.1 protein_id gnl|my_center|LOCUS_17330 154345 154109 gene locus_tag LOCUS_17340 154345 154109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 155755 154448 gene locus_tag LOCUS_17350 gene purB 155755 154448 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971906.1 protein_id gnl|my_center|LOCUS_17350 156350 155820 gene locus_tag LOCUS_17360 156350 155820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969446.1 protein_id gnl|my_center|LOCUS_17360 157087 156353 gene locus_tag LOCUS_17370 157087 156353 CDS product DUF2259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392934.1 protein_id gnl|my_center|LOCUS_17370 157761 157084 gene locus_tag LOCUS_17380 gene rpe 157761 157084 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975644.1 protein_id gnl|my_center|LOCUS_17380 158831 157830 gene locus_tag LOCUS_17390 158831 157830 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392939.1 protein_id gnl|my_center|LOCUS_17390 159895 158831 gene locus_tag LOCUS_17400 159895 158831 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253217.1 protein_id gnl|my_center|LOCUS_17400 160071 160565 gene locus_tag LOCUS_17410 160071 160565 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392944.1 protein_id gnl|my_center|LOCUS_17410 160593 161519 gene locus_tag LOCUS_17420 160593 161519 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969441.1 protein_id gnl|my_center|LOCUS_17420 161523 162764 gene locus_tag LOCUS_17430 161523 162764 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392949.1 protein_id gnl|my_center|LOCUS_17430 162775 163101 gene locus_tag LOCUS_17440 162775 163101 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975638.1 protein_id gnl|my_center|LOCUS_17440 163101 163799 gene locus_tag LOCUS_17450 163101 163799 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532111.1 protein_id gnl|my_center|LOCUS_17450 163817 165406 gene locus_tag LOCUS_17460 163817 165406 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392955.1 protein_id gnl|my_center|LOCUS_17460 165410 165727 gene locus_tag LOCUS_17470 165410 165727 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383518.1 protein_id gnl|my_center|LOCUS_17470 165836 167950 gene locus_tag LOCUS_17480 165836 167950 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396106.1 protein_id gnl|my_center|LOCUS_17480 168361 167951 gene locus_tag LOCUS_17490 168361 167951 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531455.1 protein_id gnl|my_center|LOCUS_17490 169869 168370 gene locus_tag LOCUS_17500 169869 168370 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969437.1 protein_id gnl|my_center|LOCUS_17500 171343 170063 gene locus_tag LOCUS_17510 171343 170063 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392990.1 protein_id gnl|my_center|LOCUS_17510 172265 171438 gene locus_tag LOCUS_17520 172265 171438 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650909.1 protein_id gnl|my_center|LOCUS_17520 172755 172288 gene locus_tag LOCUS_17530 gene bcp 172755 172288 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971896.1 protein_id gnl|my_center|LOCUS_17530 172905 176297 gene locus_tag LOCUS_17540 172905 176297 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392970.1 protein_id gnl|my_center|LOCUS_17540 177700 176447 gene locus_tag LOCUS_17550 gene tyrS 177700 176447 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240393.1 protein_id gnl|my_center|LOCUS_17550 177831 178964 gene locus_tag LOCUS_17560 177831 178964 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435942.1 protein_id gnl|my_center|LOCUS_17560 179055 180233 gene locus_tag LOCUS_17570 179055 180233 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393001.1 protein_id gnl|my_center|LOCUS_17570 180985 180308 gene locus_tag LOCUS_17580 180985 180308 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531477.1 protein_id gnl|my_center|LOCUS_17580 181200 182369 gene locus_tag LOCUS_17590 181200 182369 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253209.1 protein_id gnl|my_center|LOCUS_17590 182508 183977 gene locus_tag LOCUS_17600 gene sufB 182508 183977 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531481.1 protein_id gnl|my_center|LOCUS_17600 184092 184253 gene locus_tag LOCUS_17610 184092 184253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 184302 185057 gene locus_tag LOCUS_17620 gene sufC 184302 185057 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531483.1 protein_id gnl|my_center|LOCUS_17620 185082 186356 gene locus_tag LOCUS_17630 gene sufD 185082 186356 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975621.1 protein_id gnl|my_center|LOCUS_17630 186423 187661 gene locus_tag LOCUS_17640 186423 187661 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393009.1 protein_id gnl|my_center|LOCUS_17640 187674 188054 gene locus_tag LOCUS_17650 187674 188054 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018239791.1 protein_id gnl|my_center|LOCUS_17650 188340 188732 gene locus_tag LOCUS_17660 gene sufA 188340 188732 CDS product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253204.1 protein_id gnl|my_center|LOCUS_17660 188952 190817 gene locus_tag LOCUS_17670 188952 190817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 190801 191208 gene locus_tag LOCUS_17680 190801 191208 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889309.1 protein_id gnl|my_center|LOCUS_17680 194245 191375 gene locus_tag LOCUS_17690 gene gcvP 194245 191375 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969293.1 protein_id gnl|my_center|LOCUS_17690 194607 194245 gene locus_tag LOCUS_17700 gene gcvH 194607 194245 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971640.1 protein_id gnl|my_center|LOCUS_17700 195920 194781 gene locus_tag LOCUS_17710 gene gcvT 195920 194781 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129718.1 protein_id gnl|my_center|LOCUS_17710 196615 196334 gene locus_tag LOCUS_17720 196615 196334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 196830 197066 gene locus_tag LOCUS_17730 196830 197066 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313966.1 protein_id gnl|my_center|LOCUS_17730 197138 198130 gene locus_tag LOCUS_17740 197138 198130 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975196.1 protein_id gnl|my_center|LOCUS_17740 198130 198795 gene locus_tag LOCUS_17750 198130 198795 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537405.1 protein_id gnl|my_center|LOCUS_17750 198788 199573 gene locus_tag LOCUS_17760 198788 199573 CDS product ATP12 family chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975194.1 protein_id gnl|my_center|LOCUS_17760 199647 200297 gene locus_tag LOCUS_17770 199647 200297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 200400 200783 gene locus_tag LOCUS_17780 200400 200783 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214914.1 protein_id gnl|my_center|LOCUS_17780 201109 200795 gene locus_tag LOCUS_17790 gene sugE 201109 200795 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240659.1 protein_id gnl|my_center|LOCUS_17790 202099 201266 gene locus_tag LOCUS_17800 gene fghA 202099 201266 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969204.1 protein_id gnl|my_center|LOCUS_17800 202776 202120 gene locus_tag LOCUS_17810 202776 202120 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328088.1 protein_id gnl|my_center|LOCUS_17810 203234 202773 gene locus_tag LOCUS_17820 203234 202773 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975200.1 protein_id gnl|my_center|LOCUS_17820 203738 203274 gene locus_tag LOCUS_17830 203738 203274 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038584.1 protein_id gnl|my_center|LOCUS_17830 204862 203735 gene locus_tag LOCUS_17840 204862 203735 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384665.1 protein_id gnl|my_center|LOCUS_17840 205349 204945 gene locus_tag LOCUS_17850 205349 204945 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536742.1 protein_id gnl|my_center|LOCUS_17850 205493 206443 gene locus_tag LOCUS_17860 205493 206443 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992293.1 protein_id gnl|my_center|LOCUS_17860 206535 207779 gene locus_tag LOCUS_17870 206535 207779 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531110.1 protein_id gnl|my_center|LOCUS_17870 208498 207752 gene locus_tag LOCUS_17880 gene lipB 208498 207752 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536740.1 protein_id gnl|my_center|LOCUS_17880 208693 208777 gene locus_tag LOCUS_t00100 208693 208777 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 209118 208870 gene locus_tag LOCUS_17890 209118 208870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 209714 209220 gene locus_tag LOCUS_17900 209714 209220 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328099.1 protein_id gnl|my_center|LOCUS_17900 210018 211448 gene locus_tag LOCUS_17910 gene mgtE 210018 211448 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244592.1 protein_id gnl|my_center|LOCUS_17910 211566 211952 gene locus_tag LOCUS_17920 211566 211952 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003515319.1 protein_id gnl|my_center|LOCUS_17920 212433 211960 gene locus_tag LOCUS_17930 212433 211960 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969210.1 protein_id gnl|my_center|LOCUS_17930 213457 212438 gene locus_tag LOCUS_17940 213457 212438 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244595.1 protein_id gnl|my_center|LOCUS_17940 214240 213551 gene locus_tag LOCUS_17950 214240 213551 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844304.1 protein_id gnl|my_center|LOCUS_17950 214886 216217 gene locus_tag LOCUS_17960 214886 216217 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328106.1 protein_id gnl|my_center|LOCUS_17960 216294 216731 gene locus_tag LOCUS_17970 216294 216731 CDS product DUF1489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328107.1 protein_id gnl|my_center|LOCUS_17970 216815 217849 gene locus_tag LOCUS_17980 216815 217849 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215921.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17980 218852 217836 gene locus_tag LOCUS_17990 218852 217836 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068883688.1 protein_id gnl|my_center|LOCUS_17990 219186 218914 gene locus_tag LOCUS_18000 219186 218914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969213.1 protein_id gnl|my_center|LOCUS_18000 220716 219352 gene locus_tag LOCUS_18010 220716 219352 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244600.1 protein_id gnl|my_center|LOCUS_18010 221697 220936 gene locus_tag LOCUS_18020 221697 220936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401782.1 protein_id gnl|my_center|LOCUS_18020 221951 222166 gene locus_tag LOCUS_18030 221951 222166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 222369 223385 gene locus_tag LOCUS_18040 222369 223385 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396470.1 protein_id gnl|my_center|LOCUS_18040 223463 224626 gene locus_tag LOCUS_18050 223463 224626 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328465.1 protein_id gnl|my_center|LOCUS_18050 224735 225418 gene locus_tag LOCUS_18060 gene tmk 224735 225418 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969339.1 protein_id gnl|my_center|LOCUS_18060 225415 226446 gene locus_tag LOCUS_18070 225415 226446 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969338.1 protein_id gnl|my_center|LOCUS_18070 226524 228074 gene locus_tag LOCUS_18080 gene metG 226524 228074 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975450.1 protein_id gnl|my_center|LOCUS_18080 228075 228854 gene locus_tag LOCUS_18090 228075 228854 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528321.1 protein_id gnl|my_center|LOCUS_18090 228857 229684 gene locus_tag LOCUS_18100 228857 229684 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396450.1 protein_id gnl|my_center|LOCUS_18100 230628 229672 gene locus_tag LOCUS_18110 230628 229672 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032931383.1 protein_id gnl|my_center|LOCUS_18110 231020 231541 gene locus_tag LOCUS_18120 231020 231541 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327899.1 protein_id gnl|my_center|LOCUS_18120 231755 232171 gene locus_tag LOCUS_18130 231755 232171 CDS product DUF4864 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909625.1 protein_id gnl|my_center|LOCUS_18130 233326 232196 gene locus_tag LOCUS_18140 gene tgt 233326 232196 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328449.1 protein_id gnl|my_center|LOCUS_18140 234390 233323 gene locus_tag LOCUS_18150 gene queA 234390 233323 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975428.1 protein_id gnl|my_center|LOCUS_18150 234848 234399 gene locus_tag LOCUS_18160 234848 234399 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531824.1 protein_id gnl|my_center|LOCUS_18160 235444 234929 gene locus_tag LOCUS_18170 235444 234929 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529604.1 protein_id gnl|my_center|LOCUS_18170 236096 235527 gene locus_tag LOCUS_18180 236096 235527 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328446.1 protein_id gnl|my_center|LOCUS_18180 236624 236130 gene locus_tag LOCUS_18190 gene coaD 236624 236130 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383413.1 protein_id gnl|my_center|LOCUS_18190 236874 236999 gene locus_tag LOCUS_18200 236874 236999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 237013 237159 gene locus_tag LOCUS_18210 237013 237159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 240092 237381 gene locus_tag LOCUS_18220 gene gyrA 240092 237381 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037436050.1 protein_id gnl|my_center|LOCUS_18220 240404 241033 gene locus_tag LOCUS_18230 240404 241033 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969300.1 protein_id gnl|my_center|LOCUS_18230 241768 241361 gene locus_tag LOCUS_18240 241768 241361 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163086.1 protein_id gnl|my_center|LOCUS_18240 242352 241849 gene locus_tag LOCUS_18250 242352 241849 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240374.1 protein_id gnl|my_center|LOCUS_18250 242644 245562 gene locus_tag LOCUS_18260 gene uvrA 242644 245562 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975397.1 protein_id gnl|my_center|LOCUS_18260 245567 246190 gene locus_tag LOCUS_18270 245567 246190 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084232.1 protein_id gnl|my_center|LOCUS_18270 246228 247031 gene locus_tag LOCUS_18280 246228 247031 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969299.1 protein_id gnl|my_center|LOCUS_18280 247812 247081 gene locus_tag LOCUS_18290 247812 247081 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967295.1 protein_id gnl|my_center|LOCUS_18290 249372 247888 gene locus_tag LOCUS_18300 249372 247888 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969363.1 protein_id gnl|my_center|LOCUS_18300 249739 250077 gene locus_tag LOCUS_18310 249739 250077 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975544.1 protein_id gnl|my_center|LOCUS_18310 250138 251547 gene locus_tag LOCUS_18320 gene glnA 250138 251547 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328343.1 protein_id gnl|my_center|LOCUS_18320 252816 251785 gene locus_tag LOCUS_18330 252816 251785 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339192.1 protein_id gnl|my_center|LOCUS_18330 253928 252885 gene locus_tag LOCUS_18340 253928 252885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 254081 254413 gene locus_tag LOCUS_18350 gene hspQ 254081 254413 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528052.1 protein_id gnl|my_center|LOCUS_18350 255114 254488 gene locus_tag LOCUS_18360 255114 254488 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528049.1 protein_id gnl|my_center|LOCUS_18360 255390 257201 gene locus_tag LOCUS_18370 255390 257201 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969364.1 protein_id gnl|my_center|LOCUS_18370 257398 258069 gene locus_tag LOCUS_18380 257398 258069 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240310.1 protein_id gnl|my_center|LOCUS_18380 258708 258076 gene locus_tag LOCUS_18390 258708 258076 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532149.1 protein_id gnl|my_center|LOCUS_18390 262281 258775 gene locus_tag LOCUS_18400 gene mfd 262281 258775 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969372.1 protein_id gnl|my_center|LOCUS_18400 262697 262278 gene locus_tag LOCUS_18410 262697 262278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 262708 264801 gene locus_tag LOCUS_18420 gene recG 262708 264801 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969373.1 protein_id gnl|my_center|LOCUS_18420 264901 265116 gene locus_tag LOCUS_18430 264901 265116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018010623.1 protein_id gnl|my_center|LOCUS_18430 266132 265440 gene locus_tag LOCUS_18440 266132 265440 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392752.1 protein_id gnl|my_center|LOCUS_18440 266665 266168 gene locus_tag LOCUS_18450 266665 266168 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707040.1 protein_id gnl|my_center|LOCUS_18450 268488 266662 gene locus_tag LOCUS_18460 gene glmS 268488 266662 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969375.1 protein_id gnl|my_center|LOCUS_18460 269976 268603 gene locus_tag LOCUS_18470 gene glmU 269976 268603 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533259.1 protein_id gnl|my_center|LOCUS_18470 271771 270122 gene locus_tag LOCUS_18480 271771 270122 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328331.1 protein_id gnl|my_center|LOCUS_18480 272053 273942 gene locus_tag LOCUS_18490 272053 273942 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969377.1 protein_id gnl|my_center|LOCUS_18490 273958 274980 gene locus_tag LOCUS_18500 gene trpD 273958 274980 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328329.1 protein_id gnl|my_center|LOCUS_18500 274989 275804 gene locus_tag LOCUS_18510 gene trpC 274989 275804 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314425.1 protein_id gnl|my_center|LOCUS_18510 275818 276315 gene locus_tag LOCUS_18520 gene moaC 275818 276315 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969379.1 protein_id gnl|my_center|LOCUS_18520 276315 277538 gene locus_tag LOCUS_18530 276315 277538 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328326.1 protein_id gnl|my_center|LOCUS_18530 277637 278356 gene locus_tag LOCUS_18540 gene lexA 277637 278356 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240339.1 protein_id gnl|my_center|LOCUS_18540 280662 278347 gene locus_tag LOCUS_18550 280662 278347 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129945.1 protein_id gnl|my_center|LOCUS_18550 280588 280869 gene locus_tag LOCUS_18560 280588 280869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 281111 282400 gene locus_tag LOCUS_18570 gene gltA 281111 282400 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328205.1 protein_id gnl|my_center|LOCUS_18570 283608 282430 gene locus_tag LOCUS_18580 gene lpxB 283608 282430 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393442.1 protein_id gnl|my_center|LOCUS_18580 284483 283605 gene locus_tag LOCUS_18590 284483 283605 CDS product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969262.1 protein_id gnl|my_center|LOCUS_18590 285298 284489 gene locus_tag LOCUS_18600 gene lpxA 285298 284489 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244681.1 protein_id gnl|my_center|LOCUS_18600 285768 285301 gene locus_tag LOCUS_18610 gene fabZ 285768 285301 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969260.1 protein_id gnl|my_center|LOCUS_18610 286828 285761 gene locus_tag LOCUS_18620 gene lpxD 286828 285761 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969259.1 protein_id gnl|my_center|LOCUS_18620 289151 286878 gene locus_tag LOCUS_18630 gene bamA 289151 286878 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969258.1 protein_id gnl|my_center|LOCUS_18630 290582 289449 gene locus_tag LOCUS_18640 gene rseP 290582 289449 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534980.1 protein_id gnl|my_center|LOCUS_18640 291441 290608 gene locus_tag LOCUS_18650 291441 290608 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969257.1 protein_id gnl|my_center|LOCUS_18650 292187 291441 gene locus_tag LOCUS_18660 292187 291441 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328197.1 protein_id gnl|my_center|LOCUS_18660 292790 292230 gene locus_tag LOCUS_18670 gene frr 292790 292230 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244675.1 protein_id gnl|my_center|LOCUS_18670 293570 292848 gene locus_tag LOCUS_18680 gene pyrH 293570 292848 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534989.1 protein_id gnl|my_center|LOCUS_18680 294704 293778 gene locus_tag LOCUS_18690 gene tsf 294704 293778 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534991.1 protein_id gnl|my_center|LOCUS_18690 295710 294949 gene locus_tag LOCUS_18700 gene rpsB 295710 294949 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312546.1 protein_id gnl|my_center|LOCUS_18700 296881 296054 gene locus_tag LOCUS_18710 296881 296054 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534995.1 protein_id gnl|my_center|LOCUS_18710 297061 297525 gene locus_tag LOCUS_18720 297061 297525 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969255.1 protein_id gnl|my_center|LOCUS_18720 297525 298250 gene locus_tag LOCUS_18730 297525 298250 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328190.1 protein_id gnl|my_center|LOCUS_18730 298252 299445 gene locus_tag LOCUS_18740 298252 299445 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328189.1 protein_id gnl|my_center|LOCUS_18740 299463 299888 gene locus_tag LOCUS_18750 299463 299888 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535003.1 protein_id gnl|my_center|LOCUS_18750 300409 300065 gene locus_tag LOCUS_18760 300409 300065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 301140 300406 gene locus_tag LOCUS_18770 301140 300406 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393451.1 protein_id gnl|my_center|LOCUS_18770 303889 301379 gene locus_tag LOCUS_18780 gene clpA 303889 301379 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975287.1 protein_id gnl|my_center|LOCUS_18780 304228 303899 gene locus_tag LOCUS_18790 gene clpS 304228 303899 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975286.1 protein_id gnl|my_center|LOCUS_18790 304887 304534 gene locus_tag LOCUS_18800 304887 304534 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244664.1 protein_id gnl|my_center|LOCUS_18800 305509 305306 gene locus_tag LOCUS_18810 305509 305306 CDS product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535016.1 protein_id gnl|my_center|LOCUS_18810 306437 305604 gene locus_tag LOCUS_18820 gene cysE 306437 305604 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393467.1 protein_id gnl|my_center|LOCUS_18820 307313 306528 gene locus_tag LOCUS_18830 307313 306528 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535020.1 protein_id gnl|my_center|LOCUS_18830 307480 307728 gene locus_tag LOCUS_18840 307480 307728 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535025.1 protein_id gnl|my_center|LOCUS_18840 307751 308911 gene locus_tag LOCUS_18850 307751 308911 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969248.1 protein_id gnl|my_center|LOCUS_18850 310295 309105 gene locus_tag LOCUS_18860 310295 309105 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312602.1 protein_id gnl|my_center|LOCUS_18860 310651 311679 gene locus_tag LOCUS_18870 310651 311679 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975279.1 protein_id gnl|my_center|LOCUS_18870 311778 312986 gene locus_tag LOCUS_18880 311778 312986 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874276.1 protein_id gnl|my_center|LOCUS_18880 312988 314142 gene locus_tag LOCUS_18890 312988 314142 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969245.1 protein_id gnl|my_center|LOCUS_18890 314162 314938 gene locus_tag LOCUS_18900 314162 314938 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874280.1 protein_id gnl|my_center|LOCUS_18900 315202 316071 gene locus_tag LOCUS_18910 315202 316071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 316237 316161 gene locus_tag LOCUS_t00110 316237 316161 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 316567 316262 gene locus_tag LOCUS_18920 316567 316262 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393354.1 protein_id gnl|my_center|LOCUS_18920 316773 316697 gene locus_tag LOCUS_t00120 316773 316697 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 317362 316865 gene locus_tag LOCUS_18930 317362 316865 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969419.1 protein_id gnl|my_center|LOCUS_18930 317940 317362 gene locus_tag LOCUS_18940 317940 317362 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328282.1 protein_id gnl|my_center|LOCUS_18940 318136 318576 gene locus_tag LOCUS_18950 318136 318576 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037384441.1 protein_id gnl|my_center|LOCUS_18950 318906 320252 gene locus_tag LOCUS_18960 318906 320252 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969420.1 protein_id gnl|my_center|LOCUS_18960 320389 320463 gene locus_tag LOCUS_t00130 320389 320463 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 320644 320943 gene locus_tag LOCUS_18970 320644 320943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 320960 321034 gene locus_tag LOCUS_t00140 320960 321034 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 321202 321492 gene locus_tag LOCUS_18980 321202 321492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972670.1 protein_id gnl|my_center|LOCUS_18980 321489 321974 gene locus_tag LOCUS_18990 321489 321974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 322076 322150 gene locus_tag LOCUS_t00150 322076 322150 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 323991 322183 gene locus_tag LOCUS_19000 gene recJ 323991 322183 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975607.1 protein_id gnl|my_center|LOCUS_19000 325515 324193 gene locus_tag LOCUS_19010 325515 324193 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393361.1 protein_id gnl|my_center|LOCUS_19010 326794 325574 gene locus_tag LOCUS_19020 326794 325574 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003515379.1 protein_id gnl|my_center|LOCUS_19020 327313 326969 gene locus_tag LOCUS_19030 327313 326969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 327439 329295 gene locus_tag LOCUS_19040 gene phaC 327439 329295 CDS product poly(3-hydroxyalkanoate) polymerase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393363.1 protein_id gnl|my_center|LOCUS_19040 329308 330027 gene locus_tag LOCUS_19050 gene sfsA 329308 330027 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316347.1 protein_id gnl|my_center|LOCUS_19050 330058 330885 gene locus_tag LOCUS_19060 gene map 330058 330885 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537051.1 protein_id gnl|my_center|LOCUS_19060 330894 331724 gene locus_tag LOCUS_19070 gene radC 330894 331724 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969427.1 protein_id gnl|my_center|LOCUS_19070 331906 333312 gene locus_tag LOCUS_19080 gene sthA 331906 333312 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393365.1 protein_id gnl|my_center|LOCUS_19080 333403 334206 gene locus_tag LOCUS_19090 333403 334206 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970034.1 protein_id gnl|my_center|LOCUS_19090 336636 335158 gene locus_tag LOCUS_19100 gene tig 336636 335158 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328265.1 protein_id gnl|my_center|LOCUS_19100 336900 336816 gene locus_tag LOCUS_t00160 336900 336816 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 337615 337025 gene locus_tag LOCUS_19110 337615 337025 CDS product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083237.1 protein_id gnl|my_center|LOCUS_19110 338721 337618 gene locus_tag LOCUS_19120 338721 337618 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531316.1 protein_id gnl|my_center|LOCUS_19120 339822 339965 gene locus_tag LOCUS_19130 339822 339965 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529522.1 protein_id gnl|my_center|LOCUS_19130 340308 340451 gene locus_tag LOCUS_19140 340308 340451 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003515516.1 protein_id gnl|my_center|LOCUS_19140 340595 342004 gene locus_tag LOCUS_19150 gene trmFO 340595 342004 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328241.1 protein_id gnl|my_center|LOCUS_19150 342660 342208 gene locus_tag LOCUS_19160 342660 342208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328238.1 protein_id gnl|my_center|LOCUS_19160 343772 342960 gene locus_tag LOCUS_19170 343772 342960 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529514.1 protein_id gnl|my_center|LOCUS_19170 344209 343823 gene locus_tag LOCUS_19180 344209 343823 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393388.1 protein_id gnl|my_center|LOCUS_19180 346709 344202 gene locus_tag LOCUS_19190 gene secDF 346709 344202 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971714.1 protein_id gnl|my_center|LOCUS_19190 347133 346798 gene locus_tag LOCUS_19200 gene yajC 347133 346798 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534584.1 protein_id gnl|my_center|LOCUS_19200 347317 348186 gene locus_tag LOCUS_19210 347317 348186 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393410.1 protein_id gnl|my_center|LOCUS_19210 348248 348345 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 350577 348997 gene locus_tag LOCUS_19220 350577 348997 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393411.1 protein_id gnl|my_center|LOCUS_19220 351354 350728 gene locus_tag LOCUS_19230 351354 350728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 352254 351613 gene locus_tag LOCUS_19240 352254 351613 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975339.1 protein_id gnl|my_center|LOCUS_19240 353036 352266 gene locus_tag LOCUS_19250 gene surE 353036 352266 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971810.1 protein_id gnl|my_center|LOCUS_19250 354339 353056 gene locus_tag LOCUS_19260 gene serS 354339 353056 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534571.1 protein_id gnl|my_center|LOCUS_19260 355245 354409 gene locus_tag LOCUS_19270 gene tatC 355245 354409 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534569.1 protein_id gnl|my_center|LOCUS_19270 355868 355242 gene locus_tag LOCUS_19280 gene tatB 355868 355242 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975335.1 protein_id gnl|my_center|LOCUS_19280 356212 356015 gene locus_tag LOCUS_19290 356212 356015 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975334.1 protein_id gnl|my_center|LOCUS_19290 357358 356255 gene locus_tag LOCUS_19300 357358 356255 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328224.1 protein_id gnl|my_center|LOCUS_19300 358236 357523 gene locus_tag LOCUS_19310 gene scpB 358236 357523 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969279.1 protein_id gnl|my_center|LOCUS_19310 359038 358229 gene locus_tag LOCUS_19320 359038 358229 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129796.1 protein_id gnl|my_center|LOCUS_19320 360171 359152 gene locus_tag LOCUS_19330 gene nagZ 360171 359152 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969277.1 protein_id gnl|my_center|LOCUS_19330 363776 360297 gene locus_tag LOCUS_19340 363776 360297 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435262.1 protein_id gnl|my_center|LOCUS_19340 365600 363840 gene locus_tag LOCUS_19350 gene argS 365600 363840 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328219.1 protein_id gnl|my_center|LOCUS_19350 366888 365668 gene locus_tag LOCUS_19360 366888 365668 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534550.1 protein_id gnl|my_center|LOCUS_19360 367107 367439 gene locus_tag LOCUS_19370 gene erpA 367107 367439 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393432.1 protein_id gnl|my_center|LOCUS_19370 367469 368266 gene locus_tag LOCUS_19380 gene xth 367469 368266 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975324.1 protein_id gnl|my_center|LOCUS_19380 369181 368417 gene locus_tag LOCUS_19390 369181 368417 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244692.1 protein_id gnl|my_center|LOCUS_19390 369078 369524 gene locus_tag LOCUS_19400 369078 369524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 370839 369586 gene locus_tag LOCUS_19410 370839 369586 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975322.1 protein_id gnl|my_center|LOCUS_19410 374124 371197 gene locus_tag LOCUS_19420 374124 371197 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314374.1 protein_id gnl|my_center|LOCUS_19420 375034 374264 gene locus_tag LOCUS_19430 375034 374264 CDS product PopZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393435.1 protein_id gnl|my_center|LOCUS_19430 376724 375324 gene locus_tag LOCUS_19440 gene tolC 376724 375324 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975319.1 protein_id gnl|my_center|LOCUS_19440 377636 376983 gene locus_tag LOCUS_19450 377636 376983 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969269.1 protein_id gnl|my_center|LOCUS_19450 377944 379035 gene locus_tag LOCUS_19460 377944 379035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 379040 379477 gene locus_tag LOCUS_19470 gene exbD 379040 379477 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037384564.1 protein_id gnl|my_center|LOCUS_19470 379665 379738 gene locus_tag LOCUS_t00170 379665 379738 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 380192 379950 gene locus_tag LOCUS_19480 380192 379950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 380952 381206 gene locus_tag LOCUS_19490 380952 381206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 381783 381289 gene locus_tag LOCUS_19500 381783 381289 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974717.1 protein_id gnl|my_center|LOCUS_19500 382116 382445 gene locus_tag LOCUS_19510 382116 382445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 382927 382388 gene locus_tag LOCUS_19520 382927 382388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 382830 383108 gene locus_tag LOCUS_19530 382830 383108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971825.1 protein_id gnl|my_center|LOCUS_19530 383793 383317 gene locus_tag LOCUS_19540 383793 383317 CDS product DUF2938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972115.1 protein_id gnl|my_center|LOCUS_19540 384126 383863 gene locus_tag LOCUS_19550 384126 383863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969346.1 protein_id gnl|my_center|LOCUS_19550 384312 384386 gene locus_tag LOCUS_t00180 384312 384386 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 384662 384471 gene locus_tag LOCUS_19560 384662 384471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527526.1 protein_id gnl|my_center|LOCUS_19560 384949 384740 gene locus_tag LOCUS_19570 384949 384740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 385191 386444 gene locus_tag LOCUS_19580 385191 386444 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531472.1 protein_id gnl|my_center|LOCUS_19580 386570 387610 gene locus_tag LOCUS_19590 386570 387610 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328363.1 protein_id gnl|my_center|LOCUS_19590 387616 388353 gene locus_tag LOCUS_19600 387616 388353 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971477.1 protein_id gnl|my_center|LOCUS_19600 388471 389325 gene locus_tag LOCUS_19610 388471 389325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19610 389325 389915 gene locus_tag LOCUS_19620 389325 389915 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969353.1 protein_id gnl|my_center|LOCUS_19620 390015 390575 gene locus_tag LOCUS_19630 390015 390575 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531463.1 protein_id gnl|my_center|LOCUS_19630 390724 391809 gene locus_tag LOCUS_19640 390724 391809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 391881 392348 gene locus_tag LOCUS_19650 391881 392348 CDS product DUF1203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531464.1 protein_id gnl|my_center|LOCUS_19650 393515 392397 gene locus_tag LOCUS_19660 gene ald 393515 392397 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328358.1 protein_id gnl|my_center|LOCUS_19660 393680 394141 gene locus_tag LOCUS_19670 393680 394141 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975527.1 protein_id gnl|my_center|LOCUS_19670 395426 394179 gene locus_tag LOCUS_19680 395426 394179 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240324.1 protein_id gnl|my_center|LOCUS_19680 395894 395580 gene locus_tag LOCUS_19690 395894 395580 CDS product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312784.1 protein_id gnl|my_center|LOCUS_19690 397256 396009 gene locus_tag LOCUS_19700 gene ilvA 397256 396009 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328353.1 protein_id gnl|my_center|LOCUS_19700 397517 398971 gene locus_tag LOCUS_19710 397517 398971 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975530.1 protein_id gnl|my_center|LOCUS_19710 399052 399630 gene locus_tag LOCUS_19720 399052 399630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975531.1 protein_id gnl|my_center|LOCUS_19720 399746 400390 gene locus_tag LOCUS_19730 399746 400390 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330544.1 protein_id gnl|my_center|LOCUS_19730 400390 401397 gene locus_tag LOCUS_19740 400390 401397 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390645.1 protein_id gnl|my_center|LOCUS_19740 402273 401470 gene locus_tag LOCUS_19750 402273 401470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 402627 402543 gene locus_tag LOCUS_t00190 402627 402543 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 403454 402855 gene locus_tag LOCUS_19760 gene wrbA 403454 402855 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971828.1 protein_id gnl|my_center|LOCUS_19760 403626 404381 gene locus_tag LOCUS_19770 403626 404381 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969361.1 protein_id gnl|my_center|LOCUS_19770 404447 405289 gene locus_tag LOCUS_19780 404447 405289 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314363.1 protein_id gnl|my_center|LOCUS_19780 405412 405909 gene locus_tag LOCUS_19790 gene gpt 405412 405909 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614148.1 protein_id gnl|my_center|LOCUS_19790 406089 406670 gene locus_tag LOCUS_19800 406089 406670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549603.1 protein_id gnl|my_center|LOCUS_19800 407296 411114 gene locus_tag LOCUS_19810 407296 411114 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971830.1 protein_id gnl|my_center|LOCUS_19810 411370 412035 gene locus_tag LOCUS_19820 411370 412035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138787218.1 protein_id gnl|my_center|LOCUS_19820 412310 412080 gene locus_tag LOCUS_19830 412310 412080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 412772 413782 gene locus_tag LOCUS_19840 412772 413782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 413847 414017 gene locus_tag LOCUS_19850 413847 414017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 414068 414706 gene locus_tag LOCUS_19860 414068 414706 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392204.1 protein_id gnl|my_center|LOCUS_19860 414806 414982 gene locus_tag LOCUS_19870 414806 414982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 416037 415093 gene locus_tag LOCUS_19880 416037 415093 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532089.1 protein_id gnl|my_center|LOCUS_19880 416303 416620 gene locus_tag LOCUS_19890 416303 416620 CDS product DUF1883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252719.1 protein_id gnl|my_center|LOCUS_19890 417943 416636 gene locus_tag LOCUS_19900 417943 416636 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969201.1 protein_id gnl|my_center|LOCUS_19900 419343 417940 gene locus_tag LOCUS_19910 419343 417940 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969200.1 protein_id gnl|my_center|LOCUS_19910 419547 420488 gene locus_tag LOCUS_19920 gene msrP 419547 420488 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401748.1 protein_id gnl|my_center|LOCUS_19920 420488 421144 gene locus_tag LOCUS_19930 gene msrQ 420488 421144 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252723.1 protein_id gnl|my_center|LOCUS_19930 422495 421299 gene locus_tag LOCUS_19940 422495 421299 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992359.1 protein_id gnl|my_center|LOCUS_19940 423082 422657 gene locus_tag LOCUS_19950 gene rplQ 423082 422657 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707774.1 protein_id gnl|my_center|LOCUS_19950 424138 423128 gene locus_tag LOCUS_19960 424138 423128 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707773.1 protein_id gnl|my_center|LOCUS_19960 424631 424242 gene locus_tag LOCUS_19970 gene rpsK 424631 424242 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495225.1 protein_id gnl|my_center|LOCUS_19970 425240 424872 gene locus_tag LOCUS_19980 gene rpsM 425240 424872 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328076.1 protein_id gnl|my_center|LOCUS_19980 426104 425520 gene locus_tag LOCUS_19990 426104 425520 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328075.1 protein_id gnl|my_center|LOCUS_19990 427441 426101 gene locus_tag LOCUS_20000 gene secY 427441 426101 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536503.1 protein_id gnl|my_center|LOCUS_20000 428236 427757 gene locus_tag LOCUS_20010 gene rplO 428236 427757 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328073.1 protein_id gnl|my_center|LOCUS_20010 428451 428248 gene locus_tag LOCUS_20020 gene rpmD 428451 428248 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536508.1 protein_id gnl|my_center|LOCUS_20020 429031 428465 gene locus_tag LOCUS_20030 gene rpsE 429031 428465 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536510.1 protein_id gnl|my_center|LOCUS_20030 429521 429159 gene locus_tag LOCUS_20040 gene rplR 429521 429159 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313980.1 protein_id gnl|my_center|LOCUS_20040 430067 429534 gene locus_tag LOCUS_20050 gene rplF 430067 429534 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975182.1 protein_id gnl|my_center|LOCUS_20050 430508 430110 gene locus_tag LOCUS_20060 gene rpsH 430508 430110 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707765.1 protein_id gnl|my_center|LOCUS_20060 430826 430521 gene locus_tag LOCUS_20070 gene rpsN 430826 430521 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707764.1 protein_id gnl|my_center|LOCUS_20070 431420 430863 gene locus_tag LOCUS_20080 gene rplE 431420 430863 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975179.1 protein_id gnl|my_center|LOCUS_20080 431730 431413 gene locus_tag LOCUS_20090 gene rplX 431730 431413 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536524.1 protein_id gnl|my_center|LOCUS_20090 432105 431737 gene locus_tag LOCUS_20100 gene rplN 432105 431737 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707761.1 protein_id gnl|my_center|LOCUS_20100 432678 432442 gene locus_tag LOCUS_20110 gene rpsQ 432678 432442 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240643.1 protein_id gnl|my_center|LOCUS_20110 432891 432691 gene locus_tag LOCUS_20120 gene rpmC 432891 432691 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536529.1 protein_id gnl|my_center|LOCUS_20120 433317 432904 gene locus_tag LOCUS_20130 gene rplP 433317 432904 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975175.1 protein_id gnl|my_center|LOCUS_20130 434084 433356 gene locus_tag LOCUS_20140 gene rpsC 434084 433356 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536533.1 protein_id gnl|my_center|LOCUS_20140 434473 434084 gene locus_tag LOCUS_20150 gene rplV 434473 434084 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707758.1 protein_id gnl|my_center|LOCUS_20150 434754 434476 gene locus_tag LOCUS_20160 gene rpsS 434754 434476 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507772.1 protein_id gnl|my_center|LOCUS_20160 435606 434770 gene locus_tag LOCUS_20170 gene rplB 435606 434770 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707757.1 protein_id gnl|my_center|LOCUS_20170 435930 435637 gene locus_tag LOCUS_20180 435930 435637 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536621.1 protein_id gnl|my_center|LOCUS_20180 436547 435927 gene locus_tag LOCUS_20190 gene rplD 436547 435927 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536623.1 protein_id gnl|my_center|LOCUS_20190 437210 436560 gene locus_tag LOCUS_20200 gene rplC 437210 436560 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328064.1 protein_id gnl|my_center|LOCUS_20200 437710 437402 gene locus_tag LOCUS_20210 gene rpsJ 437710 437402 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507767.1 protein_id gnl|my_center|LOCUS_20210 439075 437900 gene locus_tag LOCUS_20220 gene tuf 439075 437900 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969189.1 protein_id gnl|my_center|LOCUS_20220 441239 439140 gene locus_tag LOCUS_20230 gene fusA 441239 439140 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707752.1 protein_id gnl|my_center|LOCUS_20230 441742 441272 gene locus_tag LOCUS_20240 gene rpsG 441742 441272 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507761.1 protein_id gnl|my_center|LOCUS_20240 442169 441798 gene locus_tag LOCUS_20250 gene rpsL 442169 441798 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507760.1 protein_id gnl|my_center|LOCUS_20250 442713 443009 gene locus_tag LOCUS_20260 442713 443009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975168.1 protein_id gnl|my_center|LOCUS_20260 444074 443025 gene locus_tag LOCUS_20270 444074 443025 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719549.1 protein_id gnl|my_center|LOCUS_20270 448442 444231 gene locus_tag LOCUS_20280 gene rpoC 448442 444231 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536196.1 protein_id gnl|my_center|LOCUS_20280 452736 448597 gene locus_tag LOCUS_20290 gene rpoB 452736 448597 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316439.1 protein_id gnl|my_center|LOCUS_20290 453367 452990 gene locus_tag LOCUS_20300 gene rplL 453367 452990 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316437.1 protein_id gnl|my_center|LOCUS_20300 453946 453428 gene locus_tag LOCUS_20310 gene rplJ 453946 453428 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507705.1 protein_id gnl|my_center|LOCUS_20310 454989 454297 gene locus_tag LOCUS_20320 gene rplA 454989 454297 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536190.1 protein_id gnl|my_center|LOCUS_20320 455425 454994 gene locus_tag LOCUS_20330 gene rplK 455425 454994 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316435.1 protein_id gnl|my_center|LOCUS_20330 456155 455625 gene locus_tag LOCUS_20340 gene nusG 456155 455625 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707742.1 protein_id gnl|my_center|LOCUS_20340 456372 456172 gene locus_tag LOCUS_20350 gene secE 456372 456172 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707741.1 protein_id gnl|my_center|LOCUS_20350 456642 456567 gene locus_tag LOCUS_t00200 456642 456567 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 457387 456776 gene locus_tag LOCUS_20360 457387 456776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969190.1 protein_id gnl|my_center|LOCUS_20360 459014 457839 gene locus_tag LOCUS_20370 gene tuf 459014 457839 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969189.1 protein_id gnl|my_center|LOCUS_20370 460384 459404 gene locus_tag LOCUS_20380 460384 459404 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_20380 461097 460399 gene locus_tag LOCUS_20390 461097 460399 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532941.1 protein_id gnl|my_center|LOCUS_20390 461910 461101 gene locus_tag LOCUS_20400 461910 461101 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970485.1 protein_id gnl|my_center|LOCUS_20400 462746 461907 gene locus_tag LOCUS_20410 462746 461907 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529656.1 protein_id gnl|my_center|LOCUS_20410 463783 462746 gene locus_tag LOCUS_20420 463783 462746 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529657.1 protein_id gnl|my_center|LOCUS_20420 465009 463870 gene locus_tag LOCUS_20430 465009 463870 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532949.1 protein_id gnl|my_center|LOCUS_20430 466263 465334 gene locus_tag LOCUS_20440 466263 465334 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532950.1 protein_id gnl|my_center|LOCUS_20440 467067 466267 gene locus_tag LOCUS_20450 467067 466267 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532951.1 protein_id gnl|my_center|LOCUS_20450 467280 468041 gene locus_tag LOCUS_20460 467280 468041 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532952.1 protein_id gnl|my_center|LOCUS_20460 468865 468053 gene locus_tag LOCUS_20470 468865 468053 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532945.1 protein_id gnl|my_center|LOCUS_20470 469135 470283 gene locus_tag LOCUS_20480 469135 470283 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532953.1 protein_id gnl|my_center|LOCUS_20480 470280 471260 gene locus_tag LOCUS_20490 470280 471260 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827543.1 protein_id gnl|my_center|LOCUS_20490 472275 471241 gene locus_tag LOCUS_20500 472275 471241 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532955.1 protein_id gnl|my_center|LOCUS_20500 472604 473851 gene locus_tag LOCUS_20510 472604 473851 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532948.1 protein_id gnl|my_center|LOCUS_20510 473939 474877 gene locus_tag LOCUS_20520 473939 474877 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532947.1 protein_id gnl|my_center|LOCUS_20520 474883 475731 gene locus_tag LOCUS_20530 474883 475731 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532946.1 protein_id gnl|my_center|LOCUS_20530 477073 475847 gene locus_tag LOCUS_20540 477073 475847 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530260.1 protein_id gnl|my_center|LOCUS_20540 478003 477119 gene locus_tag LOCUS_20550 478003 477119 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530264.1 protein_id gnl|my_center|LOCUS_20550 478500 479456 gene locus_tag LOCUS_20560 478500 479456 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432420.1 protein_id gnl|my_center|LOCUS_20560 479688 481121 gene locus_tag LOCUS_20570 479688 481121 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066912.1 protein_id gnl|my_center|LOCUS_20570 481229 482110 gene locus_tag LOCUS_20580 481229 482110 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_20580 482110 482946 gene locus_tag LOCUS_20590 482110 482946 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404217.1 protein_id gnl|my_center|LOCUS_20590 482950 483186 gene locus_tag LOCUS_20600 482950 483186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 483219 484262 gene locus_tag LOCUS_20610 483219 484262 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975043.1 protein_id gnl|my_center|LOCUS_20610 484272 485333 gene locus_tag LOCUS_20620 gene ugpC 484272 485333 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061266.1 protein_id gnl|my_center|LOCUS_20620 485347 486117 gene locus_tag LOCUS_20630 485347 486117 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086009.1 protein_id gnl|my_center|LOCUS_20630 486129 486854 gene locus_tag LOCUS_20640 486129 486854 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315912.1 protein_id gnl|my_center|LOCUS_20640 486873 487943 gene locus_tag LOCUS_20650 486873 487943 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095090.1 protein_id gnl|my_center|LOCUS_20650 487937 488665 gene locus_tag LOCUS_20660 487937 488665 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089402.1 protein_id gnl|my_center|LOCUS_20660 489227 488790 gene locus_tag LOCUS_20670 489227 488790 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243009.1 protein_id gnl|my_center|LOCUS_20670 490387 489227 gene locus_tag LOCUS_20680 490387 489227 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243008.1 protein_id gnl|my_center|LOCUS_20680 491938 490412 gene locus_tag LOCUS_20690 491938 490412 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243007.1 protein_id gnl|my_center|LOCUS_20690 492716 491961 gene locus_tag LOCUS_20700 492716 491961 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707183.1 protein_id gnl|my_center|LOCUS_20700 493561 492794 gene locus_tag LOCUS_20710 493561 492794 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243005.1 protein_id gnl|my_center|LOCUS_20710 494827 493619 gene locus_tag LOCUS_20720 494827 493619 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243004.1 protein_id gnl|my_center|LOCUS_20720 495096 495854 gene locus_tag LOCUS_20730 495096 495854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243003.1 protein_id gnl|my_center|LOCUS_20730 495847 496554 gene locus_tag LOCUS_20740 495847 496554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552530.1 protein_id gnl|my_center|LOCUS_20740 496590 497477 gene locus_tag LOCUS_20750 496590 497477 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243002.1 protein_id gnl|my_center|LOCUS_20750 497480 498451 gene locus_tag LOCUS_20760 497480 498451 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243001.1 protein_id gnl|my_center|LOCUS_20760 499305 498511 gene locus_tag LOCUS_20770 499305 498511 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243000.1 protein_id gnl|my_center|LOCUS_20770 499519 500406 gene locus_tag LOCUS_20780 499519 500406 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_20780 500399 500884 gene locus_tag LOCUS_20790 500399 500884 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242999.1 protein_id gnl|my_center|LOCUS_20790 500881 501639 gene locus_tag LOCUS_20800 500881 501639 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242998.1 protein_id gnl|my_center|LOCUS_20800 501636 504029 gene locus_tag LOCUS_20810 501636 504029 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242997.1 protein_id gnl|my_center|LOCUS_20810 505041 504019 gene locus_tag LOCUS_20820 505041 504019 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162273436.1 protein_id gnl|my_center|LOCUS_20820 506230 505235 gene locus_tag LOCUS_20830 gene adhP 506230 505235 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088401.1 protein_id gnl|my_center|LOCUS_20830 507204 506254 gene locus_tag LOCUS_20840 gene choX 507204 506254 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532407.1 protein_id gnl|my_center|LOCUS_20840 507309 507971 gene locus_tag LOCUS_20850 gene betI 507309 507971 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532408.1 protein_id gnl|my_center|LOCUS_20850 507974 508213 gene locus_tag LOCUS_20860 507974 508213 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315820.1 protein_id gnl|my_center|LOCUS_20860 508390 509451 gene locus_tag LOCUS_20870 508390 509451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 511625 509754 gene locus_tag LOCUS_20880 gene ftsH 511625 509754 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_20880 512186 511959 gene locus_tag LOCUS_20890 512186 511959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 512077 513879 gene locus_tag LOCUS_20900 512077 513879 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402494.1 protein_id gnl|my_center|LOCUS_20900 514812 514018 gene locus_tag LOCUS_20910 gene gltC 514812 514018 CDS product glutamate biosynthesis transcriptional regulator GltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399246.1 protein_id gnl|my_center|LOCUS_20910 515715 515032 gene locus_tag LOCUS_20920 515715 515032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 516728 515739 gene locus_tag LOCUS_20930 516728 515739 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038796.1 protein_id gnl|my_center|LOCUS_20930 517850 516744 gene locus_tag LOCUS_20940 517850 516744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_20940 518992 517946 gene locus_tag LOCUS_20950 518992 517946 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384670.1 protein_id gnl|my_center|LOCUS_20950 520078 519026 gene locus_tag LOCUS_20960 520078 519026 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529319.1 protein_id gnl|my_center|LOCUS_20960 521865 520120 gene locus_tag LOCUS_20970 521865 520120 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930994.1 protein_id gnl|my_center|LOCUS_20970 523122 521905 gene locus_tag LOCUS_20980 523122 521905 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085289.1 protein_id gnl|my_center|LOCUS_20980 525182 523626 gene locus_tag LOCUS_20990 gene betC 525182 523626 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_20990 525946 525194 gene locus_tag LOCUS_21000 525946 525194 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827580.1 protein_id gnl|my_center|LOCUS_21000 527060 525966 gene locus_tag LOCUS_21010 527060 525966 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530398.1 protein_id gnl|my_center|LOCUS_21010 528231 527077 gene locus_tag LOCUS_21020 528231 527077 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530399.1 protein_id gnl|my_center|LOCUS_21020 529342 528305 gene locus_tag LOCUS_21030 529342 528305 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530400.1 protein_id gnl|my_center|LOCUS_21030 529527 530246 gene locus_tag LOCUS_21040 529527 530246 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244148.1 protein_id gnl|my_center|LOCUS_21040 530538 530465 gene locus_tag LOCUS_t00210 530538 530465 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 530647 530563 gene locus_tag LOCUS_t00220 530647 530563 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 530917 531792 gene locus_tag LOCUS_21050 530917 531792 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969188.1 protein_id gnl|my_center|LOCUS_21050 532485 531862 gene locus_tag LOCUS_21060 532485 531862 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969187.1 protein_id gnl|my_center|LOCUS_21060 532617 533564 gene locus_tag LOCUS_21070 532617 533564 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975154.1 protein_id gnl|my_center|LOCUS_21070 533619 533694 gene locus_tag LOCUS_t00230 533619 533694 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 533957 534151 gene locus_tag LOCUS_21080 533957 534151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328794.1 protein_id gnl|my_center|LOCUS_21080 534277 535050 gene locus_tag LOCUS_21090 534277 535050 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401481.1 protein_id gnl|my_center|LOCUS_21090 535086 535595 gene locus_tag LOCUS_21100 535086 535595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969184.1 protein_id gnl|my_center|LOCUS_21100 536745 535717 gene locus_tag LOCUS_21110 gene prfB 536745 535717 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101777569.1 protein_id gnl|my_center|LOCUS_21110 539397 536950 gene locus_tag LOCUS_21120 539397 536950 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969182.1 protein_id gnl|my_center|LOCUS_21120 540903 539662 gene locus_tag LOCUS_21130 540903 539662 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401505.1 protein_id gnl|my_center|LOCUS_21130 541539 544409 gene locus_tag LOCUS_21140 541539 544409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 544600 545364 gene locus_tag LOCUS_21150 544600 545364 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226013866.1 protein_id gnl|my_center|LOCUS_21150 546598 545447 gene locus_tag LOCUS_21160 546598 545447 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969178.1 protein_id gnl|my_center|LOCUS_21160 546805 547563 gene locus_tag LOCUS_21170 546805 547563 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533078.1 protein_id gnl|my_center|LOCUS_21170 547713 548150 gene locus_tag LOCUS_21180 gene aroQ 547713 548150 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975144.1 protein_id gnl|my_center|LOCUS_21180 548171 548638 gene locus_tag LOCUS_21190 gene accB 548171 548638 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383006.1 protein_id gnl|my_center|LOCUS_21190 548649 549995 gene locus_tag LOCUS_21200 gene accC 548649 549995 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533072.1 protein_id gnl|my_center|LOCUS_21200 550008 550622 gene locus_tag LOCUS_21210 gene aat 550008 550622 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975141.1 protein_id gnl|my_center|LOCUS_21210 551308 550853 gene locus_tag LOCUS_21220 551308 550853 CDS product DUF2155 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975140.1 protein_id gnl|my_center|LOCUS_21220 551883 551488 gene locus_tag LOCUS_21230 551883 551488 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328036.1 protein_id gnl|my_center|LOCUS_21230 552537 552037 gene locus_tag LOCUS_21240 552537 552037 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533058.1 protein_id gnl|my_center|LOCUS_21240 554105 552603 gene locus_tag LOCUS_21250 gene gatB 554105 552603 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401529.1 protein_id gnl|my_center|LOCUS_21250 554290 554691 gene locus_tag LOCUS_21260 554290 554691 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968525.1 protein_id gnl|my_center|LOCUS_21260 554777 555679 gene locus_tag LOCUS_21270 554777 555679 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118999.1 protein_id gnl|my_center|LOCUS_21270 555871 556128 gene locus_tag LOCUS_21280 555871 556128 CDS product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312635.1 protein_id gnl|my_center|LOCUS_21280 556675 556163 gene locus_tag LOCUS_21290 556675 556163 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328030.1 protein_id gnl|my_center|LOCUS_21290 557964 556819 gene locus_tag LOCUS_21300 557964 556819 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531225.1 protein_id gnl|my_center|LOCUS_21300 558450 558379 gene locus_tag LOCUS_t00240 558450 558379 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 560261 558780 gene locus_tag LOCUS_21310 gene gatA 560261 558780 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240741.1 protein_id gnl|my_center|LOCUS_21310 560744 560280 gene locus_tag LOCUS_21320 560744 560280 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531786.1 protein_id gnl|my_center|LOCUS_21320 561035 560748 gene locus_tag LOCUS_21330 gene gatC 561035 560748 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533050.1 protein_id gnl|my_center|LOCUS_21330 561843 561139 gene locus_tag LOCUS_21340 561843 561139 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256572.1 protein_id gnl|my_center|LOCUS_21340 561961 562257 gene locus_tag LOCUS_21350 561961 562257 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974886.1 protein_id gnl|my_center|LOCUS_21350 562269 562754 gene locus_tag LOCUS_21360 gene ruvX 562269 562754 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971538.1 protein_id gnl|my_center|LOCUS_21360 563026 562700 gene locus_tag LOCUS_21370 563026 562700 CDS product DUF6105 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972656.1 protein_id gnl|my_center|LOCUS_21370 563365 564300 gene locus_tag LOCUS_21380 563365 564300 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240746.1 protein_id gnl|my_center|LOCUS_21380 565934 564282 gene locus_tag LOCUS_21390 565934 564282 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328023.1 protein_id gnl|my_center|LOCUS_21390 566106 567047 gene locus_tag LOCUS_21400 566106 567047 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975127.1 protein_id gnl|my_center|LOCUS_21400 567044 568336 gene locus_tag LOCUS_21410 567044 568336 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969167.1 protein_id gnl|my_center|LOCUS_21410 568539 569153 gene locus_tag LOCUS_21420 gene plsY 568539 569153 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975125.1 protein_id gnl|my_center|LOCUS_21420 569156 570307 gene locus_tag LOCUS_21430 gene dprA 569156 570307 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240751.1 protein_id gnl|my_center|LOCUS_21430 570493 570239 gene locus_tag LOCUS_21440 570493 570239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 570828 573461 gene locus_tag LOCUS_21450 gene topA 570828 573461 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533027.1 protein_id gnl|my_center|LOCUS_21450 573466 575817 gene locus_tag LOCUS_21460 gene rnr 573466 575817 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399477.1 protein_id gnl|my_center|LOCUS_21460 575873 576349 gene locus_tag LOCUS_21470 575873 576349 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252183.1 protein_id gnl|my_center|LOCUS_21470 576346 577008 gene locus_tag LOCUS_21480 576346 577008 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399475.1 protein_id gnl|my_center|LOCUS_21480 577022 578206 gene locus_tag LOCUS_21490 577022 578206 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975119.1 protein_id gnl|my_center|LOCUS_21490 578300 578467 gene locus_tag LOCUS_21500 gene rpmG 578300 578467 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707650.1 protein_id gnl|my_center|LOCUS_21500 580518 579151 gene locus_tag LOCUS_21510 580518 579151 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537641.1 protein_id gnl|my_center|LOCUS_21510 580906 580535 gene locus_tag LOCUS_21520 580906 580535 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003496409.1 protein_id gnl|my_center|LOCUS_21520 581048 581347 gene locus_tag LOCUS_21530 581048 581347 CDS product DUF3572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328012.1 protein_id gnl|my_center|LOCUS_21530 581459 582817 gene locus_tag LOCUS_21540 581459 582817 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650680.1 protein_id gnl|my_center|LOCUS_21540 582948 584264 gene locus_tag LOCUS_21550 582948 584264 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969159.1 protein_id gnl|my_center|LOCUS_21550 584959 584369 gene locus_tag LOCUS_21560 584959 584369 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402250.1 protein_id gnl|my_center|LOCUS_21560 585111 585509 gene locus_tag LOCUS_21570 585111 585509 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315324.1 protein_id gnl|my_center|LOCUS_21570 589010 585513 gene locus_tag LOCUS_21580 gene dnaE 589010 585513 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969158.1 protein_id gnl|my_center|LOCUS_21580 589356 589937 gene locus_tag LOCUS_21590 589356 589937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328006.1 protein_id gnl|my_center|LOCUS_21590 590741 590055 gene locus_tag LOCUS_21600 590741 590055 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975112.1 protein_id gnl|my_center|LOCUS_21600 592060 590753 gene locus_tag LOCUS_21610 592060 590753 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018208662.1 protein_id gnl|my_center|LOCUS_21610 593425 592097 gene locus_tag LOCUS_21620 593425 592097 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240764.1 protein_id gnl|my_center|LOCUS_21620 594408 594139 gene locus_tag LOCUS_21630 594408 594139 CDS product DUF1467 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975099.1 protein_id gnl|my_center|LOCUS_21630 596213 594546 gene locus_tag LOCUS_21640 596213 594546 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975097.1 protein_id gnl|my_center|LOCUS_21640 596996 596229 gene locus_tag LOCUS_21650 596996 596229 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975096.1 protein_id gnl|my_center|LOCUS_21650 598435 596993 gene locus_tag LOCUS_21660 gene nuoN 598435 596993 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969150.1 protein_id gnl|my_center|LOCUS_21660 599964 598453 gene locus_tag LOCUS_21670 599964 598453 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531857.1 protein_id gnl|my_center|LOCUS_21670 601961 599964 gene locus_tag LOCUS_21680 gene nuoL 601961 599964 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531855.1 protein_id gnl|my_center|LOCUS_21680 602277 601969 gene locus_tag LOCUS_21690 gene nuoK 602277 601969 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531854.1 protein_id gnl|my_center|LOCUS_21690 602919 602305 gene locus_tag LOCUS_21700 602919 602305 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707629.1 protein_id gnl|my_center|LOCUS_21700 603518 603027 gene locus_tag LOCUS_21710 gene nuoI 603518 603027 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707628.1 protein_id gnl|my_center|LOCUS_21710 604601 603555 gene locus_tag LOCUS_21720 gene nuoH 604601 603555 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531848.1 protein_id gnl|my_center|LOCUS_21720 606700 604622 gene locus_tag LOCUS_21730 gene nuoG 606700 604622 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975089.1 protein_id gnl|my_center|LOCUS_21730 607466 606819 gene locus_tag LOCUS_21740 607466 606819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240776.1 protein_id gnl|my_center|LOCUS_21740 608775 607471 gene locus_tag LOCUS_21750 gene nuoF 608775 607471 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312708.1 protein_id gnl|my_center|LOCUS_21750 609920 608787 gene locus_tag LOCUS_21760 609920 608787 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971510.1 protein_id gnl|my_center|LOCUS_21760 610179 609937 gene locus_tag LOCUS_21770 610179 609937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327988.1 protein_id gnl|my_center|LOCUS_21770 611369 610179 gene locus_tag LOCUS_21780 611369 610179 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327987.1 protein_id gnl|my_center|LOCUS_21780 611762 611427 gene locus_tag LOCUS_21790 611762 611427 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_21790 612456 611854 gene locus_tag LOCUS_21800 612456 611854 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327986.1 protein_id gnl|my_center|LOCUS_21800 613057 612476 gene locus_tag LOCUS_21810 613057 612476 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975082.1 protein_id gnl|my_center|LOCUS_21810 613413 613048 gene locus_tag LOCUS_21820 613413 613048 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707618.1 protein_id gnl|my_center|LOCUS_21820 613918 613842 gene locus_tag LOCUS_t00250 613918 613842 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 614043 613967 gene locus_tag LOCUS_t00260 614043 613967 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 614287 614362 gene locus_tag LOCUS_t00270 614287 614362 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 614654 616420 gene locus_tag LOCUS_21830 614654 616420 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066587.1 protein_id gnl|my_center|LOCUS_21830 616558 616725 gene locus_tag LOCUS_21840 616558 616725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 616725 616910 gene locus_tag LOCUS_21850 616725 616910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 618314 617082 gene locus_tag LOCUS_21860 618314 617082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 619003 618461 gene locus_tag LOCUS_21870 619003 618461 CDS product DUF5706 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976262.1 protein_id gnl|my_center|LOCUS_21870 619187 621145 gene locus_tag LOCUS_21880 619187 621145 CDS product CHASE2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050996810.1 protein_id gnl|my_center|LOCUS_21880 621958 621149 gene locus_tag LOCUS_21890 gene hutC 621958 621149 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072642950.1 protein_id gnl|my_center|LOCUS_21890 623336 621990 gene locus_tag LOCUS_21900 623336 621990 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532304.1 protein_id gnl|my_center|LOCUS_21900 623450 624673 gene locus_tag LOCUS_21910 gene hutI 623450 624673 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532303.1 protein_id gnl|my_center|LOCUS_21910 624716 626251 gene locus_tag LOCUS_21920 gene hutH 624716 626251 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061588.1 protein_id gnl|my_center|LOCUS_21920 626577 627380 gene locus_tag LOCUS_21930 gene hutG 626577 627380 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975686.1 protein_id gnl|my_center|LOCUS_21930 627397 629073 gene locus_tag LOCUS_21940 627397 629073 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975685.1 protein_id gnl|my_center|LOCUS_21940 629116 629703 gene locus_tag LOCUS_21950 629116 629703 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973439.1 protein_id gnl|my_center|LOCUS_21950 629798 630784 gene locus_tag LOCUS_21960 629798 630784 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_21960 630852 631685 gene locus_tag LOCUS_21970 630852 631685 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969901.1 protein_id gnl|my_center|LOCUS_21970 632045 631830 gene locus_tag LOCUS_21980 632045 631830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 632189 633145 gene locus_tag LOCUS_21990 632189 633145 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061600.1 protein_id gnl|my_center|LOCUS_21990 633230 634354 gene locus_tag LOCUS_22000 633230 634354 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061599.1 protein_id gnl|my_center|LOCUS_22000 636927 634390 gene locus_tag LOCUS_22010 gene secD 636927 634390 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327248.1 protein_id gnl|my_center|LOCUS_22010 637457 637035 gene locus_tag LOCUS_22020 637457 637035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 641066 637596 gene locus_tag LOCUS_22030 641066 637596 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975072.1 protein_id gnl|my_center|LOCUS_22030 642338 641070 gene locus_tag LOCUS_22040 642338 641070 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969142.1 protein_id gnl|my_center|LOCUS_22040 642597 643061 gene locus_tag LOCUS_22050 642597 643061 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975070.1 protein_id gnl|my_center|LOCUS_22050 645377 643182 gene locus_tag LOCUS_22060 645377 643182 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969141.1 protein_id gnl|my_center|LOCUS_22060 645841 645566 gene locus_tag LOCUS_22070 gene hupB 645841 645566 CDS product DNA-binding protein HupB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531811.1 protein_id gnl|my_center|LOCUS_22070 648470 646047 gene locus_tag LOCUS_22080 gene lon 648470 646047 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531808.1 protein_id gnl|my_center|LOCUS_22080 650288 649011 gene locus_tag LOCUS_22090 gene clpX 650288 649011 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531807.1 protein_id gnl|my_center|LOCUS_22090 651207 650575 gene locus_tag LOCUS_22100 gene clpP 651207 650575 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327975.1 protein_id gnl|my_center|LOCUS_22100 651480 653234 gene locus_tag LOCUS_22110 gene ggt 651480 653234 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974729.1 protein_id gnl|my_center|LOCUS_22110 653623 653237 gene locus_tag LOCUS_22120 653623 653237 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_22120 653877 653620 gene locus_tag LOCUS_22130 653877 653620 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061623.1 protein_id gnl|my_center|LOCUS_22130 653946 655214 gene locus_tag LOCUS_22140 653946 655214 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971502.1 protein_id gnl|my_center|LOCUS_22140 655223 655792 gene locus_tag LOCUS_22150 655223 655792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 656199 655855 gene locus_tag LOCUS_22160 656199 655855 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327970.1 protein_id gnl|my_center|LOCUS_22160 657696 656413 gene locus_tag LOCUS_22170 657696 656413 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969134.1 protein_id gnl|my_center|LOCUS_22170 658244 657816 gene locus_tag LOCUS_22180 658244 657816 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529220.1 protein_id gnl|my_center|LOCUS_22180 658747 658310 gene locus_tag LOCUS_22190 658747 658310 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529220.1 protein_id gnl|my_center|LOCUS_22190 659010 659846 gene locus_tag LOCUS_22200 659010 659846 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969133.1 protein_id gnl|my_center|LOCUS_22200 659905 660174 gene locus_tag LOCUS_22210 659905 660174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 660171 660440 gene locus_tag LOCUS_22220 660171 660440 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972002.1 protein_id gnl|my_center|LOCUS_22220 661260 660445 gene locus_tag LOCUS_22230 661260 660445 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391002.1 protein_id gnl|my_center|LOCUS_22230 661400 661831 gene locus_tag LOCUS_22240 661400 661831 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969131.1 protein_id gnl|my_center|LOCUS_22240 662061 662525 gene locus_tag LOCUS_22250 gene rplM 662061 662525 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707596.1 protein_id gnl|my_center|LOCUS_22250 662528 663004 gene locus_tag LOCUS_22260 gene rpsI 662528 663004 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975055.1 protein_id gnl|my_center|LOCUS_22260 663191 664144 gene locus_tag LOCUS_22270 gene speB 663191 664144 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391007.1 protein_id gnl|my_center|LOCUS_22270 664278 665210 gene locus_tag LOCUS_22280 gene argC 664278 665210 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969129.1 protein_id gnl|my_center|LOCUS_22280 665613 665218 gene locus_tag LOCUS_22290 665613 665218 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605909.1 protein_id gnl|my_center|LOCUS_22290 665864 665610 gene locus_tag LOCUS_22300 665864 665610 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892665.1 protein_id gnl|my_center|LOCUS_22300 666997 665918 gene locus_tag LOCUS_22310 666997 665918 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969128.1 protein_id gnl|my_center|LOCUS_22310 667198 667416 gene locus_tag LOCUS_22320 667198 667416 CDS product DUF2842 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379956.1 protein_id gnl|my_center|LOCUS_22320 667861 667418 gene locus_tag LOCUS_22330 667861 667418 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967328.1 protein_id gnl|my_center|LOCUS_22330 668032 669303 gene locus_tag LOCUS_22340 668032 669303 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327954.1 protein_id gnl|my_center|LOCUS_22340 671583 669310 gene locus_tag LOCUS_22350 671583 669310 CDS product exopolysaccharide transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969123.1 protein_id gnl|my_center|LOCUS_22350 671798 672373 gene locus_tag LOCUS_22360 671798 672373 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327952.1 protein_id gnl|my_center|LOCUS_22360 672379 673545 gene locus_tag LOCUS_22370 672379 673545 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391038.1 protein_id gnl|my_center|LOCUS_22370 673615 675183 gene locus_tag LOCUS_22380 673615 675183 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969121.1 protein_id gnl|my_center|LOCUS_22380 675180 676415 gene locus_tag LOCUS_22390 675180 676415 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529257.1 protein_id gnl|my_center|LOCUS_22390 676423 677583 gene locus_tag LOCUS_22400 676423 677583 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969120.1 protein_id gnl|my_center|LOCUS_22400 677905 677654 gene locus_tag LOCUS_22410 677905 677654 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313814.1 protein_id gnl|my_center|LOCUS_22410 678217 679458 gene locus_tag LOCUS_22420 678217 679458 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_22420 679458 679958 gene locus_tag LOCUS_22430 679458 679958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 680026 680229 gene locus_tag LOCUS_22440 680026 680229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 680226 681002 gene locus_tag LOCUS_22450 680226 681002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 681065 681403 gene locus_tag LOCUS_22460 681065 681403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 681470 681736 gene locus_tag LOCUS_22470 681470 681736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 681714 683162 gene locus_tag LOCUS_22480 681714 683162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 683429 683638 gene locus_tag LOCUS_22490 683429 683638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 683886 683722 gene locus_tag LOCUS_22500 683886 683722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 684198 684016 gene locus_tag LOCUS_22510 684198 684016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 684503 684237 gene locus_tag LOCUS_22520 684503 684237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 684680 685540 gene locus_tag LOCUS_22530 684680 685540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 685865 686218 gene locus_tag LOCUS_22540 685865 686218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 686215 687168 gene locus_tag LOCUS_22550 686215 687168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 687158 687892 gene locus_tag LOCUS_22560 687158 687892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 688298 688585 gene locus_tag LOCUS_22570 688298 688585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 688602 690890 gene locus_tag LOCUS_22580 688602 690890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 690899 692041 gene locus_tag LOCUS_22590 690899 692041 CDS product contractile injection system protein, VgrG/Pvc8 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970909.1 protein_id gnl|my_center|LOCUS_22590 692782 692054 gene locus_tag LOCUS_22600 692782 692054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 693054 693293 gene locus_tag LOCUS_22610 693054 693293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 693286 693579 gene locus_tag LOCUS_22620 693286 693579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 693967 693662 gene locus_tag LOCUS_22630 693967 693662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 694155 693967 gene locus_tag LOCUS_22640 694155 693967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 694345 694521 gene locus_tag LOCUS_22650 694345 694521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 694911 694567 gene locus_tag LOCUS_22660 694911 694567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 695447 694998 gene locus_tag LOCUS_22670 695447 694998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 695861 695502 gene locus_tag LOCUS_22680 695861 695502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 696687 696184 gene locus_tag LOCUS_22690 696687 696184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 697056 697637 gene locus_tag LOCUS_22700 697056 697637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 697634 697798 gene locus_tag LOCUS_22710 697634 697798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 697838 698065 gene locus_tag LOCUS_22720 697838 698065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 698072 698146 gene locus_tag LOCUS_t00280 698072 698146 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 698628 698428 gene locus_tag LOCUS_22730 698628 698428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 698997 698812 gene locus_tag LOCUS_22740 698997 698812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244278.1 protein_id gnl|my_center|LOCUS_22740 699538 699462 gene locus_tag LOCUS_t00290 699538 699462 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 700023 700235 gene locus_tag LOCUS_22750 700023 700235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034857441.1 protein_id gnl|my_center|LOCUS_22750 700923 700393 gene locus_tag LOCUS_22760 700923 700393 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529274.1 protein_id gnl|my_center|LOCUS_22760 701389 701051 gene locus_tag LOCUS_22770 701389 701051 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529278.1 protein_id gnl|my_center|LOCUS_22770 702583 701612 gene locus_tag LOCUS_22780 702583 701612 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529280.1 protein_id gnl|my_center|LOCUS_22780 703643 702585 gene locus_tag LOCUS_22790 gene plsX 703643 702585 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529283.1 protein_id gnl|my_center|LOCUS_22790 704315 703761 gene locus_tag LOCUS_22800 704315 703761 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327907.1 protein_id gnl|my_center|LOCUS_22800 704887 704327 gene locus_tag LOCUS_22810 704887 704327 CDS product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327906.1 protein_id gnl|my_center|LOCUS_22810 705041 705520 gene locus_tag LOCUS_22820 705041 705520 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707542.1 protein_id gnl|my_center|LOCUS_22820 707740 705605 gene locus_tag LOCUS_22830 707740 705605 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969115.1 protein_id gnl|my_center|LOCUS_22830 709159 707933 gene locus_tag LOCUS_22840 709159 707933 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971445.1 protein_id gnl|my_center|LOCUS_22840 709656 709174 gene locus_tag LOCUS_22850 gene nusB 709656 709174 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707539.1 protein_id gnl|my_center|LOCUS_22850 710114 709653 gene locus_tag LOCUS_22860 gene ribH 710114 709653 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529297.1 protein_id gnl|my_center|LOCUS_22860 710315 710818 gene locus_tag LOCUS_22870 710315 710818 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252217.1 protein_id gnl|my_center|LOCUS_22870 711960 710824 gene locus_tag LOCUS_22880 711960 710824 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531843.1 protein_id gnl|my_center|LOCUS_22880 712709 712092 gene locus_tag LOCUS_22890 712709 712092 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391077.1 protein_id gnl|my_center|LOCUS_22890 713998 712709 gene locus_tag LOCUS_22900 gene ribD 713998 712709 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529307.1 protein_id gnl|my_center|LOCUS_22900 714478 713999 gene locus_tag LOCUS_22910 gene nrdR 714478 713999 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529310.1 protein_id gnl|my_center|LOCUS_22910 715786 714488 gene locus_tag LOCUS_22920 715786 714488 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037431185.1 protein_id gnl|my_center|LOCUS_22920 717440 716118 gene locus_tag LOCUS_22930 717440 716118 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529314.1 protein_id gnl|my_center|LOCUS_22930 718240 717728 gene locus_tag LOCUS_22940 718240 717728 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975011.1 protein_id gnl|my_center|LOCUS_22940 718842 718372 gene locus_tag LOCUS_22950 718842 718372 CDS product DUF6163 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225996759.1 protein_id gnl|my_center|LOCUS_22950 718965 719981 gene locus_tag LOCUS_22960 gene hemB 718965 719981 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391123.1 protein_id gnl|my_center|LOCUS_22960 720227 720691 gene locus_tag LOCUS_22970 720227 720691 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327890.1 protein_id gnl|my_center|LOCUS_22970 720843 721607 gene locus_tag LOCUS_22980 720843 721607 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327889.1 protein_id gnl|my_center|LOCUS_22980 721686 722600 gene locus_tag LOCUS_22990 721686 722600 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969107.1 protein_id gnl|my_center|LOCUS_22990 722652 722873 gene locus_tag LOCUS_23000 722652 722873 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405518.1 protein_id gnl|my_center|LOCUS_23000 722870 723262 gene locus_tag LOCUS_23010 722870 723262 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_23010 725515 723263 gene locus_tag LOCUS_23020 gene parC 725515 723263 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975004.1 protein_id gnl|my_center|LOCUS_23020 725725 726921 gene locus_tag LOCUS_23030 725725 726921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391097.1 protein_id gnl|my_center|LOCUS_23030 728598 727162 gene locus_tag LOCUS_23040 gene creD 728598 727162 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992270.1 protein_id gnl|my_center|LOCUS_23040 729106 728777 gene locus_tag LOCUS_23050 729106 728777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 730989 729202 gene locus_tag LOCUS_23060 gene aspS 730989 729202 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971433.1 protein_id gnl|my_center|LOCUS_23060 731961 731365 gene locus_tag LOCUS_23070 731961 731365 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971421.1 protein_id gnl|my_center|LOCUS_23070 734097 731983 gene locus_tag LOCUS_23080 734097 731983 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391112.1 protein_id gnl|my_center|LOCUS_23080 734209 735069 gene locus_tag LOCUS_23090 734209 735069 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391113.1 protein_id gnl|my_center|LOCUS_23090 735066 735875 gene locus_tag LOCUS_23100 735066 735875 CDS product ribonuclease T(2) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391115.1 protein_id gnl|my_center|LOCUS_23100 735992 736582 gene locus_tag LOCUS_23110 735992 736582 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391116.1 protein_id gnl|my_center|LOCUS_23110 737642 737001 gene locus_tag LOCUS_23120 737642 737001 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327858.1 protein_id gnl|my_center|LOCUS_23120 738001 738765 gene locus_tag LOCUS_23130 738001 738765 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974981.1 protein_id gnl|my_center|LOCUS_23130 738762 740813 gene locus_tag LOCUS_23140 gene uvrC 738762 740813 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969086.1 protein_id gnl|my_center|LOCUS_23140 740881 741348 gene locus_tag LOCUS_23150 740881 741348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133033266.1 protein_id gnl|my_center|LOCUS_23150 741504 742088 gene locus_tag LOCUS_23160 gene pgsA 741504 742088 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312874.1 protein_id gnl|my_center|LOCUS_23160 742090 742344 gene locus_tag LOCUS_23170 gene moaD 742090 742344 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327854.1 protein_id gnl|my_center|LOCUS_23170 742348 742815 gene locus_tag LOCUS_23180 742348 742815 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240872.1 protein_id gnl|my_center|LOCUS_23180 743932 743003 gene locus_tag LOCUS_23190 743932 743003 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969084.1 protein_id gnl|my_center|LOCUS_23190 744019 744573 gene locus_tag LOCUS_23200 744019 744573 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327851.1 protein_id gnl|my_center|LOCUS_23200 744570 745076 gene locus_tag LOCUS_23210 744570 745076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531615.1 protein_id gnl|my_center|LOCUS_23210 745135 746544 gene locus_tag LOCUS_23220 745135 746544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 747038 746616 gene locus_tag LOCUS_23230 gene ndk 747038 746616 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707487.1 protein_id gnl|my_center|LOCUS_23230 747833 747144 gene locus_tag LOCUS_23240 747833 747144 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240876.1 protein_id gnl|my_center|LOCUS_23240 747966 748475 gene locus_tag LOCUS_23250 747966 748475 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874483.1 protein_id gnl|my_center|LOCUS_23250 748674 748958 gene locus_tag LOCUS_23260 748674 748958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 749148 750230 gene locus_tag LOCUS_23270 749148 750230 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992266.1 protein_id gnl|my_center|LOCUS_23270 750320 752206 gene locus_tag LOCUS_23280 750320 752206 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969079.1 protein_id gnl|my_center|LOCUS_23280 752295 753122 gene locus_tag LOCUS_23290 752295 753122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 753971 753129 gene locus_tag LOCUS_23300 753971 753129 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391143.1 protein_id gnl|my_center|LOCUS_23300 754239 755327 gene locus_tag LOCUS_23310 754239 755327 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180937856.1 protein_id gnl|my_center|LOCUS_23310 757341 755569 gene locus_tag LOCUS_23320 757341 755569 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066873328.1 protein_id gnl|my_center|LOCUS_23320 757913 757338 gene locus_tag LOCUS_23330 757913 757338 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605350.1 protein_id gnl|my_center|LOCUS_23330 758161 759087 gene locus_tag LOCUS_23340 758161 759087 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391146.1 protein_id gnl|my_center|LOCUS_23340 759701 759252 gene locus_tag LOCUS_23350 759701 759252 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240883.1 protein_id gnl|my_center|LOCUS_23350 761199 759709 gene locus_tag LOCUS_23360 761199 759709 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531642.1 protein_id gnl|my_center|LOCUS_23360 761466 762650 gene locus_tag LOCUS_23370 gene lptF 761466 762650 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531650.1 protein_id gnl|my_center|LOCUS_23370 762647 763729 gene locus_tag LOCUS_23380 gene lptG 762647 763729 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391153.1 protein_id gnl|my_center|LOCUS_23380 763729 766065 gene locus_tag LOCUS_23390 763729 766065 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969074.1 protein_id gnl|my_center|LOCUS_23390 766253 767149 gene locus_tag LOCUS_23400 766253 767149 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327836.1 protein_id gnl|my_center|LOCUS_23400 767232 768266 gene locus_tag LOCUS_23410 gene pdxA 767232 768266 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327835.1 protein_id gnl|my_center|LOCUS_23410 768266 769093 gene locus_tag LOCUS_23420 gene rsmA 768266 769093 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969072.1 protein_id gnl|my_center|LOCUS_23420 769917 769258 gene locus_tag LOCUS_23430 gene gmk 769917 769258 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971396.1 protein_id gnl|my_center|LOCUS_23430 770808 769921 gene locus_tag LOCUS_23440 770808 769921 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969071.1 protein_id gnl|my_center|LOCUS_23440 772230 771049 gene locus_tag LOCUS_23450 gene mltG 772230 771049 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327831.1 protein_id gnl|my_center|LOCUS_23450 773724 772465 gene locus_tag LOCUS_23460 gene fabF 773724 772465 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391159.1 protein_id gnl|my_center|LOCUS_23460 774067 773831 gene locus_tag LOCUS_23470 774067 773831 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531676.1 protein_id gnl|my_center|LOCUS_23470 775112 774375 gene locus_tag LOCUS_23480 gene fabG 775112 774375 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531678.1 protein_id gnl|my_center|LOCUS_23480 776169 775225 gene locus_tag LOCUS_23490 gene fabD 776169 775225 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974943.1 protein_id gnl|my_center|LOCUS_23490 776363 777406 gene locus_tag LOCUS_23500 776363 777406 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327827.1 protein_id gnl|my_center|LOCUS_23500 >Feature sequence12 1401 133 gene locus_tag LOCUS_23510 1401 133 CDS product D-tagatose-bisphosphate aldolase, class II, non-catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972812.1 protein_id gnl|my_center|LOCUS_23510 2369 1398 gene locus_tag LOCUS_23520 2369 1398 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257467.1 protein_id gnl|my_center|LOCUS_23520 2711 4024 gene locus_tag LOCUS_23530 2711 4024 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257469.1 protein_id gnl|my_center|LOCUS_23530 4164 4934 gene locus_tag LOCUS_23540 4164 4934 CDS product galactitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972809.1 protein_id gnl|my_center|LOCUS_23540 4938 5960 gene locus_tag LOCUS_23550 4938 5960 CDS product D-altritol 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972808.1 protein_id gnl|my_center|LOCUS_23550 6054 7085 gene locus_tag LOCUS_23560 6054 7085 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972807.1 protein_id gnl|my_center|LOCUS_23560 8072 7134 gene locus_tag LOCUS_23570 8072 7134 CDS product choline kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400536.1 protein_id gnl|my_center|LOCUS_23570 9013 8084 gene locus_tag LOCUS_23580 9013 8084 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336754.1 protein_id gnl|my_center|LOCUS_23580 10268 9000 gene locus_tag LOCUS_23590 10268 9000 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268181.1 protein_id gnl|my_center|LOCUS_23590 11019 10261 gene locus_tag LOCUS_23600 11019 10261 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364616.1 protein_id gnl|my_center|LOCUS_23600 12832 11009 gene locus_tag LOCUS_23610 12832 11009 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336752.1 protein_id gnl|my_center|LOCUS_23610 13749 12832 gene locus_tag LOCUS_23620 13749 12832 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336751.1 protein_id gnl|my_center|LOCUS_23620 14731 13751 gene locus_tag LOCUS_23630 14731 13751 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722098.1 protein_id gnl|my_center|LOCUS_23630 16360 14795 gene locus_tag LOCUS_23640 16360 14795 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562511.1 protein_id gnl|my_center|LOCUS_23640 17802 16333 gene locus_tag LOCUS_23650 17802 16333 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463318.1 protein_id gnl|my_center|LOCUS_23650 18056 18721 gene locus_tag LOCUS_23660 18056 18721 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337082.1 protein_id gnl|my_center|LOCUS_23660 18797 19357 gene locus_tag LOCUS_23670 18797 19357 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140078.1 protein_id gnl|my_center|LOCUS_23670 19354 20331 gene locus_tag LOCUS_23680 gene bioB 19354 20331 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337080.1 protein_id gnl|my_center|LOCUS_23680 21842 20400 gene locus_tag LOCUS_23690 21842 20400 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_23690 22345 21839 gene locus_tag LOCUS_23700 22345 21839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 23468 22413 gene locus_tag LOCUS_23710 23468 22413 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_23710 25162 23741 gene locus_tag LOCUS_23720 gene cls 25162 23741 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122347.1 protein_id gnl|my_center|LOCUS_23720 25240 25644 gene locus_tag LOCUS_23730 25240 25644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 26056 25664 gene locus_tag LOCUS_23740 26056 25664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 26283 26053 gene locus_tag LOCUS_23750 26283 26053 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031814.1 protein_id gnl|my_center|LOCUS_23750 27111 26311 gene locus_tag LOCUS_23760 27111 26311 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113207.1 protein_id gnl|my_center|LOCUS_23760 28159 27104 gene locus_tag LOCUS_23770 28159 27104 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063707.1 protein_id gnl|my_center|LOCUS_23770 28407 28213 gene locus_tag LOCUS_23780 28407 28213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 28720 28466 gene locus_tag LOCUS_23790 28720 28466 CDS product DUF2171 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967854.1 protein_id gnl|my_center|LOCUS_23790 31355 28746 gene locus_tag LOCUS_23800 gene clpB 31355 28746 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084221.1 protein_id gnl|my_center|LOCUS_23800 33557 31524 gene locus_tag LOCUS_23810 33557 31524 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074303.1 protein_id gnl|my_center|LOCUS_23810 34935 33550 gene locus_tag LOCUS_23820 34935 33550 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074304.1 protein_id gnl|my_center|LOCUS_23820 35242 34961 gene locus_tag LOCUS_23830 35242 34961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 36141 35245 gene locus_tag LOCUS_23840 36141 35245 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833899.1 protein_id gnl|my_center|LOCUS_23840 38120 36240 gene locus_tag LOCUS_23850 gene dnaK 38120 36240 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083506.1 protein_id gnl|my_center|LOCUS_23850 38423 39655 gene locus_tag LOCUS_23860 38423 39655 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921042.1 protein_id gnl|my_center|LOCUS_23860 40305 39721 gene locus_tag LOCUS_23870 40305 39721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 40479 40315 gene locus_tag LOCUS_23880 40479 40315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 41614 40610 gene locus_tag LOCUS_23890 gene cydB 41614 40610 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968658.1 protein_id gnl|my_center|LOCUS_23890 43032 41620 gene locus_tag LOCUS_23900 43032 41620 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968659.1 protein_id gnl|my_center|LOCUS_23900 45392 43125 gene locus_tag LOCUS_23910 45392 43125 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919123.1 protein_id gnl|my_center|LOCUS_23910 45573 46508 gene locus_tag LOCUS_23920 45573 46508 CDS product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853391.1 protein_id gnl|my_center|LOCUS_23920 46745 47230 gene locus_tag LOCUS_23930 46745 47230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 47227 47931 gene locus_tag LOCUS_23940 47227 47931 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972715.1 protein_id gnl|my_center|LOCUS_23940 47931 49268 gene locus_tag LOCUS_23950 47931 49268 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972714.1 protein_id gnl|my_center|LOCUS_23950 49332 50978 gene locus_tag LOCUS_23960 49332 50978 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972713.1 protein_id gnl|my_center|LOCUS_23960 51089 52039 gene locus_tag LOCUS_23970 51089 52039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972712.1 protein_id gnl|my_center|LOCUS_23970 52051 52932 gene locus_tag LOCUS_23980 52051 52932 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972711.1 protein_id gnl|my_center|LOCUS_23980 52937 54259 gene locus_tag LOCUS_23990 52937 54259 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972710.1 protein_id gnl|my_center|LOCUS_23990 54275 54622 gene locus_tag LOCUS_24000 54275 54622 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311983.1 protein_id gnl|my_center|LOCUS_24000 54646 56265 gene locus_tag LOCUS_24010 54646 56265 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972717.1 protein_id gnl|my_center|LOCUS_24010 57604 56465 gene locus_tag LOCUS_24020 57604 56465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 57912 58928 gene locus_tag LOCUS_24030 57912 58928 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401259.1 protein_id gnl|my_center|LOCUS_24030 59974 58931 gene locus_tag LOCUS_24040 59974 58931 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033050513.1 protein_id gnl|my_center|LOCUS_24040 60767 59982 gene locus_tag LOCUS_24050 60767 59982 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312095.1 protein_id gnl|my_center|LOCUS_24050 61216 60875 gene locus_tag LOCUS_24060 61216 60875 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536339.1 protein_id gnl|my_center|LOCUS_24060 61818 61258 gene locus_tag LOCUS_24070 61818 61258 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329246.1 protein_id gnl|my_center|LOCUS_24070 61957 62373 gene locus_tag LOCUS_24080 61957 62373 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329247.1 protein_id gnl|my_center|LOCUS_24080 62378 62746 gene locus_tag LOCUS_24090 62378 62746 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969927.1 protein_id gnl|my_center|LOCUS_24090 63120 62749 gene locus_tag LOCUS_24100 63120 62749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 63431 63117 gene locus_tag LOCUS_24110 63431 63117 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536354.1 protein_id gnl|my_center|LOCUS_24110 63745 63503 gene locus_tag LOCUS_24120 63745 63503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 64413 63769 gene locus_tag LOCUS_24130 64413 63769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 65480 64569 gene locus_tag LOCUS_24140 65480 64569 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066558.1 protein_id gnl|my_center|LOCUS_24140 65958 65527 gene locus_tag LOCUS_24150 65958 65527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394543.1 protein_id gnl|my_center|LOCUS_24150 66192 67238 gene locus_tag LOCUS_24160 66192 67238 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329255.1 protein_id gnl|my_center|LOCUS_24160 67317 68258 gene locus_tag LOCUS_24170 67317 68258 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329256.1 protein_id gnl|my_center|LOCUS_24170 68245 69366 gene locus_tag LOCUS_24180 68245 69366 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240161.1 protein_id gnl|my_center|LOCUS_24180 69371 70159 gene locus_tag LOCUS_24190 69371 70159 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394513.1 protein_id gnl|my_center|LOCUS_24190 70286 70684 gene locus_tag LOCUS_24200 70286 70684 CDS product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394510.1 protein_id gnl|my_center|LOCUS_24200 70748 71179 gene locus_tag LOCUS_24210 70748 71179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 72716 71211 gene locus_tag LOCUS_24220 72716 71211 CDS product HWE histidine kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969936.1 protein_id gnl|my_center|LOCUS_24220 73393 72839 gene locus_tag LOCUS_24230 73393 72839 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329263.1 protein_id gnl|my_center|LOCUS_24230 73607 73401 gene locus_tag LOCUS_24240 73607 73401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 73739 74533 gene locus_tag LOCUS_24250 73739 74533 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394504.1 protein_id gnl|my_center|LOCUS_24250 76449 74866 gene locus_tag LOCUS_24260 76449 74866 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969937.1 protein_id gnl|my_center|LOCUS_24260 77156 76449 gene locus_tag LOCUS_24270 77156 76449 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525568.1 protein_id gnl|my_center|LOCUS_24270 78705 77221 gene locus_tag LOCUS_24280 78705 77221 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969938.1 protein_id gnl|my_center|LOCUS_24280 79535 78762 gene locus_tag LOCUS_24290 79535 78762 CDS product L-iditol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240170.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence13 879 136 gene locus_tag LOCUS_24300 879 136 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992241.1 protein_id gnl|my_center|LOCUS_24300 1222 845 gene locus_tag LOCUS_24310 1222 845 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531903.1 protein_id gnl|my_center|LOCUS_24310 1685 1293 gene locus_tag LOCUS_24320 1685 1293 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730705.1 protein_id gnl|my_center|LOCUS_24320 1987 1697 gene locus_tag LOCUS_24330 1987 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2278 2102 gene locus_tag LOCUS_24340 2278 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2853 2431 gene locus_tag LOCUS_24350 2853 2431 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968954.1 protein_id gnl|my_center|LOCUS_24350 2967 3458 gene locus_tag LOCUS_24360 2967 3458 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327666.1 protein_id gnl|my_center|LOCUS_24360 3555 5474 gene locus_tag LOCUS_24370 3555 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 5477 5854 gene locus_tag LOCUS_24380 5477 5854 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_24380 6284 7519 gene locus_tag LOCUS_24390 6284 7519 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974999.1 protein_id gnl|my_center|LOCUS_24390 7605 8990 gene locus_tag LOCUS_24400 7605 8990 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530218.1 protein_id gnl|my_center|LOCUS_24400 9482 10633 gene locus_tag LOCUS_24410 gene rnd 9482 10633 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969099.1 protein_id gnl|my_center|LOCUS_24410 11041 10634 gene locus_tag LOCUS_24420 11041 10634 CDS product DUF2000 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046118341.1 protein_id gnl|my_center|LOCUS_24420 11028 11930 gene locus_tag LOCUS_24430 11028 11930 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206696091.1 protein_id gnl|my_center|LOCUS_24430 11987 13396 gene locus_tag LOCUS_24440 11987 13396 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982140.1 protein_id gnl|my_center|LOCUS_24440 14193 13609 gene locus_tag LOCUS_24450 14193 13609 CDS product DUF922 domain-containing Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392406.1 protein_id gnl|my_center|LOCUS_24450 15722 14202 gene locus_tag LOCUS_24460 gene ppx 15722 14202 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529361.1 protein_id gnl|my_center|LOCUS_24460 17950 15734 gene locus_tag LOCUS_24470 17950 15734 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156528573.1 protein_id gnl|my_center|LOCUS_24470 19109 18423 gene locus_tag LOCUS_24480 gene hdaA 19109 18423 CDS product DnaA regulatory inactivator HdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327870.1 protein_id gnl|my_center|LOCUS_24480 20308 19190 gene locus_tag LOCUS_24490 20308 19190 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969095.1 protein_id gnl|my_center|LOCUS_24490 20750 21823 gene locus_tag LOCUS_24500 gene purM 20750 21823 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327868.1 protein_id gnl|my_center|LOCUS_24500 21820 22485 gene locus_tag LOCUS_24510 gene purN 21820 22485 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974989.1 protein_id gnl|my_center|LOCUS_24510 23504 22752 gene locus_tag LOCUS_24520 23504 22752 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033043067.1 protein_id gnl|my_center|LOCUS_24520 23776 24735 gene locus_tag LOCUS_24530 23776 24735 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339057.1 protein_id gnl|my_center|LOCUS_24530 24824 25111 gene locus_tag LOCUS_24540 24824 25111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 26733 25108 gene locus_tag LOCUS_24550 26733 25108 CDS product cisplatin damage response ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971187.1 protein_id gnl|my_center|LOCUS_24550 28002 26992 gene locus_tag LOCUS_24560 28002 26992 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992240.1 protein_id gnl|my_center|LOCUS_24560 28701 28255 gene locus_tag LOCUS_24570 28701 28255 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509099.1 protein_id gnl|my_center|LOCUS_24570 31008 28765 gene locus_tag LOCUS_24580 31008 28765 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974776.1 protein_id gnl|my_center|LOCUS_24580 31298 32665 gene locus_tag LOCUS_24590 31298 32665 CDS product TIGR03808 family TAT-translocated repetitive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532675.1 protein_id gnl|my_center|LOCUS_24590 33268 32768 gene locus_tag LOCUS_24600 33268 32768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 34683 33295 gene locus_tag LOCUS_24610 34683 33295 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383117.1 protein_id gnl|my_center|LOCUS_24610 35130 34747 gene locus_tag LOCUS_24620 35130 34747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253236.1 protein_id gnl|my_center|LOCUS_24620 35385 36044 gene locus_tag LOCUS_24630 35385 36044 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968950.1 protein_id gnl|my_center|LOCUS_24630 36945 36004 gene locus_tag LOCUS_24640 36945 36004 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974774.1 protein_id gnl|my_center|LOCUS_24640 37049 37243 gene locus_tag LOCUS_24650 37049 37243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 37302 37664 gene locus_tag LOCUS_24660 37302 37664 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391352.1 protein_id gnl|my_center|LOCUS_24660 38282 37887 gene locus_tag LOCUS_24670 38282 37887 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976191.1 protein_id gnl|my_center|LOCUS_24670 38753 38388 gene locus_tag LOCUS_24680 38753 38388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026986.1 protein_id gnl|my_center|LOCUS_24680 38855 39610 gene locus_tag LOCUS_24690 38855 39610 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226563.1 protein_id gnl|my_center|LOCUS_24690 39913 39611 gene locus_tag LOCUS_24700 39913 39611 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 protein_id gnl|my_center|LOCUS_24700 40190 39906 gene locus_tag LOCUS_24710 40190 39906 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_24710 41241 40228 gene locus_tag LOCUS_24720 41241 40228 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391327.1 protein_id gnl|my_center|LOCUS_24720 41319 42053 gene locus_tag LOCUS_24730 41319 42053 CDS product DUF3750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391328.1 protein_id gnl|my_center|LOCUS_24730 43019 42153 gene locus_tag LOCUS_24740 43019 42153 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090536.1 protein_id gnl|my_center|LOCUS_24740 43295 43023 gene locus_tag LOCUS_24750 43295 43023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 43182 43586 gene locus_tag LOCUS_24760 43182 43586 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090535.1 protein_id gnl|my_center|LOCUS_24760 43964 45400 gene locus_tag LOCUS_24770 43964 45400 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298733.1 protein_id gnl|my_center|LOCUS_24770 45559 46491 gene locus_tag LOCUS_24780 45559 46491 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970199.1 protein_id gnl|my_center|LOCUS_24780 47572 46571 gene locus_tag LOCUS_24790 47572 46571 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391329.1 protein_id gnl|my_center|LOCUS_24790 47935 48192 gene locus_tag LOCUS_24800 47935 48192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 50049 48232 gene locus_tag LOCUS_24810 50049 48232 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974769.1 protein_id gnl|my_center|LOCUS_24810 50609 50172 gene locus_tag LOCUS_24820 50609 50172 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972923.1 protein_id gnl|my_center|LOCUS_24820 50995 50606 gene locus_tag LOCUS_24830 gene crcB 50995 50606 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253076.1 protein_id gnl|my_center|LOCUS_24830 51768 51220 gene locus_tag LOCUS_24840 51768 51220 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391330.1 protein_id gnl|my_center|LOCUS_24840 51920 52573 gene locus_tag LOCUS_24850 gene betI 51920 52573 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968943.1 protein_id gnl|my_center|LOCUS_24850 52614 54143 gene locus_tag LOCUS_24860 gene betC 52614 54143 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968942.1 protein_id gnl|my_center|LOCUS_24860 54145 55608 gene locus_tag LOCUS_24870 gene betB 54145 55608 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327650.1 protein_id gnl|my_center|LOCUS_24870 55981 55619 gene locus_tag LOCUS_24880 55981 55619 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968936.1 protein_id gnl|my_center|LOCUS_24880 56221 55985 gene locus_tag LOCUS_24890 56221 55985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 56282 57934 gene locus_tag LOCUS_24900 gene betA 56282 57934 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971180.1 protein_id gnl|my_center|LOCUS_24900 57999 58277 gene locus_tag LOCUS_24910 57999 58277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 58740 58270 gene locus_tag LOCUS_24920 58740 58270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968939.1 protein_id gnl|my_center|LOCUS_24920 59134 58751 gene locus_tag LOCUS_24930 59134 58751 CDS product DUF6152 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536268.1 protein_id gnl|my_center|LOCUS_24930 60200 59280 gene locus_tag LOCUS_24940 60200 59280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 60443 61192 gene locus_tag LOCUS_24950 60443 61192 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974761.1 protein_id gnl|my_center|LOCUS_24950 61239 62192 gene locus_tag LOCUS_24960 gene cysD 61239 62192 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974760.1 protein_id gnl|my_center|LOCUS_24960 62194 63684 gene locus_tag LOCUS_24970 gene cysN 62194 63684 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241104.1 protein_id gnl|my_center|LOCUS_24970 65390 64074 gene locus_tag LOCUS_24980 65390 64074 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338571.1 protein_id gnl|my_center|LOCUS_24980 67133 65403 gene locus_tag LOCUS_24990 67133 65403 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338570.1 protein_id gnl|my_center|LOCUS_24990 67850 67347 gene locus_tag LOCUS_25000 67850 67347 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974554.1 protein_id gnl|my_center|LOCUS_25000 68006 68082 gene locus_tag LOCUS_t00300 68006 68082 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 70024 68591 gene locus_tag LOCUS_25010 70024 68591 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384711.1 protein_id gnl|my_center|LOCUS_25010 70916 70080 gene locus_tag LOCUS_25020 70916 70080 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704638.1 protein_id gnl|my_center|LOCUS_25020 71870 70962 gene locus_tag LOCUS_25030 71870 70962 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206888.1 protein_id gnl|my_center|LOCUS_25030 73227 71992 gene locus_tag LOCUS_25040 73227 71992 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114387.1 protein_id gnl|my_center|LOCUS_25040 73313 73798 gene locus_tag LOCUS_25050 73313 73798 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705238.1 protein_id gnl|my_center|LOCUS_25050 74501 73812 gene locus_tag LOCUS_25060 74501 73812 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114389.1 protein_id gnl|my_center|LOCUS_25060 74843 76678 gene locus_tag LOCUS_25070 74843 76678 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971035.1 protein_id gnl|my_center|LOCUS_25070 76885 77622 gene locus_tag LOCUS_25080 76885 77622 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_25080 77754 78497 gene locus_tag LOCUS_25090 77754 78497 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524570.1 protein_id gnl|my_center|LOCUS_25090 79229 78525 gene locus_tag LOCUS_25100 79229 78525 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310912.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence14 941 90 gene locus_tag LOCUS_25110 941 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 1983 1048 gene locus_tag LOCUS_25120 1983 1048 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875267.1 protein_id gnl|my_center|LOCUS_25120 2155 2916 gene locus_tag LOCUS_25130 2155 2916 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092584909.1 protein_id gnl|my_center|LOCUS_25130 2940 3803 gene locus_tag LOCUS_25140 2940 3803 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969403.1 protein_id gnl|my_center|LOCUS_25140 3800 4825 gene locus_tag LOCUS_25150 3800 4825 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206051.1 protein_id gnl|my_center|LOCUS_25150 4912 5916 gene locus_tag LOCUS_25160 4912 5916 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037087840.1 protein_id gnl|my_center|LOCUS_25160 5990 6523 gene locus_tag LOCUS_25170 5990 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 6520 7782 gene locus_tag LOCUS_25180 6520 7782 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037087835.1 protein_id gnl|my_center|LOCUS_25180 9515 8010 gene locus_tag LOCUS_25190 9515 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 10688 9615 gene locus_tag LOCUS_25200 10688 9615 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533235.1 protein_id gnl|my_center|LOCUS_25200 11399 10860 gene locus_tag LOCUS_25210 11399 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 11815 13389 gene locus_tag LOCUS_25220 11815 13389 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974513.1 protein_id gnl|my_center|LOCUS_25220 13447 14301 gene locus_tag LOCUS_25230 13447 14301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227200.1 protein_id gnl|my_center|LOCUS_25230 14298 15908 gene locus_tag LOCUS_25240 gene ggt 14298 15908 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_25240 16006 16956 gene locus_tag LOCUS_25250 16006 16956 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267757.1 protein_id gnl|my_center|LOCUS_25250 16961 17866 gene locus_tag LOCUS_25260 16961 17866 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113175525.1 protein_id gnl|my_center|LOCUS_25260 17863 18843 gene locus_tag LOCUS_25270 17863 18843 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267759.1 protein_id gnl|my_center|LOCUS_25270 18840 19841 gene locus_tag LOCUS_25280 18840 19841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113175527.1 protein_id gnl|my_center|LOCUS_25280 19914 21110 gene locus_tag LOCUS_25290 19914 21110 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310345.1 protein_id gnl|my_center|LOCUS_25290 21886 21206 gene locus_tag LOCUS_25300 21886 21206 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703493.1 protein_id gnl|my_center|LOCUS_25300 21987 22586 gene locus_tag LOCUS_25310 21987 22586 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973670.1 protein_id gnl|my_center|LOCUS_25310 22561 23352 gene locus_tag LOCUS_25320 22561 23352 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397724.1 protein_id gnl|my_center|LOCUS_25320 23408 24307 gene locus_tag LOCUS_25330 23408 24307 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973672.1 protein_id gnl|my_center|LOCUS_25330 24311 25348 gene locus_tag LOCUS_25340 24311 25348 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536944.1 protein_id gnl|my_center|LOCUS_25340 25356 26819 gene locus_tag LOCUS_25350 25356 26819 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397733.1 protein_id gnl|my_center|LOCUS_25350 26825 27154 gene locus_tag LOCUS_25360 26825 27154 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397896.1 protein_id gnl|my_center|LOCUS_25360 27188 28198 gene locus_tag LOCUS_25370 27188 28198 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973676.1 protein_id gnl|my_center|LOCUS_25370 28268 29119 gene locus_tag LOCUS_25380 28268 29119 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397738.1 protein_id gnl|my_center|LOCUS_25380 29121 29921 gene locus_tag LOCUS_25390 29121 29921 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970933.1 protein_id gnl|my_center|LOCUS_25390 29918 30994 gene locus_tag LOCUS_25400 29918 30994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397743.1 protein_id gnl|my_center|LOCUS_25400 31644 31057 gene locus_tag LOCUS_25410 31644 31057 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525187.1 protein_id gnl|my_center|LOCUS_25410 31811 33613 gene locus_tag LOCUS_25420 31811 33613 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974489.1 protein_id gnl|my_center|LOCUS_25420 33740 34732 gene locus_tag LOCUS_25430 33740 34732 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525189.1 protein_id gnl|my_center|LOCUS_25430 34734 36248 gene locus_tag LOCUS_25440 34734 36248 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525190.1 protein_id gnl|my_center|LOCUS_25440 36272 37348 gene locus_tag LOCUS_25450 36272 37348 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525191.1 protein_id gnl|my_center|LOCUS_25450 37351 38163 gene locus_tag LOCUS_25460 37351 38163 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525192.1 protein_id gnl|my_center|LOCUS_25460 38156 38545 gene locus_tag LOCUS_25470 38156 38545 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525193.1 protein_id gnl|my_center|LOCUS_25470 38694 39527 gene locus_tag LOCUS_25480 38694 39527 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525194.1 protein_id gnl|my_center|LOCUS_25480 39586 40560 gene locus_tag LOCUS_25490 39586 40560 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525195.1 protein_id gnl|my_center|LOCUS_25490 40557 41297 gene locus_tag LOCUS_25500 40557 41297 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533434.1 protein_id gnl|my_center|LOCUS_25500 42597 41317 gene locus_tag LOCUS_25510 42597 41317 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894844.1 protein_id gnl|my_center|LOCUS_25510 42836 43804 gene locus_tag LOCUS_25520 42836 43804 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382910.1 protein_id gnl|my_center|LOCUS_25520 44544 43720 gene locus_tag LOCUS_25530 44544 43720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 46341 44869 gene locus_tag LOCUS_25540 46341 44869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 47831 46338 gene locus_tag LOCUS_25550 47831 46338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 48676 47828 gene locus_tag LOCUS_25560 48676 47828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 49648 48680 gene locus_tag LOCUS_25570 49648 48680 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393023.1 protein_id gnl|my_center|LOCUS_25570 51066 49690 gene locus_tag LOCUS_25580 51066 49690 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269247.1 protein_id gnl|my_center|LOCUS_25580 51484 53103 gene locus_tag LOCUS_25590 51484 53103 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730601.1 protein_id gnl|my_center|LOCUS_25590 53100 53423 gene locus_tag LOCUS_25600 53100 53423 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530816.1 protein_id gnl|my_center|LOCUS_25600 53504 54568 gene locus_tag LOCUS_25610 53504 54568 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206772.1 protein_id gnl|my_center|LOCUS_25610 54639 55505 gene locus_tag LOCUS_25620 54639 55505 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206757.1 protein_id gnl|my_center|LOCUS_25620 55507 56307 gene locus_tag LOCUS_25630 55507 56307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25630 56292 57080 gene locus_tag LOCUS_25640 56292 57080 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112653.1 protein_id gnl|my_center|LOCUS_25640 58620 57556 gene locus_tag LOCUS_25650 58620 57556 CDS product adenylate cyclase Cya2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969098.1 protein_id gnl|my_center|LOCUS_25650 58798 58715 gene locus_tag LOCUS_t00310 58798 58715 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 59356 58892 gene locus_tag LOCUS_25660 59356 58892 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974328.1 protein_id gnl|my_center|LOCUS_25660 59482 60303 gene locus_tag LOCUS_25670 59482 60303 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974329.1 protein_id gnl|my_center|LOCUS_25670 60357 61124 gene locus_tag LOCUS_25680 60357 61124 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974330.1 protein_id gnl|my_center|LOCUS_25680 62291 61638 gene locus_tag LOCUS_25690 62291 61638 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966548.1 protein_id gnl|my_center|LOCUS_25690 62190 62402 gene locus_tag LOCUS_25700 62190 62402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 62446 63327 gene locus_tag LOCUS_25710 62446 63327 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966549.1 protein_id gnl|my_center|LOCUS_25710 64411 63347 gene locus_tag LOCUS_25720 64411 63347 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064355.1 protein_id gnl|my_center|LOCUS_25720 65424 64675 gene locus_tag LOCUS_25730 65424 64675 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651594.1 protein_id gnl|my_center|LOCUS_25730 65984 65517 gene locus_tag LOCUS_25740 65984 65517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 65991 66404 gene locus_tag LOCUS_25750 65991 66404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 67517 67155 gene locus_tag LOCUS_25760 67517 67155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 67681 68148 gene locus_tag LOCUS_25770 67681 68148 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338294.1 protein_id gnl|my_center|LOCUS_25770 68153 68701 gene locus_tag LOCUS_25780 68153 68701 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063706.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence15 875 123 gene locus_tag LOCUS_25790 875 123 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336749.1 protein_id gnl|my_center|LOCUS_25790 1074 1883 gene locus_tag LOCUS_25800 gene hisN 1074 1883 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528764.1 protein_id gnl|my_center|LOCUS_25800 1910 2977 gene locus_tag LOCUS_25810 1910 2977 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808774.1 protein_id gnl|my_center|LOCUS_25810 2974 4617 gene locus_tag LOCUS_25820 2974 4617 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808776.1 protein_id gnl|my_center|LOCUS_25820 4719 5720 gene locus_tag LOCUS_25830 4719 5720 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902589.1 protein_id gnl|my_center|LOCUS_25830 6855 5848 gene locus_tag LOCUS_25840 6855 5848 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391989.1 protein_id gnl|my_center|LOCUS_25840 8229 6883 gene locus_tag LOCUS_25850 8229 6883 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331280.1 protein_id gnl|my_center|LOCUS_25850 9725 8226 gene locus_tag LOCUS_25860 9725 8226 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331281.1 protein_id gnl|my_center|LOCUS_25860 10633 9728 gene locus_tag LOCUS_25870 10633 9728 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331282.1 protein_id gnl|my_center|LOCUS_25870 11857 10832 gene locus_tag LOCUS_25880 11857 10832 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395757.1 protein_id gnl|my_center|LOCUS_25880 12029 13024 gene locus_tag LOCUS_25890 12029 13024 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252613.1 protein_id gnl|my_center|LOCUS_25890 13095 15119 gene locus_tag LOCUS_25900 13095 15119 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395834.1 protein_id gnl|my_center|LOCUS_25900 16203 15166 gene locus_tag LOCUS_25910 16203 15166 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384672.1 protein_id gnl|my_center|LOCUS_25910 17083 16196 gene locus_tag LOCUS_25920 17083 16196 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241012.1 protein_id gnl|my_center|LOCUS_25920 18217 17216 gene locus_tag LOCUS_25930 18217 17216 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434654.1 protein_id gnl|my_center|LOCUS_25930 19677 18328 gene locus_tag LOCUS_25940 19677 18328 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331280.1 protein_id gnl|my_center|LOCUS_25940 20565 19681 gene locus_tag LOCUS_25950 20565 19681 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186540.1 protein_id gnl|my_center|LOCUS_25950 20836 21549 gene locus_tag LOCUS_25960 20836 21549 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101372.1 protein_id gnl|my_center|LOCUS_25960 27772 21782 gene locus_tag LOCUS_25970 27772 21782 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061269.1 protein_id gnl|my_center|LOCUS_25970 28088 31405 gene locus_tag LOCUS_25980 gene cas9 28088 31405 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_25980 31546 32385 gene locus_tag LOCUS_25990 gene cas1 31546 32385 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_25990 32457 32756 gene locus_tag LOCUS_26000 32457 32756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 32829 34843 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agcctagcagttcagaaatcgcaggccaaccgcaac 35669 35593 gene locus_tag LOCUS_t00320 35669 35593 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 36622 35837 gene locus_tag LOCUS_26010 36622 35837 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396011.1 protein_id gnl|my_center|LOCUS_26010 37950 36637 gene locus_tag LOCUS_26020 37950 36637 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396013.1 protein_id gnl|my_center|LOCUS_26020 39207 38167 gene locus_tag LOCUS_26030 gene xylF 39207 38167 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329224.1 protein_id gnl|my_center|LOCUS_26030 39451 40671 gene locus_tag LOCUS_26040 39451 40671 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976024.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence16 1048 74 gene locus_tag LOCUS_26050 1048 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240927.1 protein_id gnl|my_center|LOCUS_26050 1578 1045 gene locus_tag LOCUS_26060 1578 1045 CDS product tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379686.1 protein_id gnl|my_center|LOCUS_26060 2212 1583 gene locus_tag LOCUS_26070 2212 1583 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532680.1 protein_id gnl|my_center|LOCUS_26070 3054 2209 gene locus_tag LOCUS_26080 3054 2209 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971363.1 protein_id gnl|my_center|LOCUS_26080 3226 3831 gene locus_tag LOCUS_26090 3226 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973694.1 protein_id gnl|my_center|LOCUS_26090 4617 3835 gene locus_tag LOCUS_26100 4617 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391177.1 protein_id gnl|my_center|LOCUS_26100 4912 4634 gene locus_tag LOCUS_26110 4912 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969047.1 protein_id gnl|my_center|LOCUS_26110 5412 4996 gene locus_tag LOCUS_26120 5412 4996 CDS product TIGR02301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974910.1 protein_id gnl|my_center|LOCUS_26120 5849 5415 gene locus_tag LOCUS_26130 5849 5415 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974911.1 protein_id gnl|my_center|LOCUS_26130 5928 6689 gene locus_tag LOCUS_26140 5928 6689 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971366.1 protein_id gnl|my_center|LOCUS_26140 6903 6721 gene locus_tag LOCUS_26150 6903 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 7261 7079 gene locus_tag LOCUS_26160 7261 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 7508 8941 gene locus_tag LOCUS_26170 gene cysS 7508 8941 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971378.1 protein_id gnl|my_center|LOCUS_26170 9100 9504 gene locus_tag LOCUS_26180 9100 9504 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971377.1 protein_id gnl|my_center|LOCUS_26180 9501 9983 gene locus_tag LOCUS_26190 9501 9983 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969049.1 protein_id gnl|my_center|LOCUS_26190 9980 10477 gene locus_tag LOCUS_26200 9980 10477 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969051.1 protein_id gnl|my_center|LOCUS_26200 10474 10593 gene locus_tag LOCUS_26210 10474 10593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 10604 11086 gene locus_tag LOCUS_26220 10604 11086 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532558.1 protein_id gnl|my_center|LOCUS_26220 11083 12042 gene locus_tag LOCUS_26230 gene pip 11083 12042 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969052.1 protein_id gnl|my_center|LOCUS_26230 12225 13841 gene locus_tag LOCUS_26240 gene cimA 12225 13841 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974919.1 protein_id gnl|my_center|LOCUS_26240 13950 14894 gene locus_tag LOCUS_26250 gene rarD 13950 14894 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391171.1 protein_id gnl|my_center|LOCUS_26250 14898 15431 gene locus_tag LOCUS_26260 14898 15431 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_26260 16088 15468 gene locus_tag LOCUS_26270 16088 15468 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974921.1 protein_id gnl|my_center|LOCUS_26270 16251 18638 gene locus_tag LOCUS_26280 16251 18638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 18829 20724 gene locus_tag LOCUS_26290 18829 20724 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969054.1 protein_id gnl|my_center|LOCUS_26290 21372 20725 gene locus_tag LOCUS_26300 21372 20725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 21914 22612 gene locus_tag LOCUS_26310 21914 22612 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969055.1 protein_id gnl|my_center|LOCUS_26310 22713 23564 gene locus_tag LOCUS_26320 gene pssA 22713 23564 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974925.1 protein_id gnl|my_center|LOCUS_26320 23703 24158 gene locus_tag LOCUS_26330 23703 24158 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969062.1 protein_id gnl|my_center|LOCUS_26330 24155 25858 gene locus_tag LOCUS_26340 24155 25858 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969063.1 protein_id gnl|my_center|LOCUS_26340 25864 26901 gene locus_tag LOCUS_26350 25864 26901 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974937.1 protein_id gnl|my_center|LOCUS_26350 27830 27090 gene locus_tag LOCUS_26360 27830 27090 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240909.1 protein_id gnl|my_center|LOCUS_26360 29335 27842 gene locus_tag LOCUS_26370 gene purF 29335 27842 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314558.1 protein_id gnl|my_center|LOCUS_26370 30138 29530 gene locus_tag LOCUS_26380 30138 29530 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379721.1 protein_id gnl|my_center|LOCUS_26380 31685 30282 gene locus_tag LOCUS_26390 gene radA 31685 30282 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971380.1 protein_id gnl|my_center|LOCUS_26390 32977 31808 gene locus_tag LOCUS_26400 gene alr 32977 31808 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327819.1 protein_id gnl|my_center|LOCUS_26400 33115 33684 gene locus_tag LOCUS_26410 33115 33684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 35352 33853 gene locus_tag LOCUS_26420 35352 33853 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531702.1 protein_id gnl|my_center|LOCUS_26420 36826 35540 gene locus_tag LOCUS_26430 36826 35540 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532522.1 protein_id gnl|my_center|LOCUS_26430 36710 36916 gene locus_tag LOCUS_26440 36710 36916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 37625 37050 gene locus_tag LOCUS_26450 gene rplI 37625 37050 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531697.1 protein_id gnl|my_center|LOCUS_26450 38620 37646 gene locus_tag LOCUS_26460 38620 37646 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327825.1 protein_id gnl|my_center|LOCUS_26460 39081 38833 gene locus_tag LOCUS_26470 gene rpsR 39081 38833 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707461.1 protein_id gnl|my_center|LOCUS_26470 39558 39106 gene locus_tag LOCUS_26480 39558 39106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 39929 40285 gene locus_tag LOCUS_26490 39929 40285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence17 1051 494 gene locus_tag LOCUS_26500 gene traF 1051 494 CDS product conjugative transfer signal peptidase TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970269.1 protein_id gnl|my_center|LOCUS_26500 2997 1048 gene locus_tag LOCUS_26510 2997 1048 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 protein_id gnl|my_center|LOCUS_26510 4442 2994 gene locus_tag LOCUS_26520 4442 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 4789 4460 gene locus_tag LOCUS_26530 4789 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 4767 5045 gene locus_tag LOCUS_26540 4767 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 5700 5323 gene locus_tag LOCUS_26550 5700 5323 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388103.1 protein_id gnl|my_center|LOCUS_26550 6010 6339 gene locus_tag LOCUS_26560 6010 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 6419 7144 gene locus_tag LOCUS_26570 6419 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 7154 7612 gene locus_tag LOCUS_26580 7154 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 7735 8166 gene locus_tag LOCUS_26590 7735 8166 CDS product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703394.1 protein_id gnl|my_center|LOCUS_26590 8238 9173 gene locus_tag LOCUS_26600 8238 9173 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103973.1 protein_id gnl|my_center|LOCUS_26600 9207 9461 gene locus_tag LOCUS_26610 9207 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 9787 9485 gene locus_tag LOCUS_26620 9787 9485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 10128 9784 gene locus_tag LOCUS_26630 10128 9784 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_26630 10502 10281 gene locus_tag LOCUS_26640 10502 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 10946 10704 gene locus_tag LOCUS_26650 10946 10704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 11709 11167 gene locus_tag LOCUS_26660 11709 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 12433 12146 gene locus_tag LOCUS_26670 12433 12146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 12687 12430 gene locus_tag LOCUS_26680 12687 12430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 12967 12674 gene locus_tag LOCUS_26690 12967 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 13416 13117 gene locus_tag LOCUS_26700 13416 13117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042066.1 protein_id gnl|my_center|LOCUS_26700 15033 13585 gene locus_tag LOCUS_26710 15033 13585 CDS product replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042065.1 protein_id gnl|my_center|LOCUS_26710 15551 15231 gene locus_tag LOCUS_26720 15551 15231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 15956 15669 gene locus_tag LOCUS_26730 15956 15669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 16585 15953 gene locus_tag LOCUS_26740 gene parA 16585 15953 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 protein_id gnl|my_center|LOCUS_26740 17282 16683 gene locus_tag LOCUS_26750 17282 16683 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088057164.1 protein_id gnl|my_center|LOCUS_26750 17452 17700 gene locus_tag LOCUS_26760 17452 17700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 17950 18915 gene locus_tag LOCUS_26770 gene trbB 17950 18915 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015633597.1 protein_id gnl|my_center|LOCUS_26770 18919 19314 gene locus_tag LOCUS_26780 18919 19314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 19311 19625 gene locus_tag LOCUS_26790 19311 19625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 19636 22134 gene locus_tag LOCUS_26800 19636 22134 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970257.1 protein_id gnl|my_center|LOCUS_26800 22112 22873 gene locus_tag LOCUS_26810 22112 22873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 22873 23043 gene locus_tag LOCUS_26820 22873 23043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 23043 24614 gene locus_tag LOCUS_26830 23043 24614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 24709 25407 gene locus_tag LOCUS_26840 24709 25407 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970261.1 protein_id gnl|my_center|LOCUS_26840 25428 26342 gene locus_tag LOCUS_26850 gene trbG 25428 26342 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974834.1 protein_id gnl|my_center|LOCUS_26850 26345 26821 gene locus_tag LOCUS_26860 26345 26821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 26814 28127 gene locus_tag LOCUS_26870 gene trbI 26814 28127 CDS product IncP-type conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974832.1 protein_id gnl|my_center|LOCUS_26870 28476 28213 gene locus_tag LOCUS_26880 28476 28213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 29609 28818 gene locus_tag LOCUS_26890 29609 28818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 29927 29703 gene locus_tag LOCUS_26900 29927 29703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 30250 30017 gene locus_tag LOCUS_26910 30250 30017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 30931 30308 gene locus_tag LOCUS_26920 30931 30308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 31167 30934 gene locus_tag LOCUS_26930 31167 30934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 31259 31480 gene locus_tag LOCUS_26940 31259 31480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 31835 31551 gene locus_tag LOCUS_26950 31835 31551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 32642 31998 gene locus_tag LOCUS_26960 32642 31998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 33994 33458 gene locus_tag LOCUS_26970 33994 33458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 34431 34063 gene locus_tag LOCUS_26980 34431 34063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 34598 34428 gene locus_tag LOCUS_26990 34598 34428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 36613 34595 gene locus_tag LOCUS_27000 gene topA 36613 34595 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829508.1 protein_id gnl|my_center|LOCUS_27000 39970 36728 gene locus_tag LOCUS_27010 39970 36728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 >Feature sequence18 91 294 gene locus_tag LOCUS_27020 91 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 287 544 gene locus_tag LOCUS_27030 287 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 541 903 gene locus_tag LOCUS_27040 541 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 916 1752 gene locus_tag LOCUS_27050 916 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 2229 2993 gene locus_tag LOCUS_27060 2229 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 3279 3953 gene locus_tag LOCUS_27070 3279 3953 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074390.1 protein_id gnl|my_center|LOCUS_27070 3950 4246 gene locus_tag LOCUS_27080 3950 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 4300 4704 gene locus_tag LOCUS_27090 4300 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 5065 4733 gene locus_tag LOCUS_27100 5065 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 5316 5062 gene locus_tag LOCUS_27110 5316 5062 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259386.1 protein_id gnl|my_center|LOCUS_27110 5808 5437 gene locus_tag LOCUS_27120 5808 5437 CDS product DUF1515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456612.1 protein_id gnl|my_center|LOCUS_27120 6158 5916 gene locus_tag LOCUS_27130 6158 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153451468.1 protein_id gnl|my_center|LOCUS_27130 6952 6155 gene locus_tag LOCUS_27140 6952 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 9297 7033 gene locus_tag LOCUS_27150 9297 7033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 9992 9315 gene locus_tag LOCUS_27160 9992 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 11778 10003 gene locus_tag LOCUS_27170 11778 10003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 12167 11778 gene locus_tag LOCUS_27180 12167 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 12745 12170 gene locus_tag LOCUS_27190 12745 12170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149765254.1 protein_id gnl|my_center|LOCUS_27190 16032 12742 gene locus_tag LOCUS_27200 16032 12742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 16079 16648 gene locus_tag LOCUS_27210 16079 16648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 16752 17321 gene locus_tag LOCUS_27220 16752 17321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 17481 17314 gene locus_tag LOCUS_27230 17481 17314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 17993 17514 gene locus_tag LOCUS_27240 17993 17514 CDS product gene transfer agent family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975483.1 protein_id gnl|my_center|LOCUS_27240 18427 17990 gene locus_tag LOCUS_27250 18427 17990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 18844 18455 gene locus_tag LOCUS_27260 18844 18455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 19269 18841 gene locus_tag LOCUS_27270 19269 18841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 19445 19266 gene locus_tag LOCUS_27280 19445 19266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 19837 19445 gene locus_tag LOCUS_27290 19837 19445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 20385 19837 gene locus_tag LOCUS_27300 20385 19837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 20570 20388 gene locus_tag LOCUS_27310 20570 20388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 21914 20634 gene locus_tag LOCUS_27320 21914 20634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 22597 22013 gene locus_tag LOCUS_27330 22597 22013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 23849 22581 gene locus_tag LOCUS_27340 23849 22581 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523689.1 protein_id gnl|my_center|LOCUS_27340 25666 23849 gene locus_tag LOCUS_27350 25666 23849 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 protein_id gnl|my_center|LOCUS_27350 26114 25650 gene locus_tag LOCUS_27360 26114 25650 CDS product P27 family phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336919.1 protein_id gnl|my_center|LOCUS_27360 26750 26364 gene locus_tag LOCUS_27370 26750 26364 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183394652.1 protein_id gnl|my_center|LOCUS_27370 27541 26864 gene locus_tag LOCUS_27380 27541 26864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 28361 27525 gene locus_tag LOCUS_27390 28361 27525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27390 28704 28351 gene locus_tag LOCUS_27400 28704 28351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 29027 28701 gene locus_tag LOCUS_27410 29027 28701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 29565 29029 gene locus_tag LOCUS_27420 29565 29029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972614.1 protein_id gnl|my_center|LOCUS_27420 30371 29562 gene locus_tag LOCUS_27430 30371 29562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 32530 30368 gene locus_tag LOCUS_27440 32530 30368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 32783 32532 gene locus_tag LOCUS_27450 32783 32532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 33292 32786 gene locus_tag LOCUS_27460 33292 32786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970897.1 protein_id gnl|my_center|LOCUS_27460 33410 33730 gene locus_tag LOCUS_27470 33410 33730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 33876 34589 gene locus_tag LOCUS_27480 33876 34589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 34831 34586 gene locus_tag LOCUS_27490 34831 34586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 35032 35229 gene locus_tag LOCUS_27500 35032 35229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 35292 35462 gene locus_tag LOCUS_27510 35292 35462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 35459 35671 gene locus_tag LOCUS_27520 35459 35671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 35668 35931 gene locus_tag LOCUS_27530 35668 35931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 35924 36262 gene locus_tag LOCUS_27540 35924 36262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 36255 36794 gene locus_tag LOCUS_27550 36255 36794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 36784 37146 gene locus_tag LOCUS_27560 36784 37146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 37139 37351 gene locus_tag LOCUS_27570 37139 37351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 37344 37895 gene locus_tag LOCUS_27580 37344 37895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 38221 37892 gene locus_tag LOCUS_27590 38221 37892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 38489 38223 gene locus_tag LOCUS_27600 38489 38223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence19 710 120 gene locus_tag LOCUS_27610 710 120 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067216.1 protein_id gnl|my_center|LOCUS_27610 1339 707 gene locus_tag LOCUS_27620 1339 707 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310872.1 protein_id gnl|my_center|LOCUS_27620 1734 1465 gene locus_tag LOCUS_27630 gene rpmA 1734 1465 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003492686.1 protein_id gnl|my_center|LOCUS_27630 2131 1760 gene locus_tag LOCUS_27640 gene rplU 2131 1760 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067213.1 protein_id gnl|my_center|LOCUS_27640 2456 2545 gene locus_tag LOCUS_t00330 2456 2545 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3098 2784 gene locus_tag LOCUS_27650 3098 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 3758 3099 gene locus_tag LOCUS_27660 3758 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 4857 5132 gene locus_tag LOCUS_27670 4857 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 5397 5218 gene locus_tag LOCUS_27680 5397 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 5520 5717 gene locus_tag LOCUS_27690 5520 5717 CDS product DUF2158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527958.1 protein_id gnl|my_center|LOCUS_27690 5931 5668 gene locus_tag LOCUS_27700 5931 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 5948 6508 gene locus_tag LOCUS_27710 5948 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 7028 6570 gene locus_tag LOCUS_27720 7028 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 7478 7170 gene locus_tag LOCUS_27730 7478 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 7529 7813 gene locus_tag LOCUS_27740 7529 7813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 10212 7978 gene locus_tag LOCUS_27750 10212 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 11281 10229 gene locus_tag LOCUS_27760 11281 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 11214 11417 gene locus_tag LOCUS_27770 11214 11417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 12323 11625 gene locus_tag LOCUS_27780 12323 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 13025 12411 gene locus_tag LOCUS_27790 13025 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 14533 13037 gene locus_tag LOCUS_27800 14533 13037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 14784 14530 gene locus_tag LOCUS_27810 14784 14530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 15005 14784 gene locus_tag LOCUS_27820 15005 14784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 15946 15275 gene locus_tag LOCUS_27830 15946 15275 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921628.1 protein_id gnl|my_center|LOCUS_27830 16589 16068 gene locus_tag LOCUS_27840 16589 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 16841 16623 gene locus_tag LOCUS_27850 16841 16623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 17305 16838 gene locus_tag LOCUS_27860 17305 16838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 18198 17989 gene locus_tag LOCUS_27870 18198 17989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 19756 18494 gene locus_tag LOCUS_27880 19756 18494 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973356.1 protein_id gnl|my_center|LOCUS_27880 20701 19964 gene locus_tag LOCUS_27890 20701 19964 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724361.1 protein_id gnl|my_center|LOCUS_27890 20877 22499 gene locus_tag LOCUS_27900 20877 22499 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973389.1 protein_id gnl|my_center|LOCUS_27900 22926 22525 gene locus_tag LOCUS_27910 22926 22525 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_27910 23032 24249 gene locus_tag LOCUS_27920 23032 24249 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401262.1 protein_id gnl|my_center|LOCUS_27920 25042 24260 gene locus_tag LOCUS_27930 25042 24260 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018012046.1 protein_id gnl|my_center|LOCUS_27930 25267 26337 gene locus_tag LOCUS_27940 25267 26337 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969741.1 protein_id gnl|my_center|LOCUS_27940 26371 27879 gene locus_tag LOCUS_27950 26371 27879 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530864.1 protein_id gnl|my_center|LOCUS_27950 27876 28841 gene locus_tag LOCUS_27960 27876 28841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 28838 29779 gene locus_tag LOCUS_27970 28838 29779 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974943.1 protein_id gnl|my_center|LOCUS_27970 29776 30732 gene locus_tag LOCUS_27980 29776 30732 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113699.1 protein_id gnl|my_center|LOCUS_27980 30725 32038 gene locus_tag LOCUS_27990 30725 32038 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086758.1 protein_id gnl|my_center|LOCUS_27990 32065 32409 gene locus_tag LOCUS_28000 32065 32409 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086753.1 protein_id gnl|my_center|LOCUS_28000 32435 33448 gene locus_tag LOCUS_28010 32435 33448 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086752.1 protein_id gnl|my_center|LOCUS_28010 34637 33453 gene locus_tag LOCUS_28020 34637 33453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537581.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence20 276 58 gene locus_tag LOCUS_28030 276 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 404 1123 gene locus_tag LOCUS_28040 404 1123 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970510.1 protein_id gnl|my_center|LOCUS_28040 1532 1906 gene locus_tag LOCUS_28050 1532 1906 CDS product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310858.1 protein_id gnl|my_center|LOCUS_28050 2462 1911 gene locus_tag LOCUS_28060 2462 1911 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393929.1 protein_id gnl|my_center|LOCUS_28060 6052 2594 gene locus_tag LOCUS_28070 gene pyc 6052 2594 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400767.1 protein_id gnl|my_center|LOCUS_28070 6999 6271 gene locus_tag LOCUS_28080 6999 6271 CDS product autoinducer binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390409.1 protein_id gnl|my_center|LOCUS_28080 7313 9070 gene locus_tag LOCUS_28090 7313 9070 CDS product glucan ABC transporter ATP-binding protein/ permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330307.1 protein_id gnl|my_center|LOCUS_28090 10249 9080 gene locus_tag LOCUS_28100 10249 9080 CDS product OpgC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970543.1 protein_id gnl|my_center|LOCUS_28100 18773 10275 gene locus_tag LOCUS_28110 gene ndvB 18773 10275 CDS product cyclic beta-(1,2)-glucan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400777.1 protein_id gnl|my_center|LOCUS_28110 19512 19727 gene locus_tag LOCUS_28120 19512 19727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 19811 23605 gene locus_tag LOCUS_28130 gene metH 19811 23605 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530215.1 protein_id gnl|my_center|LOCUS_28130 24589 23612 gene locus_tag LOCUS_28140 24589 23612 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256280.1 protein_id gnl|my_center|LOCUS_28140 24722 25585 gene locus_tag LOCUS_28150 24722 25585 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971057.1 protein_id gnl|my_center|LOCUS_28150 26346 25582 gene locus_tag LOCUS_28160 gene cobM 26346 25582 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970288.1 protein_id gnl|my_center|LOCUS_28160 27605 26343 gene locus_tag LOCUS_28170 27605 26343 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394056.1 protein_id gnl|my_center|LOCUS_28170 27598 28368 gene locus_tag LOCUS_28180 27598 28368 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531081.1 protein_id gnl|my_center|LOCUS_28180 29096 28332 gene locus_tag LOCUS_28190 29096 28332 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970291.1 protein_id gnl|my_center|LOCUS_28190 29836 29093 gene locus_tag LOCUS_28200 29836 29093 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528814.1 protein_id gnl|my_center|LOCUS_28200 30465 29833 gene locus_tag LOCUS_28210 30465 29833 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067032.1 protein_id gnl|my_center|LOCUS_28210 31367 30462 gene locus_tag LOCUS_28220 31367 30462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 31308 31799 gene locus_tag LOCUS_28230 31308 31799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 32587 31808 gene locus_tag LOCUS_28240 gene cobF 32587 31808 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528807.1 protein_id gnl|my_center|LOCUS_28240 33536 32715 gene locus_tag LOCUS_28250 33536 32715 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972800.1 protein_id gnl|my_center|LOCUS_28250 33648 34847 gene locus_tag LOCUS_28260 33648 34847 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972801.1 protein_id gnl|my_center|LOCUS_28260 >Feature sequence21 428 1183 gene locus_tag LOCUS_28270 428 1183 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402690.1 protein_id gnl|my_center|LOCUS_28270 1380 2030 gene locus_tag LOCUS_28280 1380 2030 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976284.1 protein_id gnl|my_center|LOCUS_28280 2899 2015 gene locus_tag LOCUS_28290 2899 2015 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242252.1 protein_id gnl|my_center|LOCUS_28290 3015 4187 gene locus_tag LOCUS_28300 gene pobA 3015 4187 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242251.1 protein_id gnl|my_center|LOCUS_28300 5047 4181 gene locus_tag LOCUS_28310 5047 4181 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895546.1 protein_id gnl|my_center|LOCUS_28310 6002 5079 gene locus_tag LOCUS_28320 gene pcaQ 6002 5079 CDS product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976280.1 protein_id gnl|my_center|LOCUS_28320 6098 6910 gene locus_tag LOCUS_28330 gene pcaD 6098 6910 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976279.1 protein_id gnl|my_center|LOCUS_28330 6903 7307 gene locus_tag LOCUS_28340 gene pcaC 6903 7307 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392057.1 protein_id gnl|my_center|LOCUS_28340 7315 8064 gene locus_tag LOCUS_28350 gene pcaH 7315 8064 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244051.1 protein_id gnl|my_center|LOCUS_28350 8064 8678 gene locus_tag LOCUS_28360 gene pcaG 8064 8678 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976277.1 protein_id gnl|my_center|LOCUS_28360 8874 9929 gene locus_tag LOCUS_28370 8874 9929 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392062.1 protein_id gnl|my_center|LOCUS_28370 10069 11241 gene locus_tag LOCUS_28380 10069 11241 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976271.1 protein_id gnl|my_center|LOCUS_28380 11434 12297 gene locus_tag LOCUS_28390 11434 12297 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969845.1 protein_id gnl|my_center|LOCUS_28390 12294 13304 gene locus_tag LOCUS_28400 12294 13304 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909953.1 protein_id gnl|my_center|LOCUS_28400 13301 14065 gene locus_tag LOCUS_28410 13301 14065 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391538.1 protein_id gnl|my_center|LOCUS_28410 14046 14762 gene locus_tag LOCUS_28420 14046 14762 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976268.1 protein_id gnl|my_center|LOCUS_28420 14970 16691 gene locus_tag LOCUS_28430 14970 16691 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703274.1 protein_id gnl|my_center|LOCUS_28430 16716 17249 gene locus_tag LOCUS_28440 16716 17249 CDS product 2,4'-dihydroxyacetophenone dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113028.1 protein_id gnl|my_center|LOCUS_28440 17354 17530 gene locus_tag LOCUS_28450 17354 17530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 18358 17600 gene locus_tag LOCUS_28460 18358 17600 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397283.1 protein_id gnl|my_center|LOCUS_28460 19813 18362 gene locus_tag LOCUS_28470 19813 18362 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384684.1 protein_id gnl|my_center|LOCUS_28470 20548 19835 gene locus_tag LOCUS_28480 20548 19835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384685.1 protein_id gnl|my_center|LOCUS_28480 21134 20541 gene locus_tag LOCUS_28490 21134 20541 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384686.1 protein_id gnl|my_center|LOCUS_28490 22189 21266 gene locus_tag LOCUS_28500 22189 21266 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384687.1 protein_id gnl|my_center|LOCUS_28500 23058 22186 gene locus_tag LOCUS_28510 23058 22186 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384688.1 protein_id gnl|my_center|LOCUS_28510 >Feature sequence22 877 104 gene locus_tag LOCUS_28520 877 104 CDS product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729199.1 protein_id gnl|my_center|LOCUS_28520 1925 939 gene locus_tag LOCUS_28530 1925 939 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388000.1 protein_id gnl|my_center|LOCUS_28530 3097 2093 gene locus_tag LOCUS_28540 3097 2093 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530262.1 protein_id gnl|my_center|LOCUS_28540 4630 3152 gene locus_tag LOCUS_28550 4630 3152 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196037.1 protein_id gnl|my_center|LOCUS_28550 4880 6328 gene locus_tag LOCUS_28560 4880 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 6398 6769 gene locus_tag LOCUS_28570 6398 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244589.1 protein_id gnl|my_center|LOCUS_28570 7915 6782 gene locus_tag LOCUS_28580 7915 6782 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974502.1 protein_id gnl|my_center|LOCUS_28580 8748 7918 gene locus_tag LOCUS_28590 8748 7918 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112952.1 protein_id gnl|my_center|LOCUS_28590 9663 8761 gene locus_tag LOCUS_28600 9663 8761 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529815.1 protein_id gnl|my_center|LOCUS_28600 10681 9665 gene locus_tag LOCUS_28610 10681 9665 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140151.1 protein_id gnl|my_center|LOCUS_28610 10912 11982 gene locus_tag LOCUS_28620 10912 11982 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376560.1 protein_id gnl|my_center|LOCUS_28620 11979 12893 gene locus_tag LOCUS_28630 11979 12893 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370101.1 protein_id gnl|my_center|LOCUS_28630 13311 14354 gene locus_tag LOCUS_28640 13311 14354 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399818.1 protein_id gnl|my_center|LOCUS_28640 14351 15379 gene locus_tag LOCUS_28650 14351 15379 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399815.1 protein_id gnl|my_center|LOCUS_28650 15376 16176 gene locus_tag LOCUS_28660 15376 16176 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969708.1 protein_id gnl|my_center|LOCUS_28660 16176 16625 gene locus_tag LOCUS_28670 16176 16625 CDS product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252943.1 protein_id gnl|my_center|LOCUS_28670 16625 17434 gene locus_tag LOCUS_28680 16625 17434 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974982.1 protein_id gnl|my_center|LOCUS_28680 18134 17379 gene locus_tag LOCUS_28690 gene phnF 18134 17379 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976252.1 protein_id gnl|my_center|LOCUS_28690 18254 18724 gene locus_tag LOCUS_28700 gene phnG 18254 18724 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530625.1 protein_id gnl|my_center|LOCUS_28700 18724 19332 gene locus_tag LOCUS_28710 gene phnH 18724 19332 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392105.1 protein_id gnl|my_center|LOCUS_28710 19337 20437 gene locus_tag LOCUS_28720 19337 20437 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440333.1 protein_id gnl|my_center|LOCUS_28720 20434 21318 gene locus_tag LOCUS_28730 20434 21318 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440334.1 protein_id gnl|my_center|LOCUS_28730 21515 22291 gene locus_tag LOCUS_28740 gene phnK 21515 22291 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969858.1 protein_id gnl|my_center|LOCUS_28740 22357 23064 gene locus_tag LOCUS_28750 gene phnL 22357 23064 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976256.1 protein_id gnl|my_center|LOCUS_28750 23061 23675 gene locus_tag LOCUS_28760 23061 23675 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529516.1 protein_id gnl|my_center|LOCUS_28760 23839 24687 gene locus_tag LOCUS_28770 gene phnC 23839 24687 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975699.1 protein_id gnl|my_center|LOCUS_28770 24769 25674 gene locus_tag LOCUS_28780 gene phnD 24769 25674 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391685.1 protein_id gnl|my_center|LOCUS_28780 25891 26853 gene locus_tag LOCUS_28790 gene phnE 25891 26853 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061596.1 protein_id gnl|my_center|LOCUS_28790 26863 28365 gene locus_tag LOCUS_28800 gene phnE 26863 28365 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061595.1 protein_id gnl|my_center|LOCUS_28800 28471 29178 gene locus_tag LOCUS_28810 28471 29178 CDS product DUF1045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391678.1 protein_id gnl|my_center|LOCUS_28810 29180 30319 gene locus_tag LOCUS_28820 29180 30319 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975693.1 protein_id gnl|my_center|LOCUS_28820 30316 30918 gene locus_tag LOCUS_28830 gene phnN 30316 30918 CDS product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391674.1 protein_id gnl|my_center|LOCUS_28830 32469 31030 gene locus_tag LOCUS_28840 32469 31030 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971478.1 protein_id gnl|my_center|LOCUS_28840 32842 32477 gene locus_tag LOCUS_28850 32842 32477 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314952.1 protein_id gnl|my_center|LOCUS_28850 33548 33222 gene locus_tag LOCUS_28860 33548 33222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 34041 34334 gene locus_tag LOCUS_28870 34041 34334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 34448 37354 gene locus_tag LOCUS_28880 34448 37354 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972638.1 protein_id gnl|my_center|LOCUS_28880 37354 37692 gene locus_tag LOCUS_28890 37354 37692 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493763.1 protein_id gnl|my_center|LOCUS_28890 37689 39326 gene locus_tag LOCUS_28900 37689 39326 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687984.1 protein_id gnl|my_center|LOCUS_28900 39328 39804 gene locus_tag LOCUS_28910 39328 39804 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970946.1 protein_id gnl|my_center|LOCUS_28910 39801 40082 gene locus_tag LOCUS_28920 39801 40082 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313274.1 protein_id gnl|my_center|LOCUS_28920 40079 40474 gene locus_tag LOCUS_28930 gene mnhG 40079 40474 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970945.1 protein_id gnl|my_center|LOCUS_28930 40652 41374 gene locus_tag LOCUS_28940 40652 41374 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066641.1 protein_id gnl|my_center|LOCUS_28940 41371 42543 gene locus_tag LOCUS_28950 41371 42543 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434058.1 protein_id gnl|my_center|LOCUS_28950 42584 43843 gene locus_tag LOCUS_28960 42584 43843 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972818.1 protein_id gnl|my_center|LOCUS_28960 43894 44853 gene locus_tag LOCUS_28970 43894 44853 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434064.1 protein_id gnl|my_center|LOCUS_28970 44858 45688 gene locus_tag LOCUS_28980 44858 45688 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972816.1 protein_id gnl|my_center|LOCUS_28980 45700 46767 gene locus_tag LOCUS_28990 gene ugpC 45700 46767 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329344.1 protein_id gnl|my_center|LOCUS_28990 46875 49598 gene locus_tag LOCUS_29000 46875 49598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 49845 50888 gene locus_tag LOCUS_29010 gene fba 49845 50888 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391732.1 protein_id gnl|my_center|LOCUS_29010 51333 52481 gene locus_tag LOCUS_29020 51333 52481 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992331.1 protein_id gnl|my_center|LOCUS_29020 52508 52759 gene locus_tag LOCUS_29030 52508 52759 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973870.1 protein_id gnl|my_center|LOCUS_29030 52766 53056 gene locus_tag LOCUS_29040 52766 53056 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973871.1 protein_id gnl|my_center|LOCUS_29040 54094 53060 gene locus_tag LOCUS_29050 54094 53060 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529811.1 protein_id gnl|my_center|LOCUS_29050 55485 54097 gene locus_tag LOCUS_29060 55485 54097 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528229.1 protein_id gnl|my_center|LOCUS_29060 56855 55482 gene locus_tag LOCUS_29070 56855 55482 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528228.1 protein_id gnl|my_center|LOCUS_29070 57994 56945 gene locus_tag LOCUS_29080 57994 56945 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265602.1 protein_id gnl|my_center|LOCUS_29080 58268 59164 gene locus_tag LOCUS_29090 58268 59164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 59582 59175 gene locus_tag LOCUS_29100 59582 59175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 60922 59681 gene locus_tag LOCUS_29110 60922 59681 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992327.1 protein_id gnl|my_center|LOCUS_29110 61301 61462 gene locus_tag LOCUS_29120 61301 61462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 62667 61498 gene locus_tag LOCUS_29130 gene ugd 62667 61498 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704802.1 protein_id gnl|my_center|LOCUS_29130 63196 62729 gene locus_tag LOCUS_29140 63196 62729 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310156.1 protein_id gnl|my_center|LOCUS_29140 64439 63312 gene locus_tag LOCUS_29150 64439 63312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 65760 64441 gene locus_tag LOCUS_29160 65760 64441 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992304.1 protein_id gnl|my_center|LOCUS_29160 67276 65753 gene locus_tag LOCUS_29170 67276 65753 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971788.1 protein_id gnl|my_center|LOCUS_29170 67530 67273 gene locus_tag LOCUS_29180 67530 67273 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972661.1 protein_id gnl|my_center|LOCUS_29180 68406 67561 gene locus_tag LOCUS_29190 68406 67561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972623.1 protein_id gnl|my_center|LOCUS_29190 70370 68562 gene locus_tag LOCUS_29200 70370 68562 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047161.1 protein_id gnl|my_center|LOCUS_29200 71827 70574 gene locus_tag LOCUS_29210 71827 70574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 72005 72685 gene locus_tag LOCUS_29220 72005 72685 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222476.1 protein_id gnl|my_center|LOCUS_29220 72937 73812 gene locus_tag LOCUS_29230 72937 73812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 73812 75020 gene locus_tag LOCUS_29240 73812 75020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 75017 76336 gene locus_tag LOCUS_29250 75017 76336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 76425 77732 gene locus_tag LOCUS_29260 76425 77732 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764140.1 protein_id gnl|my_center|LOCUS_29260 77713 78966 gene locus_tag LOCUS_29270 77713 78966 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089037.1 protein_id gnl|my_center|LOCUS_29270 78963 80924 gene locus_tag LOCUS_29280 78963 80924 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089039.1 protein_id gnl|my_center|LOCUS_29280 80921 82183 gene locus_tag LOCUS_29290 80921 82183 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530606.1 protein_id gnl|my_center|LOCUS_29290 82256 83572 gene locus_tag LOCUS_29300 82256 83572 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257384.1 protein_id gnl|my_center|LOCUS_29300 83706 85169 gene locus_tag LOCUS_29310 83706 85169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 85319 86161 gene locus_tag LOCUS_29320 85319 86161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972623.1 protein_id gnl|my_center|LOCUS_29320 87149 86265 gene locus_tag LOCUS_29330 87149 86265 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969685.1 protein_id gnl|my_center|LOCUS_29330 87267 88724 gene locus_tag LOCUS_29340 87267 88724 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844627.1 protein_id gnl|my_center|LOCUS_29340 88732 89415 gene locus_tag LOCUS_29350 88732 89415 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969683.1 protein_id gnl|my_center|LOCUS_29350 90773 89469 gene locus_tag LOCUS_29360 gene pncB 90773 89469 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085115.1 protein_id gnl|my_center|LOCUS_29360 91348 91602 gene locus_tag LOCUS_29370 91348 91602 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003504852.1 protein_id gnl|my_center|LOCUS_29370 91599 92771 gene locus_tag LOCUS_29380 91599 92771 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972410.1 protein_id gnl|my_center|LOCUS_29380 92776 93690 gene locus_tag LOCUS_29390 92776 93690 CDS product amino acid--[acyl-carrier-protein] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080728814.1 protein_id gnl|my_center|LOCUS_29390 93693 94661 gene locus_tag LOCUS_29400 93693 94661 CDS product DUF1839 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196302.1 protein_id gnl|my_center|LOCUS_29400 94673 97120 gene locus_tag LOCUS_29410 94673 97120 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972413.1 protein_id gnl|my_center|LOCUS_29410 97316 98101 gene locus_tag LOCUS_29420 97316 98101 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532094.1 protein_id gnl|my_center|LOCUS_29420 98176 98826 gene locus_tag LOCUS_29430 98176 98826 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532095.1 protein_id gnl|my_center|LOCUS_29430 98829 99488 gene locus_tag LOCUS_29440 98829 99488 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532096.1 protein_id gnl|my_center|LOCUS_29440 99485 100249 gene locus_tag LOCUS_29450 99485 100249 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532097.1 protein_id gnl|my_center|LOCUS_29450 100296 101666 gene locus_tag LOCUS_29460 100296 101666 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532099.1 protein_id gnl|my_center|LOCUS_29460 101676 102605 gene locus_tag LOCUS_29470 101676 102605 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 protein_id gnl|my_center|LOCUS_29470 102615 103106 gene locus_tag LOCUS_29480 102615 103106 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532101.1 protein_id gnl|my_center|LOCUS_29480 103103 104131 gene locus_tag LOCUS_29490 103103 104131 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532102.1 protein_id gnl|my_center|LOCUS_29490 105192 104230 gene locus_tag LOCUS_29500 105192 104230 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532093.1 protein_id gnl|my_center|LOCUS_29500 105276 105713 gene locus_tag LOCUS_29510 105276 105713 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532092.1 protein_id gnl|my_center|LOCUS_29510 106692 105733 gene locus_tag LOCUS_29520 106692 105733 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337349.1 protein_id gnl|my_center|LOCUS_29520 107216 107752 gene locus_tag LOCUS_29530 107216 107752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 107964 108170 gene locus_tag LOCUS_29540 107964 108170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 108527 108360 gene locus_tag LOCUS_29550 108527 108360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577192.1 protein_id gnl|my_center|LOCUS_29550 109322 108636 gene locus_tag LOCUS_29560 109322 108636 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389010.1 protein_id gnl|my_center|LOCUS_29560 109580 110680 gene locus_tag LOCUS_29570 109580 110680 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529814.1 protein_id gnl|my_center|LOCUS_29570 110683 111606 gene locus_tag LOCUS_29580 110683 111606 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529815.1 protein_id gnl|my_center|LOCUS_29580 111599 112402 gene locus_tag LOCUS_29590 111599 112402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529816.1 protein_id gnl|my_center|LOCUS_29590 112453 113478 gene locus_tag LOCUS_29600 112453 113478 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531376.1 protein_id gnl|my_center|LOCUS_29600 113557 114738 gene locus_tag LOCUS_29610 113557 114738 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529819.1 protein_id gnl|my_center|LOCUS_29610 114759 116429 gene locus_tag LOCUS_29620 114759 116429 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529813.1 protein_id gnl|my_center|LOCUS_29620 117208 117492 gene locus_tag LOCUS_29630 117208 117492 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855945.1 protein_id gnl|my_center|LOCUS_29630 118439 117657 gene locus_tag LOCUS_29640 118439 117657 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969976.1 protein_id gnl|my_center|LOCUS_29640 119301 118504 gene locus_tag LOCUS_29650 119301 118504 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525654.1 protein_id gnl|my_center|LOCUS_29650 120152 119298 gene locus_tag LOCUS_29660 120152 119298 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329325.1 protein_id gnl|my_center|LOCUS_29660 121183 120149 gene locus_tag LOCUS_29670 121183 120149 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329326.1 protein_id gnl|my_center|LOCUS_29670 122350 121262 gene locus_tag LOCUS_29680 122350 121262 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240233.1 protein_id gnl|my_center|LOCUS_29680 123471 122419 gene locus_tag LOCUS_29690 gene speB 123471 122419 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329331.1 protein_id gnl|my_center|LOCUS_29690 123656 124672 gene locus_tag LOCUS_29700 123656 124672 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017264593.1 protein_id gnl|my_center|LOCUS_29700 124689 125861 gene locus_tag LOCUS_29710 124689 125861 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969980.1 protein_id gnl|my_center|LOCUS_29710 125976 126191 gene locus_tag LOCUS_29720 125976 126191 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811035.1 protein_id gnl|my_center|LOCUS_29720 126266 128746 gene locus_tag LOCUS_29730 126266 128746 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992271.1 protein_id gnl|my_center|LOCUS_29730 128743 129153 gene locus_tag LOCUS_29740 gene cueR 128743 129153 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975862.1 protein_id gnl|my_center|LOCUS_29740 129558 129157 gene locus_tag LOCUS_29750 129558 129157 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_29750 129794 129558 gene locus_tag LOCUS_29760 gene vapB 129794 129558 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261287.1 protein_id gnl|my_center|LOCUS_29760 130257 129865 gene locus_tag LOCUS_29770 130257 129865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 130903 130277 gene locus_tag LOCUS_29780 130903 130277 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531384.1 protein_id gnl|my_center|LOCUS_29780 130985 132109 gene locus_tag LOCUS_29790 130985 132109 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531383.1 protein_id gnl|my_center|LOCUS_29790 132303 133166 gene locus_tag LOCUS_29800 132303 133166 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531382.1 protein_id gnl|my_center|LOCUS_29800 133169 133957 gene locus_tag LOCUS_29810 133169 133957 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531381.1 protein_id gnl|my_center|LOCUS_29810 133954 135039 gene locus_tag LOCUS_29820 133954 135039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531380.1 protein_id gnl|my_center|LOCUS_29820 135047 135775 gene locus_tag LOCUS_29830 135047 135775 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531379.1 protein_id gnl|my_center|LOCUS_29830 135788 137221 gene locus_tag LOCUS_29840 135788 137221 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969982.1 protein_id gnl|my_center|LOCUS_29840 137509 138387 gene locus_tag LOCUS_29850 137509 138387 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066636.1 protein_id gnl|my_center|LOCUS_29850 140208 138424 gene locus_tag LOCUS_29860 140208 138424 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967127.1 protein_id gnl|my_center|LOCUS_29860 140377 141282 gene locus_tag LOCUS_29870 140377 141282 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311167.1 protein_id gnl|my_center|LOCUS_29870 141762 141295 gene locus_tag LOCUS_29880 141762 141295 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969738.1 protein_id gnl|my_center|LOCUS_29880 141885 143975 gene locus_tag LOCUS_29890 141885 143975 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396305.1 protein_id gnl|my_center|LOCUS_29890 143979 145178 gene locus_tag LOCUS_29900 143979 145178 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243544.1 protein_id gnl|my_center|LOCUS_29900 145175 146578 gene locus_tag LOCUS_29910 gene lpdA 145175 146578 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 protein_id gnl|my_center|LOCUS_29910 146779 147861 gene locus_tag LOCUS_29920 146779 147861 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728502.1 protein_id gnl|my_center|LOCUS_29920 148781 148317 gene locus_tag LOCUS_29930 148781 148317 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968668.1 protein_id gnl|my_center|LOCUS_29930 149280 150284 gene locus_tag LOCUS_29940 gene tauA 149280 150284 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254850.1 protein_id gnl|my_center|LOCUS_29940 150477 151283 gene locus_tag LOCUS_29950 150477 151283 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393164.1 protein_id gnl|my_center|LOCUS_29950 151280 152122 gene locus_tag LOCUS_29960 151280 152122 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982269.1 protein_id gnl|my_center|LOCUS_29960 152848 152192 gene locus_tag LOCUS_29970 152848 152192 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528559.1 protein_id gnl|my_center|LOCUS_29970 153899 152829 gene locus_tag LOCUS_29980 153899 152829 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528558.1 protein_id gnl|my_center|LOCUS_29980 154832 153984 gene locus_tag LOCUS_29990 154832 153984 CDS product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528557.1 protein_id gnl|my_center|LOCUS_29990 155849 155034 gene locus_tag LOCUS_30000 155849 155034 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331794.1 protein_id gnl|my_center|LOCUS_30000 156088 157365 gene locus_tag LOCUS_30010 156088 157365 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391726.1 protein_id gnl|my_center|LOCUS_30010 157461 158942 gene locus_tag LOCUS_30020 157461 158942 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242183.1 protein_id gnl|my_center|LOCUS_30020 159373 158978 gene locus_tag LOCUS_30030 159373 158978 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918525.1 protein_id gnl|my_center|LOCUS_30030 159615 159373 gene locus_tag LOCUS_30040 159615 159373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 160317 159673 gene locus_tag LOCUS_30050 gene maiA 160317 159673 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067046.1 protein_id gnl|my_center|LOCUS_30050 161338 160322 gene locus_tag LOCUS_30060 161338 160322 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855886.1 protein_id gnl|my_center|LOCUS_30060 161454 162014 gene locus_tag LOCUS_30070 161454 162014 CDS product DUF2585 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529722.1 protein_id gnl|my_center|LOCUS_30070 163348 162017 gene locus_tag LOCUS_30080 gene hmgA 163348 162017 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970302.1 protein_id gnl|my_center|LOCUS_30080 163430 163888 gene locus_tag LOCUS_30090 163430 163888 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970303.1 protein_id gnl|my_center|LOCUS_30090 163976 164230 gene locus_tag LOCUS_30100 163976 164230 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084508.1 protein_id gnl|my_center|LOCUS_30100 164471 165682 gene locus_tag LOCUS_30110 gene repA 164471 165682 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858029.1 protein_id gnl|my_center|LOCUS_30110 165670 166713 gene locus_tag LOCUS_30120 gene repB 165670 166713 CDS product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858028.1 protein_id gnl|my_center|LOCUS_30120 166870 168192 gene locus_tag LOCUS_30130 gene repC 166870 168192 CDS product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970061.1 protein_id gnl|my_center|LOCUS_30130 168286 168579 gene locus_tag LOCUS_30140 168286 168579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 169163 168582 gene locus_tag LOCUS_30150 169163 168582 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327214.1 protein_id gnl|my_center|LOCUS_30150 169311 169811 gene locus_tag LOCUS_30160 169311 169811 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329975.1 protein_id gnl|my_center|LOCUS_30160 169913 171736 gene locus_tag LOCUS_30170 169913 171736 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391770.1 protein_id gnl|my_center|LOCUS_30170 171733 173088 gene locus_tag LOCUS_30180 171733 173088 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391769.1 protein_id gnl|my_center|LOCUS_30180 173288 174271 gene locus_tag LOCUS_30190 173288 174271 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974952.1 protein_id gnl|my_center|LOCUS_30190 174419 174880 gene locus_tag LOCUS_30200 174419 174880 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974953.1 protein_id gnl|my_center|LOCUS_30200 174890 176395 gene locus_tag LOCUS_30210 174890 176395 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309942.1 protein_id gnl|my_center|LOCUS_30210 176527 177411 gene locus_tag LOCUS_30220 176527 177411 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976269.1 protein_id gnl|my_center|LOCUS_30220 177557 179773 gene locus_tag LOCUS_30230 177557 179773 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170156.1 protein_id gnl|my_center|LOCUS_30230 180895 179873 gene locus_tag LOCUS_30240 180895 179873 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313850.1 protein_id gnl|my_center|LOCUS_30240 181640 181290 gene locus_tag LOCUS_30250 181640 181290 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973855.1 protein_id gnl|my_center|LOCUS_30250 182260 181664 gene locus_tag LOCUS_30260 182260 181664 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003499036.1 protein_id gnl|my_center|LOCUS_30260 182715 182356 gene locus_tag LOCUS_30270 182715 182356 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530464.1 protein_id gnl|my_center|LOCUS_30270 184120 182735 gene locus_tag LOCUS_30280 184120 182735 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530465.1 protein_id gnl|my_center|LOCUS_30280 185245 184139 gene locus_tag LOCUS_30290 185245 184139 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530466.1 protein_id gnl|my_center|LOCUS_30290 186034 185249 gene locus_tag LOCUS_30300 186034 185249 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530467.1 protein_id gnl|my_center|LOCUS_30300 186977 186039 gene locus_tag LOCUS_30310 186977 186039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160916.1 protein_id gnl|my_center|LOCUS_30310 188250 187231 gene locus_tag LOCUS_30320 188250 187231 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530469.1 protein_id gnl|my_center|LOCUS_30320 188964 188347 gene locus_tag LOCUS_30330 188964 188347 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530470.1 protein_id gnl|my_center|LOCUS_30330 191086 189125 gene locus_tag LOCUS_30340 191086 189125 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 protein_id gnl|my_center|LOCUS_30340 191302 191907 gene locus_tag LOCUS_30350 191302 191907 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095727.1 protein_id gnl|my_center|LOCUS_30350 192788 191910 gene locus_tag LOCUS_30360 192788 191910 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091135.1 protein_id gnl|my_center|LOCUS_30360 193031 193828 gene locus_tag LOCUS_30370 193031 193828 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969901.1 protein_id gnl|my_center|LOCUS_30370 193953 195467 gene locus_tag LOCUS_30380 193953 195467 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816379.1 protein_id gnl|my_center|LOCUS_30380 195607 196653 gene locus_tag LOCUS_30390 195607 196653 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975633.1 protein_id gnl|my_center|LOCUS_30390 196646 197668 gene locus_tag LOCUS_30400 196646 197668 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975634.1 protein_id gnl|my_center|LOCUS_30400 197914 198741 gene locus_tag LOCUS_30410 197914 198741 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534077.1 protein_id gnl|my_center|LOCUS_30410 198738 199514 gene locus_tag LOCUS_30420 198738 199514 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975636.1 protein_id gnl|my_center|LOCUS_30420 199507 200535 gene locus_tag LOCUS_30430 199507 200535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061540.1 protein_id gnl|my_center|LOCUS_30430 200532 201464 gene locus_tag LOCUS_30440 200532 201464 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975637.1 protein_id gnl|my_center|LOCUS_30440 201461 203251 gene locus_tag LOCUS_30450 201461 203251 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061542.1 protein_id gnl|my_center|LOCUS_30450 203248 204150 gene locus_tag LOCUS_30460 203248 204150 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061416.1 protein_id gnl|my_center|LOCUS_30460 204167 205468 gene locus_tag LOCUS_30470 204167 205468 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705259.1 protein_id gnl|my_center|LOCUS_30470 206902 205547 gene locus_tag LOCUS_30480 206902 205547 CDS product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188297.1 protein_id gnl|my_center|LOCUS_30480 208645 206963 gene locus_tag LOCUS_30490 208645 206963 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_30490 210321 208561 gene locus_tag LOCUS_30500 210321 208561 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969299.1 protein_id gnl|my_center|LOCUS_30500 210564 211556 gene locus_tag LOCUS_30510 210564 211556 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533169.1 protein_id gnl|my_center|LOCUS_30510 213071 211593 gene locus_tag LOCUS_30520 213071 211593 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975808.1 protein_id gnl|my_center|LOCUS_30520 213212 214228 gene locus_tag LOCUS_30530 gene tauA 213212 214228 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975809.1 protein_id gnl|my_center|LOCUS_30530 214313 215125 gene locus_tag LOCUS_30540 214313 215125 CDS product taurine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975810.1 protein_id gnl|my_center|LOCUS_30540 215118 215945 gene locus_tag LOCUS_30550 215118 215945 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061777.1 protein_id gnl|my_center|LOCUS_30550 216056 216442 gene locus_tag LOCUS_30560 216056 216442 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061778.1 protein_id gnl|my_center|LOCUS_30560 216460 217860 gene locus_tag LOCUS_30570 216460 217860 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975813.1 protein_id gnl|my_center|LOCUS_30570 217897 219672 gene locus_tag LOCUS_30580 gene xsc 217897 219672 CDS product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975814.1 protein_id gnl|my_center|LOCUS_30580 219745 220782 gene locus_tag LOCUS_30590 219745 220782 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061784.1 protein_id gnl|my_center|LOCUS_30590 220782 221783 gene locus_tag LOCUS_30600 gene pta 220782 221783 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061785.1 protein_id gnl|my_center|LOCUS_30600 221963 222187 gene locus_tag LOCUS_30610 221963 222187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969104.1 protein_id gnl|my_center|LOCUS_30610 223279 222215 gene locus_tag LOCUS_30620 223279 222215 CDS product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967920.1 protein_id gnl|my_center|LOCUS_30620 224097 223276 gene locus_tag LOCUS_30630 224097 223276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967921.1 protein_id gnl|my_center|LOCUS_30630 225128 224094 gene locus_tag LOCUS_30640 225128 224094 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967922.1 protein_id gnl|my_center|LOCUS_30640 226174 225131 gene locus_tag LOCUS_30650 226174 225131 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014531406.1 protein_id gnl|my_center|LOCUS_30650 227163 226171 gene locus_tag LOCUS_30660 227163 226171 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445481.1 protein_id gnl|my_center|LOCUS_30660 227455 229590 gene locus_tag LOCUS_30670 227455 229590 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169987.1 protein_id gnl|my_center|LOCUS_30670 230472 229597 gene locus_tag LOCUS_30680 230472 229597 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967926.1 protein_id gnl|my_center|LOCUS_30680 230932 231411 gene locus_tag LOCUS_30690 230932 231411 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395894.1 protein_id gnl|my_center|LOCUS_30690 231411 232778 gene locus_tag LOCUS_30700 gene accC 231411 232778 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395892.1 protein_id gnl|my_center|LOCUS_30700 232765 233232 gene locus_tag LOCUS_30710 232765 233232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395890.1 protein_id gnl|my_center|LOCUS_30710 233229 233927 gene locus_tag LOCUS_30720 gene pxpB 233229 233927 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973704.1 protein_id gnl|my_center|LOCUS_30720 233924 234916 gene locus_tag LOCUS_30730 233924 234916 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395886.1 protein_id gnl|my_center|LOCUS_30730 234926 235693 gene locus_tag LOCUS_30740 234926 235693 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973706.1 protein_id gnl|my_center|LOCUS_30740 235725 236927 gene locus_tag LOCUS_30750 235725 236927 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395882.1 protein_id gnl|my_center|LOCUS_30750 237835 236924 gene locus_tag LOCUS_30760 gene nac 237835 236924 CDS product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973708.1 protein_id gnl|my_center|LOCUS_30760 237986 238738 gene locus_tag LOCUS_30770 237986 238738 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973709.1 protein_id gnl|my_center|LOCUS_30770 238735 239442 gene locus_tag LOCUS_30780 238735 239442 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973710.1 protein_id gnl|my_center|LOCUS_30780 239439 240191 gene locus_tag LOCUS_30790 239439 240191 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973711.1 protein_id gnl|my_center|LOCUS_30790 240188 240955 gene locus_tag LOCUS_30800 240188 240955 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315969.1 protein_id gnl|my_center|LOCUS_30800 240982 241818 gene locus_tag LOCUS_30810 240982 241818 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973712.1 protein_id gnl|my_center|LOCUS_30810 241913 242587 gene locus_tag LOCUS_30820 241913 242587 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973713.1 protein_id gnl|my_center|LOCUS_30820 243446 242637 gene locus_tag LOCUS_30830 243446 242637 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133012.1 protein_id gnl|my_center|LOCUS_30830 244165 243470 gene locus_tag LOCUS_30840 244165 243470 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318320.1 protein_id gnl|my_center|LOCUS_30840 244878 244165 gene locus_tag LOCUS_30850 gene nocQ 244878 244165 CDS product nopaline ABC transporter permease NocQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891638.1 protein_id gnl|my_center|LOCUS_30850 246035 244875 gene locus_tag LOCUS_30860 246035 244875 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089925.1 protein_id gnl|my_center|LOCUS_30860 247428 246028 gene locus_tag LOCUS_30870 247428 246028 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040457.1 protein_id gnl|my_center|LOCUS_30870 247829 247524 gene locus_tag LOCUS_30880 247829 247524 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089927.1 protein_id gnl|my_center|LOCUS_30880 248765 247917 gene locus_tag LOCUS_30890 gene nocT 248765 247917 CDS product nopaline ABC transporter substrate-binding protein NocT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891637.1 protein_id gnl|my_center|LOCUS_30890 248989 249816 gene locus_tag LOCUS_30900 248989 249816 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973042.1 protein_id gnl|my_center|LOCUS_30900 251050 249914 gene locus_tag LOCUS_30910 251050 249914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 252135 251047 gene locus_tag LOCUS_30920 252135 251047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 253643 252321 gene locus_tag LOCUS_30930 253643 252321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 255875 253878 gene locus_tag LOCUS_30940 255875 253878 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397063.1 protein_id gnl|my_center|LOCUS_30940 257549 255966 gene locus_tag LOCUS_30950 257549 255966 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976313.1 protein_id gnl|my_center|LOCUS_30950 257691 258485 gene locus_tag LOCUS_30960 257691 258485 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969808.1 protein_id gnl|my_center|LOCUS_30960 259461 258508 gene locus_tag LOCUS_30970 259461 258508 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530452.1 protein_id gnl|my_center|LOCUS_30970 259563 260972 gene locus_tag LOCUS_30980 259563 260972 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 protein_id gnl|my_center|LOCUS_30980 260972 261820 gene locus_tag LOCUS_30990 gene urtB 260972 261820 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532993.1 protein_id gnl|my_center|LOCUS_30990 261817 262797 gene locus_tag LOCUS_31000 261817 262797 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532994.1 protein_id gnl|my_center|LOCUS_31000 262794 263480 gene locus_tag LOCUS_31010 262794 263480 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532995.1 protein_id gnl|my_center|LOCUS_31010 263480 264175 gene locus_tag LOCUS_31020 263480 264175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532996.1 protein_id gnl|my_center|LOCUS_31020 264228 265394 gene locus_tag LOCUS_31030 264228 265394 CDS product substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532997.1 protein_id gnl|my_center|LOCUS_31030 265391 266683 gene locus_tag LOCUS_31040 265391 266683 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417900.1 protein_id gnl|my_center|LOCUS_31040 267217 266741 gene locus_tag LOCUS_31050 267217 266741 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172160.1 protein_id gnl|my_center|LOCUS_31050 267343 268314 gene locus_tag LOCUS_31060 267343 268314 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090584.1 protein_id gnl|my_center|LOCUS_31060 269314 268400 gene locus_tag LOCUS_31070 269314 268400 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084684.1 protein_id gnl|my_center|LOCUS_31070 269430 270317 gene locus_tag LOCUS_31080 269430 270317 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090839.1 protein_id gnl|my_center|LOCUS_31080 270383 271042 gene locus_tag LOCUS_31090 270383 271042 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090840.1 protein_id gnl|my_center|LOCUS_31090 271039 271815 gene locus_tag LOCUS_31100 271039 271815 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090841.1 protein_id gnl|my_center|LOCUS_31100 271840 272961 gene locus_tag LOCUS_31110 271840 272961 CDS product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090843.1 protein_id gnl|my_center|LOCUS_31110 273056 274333 gene locus_tag LOCUS_31120 273056 274333 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089551.1 protein_id gnl|my_center|LOCUS_31120 274371 276125 gene locus_tag LOCUS_31130 274371 276125 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807539.1 protein_id gnl|my_center|LOCUS_31130 276154 276912 gene locus_tag LOCUS_31140 276154 276912 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969950.1 protein_id gnl|my_center|LOCUS_31140 278505 276925 gene locus_tag LOCUS_31150 278505 276925 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524564.1 protein_id gnl|my_center|LOCUS_31150 279943 278513 gene locus_tag LOCUS_31160 279943 278513 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 protein_id gnl|my_center|LOCUS_31160 280940 279933 gene locus_tag LOCUS_31170 gene fabK 280940 279933 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080864.1 protein_id gnl|my_center|LOCUS_31170 282567 280945 gene locus_tag LOCUS_31180 282567 280945 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218852620.1 protein_id gnl|my_center|LOCUS_31180 283336 282557 gene locus_tag LOCUS_31190 283336 282557 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_31190 284523 283336 gene locus_tag LOCUS_31200 284523 283336 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_31200 285269 284523 gene locus_tag LOCUS_31210 285269 284523 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228020.1 protein_id gnl|my_center|LOCUS_31210 286204 285278 gene locus_tag LOCUS_31220 286204 285278 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389693.1 protein_id gnl|my_center|LOCUS_31220 286829 286284 gene locus_tag LOCUS_31230 286829 286284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 287052 288071 gene locus_tag LOCUS_31240 287052 288071 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528515.1 protein_id gnl|my_center|LOCUS_31240 288094 289161 gene locus_tag LOCUS_31250 288094 289161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528516.1 protein_id gnl|my_center|LOCUS_31250 289158 290060 gene locus_tag LOCUS_31260 289158 290060 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528517.1 protein_id gnl|my_center|LOCUS_31260 290060 290869 gene locus_tag LOCUS_31270 290060 290869 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528518.1 protein_id gnl|my_center|LOCUS_31270 290912 292294 gene locus_tag LOCUS_31280 290912 292294 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389794.1 protein_id gnl|my_center|LOCUS_31280 292307 293326 gene locus_tag LOCUS_31290 292307 293326 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532102.1 protein_id gnl|my_center|LOCUS_31290 293396 293689 gene locus_tag LOCUS_31300 293396 293689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 293945 294547 gene locus_tag LOCUS_31310 293945 294547 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501867.1 protein_id gnl|my_center|LOCUS_31310 294790 296043 gene locus_tag LOCUS_31320 294790 296043 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528148.1 protein_id gnl|my_center|LOCUS_31320 296053 296337 gene locus_tag LOCUS_31330 296053 296337 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528149.1 protein_id gnl|my_center|LOCUS_31330 296318 299125 gene locus_tag LOCUS_31340 296318 299125 CDS product sarcosine oxidase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528150.1 protein_id gnl|my_center|LOCUS_31340 299118 299648 gene locus_tag LOCUS_31350 299118 299648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528151.1 protein_id gnl|my_center|LOCUS_31350 299708 300823 gene locus_tag LOCUS_31360 299708 300823 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532613.1 protein_id gnl|my_center|LOCUS_31360 302058 301030 gene locus_tag LOCUS_31370 302058 301030 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921512.1 protein_id gnl|my_center|LOCUS_31370 302269 303561 gene locus_tag LOCUS_31380 302269 303561 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921636.1 protein_id gnl|my_center|LOCUS_31380 303631 304506 gene locus_tag LOCUS_31390 303631 304506 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089095.1 protein_id gnl|my_center|LOCUS_31390 304517 305341 gene locus_tag LOCUS_31400 304517 305341 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089094.1 protein_id gnl|my_center|LOCUS_31400 305347 306345 gene locus_tag LOCUS_31410 305347 306345 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089093.1 protein_id gnl|my_center|LOCUS_31410 306350 307426 gene locus_tag LOCUS_31420 gene ugpC 306350 307426 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089092.1 protein_id gnl|my_center|LOCUS_31420 307423 308334 gene locus_tag LOCUS_31430 307423 308334 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089091.1 protein_id gnl|my_center|LOCUS_31430 308346 309392 gene locus_tag LOCUS_31440 308346 309392 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089090.1 protein_id gnl|my_center|LOCUS_31440 309420 310898 gene locus_tag LOCUS_31450 309420 310898 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974400.1 protein_id gnl|my_center|LOCUS_31450 310898 311641 gene locus_tag LOCUS_31460 310898 311641 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089098.1 protein_id gnl|my_center|LOCUS_31460 311649 312818 gene locus_tag LOCUS_31470 311649 312818 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812102.1 protein_id gnl|my_center|LOCUS_31470 312815 313588 gene locus_tag LOCUS_31480 312815 313588 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810210.1 protein_id gnl|my_center|LOCUS_31480 314315 313617 gene locus_tag LOCUS_31490 314315 313617 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279101.1 protein_id gnl|my_center|LOCUS_31490 315539 314433 gene locus_tag LOCUS_31500 315539 314433 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530811.1 protein_id gnl|my_center|LOCUS_31500 316674 315568 gene locus_tag LOCUS_31510 316674 315568 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976324.1 protein_id gnl|my_center|LOCUS_31510 318836 316686 gene locus_tag LOCUS_31520 318836 316686 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068954085.1 protein_id gnl|my_center|LOCUS_31520 319239 319790 gene locus_tag LOCUS_31530 319239 319790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 321461 319857 gene locus_tag LOCUS_31540 gene rtcR 321461 319857 CDS product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122266.1 protein_id gnl|my_center|LOCUS_31540 321675 323231 gene locus_tag LOCUS_31550 321675 323231 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 protein_id gnl|my_center|LOCUS_31550 323890 325314 gene locus_tag LOCUS_31560 323890 325314 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256441.1 protein_id gnl|my_center|LOCUS_31560 325287 325484 gene locus_tag LOCUS_31570 325287 325484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 325546 326763 gene locus_tag LOCUS_31580 325546 326763 CDS product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074621948.1 protein_id gnl|my_center|LOCUS_31580 326750 327370 gene locus_tag LOCUS_31590 gene prfH 326750 327370 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602086.1 protein_id gnl|my_center|LOCUS_31590 328243 327458 gene locus_tag LOCUS_31600 328243 327458 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067339.1 protein_id gnl|my_center|LOCUS_31600 329243 328293 gene locus_tag LOCUS_31610 329243 328293 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067338.1 protein_id gnl|my_center|LOCUS_31610 330735 329266 gene locus_tag LOCUS_31620 330735 329266 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067337.1 protein_id gnl|my_center|LOCUS_31620 331787 330819 gene locus_tag LOCUS_31630 331787 330819 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067336.1 protein_id gnl|my_center|LOCUS_31630 332596 331787 gene locus_tag LOCUS_31640 332596 331787 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310901.1 protein_id gnl|my_center|LOCUS_31640 332806 333780 gene locus_tag LOCUS_31650 332806 333780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067334.1 protein_id gnl|my_center|LOCUS_31650 333899 334831 gene locus_tag LOCUS_31660 333899 334831 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067333.1 protein_id gnl|my_center|LOCUS_31660 334853 336340 gene locus_tag LOCUS_31670 334853 336340 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067332.1 protein_id gnl|my_center|LOCUS_31670 336355 337143 gene locus_tag LOCUS_31680 336355 337143 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314013.1 protein_id gnl|my_center|LOCUS_31680 337440 338075 gene locus_tag LOCUS_31690 gene ribB 337440 338075 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314017.1 protein_id gnl|my_center|LOCUS_31690 339488 338157 gene locus_tag LOCUS_31700 339488 338157 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976222.1 protein_id gnl|my_center|LOCUS_31700 340535 339639 gene locus_tag LOCUS_31710 gene purU 340535 339639 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976224.1 protein_id gnl|my_center|LOCUS_31710 341446 340556 gene locus_tag LOCUS_31720 gene folD 341446 340556 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976225.1 protein_id gnl|my_center|LOCUS_31720 342821 341544 gene locus_tag LOCUS_31730 342821 341544 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976226.1 protein_id gnl|my_center|LOCUS_31730 342953 343921 gene locus_tag LOCUS_31740 342953 343921 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976227.1 protein_id gnl|my_center|LOCUS_31740 344177 345208 gene locus_tag LOCUS_31750 344177 345208 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976228.1 protein_id gnl|my_center|LOCUS_31750 345274 346485 gene locus_tag LOCUS_31760 345274 346485 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976229.1 protein_id gnl|my_center|LOCUS_31760 346482 347612 gene locus_tag LOCUS_31770 346482 347612 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976230.1 protein_id gnl|my_center|LOCUS_31770 347642 348400 gene locus_tag LOCUS_31780 347642 348400 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976231.1 protein_id gnl|my_center|LOCUS_31780 348694 348446 gene locus_tag LOCUS_31790 348694 348446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035216164.1 protein_id gnl|my_center|LOCUS_31790 349751 348873 gene locus_tag LOCUS_31800 349751 348873 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975551.1 protein_id gnl|my_center|LOCUS_31800 349842 350756 gene locus_tag LOCUS_31810 349842 350756 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158693500.1 protein_id gnl|my_center|LOCUS_31810 351082 353178 gene locus_tag LOCUS_31820 351082 353178 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399322.1 protein_id gnl|my_center|LOCUS_31820 353194 354852 gene locus_tag LOCUS_31830 353194 354852 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399319.1 protein_id gnl|my_center|LOCUS_31830 354987 355793 gene locus_tag LOCUS_31840 354987 355793 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399313.1 protein_id gnl|my_center|LOCUS_31840 355793 356986 gene locus_tag LOCUS_31850 355793 356986 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399310.1 protein_id gnl|my_center|LOCUS_31850 357737 357006 gene locus_tag LOCUS_31860 357737 357006 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399305.1 protein_id gnl|my_center|LOCUS_31860 357914 358663 gene locus_tag LOCUS_31870 357914 358663 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399300.1 protein_id gnl|my_center|LOCUS_31870 358656 359399 gene locus_tag LOCUS_31880 358656 359399 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399298.1 protein_id gnl|my_center|LOCUS_31880 360209 359418 gene locus_tag LOCUS_31890 gene hexR 360209 359418 CDS product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096857.1 protein_id gnl|my_center|LOCUS_31890 361110 360253 gene locus_tag LOCUS_31900 361110 360253 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_31900 362204 361107 gene locus_tag LOCUS_31910 362204 361107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975241.1 protein_id gnl|my_center|LOCUS_31910 363892 362210 gene locus_tag LOCUS_31920 363892 362210 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084161.1 protein_id gnl|my_center|LOCUS_31920 364994 364059 gene locus_tag LOCUS_31930 364994 364059 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969388.1 protein_id gnl|my_center|LOCUS_31930 365451 366299 gene locus_tag LOCUS_31940 365451 366299 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975032.1 protein_id gnl|my_center|LOCUS_31940 366484 367398 gene locus_tag LOCUS_31950 366484 367398 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532054.1 protein_id gnl|my_center|LOCUS_31950 367402 368328 gene locus_tag LOCUS_31960 367402 368328 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969617.1 protein_id gnl|my_center|LOCUS_31960 368321 369955 gene locus_tag LOCUS_31970 368321 369955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975058.1 protein_id gnl|my_center|LOCUS_31970 369952 370926 gene locus_tag LOCUS_31980 369952 370926 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384661.1 protein_id gnl|my_center|LOCUS_31980 371627 370914 gene locus_tag LOCUS_31990 371627 370914 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083214.1 protein_id gnl|my_center|LOCUS_31990 371773 373509 gene locus_tag LOCUS_32000 gene araD 371773 373509 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165224571.1 protein_id gnl|my_center|LOCUS_32000 373603 374313 gene locus_tag LOCUS_32010 373603 374313 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973471.1 protein_id gnl|my_center|LOCUS_32010 374454 375359 gene locus_tag LOCUS_32020 gene kdgD 374454 375359 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339506.1 protein_id gnl|my_center|LOCUS_32020 375359 376264 gene locus_tag LOCUS_32030 375359 376264 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106713570.1 protein_id gnl|my_center|LOCUS_32030 376415 377935 gene locus_tag LOCUS_32040 376415 377935 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974335.1 protein_id gnl|my_center|LOCUS_32040 377999 379054 gene locus_tag LOCUS_32050 377999 379054 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100003378.1 protein_id gnl|my_center|LOCUS_32050 379159 379641 gene locus_tag LOCUS_32060 gene greA 379159 379641 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241287.1 protein_id gnl|my_center|LOCUS_32060 380344 379646 gene locus_tag LOCUS_32070 380344 379646 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084166.1 protein_id gnl|my_center|LOCUS_32070 380711 380337 gene locus_tag LOCUS_32080 380711 380337 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084165.1 protein_id gnl|my_center|LOCUS_32080 380846 381277 gene locus_tag LOCUS_32090 380846 381277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 381349 382821 gene locus_tag LOCUS_32100 381349 382821 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028720319.1 protein_id gnl|my_center|LOCUS_32100 382945 383394 gene locus_tag LOCUS_32110 382945 383394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 383570 385144 gene locus_tag LOCUS_32120 383570 385144 CDS product D-aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339153.1 protein_id gnl|my_center|LOCUS_32120 385278 386129 gene locus_tag LOCUS_32130 385278 386129 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967047.1 protein_id gnl|my_center|LOCUS_32130 386265 387302 gene locus_tag LOCUS_32140 386265 387302 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967048.1 protein_id gnl|my_center|LOCUS_32140 387299 388099 gene locus_tag LOCUS_32150 387299 388099 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889182.1 protein_id gnl|my_center|LOCUS_32150 389084 388071 gene locus_tag LOCUS_32160 389084 388071 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967049.1 protein_id gnl|my_center|LOCUS_32160 389225 390850 gene locus_tag LOCUS_32170 389225 390850 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 protein_id gnl|my_center|LOCUS_32170 390907 392499 gene locus_tag LOCUS_32180 390907 392499 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967051.1 protein_id gnl|my_center|LOCUS_32180 392584 393519 gene locus_tag LOCUS_32190 392584 393519 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967052.1 protein_id gnl|my_center|LOCUS_32190 393525 394346 gene locus_tag LOCUS_32200 393525 394346 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967053.1 protein_id gnl|my_center|LOCUS_32200 394343 395254 gene locus_tag LOCUS_32210 394343 395254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967054.1 protein_id gnl|my_center|LOCUS_32210 395251 396213 gene locus_tag LOCUS_32220 395251 396213 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967055.1 protein_id gnl|my_center|LOCUS_32220 396300 398171 gene locus_tag LOCUS_32230 396300 398171 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969665.1 protein_id gnl|my_center|LOCUS_32230 398334 399407 gene locus_tag LOCUS_32240 398334 399407 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974116.1 protein_id gnl|my_center|LOCUS_32240 399474 401273 gene locus_tag LOCUS_32250 399474 401273 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176058.1 protein_id gnl|my_center|LOCUS_32250 402723 401350 gene locus_tag LOCUS_32260 402723 401350 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975296.1 protein_id gnl|my_center|LOCUS_32260 404477 402981 gene locus_tag LOCUS_32270 404477 402981 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975297.1 protein_id gnl|my_center|LOCUS_32270 405091 404609 gene locus_tag LOCUS_32280 405091 404609 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525883.1 protein_id gnl|my_center|LOCUS_32280 405194 406579 gene locus_tag LOCUS_32290 405194 406579 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401297.1 protein_id gnl|my_center|LOCUS_32290 406702 407487 gene locus_tag LOCUS_32300 gene ehuA 406702 407487 CDS product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525885.1 protein_id gnl|my_center|LOCUS_32300 407574 408401 gene locus_tag LOCUS_32310 gene ehuB 407574 408401 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969335.1 protein_id gnl|my_center|LOCUS_32310 408594 409265 gene locus_tag LOCUS_32320 gene ehuC 408594 409265 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525889.1 protein_id gnl|my_center|LOCUS_32320 409268 409930 gene locus_tag LOCUS_32330 gene ehuD 409268 409930 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969333.1 protein_id gnl|my_center|LOCUS_32330 409930 410706 gene locus_tag LOCUS_32340 gene eutA 409930 410706 CDS product ectoine utilization protein EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401284.1 protein_id gnl|my_center|LOCUS_32340 410710 411717 gene locus_tag LOCUS_32350 gene eutB 410710 411717 CDS product hydroxyectoine utilization dehydratase EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401316.1 protein_id gnl|my_center|LOCUS_32350 411714 412706 gene locus_tag LOCUS_32360 gene eutC 411714 412706 CDS product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975301.1 protein_id gnl|my_center|LOCUS_32360 412741 413922 gene locus_tag LOCUS_32370 gene doeA 412741 413922 CDS product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969329.1 protein_id gnl|my_center|LOCUS_32370 413926 414933 gene locus_tag LOCUS_32380 gene doeB 413926 414933 CDS product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014530717.1 protein_id gnl|my_center|LOCUS_32380 415891 415040 gene locus_tag LOCUS_32390 415891 415040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 416424 416098 gene locus_tag LOCUS_32400 416424 416098 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249692.1 protein_id gnl|my_center|LOCUS_32400 417529 416684 gene locus_tag LOCUS_32410 417529 416684 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974708.1 protein_id gnl|my_center|LOCUS_32410 418811 417651 gene locus_tag LOCUS_32420 gene tcuB 418811 417651 CDS product tricarballylate utilization protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811143.1 protein_id gnl|my_center|LOCUS_32420 420245 418827 gene locus_tag LOCUS_32430 gene tcuA 420245 418827 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228705.1 protein_id gnl|my_center|LOCUS_32430 422043 420397 gene locus_tag LOCUS_32440 422043 420397 CDS product amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087236.1 protein_id gnl|my_center|LOCUS_32440 423151 422171 gene locus_tag LOCUS_32450 423151 422171 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387478.1 protein_id gnl|my_center|LOCUS_32450 424362 423160 gene locus_tag LOCUS_32460 424362 423160 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092809287.1 protein_id gnl|my_center|LOCUS_32460 425883 424447 gene locus_tag LOCUS_32470 425883 424447 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939933.1 protein_id gnl|my_center|LOCUS_32470 426065 427717 gene locus_tag LOCUS_32480 426065 427717 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376432.1 protein_id gnl|my_center|LOCUS_32480 427707 429815 gene locus_tag LOCUS_32490 427707 429815 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_32490 429815 431425 gene locus_tag LOCUS_32500 429815 431425 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142798.1 protein_id gnl|my_center|LOCUS_32500 431437 432222 gene locus_tag LOCUS_32510 431437 432222 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 protein_id gnl|my_center|LOCUS_32510 432235 433149 gene locus_tag LOCUS_32520 432235 433149 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_32520 433158 433652 gene locus_tag LOCUS_32530 433158 433652 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086736.1 protein_id gnl|my_center|LOCUS_32530 434434 433685 gene locus_tag LOCUS_32540 434434 433685 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975340.1 protein_id gnl|my_center|LOCUS_32540 436025 434571 gene locus_tag LOCUS_32550 436025 434571 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089926.1 protein_id gnl|my_center|LOCUS_32550 436324 436022 gene locus_tag LOCUS_32560 436324 436022 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040456.1 protein_id gnl|my_center|LOCUS_32560 436836 436486 gene locus_tag LOCUS_32570 436836 436486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 437367 436942 gene locus_tag LOCUS_32580 437367 436942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 437251 437502 gene locus_tag LOCUS_32590 437251 437502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 439933 437747 gene locus_tag LOCUS_32600 439933 437747 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064868.1 protein_id gnl|my_center|LOCUS_32600 440411 439983 gene locus_tag LOCUS_32610 440411 439983 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467030.1 protein_id gnl|my_center|LOCUS_32610 441560 440415 gene locus_tag LOCUS_32620 441560 440415 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 protein_id gnl|my_center|LOCUS_32620 442552 441560 gene locus_tag LOCUS_32630 442552 441560 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 protein_id gnl|my_center|LOCUS_32630 443786 442605 gene locus_tag LOCUS_32640 443786 442605 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090004.1 protein_id gnl|my_center|LOCUS_32640 445005 443797 gene locus_tag LOCUS_32650 gene pimC 445005 443797 CDS product pimeloyl-CoA dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090542.1 protein_id gnl|my_center|LOCUS_32650 445261 446091 gene locus_tag LOCUS_32660 445261 446091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 446154 446624 gene locus_tag LOCUS_32670 446154 446624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 446634 447413 gene locus_tag LOCUS_32680 446634 447413 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_32680 447441 447629 gene locus_tag LOCUS_32690 447441 447629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 447626 449017 gene locus_tag LOCUS_32700 447626 449017 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 protein_id gnl|my_center|LOCUS_32700 450301 449090 gene locus_tag LOCUS_32710 450301 449090 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401398.1 protein_id gnl|my_center|LOCUS_32710 450998 450303 gene locus_tag LOCUS_32720 450998 450303 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 protein_id gnl|my_center|LOCUS_32720 451544 451008 gene locus_tag LOCUS_32730 451544 451008 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037975.1 protein_id gnl|my_center|LOCUS_32730 452100 451615 gene locus_tag LOCUS_32740 452100 451615 CDS product Spy/CpxP family protein refolding chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037462585.1 protein_id gnl|my_center|LOCUS_32740 453253 452267 gene locus_tag LOCUS_32750 453253 452267 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533353.1 protein_id gnl|my_center|LOCUS_32750 453478 454302 gene locus_tag LOCUS_32760 453478 454302 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389905.1 protein_id gnl|my_center|LOCUS_32760 454316 454975 gene locus_tag LOCUS_32770 454316 454975 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886243.1 protein_id gnl|my_center|LOCUS_32770 454987 455718 gene locus_tag LOCUS_32780 gene nocM 454987 455718 CDS product nopaline ABC transporter permease NocM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523894.1 protein_id gnl|my_center|LOCUS_32780 455708 456874 gene locus_tag LOCUS_32790 gene alr 455708 456874 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533357.1 protein_id gnl|my_center|LOCUS_32790 456876 457721 gene locus_tag LOCUS_32800 gene nocT 456876 457721 CDS product nopaline ABC transporter substrate-binding protein NocT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891637.1 protein_id gnl|my_center|LOCUS_32800 457791 459035 gene locus_tag LOCUS_32810 457791 459035 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533354.1 protein_id gnl|my_center|LOCUS_32810 459525 459052 gene locus_tag LOCUS_32820 459525 459052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 459727 462516 gene locus_tag LOCUS_32830 459727 462516 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_32830 462841 464226 gene locus_tag LOCUS_32840 462841 464226 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061450.1 protein_id gnl|my_center|LOCUS_32840 464625 464290 gene locus_tag LOCUS_32850 464625 464290 CDS product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976253.1 protein_id gnl|my_center|LOCUS_32850 465368 464808 gene locus_tag LOCUS_32860 gene msuE 465368 464808 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528153.1 protein_id gnl|my_center|LOCUS_32860 466061 465537 gene locus_tag LOCUS_32870 466061 465537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 466742 466125 gene locus_tag LOCUS_32880 466742 466125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 466917 466732 gene locus_tag LOCUS_32890 466917 466732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 467252 468205 gene locus_tag LOCUS_32900 467252 468205 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269279.1 protein_id gnl|my_center|LOCUS_32900 468205 469041 gene locus_tag LOCUS_32910 gene ssuC 468205 469041 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 protein_id gnl|my_center|LOCUS_32910 469038 469781 gene locus_tag LOCUS_32920 gene ssuB 469038 469781 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105420.1 protein_id gnl|my_center|LOCUS_32920 469830 470870 gene locus_tag LOCUS_32930 469830 470870 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530313.1 protein_id gnl|my_center|LOCUS_32930 470906 471754 gene locus_tag LOCUS_32940 gene cysE 470906 471754 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094922.1 protein_id gnl|my_center|LOCUS_32940 472980 471811 gene locus_tag LOCUS_32950 gene ssuD 472980 471811 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973029.1 protein_id gnl|my_center|LOCUS_32950 473460 474494 gene locus_tag LOCUS_32960 473460 474494 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089195.1 protein_id gnl|my_center|LOCUS_32960 474499 475500 gene locus_tag LOCUS_32970 474499 475500 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089194.1 protein_id gnl|my_center|LOCUS_32970 475497 476285 gene locus_tag LOCUS_32980 475497 476285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089193.1 protein_id gnl|my_center|LOCUS_32980 476275 476574 gene locus_tag LOCUS_32990 476275 476574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 476601 477962 gene locus_tag LOCUS_33000 476601 477962 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626023.1 protein_id gnl|my_center|LOCUS_33000 478183 479415 gene locus_tag LOCUS_33010 478183 479415 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206502.1 protein_id gnl|my_center|LOCUS_33010 479421 480473 gene locus_tag LOCUS_33020 479421 480473 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038713.1 protein_id gnl|my_center|LOCUS_33020 480463 481122 gene locus_tag LOCUS_33030 480463 481122 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097004.1 protein_id gnl|my_center|LOCUS_33030 481143 481955 gene locus_tag LOCUS_33040 481143 481955 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093057.1 protein_id gnl|my_center|LOCUS_33040 482030 483295 gene locus_tag LOCUS_33050 482030 483295 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528154.1 protein_id gnl|my_center|LOCUS_33050 483331 484698 gene locus_tag LOCUS_33060 483331 484698 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266344.1 protein_id gnl|my_center|LOCUS_33060 484855 485859 gene locus_tag LOCUS_33070 484855 485859 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202597.1 protein_id gnl|my_center|LOCUS_33070 485921 487453 gene locus_tag LOCUS_33080 485921 487453 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268053.1 protein_id gnl|my_center|LOCUS_33080 487443 488492 gene locus_tag LOCUS_33090 487443 488492 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104324.1 protein_id gnl|my_center|LOCUS_33090 488494 489471 gene locus_tag LOCUS_33100 488494 489471 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104323.1 protein_id gnl|my_center|LOCUS_33100 489498 490712 gene locus_tag LOCUS_33110 489498 490712 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975951.1 protein_id gnl|my_center|LOCUS_33110 492079 490868 gene locus_tag LOCUS_33120 492079 490868 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104714.1 protein_id gnl|my_center|LOCUS_33120 492344 493756 gene locus_tag LOCUS_33130 492344 493756 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107490.1 protein_id gnl|my_center|LOCUS_33130 493764 495248 gene locus_tag LOCUS_33140 493764 495248 CDS product FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061451.1 protein_id gnl|my_center|LOCUS_33140 495381 495656 gene locus_tag LOCUS_33150 495381 495656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075628183.1 protein_id gnl|my_center|LOCUS_33150 496408 495722 gene locus_tag LOCUS_33160 496408 495722 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120280.1 protein_id gnl|my_center|LOCUS_33160 496502 497722 gene locus_tag LOCUS_33170 496502 497722 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530682.1 protein_id gnl|my_center|LOCUS_33170 497719 500841 gene locus_tag LOCUS_33180 497719 500841 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972395.1 protein_id gnl|my_center|LOCUS_33180 501594 500899 gene locus_tag LOCUS_33190 501594 500899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 502373 501594 gene locus_tag LOCUS_33200 gene ehuA 502373 501594 CDS product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209942632.1 protein_id gnl|my_center|LOCUS_33200 503023 502370 gene locus_tag LOCUS_33210 gene ehuD 503023 502370 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812579.1 protein_id gnl|my_center|LOCUS_33210 503751 503023 gene locus_tag LOCUS_33220 gene ehuC 503751 503023 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812581.1 protein_id gnl|my_center|LOCUS_33220 504645 503815 gene locus_tag LOCUS_33230 gene ehuB 504645 503815 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039638.1 protein_id gnl|my_center|LOCUS_33230 504869 506050 gene locus_tag LOCUS_33240 gene doeA 504869 506050 CDS product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974131.1 protein_id gnl|my_center|LOCUS_33240 506083 507231 gene locus_tag LOCUS_33250 506083 507231 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339317.1 protein_id gnl|my_center|LOCUS_33250 507239 508495 gene locus_tag LOCUS_33260 507239 508495 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821029.1 protein_id gnl|my_center|LOCUS_33260 508506 508772 gene locus_tag LOCUS_33270 508506 508772 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821030.1 protein_id gnl|my_center|LOCUS_33270 508769 511693 gene locus_tag LOCUS_33280 508769 511693 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531141.1 protein_id gnl|my_center|LOCUS_33280 511686 512177 gene locus_tag LOCUS_33290 511686 512177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 512319 512939 gene locus_tag LOCUS_33300 512319 512939 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528422.1 protein_id gnl|my_center|LOCUS_33300 513078 514019 gene locus_tag LOCUS_33310 513078 514019 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972724.1 protein_id gnl|my_center|LOCUS_33310 514090 514890 gene locus_tag LOCUS_33320 514090 514890 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266621.1 protein_id gnl|my_center|LOCUS_33320 514887 515897 gene locus_tag LOCUS_33330 514887 515897 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972725.1 protein_id gnl|my_center|LOCUS_33330 515899 516990 gene locus_tag LOCUS_33340 515899 516990 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414790.1 protein_id gnl|my_center|LOCUS_33340 517019 517783 gene locus_tag LOCUS_33350 517019 517783 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532007.1 protein_id gnl|my_center|LOCUS_33350 517809 518720 gene locus_tag LOCUS_33360 517809 518720 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339536.1 protein_id gnl|my_center|LOCUS_33360 518717 519559 gene locus_tag LOCUS_33370 518717 519559 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339537.1 protein_id gnl|my_center|LOCUS_33370 519565 520800 gene locus_tag LOCUS_33380 519565 520800 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972730.1 protein_id gnl|my_center|LOCUS_33380 522108 520804 gene locus_tag LOCUS_33390 522108 520804 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970057.1 protein_id gnl|my_center|LOCUS_33390 522790 522122 gene locus_tag LOCUS_33400 522790 522122 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970056.1 protein_id gnl|my_center|LOCUS_33400 523815 522787 gene locus_tag LOCUS_33410 523815 522787 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970055.1 protein_id gnl|my_center|LOCUS_33410 524718 523828 gene locus_tag LOCUS_33420 524718 523828 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970054.1 protein_id gnl|my_center|LOCUS_33420 525431 524724 gene locus_tag LOCUS_33430 525431 524724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970053.1 protein_id gnl|my_center|LOCUS_33430 526158 525424 gene locus_tag LOCUS_33440 526158 525424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434161.1 protein_id gnl|my_center|LOCUS_33440 527383 526211 gene locus_tag LOCUS_33450 527383 526211 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970052.1 protein_id gnl|my_center|LOCUS_33450 528155 527505 gene locus_tag LOCUS_33460 528155 527505 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844806.1 protein_id gnl|my_center|LOCUS_33460 528961 528155 gene locus_tag LOCUS_33470 528961 528155 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434152.1 protein_id gnl|my_center|LOCUS_33470 529109 530005 gene locus_tag LOCUS_33480 529109 530005 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434149.1 protein_id gnl|my_center|LOCUS_33480 530013 531308 gene locus_tag LOCUS_33490 530013 531308 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970230.1 protein_id gnl|my_center|LOCUS_33490 531391 531624 gene locus_tag LOCUS_33500 531391 531624 CDS product DUF2171 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090751.1 protein_id gnl|my_center|LOCUS_33500 532458 531688 gene locus_tag LOCUS_33510 532458 531688 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528029.1 protein_id gnl|my_center|LOCUS_33510 532681 533646 gene locus_tag LOCUS_33520 532681 533646 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 protein_id gnl|my_center|LOCUS_33520 533810 534760 gene locus_tag LOCUS_33530 533810 534760 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 protein_id gnl|my_center|LOCUS_33530 534765 536798 gene locus_tag LOCUS_33540 534765 536798 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 protein_id gnl|my_center|LOCUS_33540 536798 537709 gene locus_tag LOCUS_33550 536798 537709 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528030.1 protein_id gnl|my_center|LOCUS_33550 537706 540147 gene locus_tag LOCUS_33560 537706 540147 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528031.1 protein_id gnl|my_center|LOCUS_33560 540237 540509 gene locus_tag LOCUS_33570 gene dmeR 540237 540509 CDS product Ni(II)/Co(II)-sensing transcriptional repressor DmeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971229.1 protein_id gnl|my_center|LOCUS_33570 540597 541592 gene locus_tag LOCUS_33580 gene dmeF 540597 541592 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971230.1 protein_id gnl|my_center|LOCUS_33580 542247 541606 gene locus_tag LOCUS_33590 542247 541606 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170453.1 protein_id gnl|my_center|LOCUS_33590 542328 543233 gene locus_tag LOCUS_33600 542328 543233 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528033.1 protein_id gnl|my_center|LOCUS_33600 543436 544464 gene locus_tag LOCUS_33610 543436 544464 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242815.1 protein_id gnl|my_center|LOCUS_33610 544689 546209 gene locus_tag LOCUS_33620 544689 546209 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242816.1 protein_id gnl|my_center|LOCUS_33620 546232 547221 gene locus_tag LOCUS_33630 546232 547221 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242817.1 protein_id gnl|my_center|LOCUS_33630 547223 548230 gene locus_tag LOCUS_33640 547223 548230 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242818.1 protein_id gnl|my_center|LOCUS_33640 548227 549222 gene locus_tag LOCUS_33650 548227 549222 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255513.1 protein_id gnl|my_center|LOCUS_33650 549235 550983 gene locus_tag LOCUS_33660 549235 550983 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255514.1 protein_id gnl|my_center|LOCUS_33660 550956 551798 gene locus_tag LOCUS_33670 550956 551798 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160785845.1 protein_id gnl|my_center|LOCUS_33670 551828 553357 gene locus_tag LOCUS_33680 551828 553357 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982203.1 protein_id gnl|my_center|LOCUS_33680 553375 554979 gene locus_tag LOCUS_33690 553375 554979 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242823.1 protein_id gnl|my_center|LOCUS_33690 555050 555298 gene locus_tag LOCUS_33700 555050 555298 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395819.1 protein_id gnl|my_center|LOCUS_33700 555295 555708 gene locus_tag LOCUS_33710 555295 555708 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528323.1 protein_id gnl|my_center|LOCUS_33710 556427 555765 gene locus_tag LOCUS_33720 556427 555765 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973419.1 protein_id gnl|my_center|LOCUS_33720 556671 557936 gene locus_tag LOCUS_33730 556671 557936 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315508.1 protein_id gnl|my_center|LOCUS_33730 557955 558722 gene locus_tag LOCUS_33740 557955 558722 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973420.1 protein_id gnl|my_center|LOCUS_33740 558732 559541 gene locus_tag LOCUS_33750 558732 559541 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973421.1 protein_id gnl|my_center|LOCUS_33750 559549 561141 gene locus_tag LOCUS_33760 559549 561141 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973422.1 protein_id gnl|my_center|LOCUS_33760 561152 562882 gene locus_tag LOCUS_33770 561152 562882 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973423.1 protein_id gnl|my_center|LOCUS_33770 563931 563086 gene locus_tag LOCUS_33780 563931 563086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 564526 563960 gene locus_tag LOCUS_33790 564526 563960 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028020.1 protein_id gnl|my_center|LOCUS_33790 565644 564559 gene locus_tag LOCUS_33800 565644 564559 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530504.1 protein_id gnl|my_center|LOCUS_33800 566513 565674 gene locus_tag LOCUS_33810 566513 565674 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315206.1 protein_id gnl|my_center|LOCUS_33810 567423 566515 gene locus_tag LOCUS_33820 567423 566515 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976104.1 protein_id gnl|my_center|LOCUS_33820 568498 567425 gene locus_tag LOCUS_33830 gene ugpC 568498 567425 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532490.1 protein_id gnl|my_center|LOCUS_33830 569439 568495 gene locus_tag LOCUS_33840 569439 568495 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_33840 570221 569436 gene locus_tag LOCUS_33850 gene nagB 570221 569436 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804961.1 protein_id gnl|my_center|LOCUS_33850 571093 570218 gene locus_tag LOCUS_33860 571093 570218 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612349.1 protein_id gnl|my_center|LOCUS_33860 572473 571205 gene locus_tag LOCUS_33870 572473 571205 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061333.1 protein_id gnl|my_center|LOCUS_33870 572787 573128 gene locus_tag LOCUS_33880 572787 573128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 574007 573291 gene locus_tag LOCUS_33890 574007 573291 CDS product DUF6065 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970027.1 protein_id gnl|my_center|LOCUS_33890 574420 574112 gene locus_tag LOCUS_33900 574420 574112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327215.1 protein_id gnl|my_center|LOCUS_33900 574949 574413 gene locus_tag LOCUS_33910 574949 574413 CDS product DUF6151 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066657.1 protein_id gnl|my_center|LOCUS_33910 575580 574900 gene locus_tag LOCUS_33920 575580 574900 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066656.1 protein_id gnl|my_center|LOCUS_33920 576781 576041 gene locus_tag LOCUS_33930 576781 576041 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967077.1 protein_id gnl|my_center|LOCUS_33930 577308 576778 gene locus_tag LOCUS_33940 577308 576778 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970030.1 protein_id gnl|my_center|LOCUS_33940 577432 578820 gene locus_tag LOCUS_33950 577432 578820 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967075.1 protein_id gnl|my_center|LOCUS_33950 579891 578902 gene locus_tag LOCUS_33960 gene nadE 579891 578902 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061276.1 protein_id gnl|my_center|LOCUS_33960 581426 579888 gene locus_tag LOCUS_33970 581426 579888 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525355.1 protein_id gnl|my_center|LOCUS_33970 581694 581440 gene locus_tag LOCUS_33980 581694 581440 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392338.1 protein_id gnl|my_center|LOCUS_33980 583652 581697 gene locus_tag LOCUS_33990 gene asnB 583652 581697 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392336.1 protein_id gnl|my_center|LOCUS_33990 584733 583657 gene locus_tag LOCUS_34000 584733 583657 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061288.1 protein_id gnl|my_center|LOCUS_34000 585697 584915 gene locus_tag LOCUS_34010 585697 584915 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967150.1 protein_id gnl|my_center|LOCUS_34010 585749 586153 gene locus_tag LOCUS_34020 585749 586153 CDS product MerR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967151.1 protein_id gnl|my_center|LOCUS_34020 586387 587505 gene locus_tag LOCUS_34030 586387 587505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 587560 589110 gene locus_tag LOCUS_34040 587560 589110 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970036.1 protein_id gnl|my_center|LOCUS_34040 589114 590085 gene locus_tag LOCUS_34050 589114 590085 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523896.1 protein_id gnl|my_center|LOCUS_34050 590100 591635 gene locus_tag LOCUS_34060 590100 591635 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533079.1 protein_id gnl|my_center|LOCUS_34060 591632 592408 gene locus_tag LOCUS_34070 591632 592408 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533078.1 protein_id gnl|my_center|LOCUS_34070 592405 594135 gene locus_tag LOCUS_34080 592405 594135 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167355198.1 protein_id gnl|my_center|LOCUS_34080 594132 595130 gene locus_tag LOCUS_34090 594132 595130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 602003 595209 gene locus_tag LOCUS_34100 602003 595209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391988.1 protein_id gnl|my_center|LOCUS_34100 604206 602191 gene locus_tag LOCUS_34110 604206 602191 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061583.1 protein_id gnl|my_center|LOCUS_34110 604688 604212 gene locus_tag LOCUS_34120 604688 604212 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067313.1 protein_id gnl|my_center|LOCUS_34120 604851 607145 gene locus_tag LOCUS_34130 604851 607145 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992291.1 protein_id gnl|my_center|LOCUS_34130 607142 607411 gene locus_tag LOCUS_34140 607142 607411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971704.1 protein_id gnl|my_center|LOCUS_34140 609685 607589 gene locus_tag LOCUS_34150 609685 607589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 611643 609766 gene locus_tag LOCUS_34160 611643 609766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 613871 611652 gene locus_tag LOCUS_34170 613871 611652 CDS product antifreeze protein, type I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339364.1 protein_id gnl|my_center|LOCUS_34170 614308 613868 gene locus_tag LOCUS_34180 614308 613868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 616100 614424 gene locus_tag LOCUS_34190 616100 614424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 617465 616515 gene locus_tag LOCUS_34200 gene araH 617465 616515 CDS product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975367.1 protein_id gnl|my_center|LOCUS_34200 618976 617462 gene locus_tag LOCUS_34210 gene araG 618976 617462 CDS product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969238.1 protein_id gnl|my_center|LOCUS_34210 620038 619055 gene locus_tag LOCUS_34220 620038 619055 CDS product arabinose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975369.1 protein_id gnl|my_center|LOCUS_34220 620224 620994 gene locus_tag LOCUS_34230 620224 620994 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028053684.1 protein_id gnl|my_center|LOCUS_34230 621030 622178 gene locus_tag LOCUS_34240 gene dgoD 621030 622178 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975371.1 protein_id gnl|my_center|LOCUS_34240 622190 622966 gene locus_tag LOCUS_34250 622190 622966 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969234.1 protein_id gnl|my_center|LOCUS_34250 624415 623210 gene locus_tag LOCUS_34260 624415 623210 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396177.1 protein_id gnl|my_center|LOCUS_34260 624605 625843 gene locus_tag LOCUS_34270 624605 625843 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396179.1 protein_id gnl|my_center|LOCUS_34270 625913 626797 gene locus_tag LOCUS_34280 625913 626797 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396180.1 protein_id gnl|my_center|LOCUS_34280 626797 627642 gene locus_tag LOCUS_34290 626797 627642 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975587.1 protein_id gnl|my_center|LOCUS_34290 627645 628661 gene locus_tag LOCUS_34300 627645 628661 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396185.1 protein_id gnl|my_center|LOCUS_34300 628662 629585 gene locus_tag LOCUS_34310 628662 629585 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456656.1 protein_id gnl|my_center|LOCUS_34310 629582 630646 gene locus_tag LOCUS_34320 629582 630646 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982245.1 protein_id gnl|my_center|LOCUS_34320 631555 630650 gene locus_tag LOCUS_34330 631555 630650 CDS product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339025.1 protein_id gnl|my_center|LOCUS_34330 633909 631600 gene locus_tag LOCUS_34340 633909 631600 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339007.1 protein_id gnl|my_center|LOCUS_34340 635049 634042 gene locus_tag LOCUS_34350 635049 634042 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972993.1 protein_id gnl|my_center|LOCUS_34350 635619 635107 gene locus_tag LOCUS_34360 635619 635107 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972994.1 protein_id gnl|my_center|LOCUS_34360 636724 635849 gene locus_tag LOCUS_34370 636724 635849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 636956 639127 gene locus_tag LOCUS_34380 636956 639127 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065177.1 protein_id gnl|my_center|LOCUS_34380 639127 640734 gene locus_tag LOCUS_34390 639127 640734 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146602274.1 protein_id gnl|my_center|LOCUS_34390 640835 641134 gene locus_tag LOCUS_34400 640835 641134 CDS product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339024.1 protein_id gnl|my_center|LOCUS_34400 641168 642070 gene locus_tag LOCUS_34410 641168 642070 CDS product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339025.1 protein_id gnl|my_center|LOCUS_34410 642067 643044 gene locus_tag LOCUS_34420 642067 643044 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068954875.1 protein_id gnl|my_center|LOCUS_34420 643037 643978 gene locus_tag LOCUS_34430 643037 643978 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221668.1 protein_id gnl|my_center|LOCUS_34430 643975 644733 gene locus_tag LOCUS_34440 643975 644733 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339141.1 protein_id gnl|my_center|LOCUS_34440 644798 646078 gene locus_tag LOCUS_34450 644798 646078 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970317.1 protein_id gnl|my_center|LOCUS_34450 646323 646402 gene locus_tag LOCUS_t00340 646323 646402 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 646971 647720 gene locus_tag LOCUS_34460 646971 647720 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528511.1 protein_id gnl|my_center|LOCUS_34460 647829 648917 gene locus_tag LOCUS_34470 647829 648917 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973437.1 protein_id gnl|my_center|LOCUS_34470 648992 649384 gene locus_tag LOCUS_34480 648992 649384 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105171.1 protein_id gnl|my_center|LOCUS_34480 649587 650126 gene locus_tag LOCUS_34490 649587 650126 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973028.1 protein_id gnl|my_center|LOCUS_34490 650249 651601 gene locus_tag LOCUS_34500 650249 651601 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529494.1 protein_id gnl|my_center|LOCUS_34500 651611 652462 gene locus_tag LOCUS_34510 651611 652462 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976274.1 protein_id gnl|my_center|LOCUS_34510 652495 653469 gene locus_tag LOCUS_34520 652495 653469 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969842.1 protein_id gnl|my_center|LOCUS_34520 653478 654248 gene locus_tag LOCUS_34530 653478 654248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976272.1 protein_id gnl|my_center|LOCUS_34530 654378 655694 gene locus_tag LOCUS_34540 654378 655694 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384271.1 protein_id gnl|my_center|LOCUS_34540 656294 655698 gene locus_tag LOCUS_34550 656294 655698 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105549.1 protein_id gnl|my_center|LOCUS_34550 656414 658150 gene locus_tag LOCUS_34560 656414 658150 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564966.1 protein_id gnl|my_center|LOCUS_34560 658158 659492 gene locus_tag LOCUS_34570 658158 659492 CDS product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532375.1 protein_id gnl|my_center|LOCUS_34570 659489 659926 gene locus_tag LOCUS_34580 659489 659926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 659923 660576 gene locus_tag LOCUS_34590 659923 660576 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532377.1 protein_id gnl|my_center|LOCUS_34590 660576 661505 gene locus_tag LOCUS_34600 660576 661505 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532378.1 protein_id gnl|my_center|LOCUS_34600 661622 661801 gene locus_tag LOCUS_34610 661622 661801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 661824 662162 gene locus_tag LOCUS_34620 661824 662162 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083946.1 protein_id gnl|my_center|LOCUS_34620 664260 662944 gene locus_tag LOCUS_34630 664260 662944 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967935.1 protein_id gnl|my_center|LOCUS_34630 665330 664263 gene locus_tag LOCUS_34640 665330 664263 CDS product phosphotransferase enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169989.1 protein_id gnl|my_center|LOCUS_34640 665595 666275 gene locus_tag LOCUS_34650 665595 666275 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967933.1 protein_id gnl|my_center|LOCUS_34650 666348 667088 gene locus_tag LOCUS_34660 666348 667088 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170044.1 protein_id gnl|my_center|LOCUS_34660 667299 668351 gene locus_tag LOCUS_34670 667299 668351 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967931.1 protein_id gnl|my_center|LOCUS_34670 668576 669643 gene locus_tag LOCUS_34680 668576 669643 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051076795.1 protein_id gnl|my_center|LOCUS_34680 669640 670818 gene locus_tag LOCUS_34690 669640 670818 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967929.1 protein_id gnl|my_center|LOCUS_34690 670822 671604 gene locus_tag LOCUS_34700 670822 671604 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967928.1 protein_id gnl|my_center|LOCUS_34700 673010 671601 gene locus_tag LOCUS_34710 673010 671601 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965040.1 protein_id gnl|my_center|LOCUS_34710 673332 674183 gene locus_tag LOCUS_34720 673332 674183 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531253.1 protein_id gnl|my_center|LOCUS_34720 674362 675381 gene locus_tag LOCUS_34730 674362 675381 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391989.1 protein_id gnl|my_center|LOCUS_34730 675458 675781 gene locus_tag LOCUS_34740 675458 675781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 676197 675892 gene locus_tag LOCUS_34750 676197 675892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 676342 677133 gene locus_tag LOCUS_34760 676342 677133 CDS product ImuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967468.1 protein_id gnl|my_center|LOCUS_34760 677141 678568 gene locus_tag LOCUS_34770 677141 678568 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257431.1 protein_id gnl|my_center|LOCUS_34770 678565 681753 gene locus_tag LOCUS_34780 678565 681753 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972863.1 protein_id gnl|my_center|LOCUS_34780 683223 681976 gene locus_tag LOCUS_34790 683223 681976 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445390.1 protein_id gnl|my_center|LOCUS_34790 684035 683244 gene locus_tag LOCUS_34800 684035 683244 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970645.1 protein_id gnl|my_center|LOCUS_34800 685004 684111 gene locus_tag LOCUS_34810 685004 684111 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967028.1 protein_id gnl|my_center|LOCUS_34810 685106 685837 gene locus_tag LOCUS_34820 685106 685837 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967030.1 protein_id gnl|my_center|LOCUS_34820 685840 687039 gene locus_tag LOCUS_34830 685840 687039 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970640.1 protein_id gnl|my_center|LOCUS_34830 687111 687803 gene locus_tag LOCUS_34840 687111 687803 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967032.1 protein_id gnl|my_center|LOCUS_34840 687847 688824 gene locus_tag LOCUS_34850 687847 688824 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445392.1 protein_id gnl|my_center|LOCUS_34850 688892 689875 gene locus_tag LOCUS_34860 688892 689875 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967034.1 protein_id gnl|my_center|LOCUS_34860 689872 690603 gene locus_tag LOCUS_34870 689872 690603 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970636.1 protein_id gnl|my_center|LOCUS_34870 690611 691366 gene locus_tag LOCUS_34880 690611 691366 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970635.1 protein_id gnl|my_center|LOCUS_34880 691366 692259 gene locus_tag LOCUS_34890 691366 692259 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970634.1 protein_id gnl|my_center|LOCUS_34890 692440 693600 gene locus_tag LOCUS_34900 692440 693600 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533015.1 protein_id gnl|my_center|LOCUS_34900 693600 694745 gene locus_tag LOCUS_34910 693600 694745 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533016.1 protein_id gnl|my_center|LOCUS_34910 695583 694771 gene locus_tag LOCUS_34920 695583 694771 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975556.1 protein_id gnl|my_center|LOCUS_34920 695741 697057 gene locus_tag LOCUS_34930 695741 697057 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975557.1 protein_id gnl|my_center|LOCUS_34930 697310 697543 gene locus_tag LOCUS_34940 697310 697543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 697613 698509 gene locus_tag LOCUS_34950 697613 698509 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533025.1 protein_id gnl|my_center|LOCUS_34950 698525 699391 gene locus_tag LOCUS_34960 698525 699391 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533026.1 protein_id gnl|my_center|LOCUS_34960 699395 700492 gene locus_tag LOCUS_34970 gene ugpC 699395 700492 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975559.1 protein_id gnl|my_center|LOCUS_34970 700494 701612 gene locus_tag LOCUS_34980 700494 701612 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533028.1 protein_id gnl|my_center|LOCUS_34980 701616 701945 gene locus_tag LOCUS_34990 701616 701945 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533029.1 protein_id gnl|my_center|LOCUS_34990 702149 703216 gene locus_tag LOCUS_35000 702149 703216 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533030.1 protein_id gnl|my_center|LOCUS_35000 703230 703679 gene locus_tag LOCUS_35010 703230 703679 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163926.1 protein_id gnl|my_center|LOCUS_35010 703699 704433 gene locus_tag LOCUS_35020 703699 704433 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061880.1 protein_id gnl|my_center|LOCUS_35020 704480 705754 gene locus_tag LOCUS_35030 704480 705754 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651334.1 protein_id gnl|my_center|LOCUS_35030 706844 705801 gene locus_tag LOCUS_35040 706844 705801 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190976.1 protein_id gnl|my_center|LOCUS_35040 707562 706834 gene locus_tag LOCUS_35050 gene glnQ 707562 706834 CDS product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569093.1 protein_id gnl|my_center|LOCUS_35050 708215 707559 gene locus_tag LOCUS_35060 gene glnP 708215 707559 CDS product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811112.1 protein_id gnl|my_center|LOCUS_35060 709016 708276 gene locus_tag LOCUS_35070 gene glnH 709016 708276 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210235.1 protein_id gnl|my_center|LOCUS_35070 710375 709038 gene locus_tag LOCUS_35080 710375 709038 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975165.1 protein_id gnl|my_center|LOCUS_35080 711256 710372 gene locus_tag LOCUS_35090 711256 710372 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969490.1 protein_id gnl|my_center|LOCUS_35090 711348 712184 gene locus_tag LOCUS_35100 711348 712184 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975163.1 protein_id gnl|my_center|LOCUS_35100 712854 712219 gene locus_tag LOCUS_35110 gene dhaL 712854 712219 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015008607.1 protein_id gnl|my_center|LOCUS_35110 714970 712868 gene locus_tag LOCUS_35120 714970 712868 CDS product bifunctional sugar-binding transcriptional regulator/dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975194.1 protein_id gnl|my_center|LOCUS_35120 715747 715106 gene locus_tag LOCUS_35130 gene dhaL 715747 715106 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015008606.1 protein_id gnl|my_center|LOCUS_35130 716697 715762 gene locus_tag LOCUS_35140 716697 715762 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975196.1 protein_id gnl|my_center|LOCUS_35140 >Feature sequence23 1877 453 gene locus_tag LOCUS_35150 1877 453 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845126.1 protein_id gnl|my_center|LOCUS_35150 3190 1874 gene locus_tag LOCUS_35160 3190 1874 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970023.1 protein_id gnl|my_center|LOCUS_35160 3762 3187 gene locus_tag LOCUS_35170 3762 3187 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970022.1 protein_id gnl|my_center|LOCUS_35170 4804 3833 gene locus_tag LOCUS_35180 gene dctP 4804 3833 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967084.1 protein_id gnl|my_center|LOCUS_35180 4954 5628 gene locus_tag LOCUS_35190 4954 5628 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970020.1 protein_id gnl|my_center|LOCUS_35190 5955 6854 gene locus_tag LOCUS_35200 5955 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 7149 6943 gene locus_tag LOCUS_35210 7149 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 7063 8028 gene locus_tag LOCUS_35220 7063 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35220 7983 8444 gene locus_tag LOCUS_35230 7983 8444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 9349 8642 gene locus_tag LOCUS_35240 9349 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 10360 9467 gene locus_tag LOCUS_35250 10360 9467 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528510.1 protein_id gnl|my_center|LOCUS_35250 10494 11681 gene locus_tag LOCUS_35260 10494 11681 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528509.1 protein_id gnl|my_center|LOCUS_35260 11797 12147 gene locus_tag LOCUS_35270 11797 12147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 12190 13293 gene locus_tag LOCUS_35280 12190 13293 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528508.1 protein_id gnl|my_center|LOCUS_35280 14395 13487 gene locus_tag LOCUS_35290 14395 13487 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530654.1 protein_id gnl|my_center|LOCUS_35290 14708 14466 gene locus_tag LOCUS_35300 14708 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 14593 15456 gene locus_tag LOCUS_35310 14593 15456 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003071365.1 protein_id gnl|my_center|LOCUS_35310 >Feature sequence24 478 1299 gene locus_tag LOCUS_35320 478 1299 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167391934.1 protein_id gnl|my_center|LOCUS_35320 1338 3926 gene locus_tag LOCUS_35330 gene mgtA 1338 3926 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 protein_id gnl|my_center|LOCUS_35330 3987 4580 gene locus_tag LOCUS_35340 3987 4580 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967613.1 protein_id gnl|my_center|LOCUS_35340 5577 4594 gene locus_tag LOCUS_35350 5577 4594 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396347.1 protein_id gnl|my_center|LOCUS_35350 6074 5649 gene locus_tag LOCUS_35360 6074 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 6392 6192 gene locus_tag LOCUS_35370 6392 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095080464.1 protein_id gnl|my_center|LOCUS_35370 6833 6429 gene locus_tag LOCUS_35380 6833 6429 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974418.1 protein_id gnl|my_center|LOCUS_35380 7555 6908 gene locus_tag LOCUS_35390 7555 6908 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525373.1 protein_id gnl|my_center|LOCUS_35390 8295 7669 gene locus_tag LOCUS_35400 gene fixJ 8295 7669 CDS product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967648.1 protein_id gnl|my_center|LOCUS_35400 9793 8285 gene locus_tag LOCUS_35410 gene fixL 9793 8285 CDS product oxygen sensor histidine kinase FixL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967649.1 protein_id gnl|my_center|LOCUS_35410 9919 10176 gene locus_tag LOCUS_35420 9919 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 10192 11775 gene locus_tag LOCUS_35430 gene ftsH 10192 11775 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35430 12154 11726 gene locus_tag LOCUS_35440 12154 11726 CDS product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228678.1 protein_id gnl|my_center|LOCUS_35440 12738 12214 gene locus_tag LOCUS_35450 12738 12214 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526659.1 protein_id gnl|my_center|LOCUS_35450 13316 13729 gene locus_tag LOCUS_35460 13316 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 >Feature sequence25 223 1703 gene locus_tag LOCUS_r00010 223 1703 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1958 2034 gene locus_tag LOCUS_t00350 1958 2034 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2151 2226 gene locus_tag LOCUS_t00360 2151 2226 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2736 5608 gene locus_tag LOCUS_r00020 2736 5608 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5642 5857 gene locus_tag LOCUS_35470 5642 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 5942 6051 gene locus_tag LOCUS_r00030 5942 6051 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence26 2655 1 gene locus_tag LOCUS_35480 gene acnA 2655 1 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393923.1 protein_id gnl|my_center|LOCUS_35480 >Feature sequence27 74 874 gene locus_tag LOCUS_35490 74 874 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972813.1 protein_id gnl|my_center|LOCUS_35490 943 1767 gene locus_tag LOCUS_35500 943 1767 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528415.1 protein_id gnl|my_center|LOCUS_35500 1791 2792 gene locus_tag LOCUS_35510 1791 2792 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528416.1 protein_id gnl|my_center|LOCUS_35510 >Feature sequence28 1840 1136 gene locus_tag LOCUS_35520 1840 1136 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973950.1 protein_id gnl|my_center|LOCUS_35520 <2499 1837 gene locus_tag LOCUS_35530 <2499 1837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973949.1:3-oxoacid CoA-transferase subunit A >Feature sequence29 203 892 gene locus_tag LOCUS_35540 203 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35540 889 1791 gene locus_tag LOCUS_35550 889 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 2035 1817 gene locus_tag LOCUS_35560 2035 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35560 2352 2053 gene locus_tag LOCUS_35570 2352 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35570 3212 2544 gene locus_tag LOCUS_35580 3212 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35580 3475 3245 gene locus_tag LOCUS_35590 3475 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 3805 4524 gene locus_tag LOCUS_35600 3805 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 4844 5299 gene locus_tag LOCUS_35610 4844 5299 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254192.1 protein_id gnl|my_center|LOCUS_35610 7106 5307 gene locus_tag LOCUS_35620 7106 5307 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445450.1 protein_id gnl|my_center|LOCUS_35620 7310 8563 gene locus_tag LOCUS_35630 7310 8563 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397527.1 protein_id gnl|my_center|LOCUS_35630 9108 8608 gene locus_tag LOCUS_35640 9108 8608 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310780.1 protein_id gnl|my_center|LOCUS_35640 9580 9155 gene locus_tag LOCUS_35650 9580 9155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 10537 9707 gene locus_tag LOCUS_35660 10537 9707 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967600.1 protein_id gnl|my_center|LOCUS_35660 12279 10657 gene locus_tag LOCUS_35670 gene groL 12279 10657 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087406.1 protein_id gnl|my_center|LOCUS_35670 12627 14183 gene locus_tag LOCUS_35680 12627 14183 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088812.1 protein_id gnl|my_center|LOCUS_35680 14784 14218 gene locus_tag LOCUS_35690 14784 14218 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535926.1 protein_id gnl|my_center|LOCUS_35690 15648 14800 gene locus_tag LOCUS_35700 15648 14800 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941847.1 protein_id gnl|my_center|LOCUS_35700 16244 16020 gene locus_tag LOCUS_35710 16244 16020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 16746 18794 gene locus_tag LOCUS_35720 16746 18794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 18802 19377 gene locus_tag LOCUS_35730 18802 19377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35730 19790 20320 gene locus_tag LOCUS_35740 19790 20320 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967173.1 protein_id gnl|my_center|LOCUS_35740 20317 21198 gene locus_tag LOCUS_35750 20317 21198 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120072.1 protein_id gnl|my_center|LOCUS_35750 21451 21804 gene locus_tag LOCUS_35760 21451 21804 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971665.1 protein_id gnl|my_center|LOCUS_35760 21801 22238 gene locus_tag LOCUS_35770 21801 22238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 22254 22781 gene locus_tag LOCUS_35780 22254 22781 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398896.1 protein_id gnl|my_center|LOCUS_35780 22781 23839 gene locus_tag LOCUS_35790 gene arsB 22781 23839 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971664.1 protein_id gnl|my_center|LOCUS_35790 23842 24264 gene locus_tag LOCUS_35800 gene arsC 23842 24264 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971663.1 protein_id gnl|my_center|LOCUS_35800 25550 24333 gene locus_tag LOCUS_35810 gene arsK 25550 24333 CDS product arsenite efflux MFS transporter ArsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061806.1 protein_id gnl|my_center|LOCUS_35810 25911 25543 gene locus_tag LOCUS_35820 25911 25543 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975859.1 protein_id gnl|my_center|LOCUS_35820 25955 26473 gene locus_tag LOCUS_35830 25955 26473 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398911.1 protein_id gnl|my_center|LOCUS_35830 26955 26695 gene locus_tag LOCUS_35840 26955 26695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35840 28175 27306 gene locus_tag LOCUS_35850 28175 27306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 28373 28185 gene locus_tag LOCUS_35860 28373 28185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 29028 29381 gene locus_tag LOCUS_35870 29028 29381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 29726 29651 gene locus_tag LOCUS_t00370 29726 29651 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 30760 29843 gene locus_tag LOCUS_35880 30760 29843 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328810.1 protein_id gnl|my_center|LOCUS_35880 31996 30890 gene locus_tag LOCUS_35890 31996 30890 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397197.1 protein_id gnl|my_center|LOCUS_35890 32164 33780 gene locus_tag LOCUS_35900 32164 33780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 34210 33794 gene locus_tag LOCUS_35910 34210 33794 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061303.1 protein_id gnl|my_center|LOCUS_35910 34349 35992 gene locus_tag LOCUS_35920 34349 35992 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976219.1 protein_id gnl|my_center|LOCUS_35920 37397 36174 gene locus_tag LOCUS_35930 37397 36174 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972000.1 protein_id gnl|my_center|LOCUS_35930 38941 37922 gene locus_tag LOCUS_35940 gene ilvC 38941 37922 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972004.1 protein_id gnl|my_center|LOCUS_35940 39723 39001 gene locus_tag LOCUS_35950 39723 39001 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969679.1 protein_id gnl|my_center|LOCUS_35950 40053 40433 gene locus_tag LOCUS_35960 40053 40433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850287.1 protein_id gnl|my_center|LOCUS_35960 40550 40849 gene locus_tag LOCUS_35970 40550 40849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 40860 41222 gene locus_tag LOCUS_35980 40860 41222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 41425 41634 gene locus_tag LOCUS_35990 41425 41634 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309931.1 protein_id gnl|my_center|LOCUS_35990 41786 42799 gene locus_tag LOCUS_36000 41786 42799 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081161075.1 protein_id gnl|my_center|LOCUS_36000 43985 42741 gene locus_tag LOCUS_36010 43985 42741 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531061.1 protein_id gnl|my_center|LOCUS_36010 44438 44031 gene locus_tag LOCUS_36020 44438 44031 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252508.1 protein_id gnl|my_center|LOCUS_36020 44608 45495 gene locus_tag LOCUS_36030 44608 45495 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328871.1 protein_id gnl|my_center|LOCUS_36030 46291 45539 gene locus_tag LOCUS_36040 46291 45539 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533813.1 protein_id gnl|my_center|LOCUS_36040 46571 47635 gene locus_tag LOCUS_36050 46571 47635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976117.1 protein_id gnl|my_center|LOCUS_36050 47960 48640 gene locus_tag LOCUS_36060 47960 48640 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328878.1 protein_id gnl|my_center|LOCUS_36060 49847 48720 gene locus_tag LOCUS_36070 49847 48720 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400932.1 protein_id gnl|my_center|LOCUS_36070 49995 51083 gene locus_tag LOCUS_36080 49995 51083 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976128.1 protein_id gnl|my_center|LOCUS_36080 51493 51080 gene locus_tag LOCUS_36090 51493 51080 CDS product nitrile hydratase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174839376.1 protein_id gnl|my_center|LOCUS_36090 52139 51480 gene locus_tag LOCUS_36100 gene nthB 52139 51480 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400923.1 protein_id gnl|my_center|LOCUS_36100 52765 52136 gene locus_tag LOCUS_36110 gene nthA 52765 52136 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879389.1 protein_id gnl|my_center|LOCUS_36110 53399 52806 gene locus_tag LOCUS_36120 53399 52806 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533855.1 protein_id gnl|my_center|LOCUS_36120 53571 54371 gene locus_tag LOCUS_36130 53571 54371 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328901.1 protein_id gnl|my_center|LOCUS_36130 55172 54600 gene locus_tag LOCUS_36140 gene ilvN 55172 54600 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507555.1 protein_id gnl|my_center|LOCUS_36140 57001 55244 gene locus_tag LOCUS_36150 57001 55244 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386810.1 protein_id gnl|my_center|LOCUS_36150 57366 59426 gene locus_tag LOCUS_36160 57366 59426 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328903.1 protein_id gnl|my_center|LOCUS_36160 60416 59490 gene locus_tag LOCUS_36170 gene miaA 60416 59490 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534915.1 protein_id gnl|my_center|LOCUS_36170 60418 61308 gene locus_tag LOCUS_36180 gene serB 60418 61308 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976142.1 protein_id gnl|my_center|LOCUS_36180 61308 61865 gene locus_tag LOCUS_36190 61308 61865 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976143.1 protein_id gnl|my_center|LOCUS_36190 63480 61957 gene locus_tag LOCUS_36200 63480 61957 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534918.1 protein_id gnl|my_center|LOCUS_36200 63796 63608 gene locus_tag LOCUS_36210 63796 63608 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976146.1 protein_id gnl|my_center|LOCUS_36210 64754 63804 gene locus_tag LOCUS_36220 64754 63804 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534924.1 protein_id gnl|my_center|LOCUS_36220 65875 64754 gene locus_tag LOCUS_36230 gene hflK 65875 64754 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534926.1 protein_id gnl|my_center|LOCUS_36230 66553 66032 gene locus_tag LOCUS_36240 66553 66032 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976149.1 protein_id gnl|my_center|LOCUS_36240 67363 66569 gene locus_tag LOCUS_36250 67363 66569 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969714.1 protein_id gnl|my_center|LOCUS_36250 67762 67451 gene locus_tag LOCUS_36260 67762 67451 CDS product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311776.1 protein_id gnl|my_center|LOCUS_36260 68544 69062 gene locus_tag LOCUS_36270 68544 69062 CDS product SspB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969716.1 protein_id gnl|my_center|LOCUS_36270 69072 69281 gene locus_tag LOCUS_36280 69072 69281 CDS product DUF4169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242963.1 protein_id gnl|my_center|LOCUS_36280 69439 69663 gene locus_tag LOCUS_36290 69439 69663 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976159.1 protein_id gnl|my_center|LOCUS_36290 73554 69757 gene locus_tag LOCUS_36300 73554 69757 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976160.1 protein_id gnl|my_center|LOCUS_36300 75018 73597 gene locus_tag LOCUS_36310 75018 73597 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969720.1 protein_id gnl|my_center|LOCUS_36310 78456 75280 gene locus_tag LOCUS_36320 78456 75280 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969721.1 protein_id gnl|my_center|LOCUS_36320 79628 78456 gene locus_tag LOCUS_36330 79628 78456 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242957.1 protein_id gnl|my_center|LOCUS_36330 79928 80749 gene locus_tag LOCUS_36340 79928 80749 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534956.1 protein_id gnl|my_center|LOCUS_36340 80800 81213 gene locus_tag LOCUS_36350 80800 81213 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534958.1 protein_id gnl|my_center|LOCUS_36350 81316 83772 gene locus_tag LOCUS_36360 81316 83772 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972026.1 protein_id gnl|my_center|LOCUS_36360 85004 83985 gene locus_tag LOCUS_36370 85004 83985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 86847 85429 gene locus_tag LOCUS_36380 86847 85429 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115242.1 protein_id gnl|my_center|LOCUS_36380 87403 86912 gene locus_tag LOCUS_36390 87403 86912 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969827.1 protein_id gnl|my_center|LOCUS_36390 87583 88191 gene locus_tag LOCUS_36400 87583 88191 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529117.1 protein_id gnl|my_center|LOCUS_36400 89308 88193 gene locus_tag LOCUS_36410 89308 88193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 89466 90254 gene locus_tag LOCUS_36420 89466 90254 CDS product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976338.1 protein_id gnl|my_center|LOCUS_36420 90353 90583 gene locus_tag LOCUS_36430 90353 90583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 90748 91944 gene locus_tag LOCUS_36440 90748 91944 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 protein_id gnl|my_center|LOCUS_36440 93567 92143 gene locus_tag LOCUS_36450 93567 92143 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188164.1 protein_id gnl|my_center|LOCUS_36450 93829 94746 gene locus_tag LOCUS_36460 93829 94746 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565322.1 protein_id gnl|my_center|LOCUS_36460 94743 95567 gene locus_tag LOCUS_36470 94743 95567 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720158.1 protein_id gnl|my_center|LOCUS_36470 95583 96692 gene locus_tag LOCUS_36480 95583 96692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337929.1 protein_id gnl|my_center|LOCUS_36480 97940 96858 gene locus_tag LOCUS_36490 97940 96858 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719295.1 protein_id gnl|my_center|LOCUS_36490 98679 97969 gene locus_tag LOCUS_36500 98679 97969 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564165.1 protein_id gnl|my_center|LOCUS_36500 99494 98676 gene locus_tag LOCUS_36510 99494 98676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 99658 101277 gene locus_tag LOCUS_36520 99658 101277 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_36520 101264 102820 gene locus_tag LOCUS_36530 101264 102820 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_36530 102817 104049 gene locus_tag LOCUS_36540 102817 104049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 104051 104308 gene locus_tag LOCUS_36550 104051 104308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 104904 104278 gene locus_tag LOCUS_36560 104904 104278 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255068.1 protein_id gnl|my_center|LOCUS_36560 108048 104911 gene locus_tag LOCUS_36570 108048 104911 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398234.1 protein_id gnl|my_center|LOCUS_36570 109355 108060 gene locus_tag LOCUS_36580 109355 108060 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844987.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36580 110514 109513 gene locus_tag LOCUS_36590 110514 109513 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844988.1 protein_id gnl|my_center|LOCUS_36590 111589 110525 gene locus_tag LOCUS_36600 111589 110525 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533467.1 protein_id gnl|my_center|LOCUS_36600 112425 111586 gene locus_tag LOCUS_36610 112425 111586 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533465.1 protein_id gnl|my_center|LOCUS_36610 113391 112441 gene locus_tag LOCUS_36620 113391 112441 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330567.1 protein_id gnl|my_center|LOCUS_36620 114972 113713 gene locus_tag LOCUS_36630 114972 113713 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066871940.1 protein_id gnl|my_center|LOCUS_36630 115910 115017 gene locus_tag LOCUS_36640 115910 115017 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400505.1 protein_id gnl|my_center|LOCUS_36640 116108 116995 gene locus_tag LOCUS_36650 116108 116995 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400508.1 protein_id gnl|my_center|LOCUS_36650 116992 117756 gene locus_tag LOCUS_36660 116992 117756 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255060.1 protein_id gnl|my_center|LOCUS_36660 117753 118799 gene locus_tag LOCUS_36670 117753 118799 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183532.1 protein_id gnl|my_center|LOCUS_36670 118796 119956 gene locus_tag LOCUS_36680 gene nagA 118796 119956 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968419.1 protein_id gnl|my_center|LOCUS_36680 120041 121096 gene locus_tag LOCUS_36690 120041 121096 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394527.1 protein_id gnl|my_center|LOCUS_36690 121119 121865 gene locus_tag LOCUS_36700 121119 121865 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172331.1 protein_id gnl|my_center|LOCUS_36700 121957 122463 gene locus_tag LOCUS_36710 121957 122463 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401014.1 protein_id gnl|my_center|LOCUS_36710 122881 122519 gene locus_tag LOCUS_36720 122881 122519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 123542 123078 gene locus_tag LOCUS_36730 123542 123078 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708610.1 protein_id gnl|my_center|LOCUS_36730 123809 123967 gene locus_tag LOCUS_36740 123809 123967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 124087 124686 gene locus_tag LOCUS_36750 124087 124686 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242948.1 protein_id gnl|my_center|LOCUS_36750 124766 125647 gene locus_tag LOCUS_36760 124766 125647 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972037.1 protein_id gnl|my_center|LOCUS_36760 126076 126600 gene locus_tag LOCUS_36770 126076 126600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 126764 128599 gene locus_tag LOCUS_36780 126764 128599 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158318.1 protein_id gnl|my_center|LOCUS_36780 128900 128589 gene locus_tag LOCUS_36790 128900 128589 CDS product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708618.1 protein_id gnl|my_center|LOCUS_36790 129631 128903 gene locus_tag LOCUS_36800 129631 128903 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396901.1 protein_id gnl|my_center|LOCUS_36800 130804 129980 gene locus_tag LOCUS_36810 gene panB 130804 129980 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969735.1 protein_id gnl|my_center|LOCUS_36810 131675 130806 gene locus_tag LOCUS_36820 gene panC 131675 130806 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242940.1 protein_id gnl|my_center|LOCUS_36820 131985 133898 gene locus_tag LOCUS_36830 131985 133898 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528794.1 protein_id gnl|my_center|LOCUS_36830 134136 134966 gene locus_tag LOCUS_36840 134136 134966 CDS product TIGR02587 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973592.1 protein_id gnl|my_center|LOCUS_36840 134974 135384 gene locus_tag LOCUS_36850 134974 135384 CDS product TIGR02588 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973591.1 protein_id gnl|my_center|LOCUS_36850 135470 136411 gene locus_tag LOCUS_36860 135470 136411 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838160.1 protein_id gnl|my_center|LOCUS_36860 138557 136398 gene locus_tag LOCUS_36870 gene ligA 138557 136398 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972042.1 protein_id gnl|my_center|LOCUS_36870 140456 138786 gene locus_tag LOCUS_36880 gene recN 140456 138786 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969739.1 protein_id gnl|my_center|LOCUS_36880 141317 140475 gene locus_tag LOCUS_36890 141317 140475 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529108.1 protein_id gnl|my_center|LOCUS_36890 142444 141482 gene locus_tag LOCUS_36900 gene lpxC 142444 141482 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386944.1 protein_id gnl|my_center|LOCUS_36900 144528 142798 gene locus_tag LOCUS_36910 gene ftsZ 144528 142798 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969741.1 protein_id gnl|my_center|LOCUS_36910 145958 144627 gene locus_tag LOCUS_36920 gene ftsA 145958 144627 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242933.1 protein_id gnl|my_center|LOCUS_36920 146875 145955 gene locus_tag LOCUS_36930 gene ftsQ 146875 145955 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969743.1 protein_id gnl|my_center|LOCUS_36930 147789 146863 gene locus_tag LOCUS_36940 147789 146863 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969744.1 protein_id gnl|my_center|LOCUS_36940 148331 148035 gene locus_tag LOCUS_36950 148331 148035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 148222 149529 gene locus_tag LOCUS_36960 148222 149529 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972049.1 protein_id gnl|my_center|LOCUS_36960 150279 149593 gene locus_tag LOCUS_36970 gene aqpZ 150279 149593 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969745.1 protein_id gnl|my_center|LOCUS_36970 151144 150410 gene locus_tag LOCUS_36980 gene aqpZ 151144 150410 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969745.1 protein_id gnl|my_center|LOCUS_36980 152253 151279 gene locus_tag LOCUS_36990 gene murB 152253 151279 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969746.1 protein_id gnl|my_center|LOCUS_36990 153665 152250 gene locus_tag LOCUS_37000 gene murC 153665 152250 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396961.1 protein_id gnl|my_center|LOCUS_37000 154798 153662 gene locus_tag LOCUS_37010 gene murG 154798 153662 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252472.1 protein_id gnl|my_center|LOCUS_37010 156131 154977 gene locus_tag LOCUS_37020 gene ftsW 156131 154977 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529129.1 protein_id gnl|my_center|LOCUS_37020 157702 156305 gene locus_tag LOCUS_37030 gene murD 157702 156305 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242926.1 protein_id gnl|my_center|LOCUS_37030 158810 157710 gene locus_tag LOCUS_37040 gene mraY 158810 157710 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328954.1 protein_id gnl|my_center|LOCUS_37040 160360 158927 gene locus_tag LOCUS_37050 160360 158927 CDS product UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diaminopimelate--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042777133.1 protein_id gnl|my_center|LOCUS_37050 161808 160357 gene locus_tag LOCUS_37060 161808 160357 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328956.1 protein_id gnl|my_center|LOCUS_37060 163621 161873 gene locus_tag LOCUS_37070 163621 161873 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969751.1 protein_id gnl|my_center|LOCUS_37070 164013 163621 gene locus_tag LOCUS_37080 164013 163621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976219.1 protein_id gnl|my_center|LOCUS_37080 165042 164017 gene locus_tag LOCUS_37090 gene rsmH 165042 164017 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529142.1 protein_id gnl|my_center|LOCUS_37090 165497 165057 gene locus_tag LOCUS_37100 gene mraZ 165497 165057 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310455.1 protein_id gnl|my_center|LOCUS_37100 167537 166356 gene locus_tag LOCUS_37110 167537 166356 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969753.1 protein_id gnl|my_center|LOCUS_37110 168273 167611 gene locus_tag LOCUS_37120 168273 167611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 169263 168499 gene locus_tag LOCUS_37130 169263 168499 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976234.1 protein_id gnl|my_center|LOCUS_37130 169943 169260 gene locus_tag LOCUS_37140 169943 169260 CDS product DnaJ family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328962.1 protein_id gnl|my_center|LOCUS_37140 170239 171453 gene locus_tag LOCUS_37150 170239 171453 CDS product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969756.1 protein_id gnl|my_center|LOCUS_37150 171536 172165 gene locus_tag LOCUS_37160 171536 172165 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252464.1 protein_id gnl|my_center|LOCUS_37160 172298 173227 gene locus_tag LOCUS_37170 172298 173227 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529156.1 protein_id gnl|my_center|LOCUS_37170 174005 173418 gene locus_tag LOCUS_37180 174005 173418 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992379.1 protein_id gnl|my_center|LOCUS_37180 174189 174590 gene locus_tag LOCUS_37190 174189 174590 CDS product ketosteroid isomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 protein_id gnl|my_center|LOCUS_37190 175981 174575 gene locus_tag LOCUS_37200 175981 174575 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969758.1 protein_id gnl|my_center|LOCUS_37200 177594 176047 gene locus_tag LOCUS_37210 177594 176047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 177843 178511 gene locus_tag LOCUS_37220 177843 178511 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530975.1 protein_id gnl|my_center|LOCUS_37220 178704 179483 gene locus_tag LOCUS_37230 178704 179483 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529163.1 protein_id gnl|my_center|LOCUS_37230 179642 180838 gene locus_tag LOCUS_37240 179642 180838 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969761.1 protein_id gnl|my_center|LOCUS_37240 180981 181916 gene locus_tag LOCUS_37250 180981 181916 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976244.1 protein_id gnl|my_center|LOCUS_37250 183318 182416 gene locus_tag LOCUS_37260 gene metF 183318 182416 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969762.1 protein_id gnl|my_center|LOCUS_37260 184327 183320 gene locus_tag LOCUS_37270 184327 183320 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969763.1 protein_id gnl|my_center|LOCUS_37270 186149 184476 gene locus_tag LOCUS_37280 gene ettA 186149 184476 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242905.1 protein_id gnl|my_center|LOCUS_37280 187068 186301 gene locus_tag LOCUS_37290 187068 186301 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242904.1 protein_id gnl|my_center|LOCUS_37290 187258 188217 gene locus_tag LOCUS_37300 187258 188217 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396993.1 protein_id gnl|my_center|LOCUS_37300 188214 189161 gene locus_tag LOCUS_37310 188214 189161 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976250.1 protein_id gnl|my_center|LOCUS_37310 189427 189092 gene locus_tag LOCUS_37320 189427 189092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 189333 190529 gene locus_tag LOCUS_37330 189333 190529 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972076.1 protein_id gnl|my_center|LOCUS_37330 190526 192175 gene locus_tag LOCUS_37340 190526 192175 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969768.1 protein_id gnl|my_center|LOCUS_37340 192701 192363 gene locus_tag LOCUS_37350 192701 192363 CDS product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976253.1 protein_id gnl|my_center|LOCUS_37350 193714 192860 gene locus_tag LOCUS_37360 193714 192860 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972080.1 protein_id gnl|my_center|LOCUS_37360 194050 195468 gene locus_tag LOCUS_37370 194050 195468 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397006.1 protein_id gnl|my_center|LOCUS_37370 197221 195698 gene locus_tag LOCUS_37380 197221 195698 CDS product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918316.1 protein_id gnl|my_center|LOCUS_37380 198193 197477 gene locus_tag LOCUS_37390 198193 197477 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397009.1 protein_id gnl|my_center|LOCUS_37390 199559 198414 gene locus_tag LOCUS_37400 199559 198414 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969773.1 protein_id gnl|my_center|LOCUS_37400 200944 199565 gene locus_tag LOCUS_37410 200944 199565 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969774.1 protein_id gnl|my_center|LOCUS_37410 202522 201152 gene locus_tag LOCUS_37420 202522 201152 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397017.1 protein_id gnl|my_center|LOCUS_37420 203653 202598 gene locus_tag LOCUS_37430 203653 202598 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 protein_id gnl|my_center|LOCUS_37430 205107 203785 gene locus_tag LOCUS_37440 205107 203785 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 protein_id gnl|my_center|LOCUS_37440 205613 205104 gene locus_tag LOCUS_37450 205613 205104 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 protein_id gnl|my_center|LOCUS_37450 206508 205747 gene locus_tag LOCUS_37460 206508 205747 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397019.1 protein_id gnl|my_center|LOCUS_37460 206680 207579 gene locus_tag LOCUS_37470 206680 207579 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529191.1 protein_id gnl|my_center|LOCUS_37470 207683 208786 gene locus_tag LOCUS_37480 207683 208786 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328990.1 protein_id gnl|my_center|LOCUS_37480 208871 209761 gene locus_tag LOCUS_37490 208871 209761 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328991.1 protein_id gnl|my_center|LOCUS_37490 209758 210540 gene locus_tag LOCUS_37500 209758 210540 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310499.1 protein_id gnl|my_center|LOCUS_37500 210550 211611 gene locus_tag LOCUS_37510 210550 211611 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969779.1 protein_id gnl|my_center|LOCUS_37510 211978 212454 gene locus_tag LOCUS_37520 211978 212454 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397025.1 protein_id gnl|my_center|LOCUS_37520 213511 212714 gene locus_tag LOCUS_37530 213511 212714 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310827.1 protein_id gnl|my_center|LOCUS_37530 213707 214786 gene locus_tag LOCUS_37540 213707 214786 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976297.1 protein_id gnl|my_center|LOCUS_37540 214817 215980 gene locus_tag LOCUS_37550 214817 215980 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969799.1 protein_id gnl|my_center|LOCUS_37550 216258 217124 gene locus_tag LOCUS_37560 216258 217124 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180941516.1 protein_id gnl|my_center|LOCUS_37560 217124 217948 gene locus_tag LOCUS_37570 217124 217948 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969801.1 protein_id gnl|my_center|LOCUS_37570 217954 218715 gene locus_tag LOCUS_37580 217954 218715 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536404.1 protein_id gnl|my_center|LOCUS_37580 219498 218815 gene locus_tag LOCUS_37590 219498 218815 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061287.1 protein_id gnl|my_center|LOCUS_37590 219705 220304 gene locus_tag LOCUS_37600 219705 220304 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395469.1 protein_id gnl|my_center|LOCUS_37600 221301 220339 gene locus_tag LOCUS_37610 221301 220339 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061899.1 protein_id gnl|my_center|LOCUS_37610 222086 221514 gene locus_tag LOCUS_37620 222086 221514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081632.1 protein_id gnl|my_center|LOCUS_37620 223763 222102 gene locus_tag LOCUS_37630 223763 222102 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521481.1 protein_id gnl|my_center|LOCUS_37630 225064 223967 gene locus_tag LOCUS_37640 225064 223967 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521482.1 protein_id gnl|my_center|LOCUS_37640 226335 225049 gene locus_tag LOCUS_37650 226335 225049 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926512.1 protein_id gnl|my_center|LOCUS_37650 227714 226335 gene locus_tag LOCUS_37660 227714 226335 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535871.1 protein_id gnl|my_center|LOCUS_37660 229265 227727 gene locus_tag LOCUS_37670 229265 227727 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530835.1 protein_id gnl|my_center|LOCUS_37670 229429 230592 gene locus_tag LOCUS_37680 229429 230592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 231563 230589 gene locus_tag LOCUS_37690 231563 230589 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397044.1 protein_id gnl|my_center|LOCUS_37690 231678 232592 gene locus_tag LOCUS_37700 231678 232592 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397047.1 protein_id gnl|my_center|LOCUS_37700 232820 234313 gene locus_tag LOCUS_37710 232820 234313 CDS product carnitine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537893.1 protein_id gnl|my_center|LOCUS_37710 234493 235653 gene locus_tag LOCUS_37720 234493 235653 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969804.1 protein_id gnl|my_center|LOCUS_37720 235808 237898 gene locus_tag LOCUS_37730 235808 237898 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242877.1 protein_id gnl|my_center|LOCUS_37730 237895 238677 gene locus_tag LOCUS_37740 237895 238677 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387085.1 protein_id gnl|my_center|LOCUS_37740 238955 240544 gene locus_tag LOCUS_37750 238955 240544 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536654.1 protein_id gnl|my_center|LOCUS_37750 240544 241653 gene locus_tag LOCUS_37760 240544 241653 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242874.1 protein_id gnl|my_center|LOCUS_37760 241650 242477 gene locus_tag LOCUS_37770 241650 242477 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976310.1 protein_id gnl|my_center|LOCUS_37770 242470 244101 gene locus_tag LOCUS_37780 242470 244101 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242873.1 protein_id gnl|my_center|LOCUS_37780 244684 244331 gene locus_tag LOCUS_37790 244684 244331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 245097 244681 gene locus_tag LOCUS_37800 245097 244681 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969811.1 protein_id gnl|my_center|LOCUS_37800 246005 245094 gene locus_tag LOCUS_37810 246005 245094 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976315.1 protein_id gnl|my_center|LOCUS_37810 246108 247124 gene locus_tag LOCUS_37820 246108 247124 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976316.1 protein_id gnl|my_center|LOCUS_37820 248014 249174 gene locus_tag LOCUS_37830 248014 249174 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969813.1 protein_id gnl|my_center|LOCUS_37830 249419 250414 gene locus_tag LOCUS_37840 249419 250414 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976318.1 protein_id gnl|my_center|LOCUS_37840 250411 251361 gene locus_tag LOCUS_37850 250411 251361 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969815.1 protein_id gnl|my_center|LOCUS_37850 251351 252166 gene locus_tag LOCUS_37860 251351 252166 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969816.1 protein_id gnl|my_center|LOCUS_37860 252282 253709 gene locus_tag LOCUS_37870 252282 253709 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534222.1 protein_id gnl|my_center|LOCUS_37870 254092 254265 gene locus_tag LOCUS_37880 254092 254265 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887622.1 protein_id gnl|my_center|LOCUS_37880 254408 256582 gene locus_tag LOCUS_37890 254408 256582 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396885.1 protein_id gnl|my_center|LOCUS_37890 256587 257345 gene locus_tag LOCUS_37900 gene fhuF 256587 257345 CDS product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969818.1 protein_id gnl|my_center|LOCUS_37900 257342 258451 gene locus_tag LOCUS_37910 257342 258451 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976324.1 protein_id gnl|my_center|LOCUS_37910 258510 259025 gene locus_tag LOCUS_37920 258510 259025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969820.1 protein_id gnl|my_center|LOCUS_37920 259682 259122 gene locus_tag LOCUS_37930 259682 259122 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329018.1 protein_id gnl|my_center|LOCUS_37930 259792 260235 gene locus_tag LOCUS_37940 259792 260235 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577593.1 protein_id gnl|my_center|LOCUS_37940 261791 260253 gene locus_tag LOCUS_37950 261791 260253 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396876.1 protein_id gnl|my_center|LOCUS_37950 262629 261784 gene locus_tag LOCUS_37960 262629 261784 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098657.1 protein_id gnl|my_center|LOCUS_37960 265073 262626 gene locus_tag LOCUS_37970 265073 262626 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969822.1 protein_id gnl|my_center|LOCUS_37970 267520 265070 gene locus_tag LOCUS_37980 267520 265070 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329022.1 protein_id gnl|my_center|LOCUS_37980 267650 268498 gene locus_tag LOCUS_37990 267650 268498 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329023.1 protein_id gnl|my_center|LOCUS_37990 268569 268823 gene locus_tag LOCUS_38000 268569 268823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 269927 269151 gene locus_tag LOCUS_38010 269927 269151 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392253.1 protein_id gnl|my_center|LOCUS_38010 271763 270111 gene locus_tag LOCUS_38020 271763 270111 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974092.1 protein_id gnl|my_center|LOCUS_38020 274013 272001 gene locus_tag LOCUS_38030 274013 272001 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074303.1 protein_id gnl|my_center|LOCUS_38030 275391 274006 gene locus_tag LOCUS_38040 275391 274006 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074304.1 protein_id gnl|my_center|LOCUS_38040 275762 275541 gene locus_tag LOCUS_38050 275762 275541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 277320 275935 gene locus_tag LOCUS_38060 277320 275935 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973503.1 protein_id gnl|my_center|LOCUS_38060 277994 277317 gene locus_tag LOCUS_38070 277994 277317 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313721.1 protein_id gnl|my_center|LOCUS_38070 279772 278081 gene locus_tag LOCUS_38080 279772 278081 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970803.1 protein_id gnl|my_center|LOCUS_38080 280092 280751 gene locus_tag LOCUS_38090 280092 280751 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554867.1 protein_id gnl|my_center|LOCUS_38090 281143 280763 gene locus_tag LOCUS_38100 281143 280763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529504.1 protein_id gnl|my_center|LOCUS_38100 283353 281179 gene locus_tag LOCUS_38110 283353 281179 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254932.1 protein_id gnl|my_center|LOCUS_38110 285917 283569 gene locus_tag LOCUS_38120 285917 283569 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876943.1 protein_id gnl|my_center|LOCUS_38120 288088 285917 gene locus_tag LOCUS_38130 gene bcsA 288088 285917 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970094.1 protein_id gnl|my_center|LOCUS_38130 289138 288170 gene locus_tag LOCUS_38140 gene bcsN 289138 288170 CDS product cellulose biosynthesis protein BcsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970093.1 protein_id gnl|my_center|LOCUS_38140 289785 289300 gene locus_tag LOCUS_38150 289785 289300 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175145.1 protein_id gnl|my_center|LOCUS_38150 290489 289893 gene locus_tag LOCUS_38160 290489 289893 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971405.1 protein_id gnl|my_center|LOCUS_38160 292075 290486 gene locus_tag LOCUS_38170 292075 290486 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650617.1 protein_id gnl|my_center|LOCUS_38170 293615 292173 gene locus_tag LOCUS_38180 293615 292173 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925697.1 protein_id gnl|my_center|LOCUS_38180 294702 293608 gene locus_tag LOCUS_38190 294702 293608 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815066.1 protein_id gnl|my_center|LOCUS_38190 295852 294704 gene locus_tag LOCUS_38200 295852 294704 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 protein_id gnl|my_center|LOCUS_38200 297051 296032 gene locus_tag LOCUS_38210 297051 296032 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215949.1 protein_id gnl|my_center|LOCUS_38210 297628 297825 gene locus_tag LOCUS_38220 297628 297825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 297878 298177 gene locus_tag LOCUS_38230 297878 298177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 299526 298312 gene locus_tag LOCUS_38240 299526 298312 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969494.1 protein_id gnl|my_center|LOCUS_38240 300270 299572 gene locus_tag LOCUS_38250 300270 299572 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040854.1 protein_id gnl|my_center|LOCUS_38250 300357 301577 gene locus_tag LOCUS_38260 300357 301577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241289.1 protein_id gnl|my_center|LOCUS_38260 301611 302243 gene locus_tag LOCUS_38270 301611 302243 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974561.1 protein_id gnl|my_center|LOCUS_38270 303153 302293 gene locus_tag LOCUS_38280 303153 302293 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971568.1 protein_id gnl|my_center|LOCUS_38280 303741 303382 gene locus_tag LOCUS_38290 303741 303382 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528018.1 protein_id gnl|my_center|LOCUS_38290 304249 303791 gene locus_tag LOCUS_38300 304249 303791 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528017.1 protein_id gnl|my_center|LOCUS_38300 305957 304404 gene locus_tag LOCUS_38310 305957 304404 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528016.1 protein_id gnl|my_center|LOCUS_38310 307291 306125 gene locus_tag LOCUS_38320 307291 306125 CDS product N-acetylneuraminate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056548.1 protein_id gnl|my_center|LOCUS_38320 308866 307325 gene locus_tag LOCUS_38330 308866 307325 CDS product putative N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827463.1 protein_id gnl|my_center|LOCUS_38330 309100 309831 gene locus_tag LOCUS_38340 309100 309831 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727258.1 protein_id gnl|my_center|LOCUS_38340 309828 311414 gene locus_tag LOCUS_38350 309828 311414 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_38350 311661 312620 gene locus_tag LOCUS_38360 311661 312620 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089452.1 protein_id gnl|my_center|LOCUS_38360 312628 313497 gene locus_tag LOCUS_38370 312628 313497 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047036674.1 protein_id gnl|my_center|LOCUS_38370 313518 314435 gene locus_tag LOCUS_38380 313518 314435 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993834.1 protein_id gnl|my_center|LOCUS_38380 314444 315460 gene locus_tag LOCUS_38390 314444 315460 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618802.1 protein_id gnl|my_center|LOCUS_38390 315457 316425 gene locus_tag LOCUS_38400 315457 316425 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_38400 317756 316527 gene locus_tag LOCUS_38410 317756 316527 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970568.1 protein_id gnl|my_center|LOCUS_38410 318906 317761 gene locus_tag LOCUS_38420 318906 317761 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027054.1 protein_id gnl|my_center|LOCUS_38420 319763 318903 gene locus_tag LOCUS_38430 319763 318903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 320815 319763 gene locus_tag LOCUS_38440 320815 319763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606037.1 protein_id gnl|my_center|LOCUS_38440 321899 320817 gene locus_tag LOCUS_38450 321899 320817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528388.1 protein_id gnl|my_center|LOCUS_38450 322657 321899 gene locus_tag LOCUS_38460 322657 321899 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970645.1 protein_id gnl|my_center|LOCUS_38460 323439 322660 gene locus_tag LOCUS_38470 323439 322660 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036719.1 protein_id gnl|my_center|LOCUS_38470 324270 323443 gene locus_tag LOCUS_38480 324270 323443 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532946.1 protein_id gnl|my_center|LOCUS_38480 325151 324267 gene locus_tag LOCUS_38490 325151 324267 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975588.1 protein_id gnl|my_center|LOCUS_38490 326424 325207 gene locus_tag LOCUS_38500 326424 325207 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037351.1 protein_id gnl|my_center|LOCUS_38500 328212 326452 gene locus_tag LOCUS_38510 328212 326452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 329291 328614 gene locus_tag LOCUS_38520 gene rutR 329291 328614 CDS product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708997.1 protein_id gnl|my_center|LOCUS_38520 329516 330367 gene locus_tag LOCUS_38530 329516 330367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 330370 332001 gene locus_tag LOCUS_38540 330370 332001 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 protein_id gnl|my_center|LOCUS_38540 331998 332318 gene locus_tag LOCUS_38550 331998 332318 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810016.1 protein_id gnl|my_center|LOCUS_38550 332428 333498 gene locus_tag LOCUS_38560 332428 333498 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970675.1 protein_id gnl|my_center|LOCUS_38560 333560 335083 gene locus_tag LOCUS_38570 333560 335083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383861.1 protein_id gnl|my_center|LOCUS_38570 335080 336126 gene locus_tag LOCUS_38580 335080 336126 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_38580 336111 337004 gene locus_tag LOCUS_38590 336111 337004 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938368.1 protein_id gnl|my_center|LOCUS_38590 337046 338554 gene locus_tag LOCUS_38600 337046 338554 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_38600 340006 338612 gene locus_tag LOCUS_38610 340006 338612 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530415.1 protein_id gnl|my_center|LOCUS_38610 340846 340040 gene locus_tag LOCUS_38620 340846 340040 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974955.1 protein_id gnl|my_center|LOCUS_38620 341681 340848 gene locus_tag LOCUS_38630 341681 340848 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974954.1 protein_id gnl|my_center|LOCUS_38630 342805 341690 gene locus_tag LOCUS_38640 342805 341690 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974953.1 protein_id gnl|my_center|LOCUS_38640 343962 342871 gene locus_tag LOCUS_38650 343962 342871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974952.1 protein_id gnl|my_center|LOCUS_38650 344975 344067 gene locus_tag LOCUS_38660 344975 344067 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974951.1 protein_id gnl|my_center|LOCUS_38660 345092 346675 gene locus_tag LOCUS_38670 345092 346675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974950.1 protein_id gnl|my_center|LOCUS_38670 346704 348431 gene locus_tag LOCUS_38680 346704 348431 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974949.1 protein_id gnl|my_center|LOCUS_38680 348425 349390 gene locus_tag LOCUS_38690 348425 349390 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974948.1 protein_id gnl|my_center|LOCUS_38690 349392 351041 gene locus_tag LOCUS_38700 349392 351041 CDS product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974947.1 protein_id gnl|my_center|LOCUS_38700 351073 350998 gene locus_tag LOCUS_t00380 351073 350998 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 351228 351983 gene locus_tag LOCUS_38710 351228 351983 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537551.1 protein_id gnl|my_center|LOCUS_38710 352794 352411 gene locus_tag LOCUS_38720 352794 352411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 353257 352907 gene locus_tag LOCUS_38730 353257 352907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 353820 353398 gene locus_tag LOCUS_38740 353820 353398 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396765.1 protein_id gnl|my_center|LOCUS_38740 353957 353832 gene locus_tag LOCUS_38750 353957 353832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 354363 354010 gene locus_tag LOCUS_38760 354363 354010 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387235.1 protein_id gnl|my_center|LOCUS_38760 354978 354469 gene locus_tag LOCUS_38770 354978 354469 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065742.1 protein_id gnl|my_center|LOCUS_38770 355642 355070 gene locus_tag LOCUS_38780 355642 355070 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537532.1 protein_id gnl|my_center|LOCUS_38780 355944 357050 gene locus_tag LOCUS_38790 355944 357050 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314633.1 protein_id gnl|my_center|LOCUS_38790 358227 357346 gene locus_tag LOCUS_38800 358227 357346 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241072.1 protein_id gnl|my_center|LOCUS_38800 358412 359452 gene locus_tag LOCUS_38810 358412 359452 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327675.1 protein_id gnl|my_center|LOCUS_38810 359718 360368 gene locus_tag LOCUS_38820 359718 360368 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241077.1 protein_id gnl|my_center|LOCUS_38820 360380 361153 gene locus_tag LOCUS_38830 gene tam 360380 361153 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312207.1 protein_id gnl|my_center|LOCUS_38830 362800 361154 gene locus_tag LOCUS_38840 362800 361154 CDS product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976330.1 protein_id gnl|my_center|LOCUS_38840 362976 363359 gene locus_tag LOCUS_38850 362976 363359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 365695 363641 gene locus_tag LOCUS_38860 gene rpoD 365695 363641 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387243.1 protein_id gnl|my_center|LOCUS_38860 366460 366113 gene locus_tag LOCUS_38870 366460 366113 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189643.1 protein_id gnl|my_center|LOCUS_38870 367512 366475 gene locus_tag LOCUS_38880 gene tdh 367512 366475 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329071.1 protein_id gnl|my_center|LOCUS_38880 368733 367546 gene locus_tag LOCUS_38890 368733 367546 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242757.1 protein_id gnl|my_center|LOCUS_38890 369235 368780 gene locus_tag LOCUS_38900 369235 368780 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969632.1 protein_id gnl|my_center|LOCUS_38900 370092 369364 gene locus_tag LOCUS_38910 370092 369364 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969706.1 protein_id gnl|my_center|LOCUS_38910 370226 370996 gene locus_tag LOCUS_38920 370226 370996 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314989.1 protein_id gnl|my_center|LOCUS_38920 371492 371013 gene locus_tag LOCUS_38930 371492 371013 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392267.1 protein_id gnl|my_center|LOCUS_38930 373431 371566 gene locus_tag LOCUS_38940 gene recQ 373431 371566 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969854.1 protein_id gnl|my_center|LOCUS_38940 373574 373957 gene locus_tag LOCUS_38950 373574 373957 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063783.1 protein_id gnl|my_center|LOCUS_38950 375961 373973 gene locus_tag LOCUS_38960 gene dnaG 375961 373973 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242755.1 protein_id gnl|my_center|LOCUS_38960 376385 376047 gene locus_tag LOCUS_38970 376385 376047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214922.1 protein_id gnl|my_center|LOCUS_38970 377084 376635 gene locus_tag LOCUS_38980 377084 376635 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532937.1 protein_id gnl|my_center|LOCUS_38980 377408 378616 gene locus_tag LOCUS_38990 gene carA 377408 378616 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396757.1 protein_id gnl|my_center|LOCUS_38990 380269 378884 gene locus_tag LOCUS_39000 380269 378884 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397667.1 protein_id gnl|my_center|LOCUS_39000 381674 380421 gene locus_tag LOCUS_39010 381674 380421 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969318.1 protein_id gnl|my_center|LOCUS_39010 382720 381818 gene locus_tag LOCUS_39020 382720 381818 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397661.1 protein_id gnl|my_center|LOCUS_39020 382825 383823 gene locus_tag LOCUS_39030 382825 383823 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397659.1 protein_id gnl|my_center|LOCUS_39030 384024 384614 gene locus_tag LOCUS_39040 384024 384614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 385536 384598 gene locus_tag LOCUS_39050 385536 384598 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975420.1 protein_id gnl|my_center|LOCUS_39050 386167 385646 gene locus_tag LOCUS_39060 386167 385646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 386258 387055 gene locus_tag LOCUS_39070 386258 387055 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004430439.1 protein_id gnl|my_center|LOCUS_39070 387134 387793 gene locus_tag LOCUS_39080 387134 387793 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530077.1 protein_id gnl|my_center|LOCUS_39080 387862 388893 gene locus_tag LOCUS_39090 387862 388893 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969316.1 protein_id gnl|my_center|LOCUS_39090 389777 388890 gene locus_tag LOCUS_39100 gene ampR 389777 388890 CDS product LysR family transcriptional regulator AmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101291.1 protein_id gnl|my_center|LOCUS_39100 389888 390694 gene locus_tag LOCUS_39110 gene blaOXA 389888 390694 CDS product OXA-42 family oxacillin-hydrolyzing class D beta-lactamase OXA-59 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524931.1 protein_id gnl|my_center|LOCUS_39110 392028 390847 gene locus_tag LOCUS_39120 392028 390847 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727834.1 protein_id gnl|my_center|LOCUS_39120 392074 392688 gene locus_tag LOCUS_39130 392074 392688 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727835.1 protein_id gnl|my_center|LOCUS_39130 392877 396359 gene locus_tag LOCUS_39140 gene carB 392877 396359 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969315.1 protein_id gnl|my_center|LOCUS_39140 396754 397230 gene locus_tag LOCUS_39150 gene greA 396754 397230 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529568.1 protein_id gnl|my_center|LOCUS_39150 397248 398324 gene locus_tag LOCUS_39160 397248 398324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 398378 399448 gene locus_tag LOCUS_39170 gene gmd 398378 399448 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857595.1 protein_id gnl|my_center|LOCUS_39170 399449 400399 gene locus_tag LOCUS_39180 399449 400399 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639972.1 protein_id gnl|my_center|LOCUS_39180 401232 400501 gene locus_tag LOCUS_39190 401232 400501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 protein_id gnl|my_center|LOCUS_39190 401346 403577 gene locus_tag LOCUS_39200 401346 403577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 403579 404538 gene locus_tag LOCUS_39210 403579 404538 CDS product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920689.1 protein_id gnl|my_center|LOCUS_39210 405060 404593 gene locus_tag LOCUS_39220 405060 404593 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310592.1 protein_id gnl|my_center|LOCUS_39220 405313 406287 gene locus_tag LOCUS_39230 gene trxB 405313 406287 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240370.1 protein_id gnl|my_center|LOCUS_39230 406400 407296 gene locus_tag LOCUS_39240 406400 407296 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529555.1 protein_id gnl|my_center|LOCUS_39240 407800 408105 gene locus_tag LOCUS_39250 407800 408105 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969306.1 protein_id gnl|my_center|LOCUS_39250 408137 409258 gene locus_tag LOCUS_39260 408137 409258 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975407.1 protein_id gnl|my_center|LOCUS_39260 409412 410506 gene locus_tag LOCUS_39270 409412 410506 CDS product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972133.1 protein_id gnl|my_center|LOCUS_39270 410831 410589 gene locus_tag LOCUS_39280 410831 410589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 412269 411067 gene locus_tag LOCUS_39290 412269 411067 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329081.1 protein_id gnl|my_center|LOCUS_39290 412581 413501 gene locus_tag LOCUS_39300 412581 413501 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316373.1 protein_id gnl|my_center|LOCUS_39300 413675 413875 gene locus_tag LOCUS_39310 413675 413875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 413950 415122 gene locus_tag LOCUS_39320 413950 415122 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396744.1 protein_id gnl|my_center|LOCUS_39320 415583 415798 gene locus_tag LOCUS_39330 415583 415798 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003494703.1 protein_id gnl|my_center|LOCUS_39330 415933 416394 gene locus_tag LOCUS_39340 415933 416394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 417383 416736 gene locus_tag LOCUS_39350 417383 416736 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532905.1 protein_id gnl|my_center|LOCUS_39350 417695 417531 gene locus_tag LOCUS_39360 417695 417531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 418291 417833 gene locus_tag LOCUS_39370 418291 417833 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532311.1 protein_id gnl|my_center|LOCUS_39370 418421 419524 gene locus_tag LOCUS_39380 gene hppD 418421 419524 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532312.1 protein_id gnl|my_center|LOCUS_39380 419829 420041 gene locus_tag LOCUS_39390 419829 420041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 420983 420096 gene locus_tag LOCUS_39400 420983 420096 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530016.1 protein_id gnl|my_center|LOCUS_39400 421224 421730 gene locus_tag LOCUS_39410 421224 421730 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976372.1 protein_id gnl|my_center|LOCUS_39410 421763 422470 gene locus_tag LOCUS_39420 421763 422470 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976373.1 protein_id gnl|my_center|LOCUS_39420 422607 423989 gene locus_tag LOCUS_39430 422607 423989 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532899.1 protein_id gnl|my_center|LOCUS_39430 424067 424651 gene locus_tag LOCUS_39440 424067 424651 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528144.1 protein_id gnl|my_center|LOCUS_39440 424836 424648 gene locus_tag LOCUS_39450 424836 424648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 425171 424830 gene locus_tag LOCUS_39460 425171 424830 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969865.1 protein_id gnl|my_center|LOCUS_39460 426183 425365 gene locus_tag LOCUS_39470 gene proC 426183 425365 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969866.1 protein_id gnl|my_center|LOCUS_39470 426686 426186 gene locus_tag LOCUS_39480 426686 426186 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532890.1 protein_id gnl|my_center|LOCUS_39480 427335 427078 gene locus_tag LOCUS_39490 427335 427078 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969867.1 protein_id gnl|my_center|LOCUS_39490 427546 428388 gene locus_tag LOCUS_39500 gene lgt 427546 428388 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651060.1 protein_id gnl|my_center|LOCUS_39500 428401 429501 gene locus_tag LOCUS_39510 428401 429501 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844743.1 protein_id gnl|my_center|LOCUS_39510 429605 430396 gene locus_tag LOCUS_39520 gene pgeF 429605 430396 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969870.1 protein_id gnl|my_center|LOCUS_39520 430434 431585 gene locus_tag LOCUS_39530 430434 431585 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976382.1 protein_id gnl|my_center|LOCUS_39530 431703 432467 gene locus_tag LOCUS_39540 431703 432467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532877.1 protein_id gnl|my_center|LOCUS_39540 432592 433524 gene locus_tag LOCUS_39550 432592 433524 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532875.1 protein_id gnl|my_center|LOCUS_39550 433600 434160 gene locus_tag LOCUS_39560 433600 434160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 434705 434331 gene locus_tag LOCUS_39570 434705 434331 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329121.1 protein_id gnl|my_center|LOCUS_39570 436341 434833 gene locus_tag LOCUS_39580 436341 434833 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329122.1 protein_id gnl|my_center|LOCUS_39580 437421 436492 gene locus_tag LOCUS_39590 437421 436492 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969872.1 protein_id gnl|my_center|LOCUS_39590 437881 439038 gene locus_tag LOCUS_39600 437881 439038 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028054209.1 protein_id gnl|my_center|LOCUS_39600 440496 439042 gene locus_tag LOCUS_39610 440496 439042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 440731 441339 gene locus_tag LOCUS_39620 440731 441339 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311165.1 protein_id gnl|my_center|LOCUS_39620 441571 443964 gene locus_tag LOCUS_39630 441571 443964 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400820.1 protein_id gnl|my_center|LOCUS_39630 443985 444734 gene locus_tag LOCUS_39640 443985 444734 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400818.1 protein_id gnl|my_center|LOCUS_39640 444767 445522 gene locus_tag LOCUS_39650 gene pth 444767 445522 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037437113.1 protein_id gnl|my_center|LOCUS_39650 445891 445526 gene locus_tag LOCUS_39660 445891 445526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 446243 445932 gene locus_tag LOCUS_39670 gene clpS 446243 445932 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708843.1 protein_id gnl|my_center|LOCUS_39670 446402 447505 gene locus_tag LOCUS_39680 gene ychF 446402 447505 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972160.1 protein_id gnl|my_center|LOCUS_39680 447512 447988 gene locus_tag LOCUS_39690 447512 447988 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976395.1 protein_id gnl|my_center|LOCUS_39690 447975 448442 gene locus_tag LOCUS_39700 447975 448442 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976396.1 protein_id gnl|my_center|LOCUS_39700 449173 448631 gene locus_tag LOCUS_39710 449173 448631 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534501.1 protein_id gnl|my_center|LOCUS_39710 450159 449281 gene locus_tag LOCUS_39720 450159 449281 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969491.1 protein_id gnl|my_center|LOCUS_39720 451455 450187 gene locus_tag LOCUS_39730 451455 450187 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240454.1 protein_id gnl|my_center|LOCUS_39730 452048 451470 gene locus_tag LOCUS_39740 gene petA 452048 451470 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975691.1 protein_id gnl|my_center|LOCUS_39740 454181 452313 gene locus_tag LOCUS_39750 454181 452313 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972168.1 protein_id gnl|my_center|LOCUS_39750 454569 454258 gene locus_tag LOCUS_39760 454569 454258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 454838 454566 gene locus_tag LOCUS_39770 454838 454566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 456800 454947 gene locus_tag LOCUS_39780 456800 454947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975693.1 protein_id gnl|my_center|LOCUS_39780 457253 457714 gene locus_tag LOCUS_39790 457253 457714 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254662.1 protein_id gnl|my_center|LOCUS_39790 458999 457791 gene locus_tag LOCUS_39800 458999 457791 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 protein_id gnl|my_center|LOCUS_39800 459568 458996 gene locus_tag LOCUS_39810 459568 458996 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396586.1 protein_id gnl|my_center|LOCUS_39810 459667 460101 gene locus_tag LOCUS_39820 gene soxR 459667 460101 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969496.1 protein_id gnl|my_center|LOCUS_39820 461420 460140 gene locus_tag LOCUS_39830 461420 460140 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530058.1 protein_id gnl|my_center|LOCUS_39830 462405 461533 gene locus_tag LOCUS_39840 462405 461533 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532847.1 protein_id gnl|my_center|LOCUS_39840 462501 462893 gene locus_tag LOCUS_39850 462501 462893 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088015.1 protein_id gnl|my_center|LOCUS_39850 463155 462898 gene locus_tag LOCUS_39860 463155 462898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975698.1 protein_id gnl|my_center|LOCUS_39860 463327 464238 gene locus_tag LOCUS_39870 gene hemF 463327 464238 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396602.1 protein_id gnl|my_center|LOCUS_39870 464324 464572 gene locus_tag LOCUS_39880 464324 464572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 464738 464929 gene locus_tag LOCUS_39890 464738 464929 CDS product DUF1059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976398.1 protein_id gnl|my_center|LOCUS_39890 466300 465023 gene locus_tag LOCUS_39900 466300 465023 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969879.1 protein_id gnl|my_center|LOCUS_39900 466929 466297 gene locus_tag LOCUS_39910 466929 466297 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976400.1 protein_id gnl|my_center|LOCUS_39910 467543 466926 gene locus_tag LOCUS_39920 467543 466926 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534495.1 protein_id gnl|my_center|LOCUS_39920 467738 468751 gene locus_tag LOCUS_39930 467738 468751 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400794.1 protein_id gnl|my_center|LOCUS_39930 468766 469686 gene locus_tag LOCUS_39940 468766 469686 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976403.1 protein_id gnl|my_center|LOCUS_39940 469683 472490 gene locus_tag LOCUS_39950 469683 472490 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969884.1 protein_id gnl|my_center|LOCUS_39950 472492 474564 gene locus_tag LOCUS_39960 472492 474564 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969885.1 protein_id gnl|my_center|LOCUS_39960 474752 475285 gene locus_tag LOCUS_39970 474752 475285 CDS product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254559.1 protein_id gnl|my_center|LOCUS_39970 476056 475454 gene locus_tag LOCUS_39980 476056 475454 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028001159.1 protein_id gnl|my_center|LOCUS_39980 476268 477254 gene locus_tag LOCUS_39990 476268 477254 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969887.1 protein_id gnl|my_center|LOCUS_39990 477754 477257 gene locus_tag LOCUS_40000 477754 477257 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976409.1 protein_id gnl|my_center|LOCUS_40000 477865 478767 gene locus_tag LOCUS_40010 477865 478767 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329147.1 protein_id gnl|my_center|LOCUS_40010 478897 479514 gene locus_tag LOCUS_40020 478897 479514 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329148.1 protein_id gnl|my_center|LOCUS_40020 479786 480229 gene locus_tag LOCUS_40030 479786 480229 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329149.1 protein_id gnl|my_center|LOCUS_40030 480229 481086 gene locus_tag LOCUS_40040 480229 481086 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066508.1 protein_id gnl|my_center|LOCUS_40040 482886 481177 gene locus_tag LOCUS_40050 gene leuA 482886 481177 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969894.1 protein_id gnl|my_center|LOCUS_40050 483965 483387 gene locus_tag LOCUS_40060 483965 483387 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066512.1 protein_id gnl|my_center|LOCUS_40060 484211 484789 gene locus_tag LOCUS_40070 484211 484789 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396117.1 protein_id gnl|my_center|LOCUS_40070 485284 484820 gene locus_tag LOCUS_40080 gene queF 485284 484820 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066516.1 protein_id gnl|my_center|LOCUS_40080 486191 485271 gene locus_tag LOCUS_40090 486191 485271 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066517.1 protein_id gnl|my_center|LOCUS_40090 488512 486323 gene locus_tag LOCUS_40100 488512 486323 CDS product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396108.1 protein_id gnl|my_center|LOCUS_40100 488906 489214 gene locus_tag LOCUS_40110 488906 489214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 489606 490136 gene locus_tag LOCUS_40120 489606 490136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 490243 490749 gene locus_tag LOCUS_40130 490243 490749 CDS product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396102.1 protein_id gnl|my_center|LOCUS_40130 492658 490979 gene locus_tag LOCUS_40140 492658 490979 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396100.1 protein_id gnl|my_center|LOCUS_40140 494051 492903 gene locus_tag LOCUS_40150 494051 492903 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242696.1 protein_id gnl|my_center|LOCUS_40150 495345 494044 gene locus_tag LOCUS_40160 495345 494044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396098.1 protein_id gnl|my_center|LOCUS_40160 495763 495356 gene locus_tag LOCUS_40170 495763 495356 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968936.1 protein_id gnl|my_center|LOCUS_40170 497989 496079 gene locus_tag LOCUS_40180 497989 496079 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982167.1 protein_id gnl|my_center|LOCUS_40180 499296 498148 gene locus_tag LOCUS_40190 499296 498148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066526.1 protein_id gnl|my_center|LOCUS_40190 500572 499484 gene locus_tag LOCUS_40200 500572 499484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066527.1 protein_id gnl|my_center|LOCUS_40200 501124 500744 gene locus_tag LOCUS_40210 501124 500744 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242689.1 protein_id gnl|my_center|LOCUS_40210 501737 501150 gene locus_tag LOCUS_40220 501737 501150 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969910.1 protein_id gnl|my_center|LOCUS_40220 501967 502926 gene locus_tag LOCUS_40230 501967 502926 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396076.1 protein_id gnl|my_center|LOCUS_40230 503192 504064 gene locus_tag LOCUS_40240 gene choW 503192 504064 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396090.1 protein_id gnl|my_center|LOCUS_40240 504061 505101 gene locus_tag LOCUS_40250 gene choV 504061 505101 CDS product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329172.1 protein_id gnl|my_center|LOCUS_40250 505181 505945 gene locus_tag LOCUS_40260 505181 505945 CDS product HugZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969914.1 protein_id gnl|my_center|LOCUS_40260 506126 506464 gene locus_tag LOCUS_40270 506126 506464 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066532.1 protein_id gnl|my_center|LOCUS_40270 506652 507977 gene locus_tag LOCUS_40280 506652 507977 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066540.1 protein_id gnl|my_center|LOCUS_40280 509652 508030 gene locus_tag LOCUS_40290 509652 508030 CDS product DUF4166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205826934.1 protein_id gnl|my_center|LOCUS_40290 510059 509649 gene locus_tag LOCUS_40300 510059 509649 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038200.1 protein_id gnl|my_center|LOCUS_40300 510591 510091 gene locus_tag LOCUS_40310 510591 510091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 510755 511624 gene locus_tag LOCUS_40320 510755 511624 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193666682.1 protein_id gnl|my_center|LOCUS_40320 511705 513399 gene locus_tag LOCUS_40330 gene ade 511705 513399 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992329.1 protein_id gnl|my_center|LOCUS_40330 513457 513657 gene locus_tag LOCUS_40340 513457 513657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530089.1 protein_id gnl|my_center|LOCUS_40340 513654 513923 gene locus_tag LOCUS_40350 513654 513923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_40350 515633 513990 gene locus_tag LOCUS_40360 515633 513990 CDS product alpha-glucosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396066.1 protein_id gnl|my_center|LOCUS_40360 515785 516789 gene locus_tag LOCUS_40370 515785 516789 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501902.1 protein_id gnl|my_center|LOCUS_40370 516808 517722 gene locus_tag LOCUS_40380 516808 517722 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396064.1 protein_id gnl|my_center|LOCUS_40380 519351 517918 gene locus_tag LOCUS_40390 gene der 519351 517918 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396062.1 protein_id gnl|my_center|LOCUS_40390 520115 519444 gene locus_tag LOCUS_40400 520115 519444 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329180.1 protein_id gnl|my_center|LOCUS_40400 520801 520217 gene locus_tag LOCUS_40410 520801 520217 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972211.1 protein_id gnl|my_center|LOCUS_40410 520941 521954 gene locus_tag LOCUS_40420 520941 521954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242674.1 protein_id gnl|my_center|LOCUS_40420 523229 521964 gene locus_tag LOCUS_40430 gene sbmA 523229 521964 CDS product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242673.1 protein_id gnl|my_center|LOCUS_40430 524237 523485 gene locus_tag LOCUS_40440 gene map 524237 523485 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387469.1 protein_id gnl|my_center|LOCUS_40440 525344 524283 gene locus_tag LOCUS_40450 525344 524283 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396053.1 protein_id gnl|my_center|LOCUS_40450 525849 525427 gene locus_tag LOCUS_40460 525849 525427 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_40460 526100 525849 gene locus_tag LOCUS_40470 526100 525849 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766946.1 protein_id gnl|my_center|LOCUS_40470 526641 526159 gene locus_tag LOCUS_40480 526641 526159 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252527.1 protein_id gnl|my_center|LOCUS_40480 527977 526721 gene locus_tag LOCUS_40490 527977 526721 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968534.1 protein_id gnl|my_center|LOCUS_40490 528348 527974 gene locus_tag LOCUS_40500 528348 527974 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527752.1 protein_id gnl|my_center|LOCUS_40500 529066 528449 gene locus_tag LOCUS_40510 529066 528449 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973484.1 protein_id gnl|my_center|LOCUS_40510 530606 529113 gene locus_tag LOCUS_40520 gene glpK 530606 529113 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396049.1 protein_id gnl|my_center|LOCUS_40520 530803 531576 gene locus_tag LOCUS_40530 530803 531576 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396047.1 protein_id gnl|my_center|LOCUS_40530 531732 532571 gene locus_tag LOCUS_40540 gene xdhC 531732 532571 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991820.1 protein_id gnl|my_center|LOCUS_40540 532747 532568 gene locus_tag LOCUS_40550 532747 532568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 532849 533742 gene locus_tag LOCUS_40560 532849 533742 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242665.1 protein_id gnl|my_center|LOCUS_40560 534459 533746 gene locus_tag LOCUS_40570 534459 533746 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976098.1 protein_id gnl|my_center|LOCUS_40570 534619 535851 gene locus_tag LOCUS_40580 534619 535851 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396043.1 protein_id gnl|my_center|LOCUS_40580 535857 537164 gene locus_tag LOCUS_40590 gene guaD 535857 537164 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975974.1 protein_id gnl|my_center|LOCUS_40590 537523 537161 gene locus_tag LOCUS_40600 gene uraH 537523 537161 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329197.1 protein_id gnl|my_center|LOCUS_40600 538025 537531 gene locus_tag LOCUS_40610 538025 537531 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061424.1 protein_id gnl|my_center|LOCUS_40610 538574 538077 gene locus_tag LOCUS_40620 gene uraD 538574 538077 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972234.1 protein_id gnl|my_center|LOCUS_40620 539503 538571 gene locus_tag LOCUS_40630 gene puuE 539503 538571 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976001.1 protein_id gnl|my_center|LOCUS_40630 539640 540014 gene locus_tag LOCUS_40640 539640 540014 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214685.1 protein_id gnl|my_center|LOCUS_40640 541200 540022 gene locus_tag LOCUS_40650 541200 540022 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976003.1 protein_id gnl|my_center|LOCUS_40650 541199 541921 gene locus_tag LOCUS_40660 gene mnmD 541199 541921 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972237.1 protein_id gnl|my_center|LOCUS_40660 545567 541926 gene locus_tag LOCUS_40670 545567 541926 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972238.1 protein_id gnl|my_center|LOCUS_40670 545759 547414 gene locus_tag LOCUS_40680 545759 547414 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 protein_id gnl|my_center|LOCUS_40680 547885 547433 gene locus_tag LOCUS_40690 547885 547433 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061418.1 protein_id gnl|my_center|LOCUS_40690 548099 549199 gene locus_tag LOCUS_40700 548099 549199 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651665.1 protein_id gnl|my_center|LOCUS_40700 549556 550986 gene locus_tag LOCUS_40710 549556 550986 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976005.1 protein_id gnl|my_center|LOCUS_40710 552106 551222 gene locus_tag LOCUS_40720 552106 551222 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329207.1 protein_id gnl|my_center|LOCUS_40720 552456 553847 gene locus_tag LOCUS_40730 552456 553847 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850494.1 protein_id gnl|my_center|LOCUS_40730 553852 554793 gene locus_tag LOCUS_40740 553852 554793 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329210.1 protein_id gnl|my_center|LOCUS_40740 554806 555627 gene locus_tag LOCUS_40750 554806 555627 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396033.1 protein_id gnl|my_center|LOCUS_40750 556112 555729 gene locus_tag LOCUS_40760 556112 555729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40760 556032 556418 gene locus_tag LOCUS_40770 556032 556418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 558364 556625 gene locus_tag LOCUS_40780 gene araD 558364 556625 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976013.1 protein_id gnl|my_center|LOCUS_40780 559851 558418 gene locus_tag LOCUS_40790 559851 558418 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329213.1 protein_id gnl|my_center|LOCUS_40790 560895 559900 gene locus_tag LOCUS_40800 gene gguC 560895 559900 CDS product GguC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976015.1 protein_id gnl|my_center|LOCUS_40800 562233 561025 gene locus_tag LOCUS_40810 gene gguB 562233 561025 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535527.1 protein_id gnl|my_center|LOCUS_40810 563768 562233 gene locus_tag LOCUS_40820 gene gguA 563768 562233 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061407.1 protein_id gnl|my_center|LOCUS_40820 564960 563887 gene locus_tag LOCUS_40830 gene chvE 564960 563887 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329217.1 protein_id gnl|my_center|LOCUS_40830 565217 566224 gene locus_tag LOCUS_40840 565217 566224 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850489.1 protein_id gnl|my_center|LOCUS_40840 566236 566739 gene locus_tag LOCUS_40850 566236 566739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976018.1 protein_id gnl|my_center|LOCUS_40850 566994 566770 gene locus_tag LOCUS_40860 566994 566770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329220.1 protein_id gnl|my_center|LOCUS_40860 567849 567055 gene locus_tag LOCUS_40870 567849 567055 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393072.1 protein_id gnl|my_center|LOCUS_40870 569093 567870 gene locus_tag LOCUS_40880 569093 567870 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456630.1 protein_id gnl|my_center|LOCUS_40880 569460 569146 gene locus_tag LOCUS_40890 569460 569146 CDS product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061915.1 protein_id gnl|my_center|LOCUS_40890 570572 569487 gene locus_tag LOCUS_40900 570572 569487 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061916.1 protein_id gnl|my_center|LOCUS_40900 570735 571766 gene locus_tag LOCUS_40910 570735 571766 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975437.1 protein_id gnl|my_center|LOCUS_40910 571931 572743 gene locus_tag LOCUS_40920 571931 572743 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392194.1 protein_id gnl|my_center|LOCUS_40920 573001 573930 gene locus_tag LOCUS_40930 573001 573930 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530542.1 protein_id gnl|my_center|LOCUS_40930 574182 575573 gene locus_tag LOCUS_40940 574182 575573 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530544.1 protein_id gnl|my_center|LOCUS_40940 575626 576645 gene locus_tag LOCUS_40950 575626 576645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530546.1 protein_id gnl|my_center|LOCUS_40950 576773 577765 gene locus_tag LOCUS_40960 gene iolG 576773 577765 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387540.1 protein_id gnl|my_center|LOCUS_40960 >Feature sequence30 1383 157 gene locus_tag LOCUS_40970 1383 157 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384689.1 protein_id gnl|my_center|LOCUS_40970 1565 2464 gene locus_tag LOCUS_40980 1565 2464 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384690.1 protein_id gnl|my_center|LOCUS_40980 2913 2569 gene locus_tag LOCUS_40990 2913 2569 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397337.1 protein_id gnl|my_center|LOCUS_40990 3613 2993 gene locus_tag LOCUS_41000 3613 2993 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397340.1 protein_id gnl|my_center|LOCUS_41000 4790 3621 gene locus_tag LOCUS_41010 gene tatA 4790 3621 CDS product tyrosine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397370.1 protein_id gnl|my_center|LOCUS_41010 4928 5419 gene locus_tag LOCUS_41020 4928 5419 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397343.1 protein_id gnl|my_center|LOCUS_41020 5506 6354 gene locus_tag LOCUS_41030 5506 6354 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969139.1 protein_id gnl|my_center|LOCUS_41030 7786 6326 gene locus_tag LOCUS_41040 7786 6326 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975325.1 protein_id gnl|my_center|LOCUS_41040 9015 7957 gene locus_tag LOCUS_41050 9015 7957 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968492.1 protein_id gnl|my_center|LOCUS_41050 9154 9714 gene locus_tag LOCUS_41060 9154 9714 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976228.1 protein_id gnl|my_center|LOCUS_41060 10579 9719 gene locus_tag LOCUS_41070 10579 9719 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338352.1 protein_id gnl|my_center|LOCUS_41070 11030 10569 gene locus_tag LOCUS_41080 11030 10569 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338351.1 protein_id gnl|my_center|LOCUS_41080 11547 12374 gene locus_tag LOCUS_41090 11547 12374 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120708963.1 protein_id gnl|my_center|LOCUS_41090 12371 13231 gene locus_tag LOCUS_41100 12371 13231 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_41100 13404 13228 gene locus_tag LOCUS_41110 13404 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 14492 13596 gene locus_tag LOCUS_41120 14492 13596 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208224.1 protein_id gnl|my_center|LOCUS_41120 14802 14599 gene locus_tag LOCUS_41130 14802 14599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 15072 14806 gene locus_tag LOCUS_41140 15072 14806 CDS product conjugal transfer protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015316600.1 protein_id gnl|my_center|LOCUS_41140 15400 15074 gene locus_tag LOCUS_41150 15400 15074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 15569 15817 gene locus_tag LOCUS_41160 15569 15817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41160 17539 17231 gene locus_tag LOCUS_41170 17539 17231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 17740 18546 gene locus_tag LOCUS_41180 17740 18546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41180 18819 19841 gene locus_tag LOCUS_41190 18819 19841 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705723.1 protein_id gnl|my_center|LOCUS_41190 21532 20336 gene locus_tag LOCUS_41200 21532 20336 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039750.1 protein_id gnl|my_center|LOCUS_41200 23413 21851 gene locus_tag LOCUS_41210 gene guaA 23413 21851 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968497.1 protein_id gnl|my_center|LOCUS_41210 24111 23467 gene locus_tag LOCUS_41220 24111 23467 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968498.1 protein_id gnl|my_center|LOCUS_41220 24557 24108 gene locus_tag LOCUS_41230 24557 24108 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311271.1 protein_id gnl|my_center|LOCUS_41230 25099 24644 gene locus_tag LOCUS_41240 25099 24644 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970792.1 protein_id gnl|my_center|LOCUS_41240 26246 25143 gene locus_tag LOCUS_41250 26246 25143 CDS product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397356.1 protein_id gnl|my_center|LOCUS_41250 27379 26246 gene locus_tag LOCUS_41260 27379 26246 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970794.1 protein_id gnl|my_center|LOCUS_41260 29121 27586 gene locus_tag LOCUS_41270 29121 27586 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081157931.1 protein_id gnl|my_center|LOCUS_41270 30443 29166 gene locus_tag LOCUS_41280 30443 29166 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970796.1 protein_id gnl|my_center|LOCUS_41280 31944 30655 gene locus_tag LOCUS_41290 31944 30655 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529788.1 protein_id gnl|my_center|LOCUS_41290 32382 32020 gene locus_tag LOCUS_41300 32382 32020 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067726.1 protein_id gnl|my_center|LOCUS_41300 33619 32744 gene locus_tag LOCUS_41310 33619 32744 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241624.1 protein_id gnl|my_center|LOCUS_41310 34761 33616 gene locus_tag LOCUS_41320 gene queG 34761 33616 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397385.1 protein_id gnl|my_center|LOCUS_41320 35464 34772 gene locus_tag LOCUS_41330 35464 34772 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330755.1 protein_id gnl|my_center|LOCUS_41330 35696 36502 gene locus_tag LOCUS_41340 35696 36502 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397388.1 protein_id gnl|my_center|LOCUS_41340 36685 36536 gene locus_tag LOCUS_41350 36685 36536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710132.1 protein_id gnl|my_center|LOCUS_41350 37916 36936 gene locus_tag LOCUS_41360 37916 36936 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968509.1 protein_id gnl|my_center|LOCUS_41360 38324 38037 gene locus_tag LOCUS_41370 38324 38037 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378049.1 protein_id gnl|my_center|LOCUS_41370 39039 38341 gene locus_tag LOCUS_41380 gene pyrF 39039 38341 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968510.1 protein_id gnl|my_center|LOCUS_41380 39623 39042 gene locus_tag LOCUS_41390 39623 39042 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968511.1 protein_id gnl|my_center|LOCUS_41390 40250 39633 gene locus_tag LOCUS_41400 40250 39633 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067737.1 protein_id gnl|my_center|LOCUS_41400 41573 40455 gene locus_tag LOCUS_41410 gene dnaN 41573 40455 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330763.1 protein_id gnl|my_center|LOCUS_41410 41808 42734 gene locus_tag LOCUS_41420 gene rsmI 41808 42734 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330764.1 protein_id gnl|my_center|LOCUS_41420 42724 43092 gene locus_tag LOCUS_41430 42724 43092 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067740.1 protein_id gnl|my_center|LOCUS_41430 43195 44493 gene locus_tag LOCUS_41440 43195 44493 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397418.1 protein_id gnl|my_center|LOCUS_41440 44655 45536 gene locus_tag LOCUS_41450 44655 45536 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984086.1 protein_id gnl|my_center|LOCUS_41450 45550 46392 gene locus_tag LOCUS_41460 gene ugpE 45550 46392 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397422.1 protein_id gnl|my_center|LOCUS_41460 46405 47523 gene locus_tag LOCUS_41470 46405 47523 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397425.1 protein_id gnl|my_center|LOCUS_41470 47520 48512 gene locus_tag LOCUS_41480 47520 48512 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397428.1 protein_id gnl|my_center|LOCUS_41480 48585 49529 gene locus_tag LOCUS_41490 gene gshB 48585 49529 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310157.1 protein_id gnl|my_center|LOCUS_41490 49795 51327 gene locus_tag LOCUS_41500 49795 51327 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241607.1 protein_id gnl|my_center|LOCUS_41500 52008 51442 gene locus_tag LOCUS_41510 52008 51442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 53031 52063 gene locus_tag LOCUS_41520 gene cysK 53031 52063 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310159.1 protein_id gnl|my_center|LOCUS_41520 53879 53262 gene locus_tag LOCUS_41530 53879 53262 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968514.1 protein_id gnl|my_center|LOCUS_41530 55115 54228 gene locus_tag LOCUS_41540 55115 54228 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528691.1 protein_id gnl|my_center|LOCUS_41540 55593 55120 gene locus_tag LOCUS_41550 gene dut 55593 55120 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552523.1 protein_id gnl|my_center|LOCUS_41550 55687 57267 gene locus_tag LOCUS_41560 55687 57267 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310162.1 protein_id gnl|my_center|LOCUS_41560 57542 58351 gene locus_tag LOCUS_41570 gene thiD 57542 58351 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338386.1 protein_id gnl|my_center|LOCUS_41570 58973 58356 gene locus_tag LOCUS_41580 58973 58356 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532395.1 protein_id gnl|my_center|LOCUS_41580 59852 59058 gene locus_tag LOCUS_41590 59852 59058 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397463.1 protein_id gnl|my_center|LOCUS_41590 60260 59856 gene locus_tag LOCUS_41600 60260 59856 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397473.1 protein_id gnl|my_center|LOCUS_41600 60640 61461 gene locus_tag LOCUS_41610 60640 61461 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968523.1 protein_id gnl|my_center|LOCUS_41610 62659 61454 gene locus_tag LOCUS_41620 gene coaBC 62659 61454 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067760.1 protein_id gnl|my_center|LOCUS_41620 63187 62960 gene locus_tag LOCUS_41630 63187 62960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 64124 63321 gene locus_tag LOCUS_41640 64124 63321 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975239.1 protein_id gnl|my_center|LOCUS_41640 67794 64168 gene locus_tag LOCUS_41650 gene nsrA 67794 64168 CDS product signal perception protein NrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976263.1 protein_id gnl|my_center|LOCUS_41650 69448 67874 gene locus_tag LOCUS_41660 gene ubiB 69448 67874 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397492.1 protein_id gnl|my_center|LOCUS_41660 70262 69486 gene locus_tag LOCUS_41670 gene ubiE 70262 69486 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310167.1 protein_id gnl|my_center|LOCUS_41670 70446 71327 gene locus_tag LOCUS_41680 gene mutM 70446 71327 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330821.1 protein_id gnl|my_center|LOCUS_41680 71356 72129 gene locus_tag LOCUS_41690 71356 72129 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330822.1 protein_id gnl|my_center|LOCUS_41690 72320 72586 gene locus_tag LOCUS_41700 gene rpsT 72320 72586 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974216.1 protein_id gnl|my_center|LOCUS_41700 73561 75015 gene locus_tag LOCUS_41710 gene dnaA 73561 75015 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015007101.1 protein_id gnl|my_center|LOCUS_41710 75957 75061 gene locus_tag LOCUS_41720 gene gcvA 75957 75061 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972039.1 protein_id gnl|my_center|LOCUS_41720 76094 77035 gene locus_tag LOCUS_41730 76094 77035 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310430.1 protein_id gnl|my_center|LOCUS_41730 78229 77036 gene locus_tag LOCUS_41740 gene hemW 78229 77036 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968537.1 protein_id gnl|my_center|LOCUS_41740 78880 78236 gene locus_tag LOCUS_41750 gene rdgB 78880 78236 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970821.1 protein_id gnl|my_center|LOCUS_41750 79305 78889 gene locus_tag LOCUS_41760 79305 78889 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909757.1 protein_id gnl|my_center|LOCUS_41760 80035 79319 gene locus_tag LOCUS_41770 gene rph 80035 79319 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310174.1 protein_id gnl|my_center|LOCUS_41770 80229 81305 gene locus_tag LOCUS_41780 gene hrcA 80229 81305 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527730.1 protein_id gnl|my_center|LOCUS_41780 81398 82021 gene locus_tag LOCUS_41790 gene grpE 81398 82021 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974227.1 protein_id gnl|my_center|LOCUS_41790 82559 82095 gene locus_tag LOCUS_41800 gene ptsN 82559 82095 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527726.1 protein_id gnl|my_center|LOCUS_41800 83208 82633 gene locus_tag LOCUS_41810 gene raiA 83208 82633 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327046.1 protein_id gnl|my_center|LOCUS_41810 85020 83458 gene locus_tag LOCUS_41820 gene rpoN 85020 83458 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399612.1 protein_id gnl|my_center|LOCUS_41820 85981 85172 gene locus_tag LOCUS_41830 gene lptB 85981 85172 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527721.1 protein_id gnl|my_center|LOCUS_41830 86551 85988 gene locus_tag LOCUS_41840 86551 85988 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378113.1 protein_id gnl|my_center|LOCUS_41840 87227 86559 gene locus_tag LOCUS_41850 gene lptC 87227 86559 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327050.1 protein_id gnl|my_center|LOCUS_41850 87440 88390 gene locus_tag LOCUS_41860 gene sppA 87440 88390 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970827.1 protein_id gnl|my_center|LOCUS_41860 88418 88717 gene locus_tag LOCUS_41870 88418 88717 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493505.1 protein_id gnl|my_center|LOCUS_41870 88762 89106 gene locus_tag LOCUS_41880 88762 89106 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974237.1 protein_id gnl|my_center|LOCUS_41880 89572 89123 gene locus_tag LOCUS_41890 89572 89123 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327054.1 protein_id gnl|my_center|LOCUS_41890 89706 90773 gene locus_tag LOCUS_41900 89706 90773 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241560.1 protein_id gnl|my_center|LOCUS_41900 90770 91624 gene locus_tag LOCUS_41910 90770 91624 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241559.1 protein_id gnl|my_center|LOCUS_41910 91621 92112 gene locus_tag LOCUS_41920 gene lspA 91621 92112 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399621.1 protein_id gnl|my_center|LOCUS_41920 92169 94463 gene locus_tag LOCUS_41930 92169 94463 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013843850.1 protein_id gnl|my_center|LOCUS_41930 94570 95448 gene locus_tag LOCUS_41940 94570 95448 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241556.1 protein_id gnl|my_center|LOCUS_41940 97870 95585 gene locus_tag LOCUS_41950 97870 95585 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327060.1 protein_id gnl|my_center|LOCUS_41950 97985 100723 gene locus_tag LOCUS_41960 gene mutS 97985 100723 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399627.1 protein_id gnl|my_center|LOCUS_41960 100768 103662 gene locus_tag LOCUS_41970 100768 103662 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399630.1 protein_id gnl|my_center|LOCUS_41970 103659 105251 gene locus_tag LOCUS_41980 gene murJ 103659 105251 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968549.1 protein_id gnl|my_center|LOCUS_41980 105731 105258 gene locus_tag LOCUS_41990 105731 105258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 105965 107032 gene locus_tag LOCUS_42000 gene trpS 105965 107032 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970836.1 protein_id gnl|my_center|LOCUS_42000 107125 107616 gene locus_tag LOCUS_42010 107125 107616 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974250.1 protein_id gnl|my_center|LOCUS_42010 107716 108285 gene locus_tag LOCUS_42020 107716 108285 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378149.1 protein_id gnl|my_center|LOCUS_42020 108307 108963 gene locus_tag LOCUS_42030 gene tsaB 108307 108963 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968552.1 protein_id gnl|my_center|LOCUS_42030 108968 109462 gene locus_tag LOCUS_42040 108968 109462 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974253.1 protein_id gnl|my_center|LOCUS_42040 109502 109927 gene locus_tag LOCUS_42050 109502 109927 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310199.1 protein_id gnl|my_center|LOCUS_42050 110055 110843 gene locus_tag LOCUS_42060 110055 110843 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399640.1 protein_id gnl|my_center|LOCUS_42060 110900 112300 gene locus_tag LOCUS_42070 gene miaB 110900 112300 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974255.1 protein_id gnl|my_center|LOCUS_42070 112328 113380 gene locus_tag LOCUS_42080 112328 113380 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974256.1 protein_id gnl|my_center|LOCUS_42080 113398 113907 gene locus_tag LOCUS_42090 gene ybeY 113398 113907 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327074.1 protein_id gnl|my_center|LOCUS_42090 113917 115068 gene locus_tag LOCUS_42100 113917 115068 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399659.1 protein_id gnl|my_center|LOCUS_42100 115181 116764 gene locus_tag LOCUS_42110 gene lnt 115181 116764 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327077.1 protein_id gnl|my_center|LOCUS_42110 116913 117332 gene locus_tag LOCUS_42120 116913 117332 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970843.1 protein_id gnl|my_center|LOCUS_42120 117535 118773 gene locus_tag LOCUS_42130 gene metK 117535 118773 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527663.1 protein_id gnl|my_center|LOCUS_42130 118781 119482 gene locus_tag LOCUS_42140 118781 119482 CDS product tRNA (guanosine(46)-N(7))-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015007103.1 protein_id gnl|my_center|LOCUS_42140 119758 119501 gene locus_tag LOCUS_42150 119758 119501 CDS product DUF1150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706639.1 protein_id gnl|my_center|LOCUS_42150 120322 119891 gene locus_tag LOCUS_42160 120322 119891 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974263.1 protein_id gnl|my_center|LOCUS_42160 120507 121448 gene locus_tag LOCUS_42170 120507 121448 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241535.1 protein_id gnl|my_center|LOCUS_42170 121505 121807 gene locus_tag LOCUS_42180 121505 121807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 124247 121911 gene locus_tag LOCUS_42190 124247 121911 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974265.1 protein_id gnl|my_center|LOCUS_42190 125428 124529 gene locus_tag LOCUS_42200 125428 124529 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327085.1 protein_id gnl|my_center|LOCUS_42200 126666 125473 gene locus_tag LOCUS_42210 126666 125473 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391792.1 protein_id gnl|my_center|LOCUS_42210 126792 127316 gene locus_tag LOCUS_42220 gene def 126792 127316 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974268.1 protein_id gnl|my_center|LOCUS_42220 127418 128362 gene locus_tag LOCUS_42230 gene fmt 127418 128362 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310212.1 protein_id gnl|my_center|LOCUS_42230 128362 129105 gene locus_tag LOCUS_42240 gene truA 128362 129105 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391799.1 protein_id gnl|my_center|LOCUS_42240 129726 129130 gene locus_tag LOCUS_42250 129726 129130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391800.1 protein_id gnl|my_center|LOCUS_42250 130912 129713 gene locus_tag LOCUS_42260 gene dapE 130912 129713 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391801.1 protein_id gnl|my_center|LOCUS_42260 131383 130997 gene locus_tag LOCUS_42270 131383 130997 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391807.1 protein_id gnl|my_center|LOCUS_42270 132244 131387 gene locus_tag LOCUS_42280 gene dapD 132244 131387 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527620.1 protein_id gnl|my_center|LOCUS_42280 132432 133325 gene locus_tag LOCUS_42290 132432 133325 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527617.1 protein_id gnl|my_center|LOCUS_42290 134387 133422 gene locus_tag LOCUS_42300 134387 133422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 135205 134510 gene locus_tag LOCUS_42310 135205 134510 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327101.1 protein_id gnl|my_center|LOCUS_42310 135309 136211 gene locus_tag LOCUS_42320 135309 136211 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327102.1 protein_id gnl|my_center|LOCUS_42320 137132 136245 gene locus_tag LOCUS_42330 gene argB 137132 136245 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968575.1 protein_id gnl|my_center|LOCUS_42330 137399 138130 gene locus_tag LOCUS_42340 137399 138130 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327108.1 protein_id gnl|my_center|LOCUS_42340 138787 138134 gene locus_tag LOCUS_42350 gene yihA 138787 138134 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252558.1 protein_id gnl|my_center|LOCUS_42350 139751 138840 gene locus_tag LOCUS_42360 139751 138840 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066869481.1 protein_id gnl|my_center|LOCUS_42360 141766 139970 gene locus_tag LOCUS_42370 gene yidC 141766 139970 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310230.1 protein_id gnl|my_center|LOCUS_42370 142158 141766 gene locus_tag LOCUS_42380 gene rnpA 142158 141766 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013843866.1 protein_id gnl|my_center|LOCUS_42380 142747 144753 gene locus_tag LOCUS_42390 142747 144753 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968581.1 protein_id gnl|my_center|LOCUS_42390 144958 146430 gene locus_tag LOCUS_42400 144958 146430 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968584.1 protein_id gnl|my_center|LOCUS_42400 146567 146643 gene locus_tag LOCUS_t00390 146567 146643 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 146870 148117 gene locus_tag LOCUS_42410 146870 148117 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240214.1 protein_id gnl|my_center|LOCUS_42410 148800 148165 gene locus_tag LOCUS_42420 148800 148165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 149730 148924 gene locus_tag LOCUS_42430 149730 148924 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531522.1 protein_id gnl|my_center|LOCUS_42430 149875 150963 gene locus_tag LOCUS_42440 149875 150963 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391825.1 protein_id gnl|my_center|LOCUS_42440 152017 150983 gene locus_tag LOCUS_42450 152017 150983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 152206 152844 gene locus_tag LOCUS_42460 152206 152844 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531518.1 protein_id gnl|my_center|LOCUS_42460 154742 152898 gene locus_tag LOCUS_42470 gene cyaD1 154742 152898 CDS product adenylate cyclase CyaD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968600.1 protein_id gnl|my_center|LOCUS_42470 155525 154821 gene locus_tag LOCUS_42480 155525 154821 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531516.1 protein_id gnl|my_center|LOCUS_42480 155834 155646 gene locus_tag LOCUS_42490 155834 155646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 156031 156459 gene locus_tag LOCUS_42500 156031 156459 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968601.1 protein_id gnl|my_center|LOCUS_42500 156609 157307 gene locus_tag LOCUS_42510 156609 157307 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970871.1 protein_id gnl|my_center|LOCUS_42510 157387 158316 gene locus_tag LOCUS_42520 157387 158316 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310651.1 protein_id gnl|my_center|LOCUS_42520 158401 159486 gene locus_tag LOCUS_42530 158401 159486 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530012.1 protein_id gnl|my_center|LOCUS_42530 161114 159489 gene locus_tag LOCUS_42540 gene pgi 161114 159489 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252578.1 protein_id gnl|my_center|LOCUS_42540 162930 161230 gene locus_tag LOCUS_42550 162930 161230 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968608.1 protein_id gnl|my_center|LOCUS_42550 163226 164416 gene locus_tag LOCUS_42560 163226 164416 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971836.1 protein_id gnl|my_center|LOCUS_42560 164645 165814 gene locus_tag LOCUS_42570 164645 165814 CDS product DUF3095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391459.1 protein_id gnl|my_center|LOCUS_42570 166706 166449 gene locus_tag LOCUS_42580 166706 166449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 166996 166718 gene locus_tag LOCUS_42590 166996 166718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331494.1 protein_id gnl|my_center|LOCUS_42590 167200 167069 gene locus_tag LOCUS_42600 167200 167069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 167484 167239 gene locus_tag LOCUS_42610 167484 167239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 167650 167967 gene locus_tag LOCUS_42620 167650 167967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 167968 168546 gene locus_tag LOCUS_42630 167968 168546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 169510 168566 gene locus_tag LOCUS_42640 169510 168566 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 protein_id gnl|my_center|LOCUS_42640 172611 169540 gene locus_tag LOCUS_42650 172611 169540 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_42650 173343 172618 gene locus_tag LOCUS_42660 173343 172618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 174003 173416 gene locus_tag LOCUS_42670 174003 173416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 175277 174000 gene locus_tag LOCUS_42680 175277 174000 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_42680 177460 175274 gene locus_tag LOCUS_42690 177460 175274 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_42690 177803 178969 gene locus_tag LOCUS_42700 177803 178969 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_42700 178956 179462 gene locus_tag LOCUS_42710 178956 179462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 179756 180037 gene locus_tag LOCUS_42720 179756 180037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 180030 182321 gene locus_tag LOCUS_42730 180030 182321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 182926 182600 gene locus_tag LOCUS_42740 182926 182600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 183041 183355 gene locus_tag LOCUS_42750 183041 183355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 184084 183362 gene locus_tag LOCUS_42760 184084 183362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 184613 184062 gene locus_tag LOCUS_42770 184613 184062 CDS product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921344.1 protein_id gnl|my_center|LOCUS_42770 184720 184645 gene locus_tag LOCUS_t00400 184720 184645 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 185945 184983 gene locus_tag LOCUS_42780 185945 184983 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970881.1 protein_id gnl|my_center|LOCUS_42780 186617 187741 gene locus_tag LOCUS_42790 186617 187741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974329.1 protein_id gnl|my_center|LOCUS_42790 188635 187754 gene locus_tag LOCUS_42800 gene ppk2 188635 187754 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241473.1 protein_id gnl|my_center|LOCUS_42800 188761 190077 gene locus_tag LOCUS_42810 gene phoR 188761 190077 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968632.1 protein_id gnl|my_center|LOCUS_42810 190264 191298 gene locus_tag LOCUS_42820 190264 191298 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878074.1 protein_id gnl|my_center|LOCUS_42820 191467 192951 gene locus_tag LOCUS_42830 gene pstC 191467 192951 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970884.1 protein_id gnl|my_center|LOCUS_42830 192948 194276 gene locus_tag LOCUS_42840 gene pstA 192948 194276 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970885.1 protein_id gnl|my_center|LOCUS_42840 194290 195105 gene locus_tag LOCUS_42850 gene pstB 194290 195105 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003514913.1 protein_id gnl|my_center|LOCUS_42850 195153 195881 gene locus_tag LOCUS_42860 gene phoU 195153 195881 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530180.1 protein_id gnl|my_center|LOCUS_42860 195901 196584 gene locus_tag LOCUS_42870 gene phoB 195901 196584 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706736.1 protein_id gnl|my_center|LOCUS_42870 197261 196731 gene locus_tag LOCUS_42880 197261 196731 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241465.1 protein_id gnl|my_center|LOCUS_42880 197685 198875 gene locus_tag LOCUS_42890 197685 198875 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974339.1 protein_id gnl|my_center|LOCUS_42890 198903 199814 gene locus_tag LOCUS_42900 gene argF 198903 199814 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970889.1 protein_id gnl|my_center|LOCUS_42900 200169 201167 gene locus_tag LOCUS_42910 200169 201167 CDS product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327203.1 protein_id gnl|my_center|LOCUS_42910 201744 201352 gene locus_tag LOCUS_42920 gene apaG 201744 201352 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974342.1 protein_id gnl|my_center|LOCUS_42920 203055 201871 gene locus_tag LOCUS_42930 203055 201871 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241461.1 protein_id gnl|my_center|LOCUS_42930 203340 204449 gene locus_tag LOCUS_42940 203340 204449 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530160.1 protein_id gnl|my_center|LOCUS_42940 204636 205778 gene locus_tag LOCUS_42950 gene ugpC 204636 205778 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975931.1 protein_id gnl|my_center|LOCUS_42950 205801 207033 gene locus_tag LOCUS_42960 205801 207033 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975930.1 protein_id gnl|my_center|LOCUS_42960 207123 208067 gene locus_tag LOCUS_42970 207123 208067 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434865.1 protein_id gnl|my_center|LOCUS_42970 208060 208872 gene locus_tag LOCUS_42980 208060 208872 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975929.1 protein_id gnl|my_center|LOCUS_42980 208875 210575 gene locus_tag LOCUS_42990 208875 210575 CDS product glycoside hydrolase family 37 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173519786.1 protein_id gnl|my_center|LOCUS_42990 210590 211621 gene locus_tag LOCUS_43000 210590 211621 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975927.1 protein_id gnl|my_center|LOCUS_43000 211826 211899 gene locus_tag LOCUS_t00410 211826 211899 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 212893 212111 gene locus_tag LOCUS_43010 212893 212111 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119004.1 protein_id gnl|my_center|LOCUS_43010 213172 215229 gene locus_tag LOCUS_43020 213172 215229 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390065.1 protein_id gnl|my_center|LOCUS_43020 216243 215290 gene locus_tag LOCUS_43030 216243 215290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 217318 216254 gene locus_tag LOCUS_43040 217318 216254 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771516.1 protein_id gnl|my_center|LOCUS_43040 218301 217315 gene locus_tag LOCUS_43050 218301 217315 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112993.1 protein_id gnl|my_center|LOCUS_43050 219119 218325 gene locus_tag LOCUS_43060 219119 218325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339288.1 protein_id gnl|my_center|LOCUS_43060 219257 220534 gene locus_tag LOCUS_43070 219257 220534 CDS product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112996.1 protein_id gnl|my_center|LOCUS_43070 221514 220648 gene locus_tag LOCUS_43080 221514 220648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 221646 222647 gene locus_tag LOCUS_43090 221646 222647 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813988.1 protein_id gnl|my_center|LOCUS_43090 222748 224172 gene locus_tag LOCUS_43100 222748 224172 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063670.1 protein_id gnl|my_center|LOCUS_43100 224218 224667 gene locus_tag LOCUS_43110 224218 224667 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368480.1 protein_id gnl|my_center|LOCUS_43110 224671 226176 gene locus_tag LOCUS_43120 224671 226176 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820743.1 protein_id gnl|my_center|LOCUS_43120 226340 227215 gene locus_tag LOCUS_43130 226340 227215 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382877.1 protein_id gnl|my_center|LOCUS_43130 227229 227846 gene locus_tag LOCUS_43140 227229 227846 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338930.1 protein_id gnl|my_center|LOCUS_43140 227906 228475 gene locus_tag LOCUS_43150 227906 228475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 228690 229436 gene locus_tag LOCUS_43160 228690 229436 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975935.1 protein_id gnl|my_center|LOCUS_43160 229497 231152 gene locus_tag LOCUS_43170 229497 231152 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975934.1 protein_id gnl|my_center|LOCUS_43170 231133 231810 gene locus_tag LOCUS_43180 231133 231810 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975933.1 protein_id gnl|my_center|LOCUS_43180 231918 233939 gene locus_tag LOCUS_43190 231918 233939 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040120974.1 protein_id gnl|my_center|LOCUS_43190 236038 234104 gene locus_tag LOCUS_43200 236038 234104 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992212.1 protein_id gnl|my_center|LOCUS_43200 236156 236977 gene locus_tag LOCUS_43210 236156 236977 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327208.1 protein_id gnl|my_center|LOCUS_43210 237646 236984 gene locus_tag LOCUS_43220 237646 236984 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970929.1 protein_id gnl|my_center|LOCUS_43220 238646 237741 gene locus_tag LOCUS_43230 238646 237741 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040959293.1 protein_id gnl|my_center|LOCUS_43230 238835 239716 gene locus_tag LOCUS_43240 238835 239716 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532537.1 protein_id gnl|my_center|LOCUS_43240 239833 241329 gene locus_tag LOCUS_43250 239833 241329 CDS product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316406.1 protein_id gnl|my_center|LOCUS_43250 241326 241772 gene locus_tag LOCUS_43260 241326 241772 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566213.1 protein_id gnl|my_center|LOCUS_43260 241773 242828 gene locus_tag LOCUS_43270 241773 242828 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971982.1 protein_id gnl|my_center|LOCUS_43270 243080 242904 gene locus_tag LOCUS_43280 243080 242904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 243443 243219 gene locus_tag LOCUS_43290 243443 243219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 243765 243526 gene locus_tag LOCUS_43300 gene rpsU 243765 243526 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976084.1 protein_id gnl|my_center|LOCUS_43300 244202 243915 gene locus_tag LOCUS_43310 244202 243915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537122.1 protein_id gnl|my_center|LOCUS_43310 244527 244318 gene locus_tag LOCUS_43320 244527 244318 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537120.1 protein_id gnl|my_center|LOCUS_43320 247077 244870 gene locus_tag LOCUS_43330 247077 244870 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970942.1 protein_id gnl|my_center|LOCUS_43330 248479 247271 gene locus_tag LOCUS_43340 248479 247271 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391931.1 protein_id gnl|my_center|LOCUS_43340 248775 248536 gene locus_tag LOCUS_43350 248775 248536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 250605 248809 gene locus_tag LOCUS_43360 250605 248809 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968641.1 protein_id gnl|my_center|LOCUS_43360 251101 255009 gene locus_tag LOCUS_43370 251101 255009 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241884.1 protein_id gnl|my_center|LOCUS_43370 255480 256448 gene locus_tag LOCUS_43380 255480 256448 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313297.1 protein_id gnl|my_center|LOCUS_43380 256445 257239 gene locus_tag LOCUS_43390 256445 257239 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968644.1 protein_id gnl|my_center|LOCUS_43390 257683 257243 gene locus_tag LOCUS_43400 257683 257243 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811678.1 protein_id gnl|my_center|LOCUS_43400 258266 257760 gene locus_tag LOCUS_43410 258266 257760 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974353.1 protein_id gnl|my_center|LOCUS_43410 258551 258937 gene locus_tag LOCUS_43420 258551 258937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43420 259652 258927 gene locus_tag LOCUS_43430 gene pdeM 259652 258927 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252590.1 protein_id gnl|my_center|LOCUS_43430 262196 259671 gene locus_tag LOCUS_43440 262196 259671 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530127.1 protein_id gnl|my_center|LOCUS_43440 262887 262252 gene locus_tag LOCUS_43450 262887 262252 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252592.1 protein_id gnl|my_center|LOCUS_43450 263894 262953 gene locus_tag LOCUS_43460 263894 262953 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311101.1 protein_id gnl|my_center|LOCUS_43460 264038 264304 gene locus_tag LOCUS_43470 264038 264304 CDS product DUF6460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974369.1 protein_id gnl|my_center|LOCUS_43470 264307 264795 gene locus_tag LOCUS_43480 264307 264795 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968649.1 protein_id gnl|my_center|LOCUS_43480 265254 264895 gene locus_tag LOCUS_43490 265254 264895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 266478 265393 gene locus_tag LOCUS_43500 266478 265393 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241446.1 protein_id gnl|my_center|LOCUS_43500 266825 266478 gene locus_tag LOCUS_43510 266825 266478 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970930.1 protein_id gnl|my_center|LOCUS_43510 266935 267363 gene locus_tag LOCUS_43520 266935 267363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974374.1 protein_id gnl|my_center|LOCUS_43520 267433 268086 gene locus_tag LOCUS_43530 267433 268086 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530107.1 protein_id gnl|my_center|LOCUS_43530 271590 268090 gene locus_tag LOCUS_43540 271590 268090 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391940.1 protein_id gnl|my_center|LOCUS_43540 271776 272216 gene locus_tag LOCUS_43550 gene mscL 271776 272216 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974377.1 protein_id gnl|my_center|LOCUS_43550 273086 272265 gene locus_tag LOCUS_43560 273086 272265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 274969 273362 gene locus_tag LOCUS_43570 274969 273362 CDS product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968665.1 protein_id gnl|my_center|LOCUS_43570 276156 274966 gene locus_tag LOCUS_43580 276156 274966 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241432.1 protein_id gnl|my_center|LOCUS_43580 276826 276188 gene locus_tag LOCUS_43590 276826 276188 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391957.1 protein_id gnl|my_center|LOCUS_43590 277767 276889 gene locus_tag LOCUS_43600 277767 276889 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_43600 277980 278753 gene locus_tag LOCUS_43610 277980 278753 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013843945.1 protein_id gnl|my_center|LOCUS_43610 278781 279563 gene locus_tag LOCUS_43620 278781 279563 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968662.1 protein_id gnl|my_center|LOCUS_43620 279633 280361 gene locus_tag LOCUS_43630 279633 280361 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391953.1 protein_id gnl|my_center|LOCUS_43630 280361 281179 gene locus_tag LOCUS_43640 280361 281179 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530908.1 protein_id gnl|my_center|LOCUS_43640 281193 282362 gene locus_tag LOCUS_43650 281193 282362 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378411.1 protein_id gnl|my_center|LOCUS_43650 283110 282436 gene locus_tag LOCUS_43660 283110 282436 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975723.1 protein_id gnl|my_center|LOCUS_43660 283324 284022 gene locus_tag LOCUS_43670 gene rpiA 283324 284022 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535076.1 protein_id gnl|my_center|LOCUS_43670 284041 284580 gene locus_tag LOCUS_43680 284041 284580 CDS product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535074.1 protein_id gnl|my_center|LOCUS_43680 284782 286170 gene locus_tag LOCUS_43690 gene gor 284782 286170 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396636.1 protein_id gnl|my_center|LOCUS_43690 287050 286148 gene locus_tag LOCUS_43700 287050 286148 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018009625.1 protein_id gnl|my_center|LOCUS_43700 287197 287427 gene locus_tag LOCUS_43710 287197 287427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 287611 288984 gene locus_tag LOCUS_43720 287611 288984 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535070.1 protein_id gnl|my_center|LOCUS_43720 289107 289502 gene locus_tag LOCUS_43730 289107 289502 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240481.1 protein_id gnl|my_center|LOCUS_43730 291238 289517 gene locus_tag LOCUS_43740 291238 289517 CDS product TadG family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969516.1 protein_id gnl|my_center|LOCUS_43740 291663 291241 gene locus_tag LOCUS_43750 291663 291241 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969515.1 protein_id gnl|my_center|LOCUS_43750 292423 292677 gene locus_tag LOCUS_43760 292423 292677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 292728 292991 gene locus_tag LOCUS_43770 292728 292991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 293221 294633 gene locus_tag LOCUS_43780 293221 294633 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327240.1 protein_id gnl|my_center|LOCUS_43780 294623 295627 gene locus_tag LOCUS_43790 gene cydB 294623 295627 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968658.1 protein_id gnl|my_center|LOCUS_43790 295972 296271 gene locus_tag LOCUS_43800 295972 296271 CDS product chorismate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241439.1 protein_id gnl|my_center|LOCUS_43800 297267 296275 gene locus_tag LOCUS_43810 gene galE 297267 296275 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061907.1 protein_id gnl|my_center|LOCUS_43810 297381 297908 gene locus_tag LOCUS_43820 297381 297908 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972312.1 protein_id gnl|my_center|LOCUS_43820 299081 297915 gene locus_tag LOCUS_43830 299081 297915 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974378.1 protein_id gnl|my_center|LOCUS_43830 299303 299854 gene locus_tag LOCUS_43840 299303 299854 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992389.1 protein_id gnl|my_center|LOCUS_43840 299996 299921 gene locus_tag LOCUS_t00420 299996 299921 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 300380 300171 gene locus_tag LOCUS_43850 gene yacG 300380 300171 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241411.1 protein_id gnl|my_center|LOCUS_43850 301002 300382 gene locus_tag LOCUS_43860 301002 300382 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435951.1 protein_id gnl|my_center|LOCUS_43860 301302 301084 gene locus_tag LOCUS_43870 gene infA 301302 301084 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435948.1 protein_id gnl|my_center|LOCUS_43870 301909 301448 gene locus_tag LOCUS_43880 301909 301448 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974421.1 protein_id gnl|my_center|LOCUS_43880 302390 301914 gene locus_tag LOCUS_43890 302390 301914 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968704.1 protein_id gnl|my_center|LOCUS_43890 303692 302394 gene locus_tag LOCUS_43900 gene hisD 303692 302394 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968703.1 protein_id gnl|my_center|LOCUS_43900 304174 303737 gene locus_tag LOCUS_43910 304174 303737 CDS product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968702.1 protein_id gnl|my_center|LOCUS_43910 305626 304334 gene locus_tag LOCUS_43920 gene murA 305626 304334 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706806.1 protein_id gnl|my_center|LOCUS_43920 305995 305795 gene locus_tag LOCUS_43930 305995 305795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 306145 306219 gene locus_tag LOCUS_t00430 306145 306219 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 307253 306198 gene locus_tag LOCUS_43940 307253 306198 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096166.1 protein_id gnl|my_center|LOCUS_43940 307297 308487 gene locus_tag LOCUS_43950 307297 308487 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705349.1 protein_id gnl|my_center|LOCUS_43950 308616 309773 gene locus_tag LOCUS_43960 308616 309773 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172901056.1 protein_id gnl|my_center|LOCUS_43960 309789 310241 gene locus_tag LOCUS_43970 309789 310241 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384214.1 protein_id gnl|my_center|LOCUS_43970 310406 313867 gene locus_tag LOCUS_43980 310406 313867 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088094.1 protein_id gnl|my_center|LOCUS_43980 313948 315111 gene locus_tag LOCUS_43990 313948 315111 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243520.1 protein_id gnl|my_center|LOCUS_43990 315111 316718 gene locus_tag LOCUS_44000 315111 316718 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435556.1 protein_id gnl|my_center|LOCUS_44000 316732 317115 gene locus_tag LOCUS_44010 316732 317115 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018012062.1 protein_id gnl|my_center|LOCUS_44010 317164 319149 gene locus_tag LOCUS_44020 317164 319149 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396257.1 protein_id gnl|my_center|LOCUS_44020 319146 320021 gene locus_tag LOCUS_44030 319146 320021 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396254.1 protein_id gnl|my_center|LOCUS_44030 320133 320933 gene locus_tag LOCUS_44040 320133 320933 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243515.1 protein_id gnl|my_center|LOCUS_44040 323192 321108 gene locus_tag LOCUS_44050 gene pbpC 323192 321108 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600459.1 protein_id gnl|my_center|LOCUS_44050 328655 323205 gene locus_tag LOCUS_44060 328655 323205 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391582.1 protein_id gnl|my_center|LOCUS_44060 329165 330109 gene locus_tag LOCUS_44070 329165 330109 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400555.1 protein_id gnl|my_center|LOCUS_44070 330974 330183 gene locus_tag LOCUS_44080 330974 330183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 331126 331881 gene locus_tag LOCUS_44090 331126 331881 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398717.1 protein_id gnl|my_center|LOCUS_44090 331895 332746 gene locus_tag LOCUS_44100 331895 332746 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398718.1 protein_id gnl|my_center|LOCUS_44100 332848 333084 gene locus_tag LOCUS_44110 332848 333084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 334013 333090 gene locus_tag LOCUS_44120 gene nudC 334013 333090 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398721.1 protein_id gnl|my_center|LOCUS_44120 334471 334061 gene locus_tag LOCUS_44130 334471 334061 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067629.1 protein_id gnl|my_center|LOCUS_44130 334746 336629 gene locus_tag LOCUS_44140 334746 336629 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968441.1 protein_id gnl|my_center|LOCUS_44140 336706 337029 gene locus_tag LOCUS_44150 336706 337029 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533413.1 protein_id gnl|my_center|LOCUS_44150 337065 337676 gene locus_tag LOCUS_44160 337065 337676 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533411.1 protein_id gnl|my_center|LOCUS_44160 338291 337677 gene locus_tag LOCUS_44170 338291 337677 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309919.1 protein_id gnl|my_center|LOCUS_44170 338349 338954 gene locus_tag LOCUS_44180 gene recR 338349 338954 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533410.1 protein_id gnl|my_center|LOCUS_44180 339124 340389 gene locus_tag LOCUS_44190 339124 340389 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067634.1 protein_id gnl|my_center|LOCUS_44190 342014 340437 gene locus_tag LOCUS_44200 342014 340437 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067635.1 protein_id gnl|my_center|LOCUS_44200 342323 342934 gene locus_tag LOCUS_44210 gene rimP 342323 342934 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241712.1 protein_id gnl|my_center|LOCUS_44210 343067 344665 gene locus_tag LOCUS_44220 gene nusA 343067 344665 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241711.1 protein_id gnl|my_center|LOCUS_44220 344695 345348 gene locus_tag LOCUS_44230 344695 345348 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534364.1 protein_id gnl|my_center|LOCUS_44230 345450 348098 gene locus_tag LOCUS_44240 gene infB 345450 348098 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037436934.1 protein_id gnl|my_center|LOCUS_44240 348207 348581 gene locus_tag LOCUS_44250 gene rbfA 348207 348581 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330664.1 protein_id gnl|my_center|LOCUS_44250 348594 349529 gene locus_tag LOCUS_44260 gene truB 348594 349529 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534367.1 protein_id gnl|my_center|LOCUS_44260 349755 351407 gene locus_tag LOCUS_44270 349755 351407 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202402528.1 protein_id gnl|my_center|LOCUS_44270 351481 351780 gene locus_tag LOCUS_44280 351481 351780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 351923 352192 gene locus_tag LOCUS_44290 gene rpsO 351923 352192 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309908.1 protein_id gnl|my_center|LOCUS_44290 352602 354746 gene locus_tag LOCUS_44300 gene pnp 352602 354746 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970644.1 protein_id gnl|my_center|LOCUS_44300 354832 355848 gene locus_tag LOCUS_44310 354832 355848 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067645.1 protein_id gnl|my_center|LOCUS_44310 356310 355852 gene locus_tag LOCUS_44320 356310 355852 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530158.1 protein_id gnl|my_center|LOCUS_44320 356441 357043 gene locus_tag LOCUS_44330 356441 357043 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113093.1 protein_id gnl|my_center|LOCUS_44330 357161 357358 gene locus_tag LOCUS_44340 357161 357358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 358308 357514 gene locus_tag LOCUS_44350 gene fabI 358308 357514 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067646.1 protein_id gnl|my_center|LOCUS_44350 359549 358326 gene locus_tag LOCUS_44360 gene fabB 359549 358326 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970685.1 protein_id gnl|my_center|LOCUS_44360 360143 359628 gene locus_tag LOCUS_44370 gene fabA 360143 359628 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309974.1 protein_id gnl|my_center|LOCUS_44370 360476 360877 gene locus_tag LOCUS_44380 360476 360877 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037377824.1 protein_id gnl|my_center|LOCUS_44380 361527 360892 gene locus_tag LOCUS_44390 361527 360892 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330674.1 protein_id gnl|my_center|LOCUS_44390 361666 362139 gene locus_tag LOCUS_44400 361666 362139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972625.1 protein_id gnl|my_center|LOCUS_44400 362934 362143 gene locus_tag LOCUS_44410 362934 362143 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330675.1 protein_id gnl|my_center|LOCUS_44410 364141 362972 gene locus_tag LOCUS_44420 364141 362972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 364255 364581 gene locus_tag LOCUS_44430 364255 364581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 364917 364594 gene locus_tag LOCUS_44440 364917 364594 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720517.1 protein_id gnl|my_center|LOCUS_44440 365317 364937 gene locus_tag LOCUS_44450 365317 364937 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531125.1 protein_id gnl|my_center|LOCUS_44450 365946 365314 gene locus_tag LOCUS_44460 365946 365314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 367026 366016 gene locus_tag LOCUS_44470 367026 366016 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531126.1 protein_id gnl|my_center|LOCUS_44470 368416 367049 gene locus_tag LOCUS_44480 368416 367049 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_44480 369627 368413 gene locus_tag LOCUS_44490 369627 368413 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_44490 370487 369633 gene locus_tag LOCUS_44500 370487 369633 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 protein_id gnl|my_center|LOCUS_44500 371292 370468 gene locus_tag LOCUS_44510 371292 370468 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384594.1 protein_id gnl|my_center|LOCUS_44510 372094 371294 gene locus_tag LOCUS_44520 372094 371294 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 protein_id gnl|my_center|LOCUS_44520 372312 373274 gene locus_tag LOCUS_44530 372312 373274 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339246.1 protein_id gnl|my_center|LOCUS_44530 373336 374538 gene locus_tag LOCUS_44540 373336 374538 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338577.1 protein_id gnl|my_center|LOCUS_44540 375596 374679 gene locus_tag LOCUS_44550 375596 374679 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_44550 377685 375613 gene locus_tag LOCUS_44560 377685 375613 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 protein_id gnl|my_center|LOCUS_44560 378749 377682 gene locus_tag LOCUS_44570 378749 377682 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 protein_id gnl|my_center|LOCUS_44570 379716 378775 gene locus_tag LOCUS_44580 379716 378775 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 protein_id gnl|my_center|LOCUS_44580 379869 380471 gene locus_tag LOCUS_44590 379869 380471 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028020.1 protein_id gnl|my_center|LOCUS_44590 380613 380538 gene locus_tag LOCUS_t00440 380613 380538 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 381149 380760 gene locus_tag LOCUS_44600 381149 380760 CDS product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534381.1 protein_id gnl|my_center|LOCUS_44600 381517 381308 gene locus_tag LOCUS_44610 381517 381308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 381411 382757 gene locus_tag LOCUS_44620 gene aroA 381411 382757 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968452.1 protein_id gnl|my_center|LOCUS_44620 382795 383589 gene locus_tag LOCUS_44630 382795 383589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 383586 384218 gene locus_tag LOCUS_44640 gene cmk 383586 384218 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255020.1 protein_id gnl|my_center|LOCUS_44640 384360 386066 gene locus_tag LOCUS_44650 gene rpsA 384360 386066 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067656.1 protein_id gnl|my_center|LOCUS_44650 387691 386135 gene locus_tag LOCUS_44660 387691 386135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 388099 389481 gene locus_tag LOCUS_44670 388099 389481 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038543.1 protein_id gnl|my_center|LOCUS_44670 389540 389875 gene locus_tag LOCUS_44680 389540 389875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067658.1 protein_id gnl|my_center|LOCUS_44680 391128 389878 gene locus_tag LOCUS_44690 391128 389878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973568.1 protein_id gnl|my_center|LOCUS_44690 391410 391180 gene locus_tag LOCUS_44700 391410 391180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44700 392052 391411 gene locus_tag LOCUS_44710 392052 391411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44710 392698 392060 gene locus_tag LOCUS_44720 392698 392060 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398756.1 protein_id gnl|my_center|LOCUS_44720 392797 393075 gene locus_tag LOCUS_44730 392797 393075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 393129 394160 gene locus_tag LOCUS_44740 393129 394160 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398750.1 protein_id gnl|my_center|LOCUS_44740 394470 394216 gene locus_tag LOCUS_44750 394470 394216 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014761069.1 protein_id gnl|my_center|LOCUS_44750 395855 394566 gene locus_tag LOCUS_44760 gene rhaI 395855 394566 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327306.1 protein_id gnl|my_center|LOCUS_44760 397959 395866 gene locus_tag LOCUS_44770 397959 395866 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327307.1 protein_id gnl|my_center|LOCUS_44770 398160 398972 gene locus_tag LOCUS_44780 398160 398972 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378547.1 protein_id gnl|my_center|LOCUS_44780 399003 399992 gene locus_tag LOCUS_44790 gene rhaS 399003 399992 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004436001.1 protein_id gnl|my_center|LOCUS_44790 400185 401708 gene locus_tag LOCUS_44800 400185 401708 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968715.1 protein_id gnl|my_center|LOCUS_44800 401708 402691 gene locus_tag LOCUS_44810 401708 402691 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241393.1 protein_id gnl|my_center|LOCUS_44810 402684 403682 gene locus_tag LOCUS_44820 402684 403682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968717.1 protein_id gnl|my_center|LOCUS_44820 403686 404000 gene locus_tag LOCUS_44830 gene rhaM 403686 404000 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391995.1 protein_id gnl|my_center|LOCUS_44830 404005 405366 gene locus_tag LOCUS_44840 404005 405366 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974440.1 protein_id gnl|my_center|LOCUS_44840 406066 405851 gene locus_tag LOCUS_44850 406066 405851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 405947 407482 gene locus_tag LOCUS_44860 405947 407482 CDS product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529954.1 protein_id gnl|my_center|LOCUS_44860 407624 407923 gene locus_tag LOCUS_44870 407624 407923 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706835.1 protein_id gnl|my_center|LOCUS_44870 407920 408285 gene locus_tag LOCUS_44880 gene cheY1 407920 408285 CDS product chemotaxis response regulator CheY1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493773.1 protein_id gnl|my_center|LOCUS_44880 408311 410581 gene locus_tag LOCUS_44890 408311 410581 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529948.1 protein_id gnl|my_center|LOCUS_44890 410588 411055 gene locus_tag LOCUS_44900 410588 411055 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327318.1 protein_id gnl|my_center|LOCUS_44900 411052 411957 gene locus_tag LOCUS_44910 gene cheR 411052 411957 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529944.1 protein_id gnl|my_center|LOCUS_44910 411954 413012 gene locus_tag LOCUS_44920 gene cheB 411954 413012 CDS product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970952.1 protein_id gnl|my_center|LOCUS_44920 413012 413401 gene locus_tag LOCUS_44930 413012 413401 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706841.1 protein_id gnl|my_center|LOCUS_44930 413398 413952 gene locus_tag LOCUS_44940 gene cheD 413398 413952 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392015.1 protein_id gnl|my_center|LOCUS_44940 414051 414440 gene locus_tag LOCUS_44950 414051 414440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392016.1 protein_id gnl|my_center|LOCUS_44950 414714 416399 gene locus_tag LOCUS_44960 gene fliF 414714 416399 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312927.1 protein_id gnl|my_center|LOCUS_44960 416930 417709 gene locus_tag LOCUS_44970 416930 417709 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968723.1 protein_id gnl|my_center|LOCUS_44970 417896 418639 gene locus_tag LOCUS_44980 417896 418639 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529926.1 protein_id gnl|my_center|LOCUS_44980 419232 418789 gene locus_tag LOCUS_44990 419232 418789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968724.1 protein_id gnl|my_center|LOCUS_44990 420371 419238 gene locus_tag LOCUS_45000 gene flhB 420371 419238 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974456.1 protein_id gnl|my_center|LOCUS_45000 421469 420429 gene locus_tag LOCUS_45010 gene fliG 421469 420429 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327328.1 protein_id gnl|my_center|LOCUS_45010 422077 421499 gene locus_tag LOCUS_45020 gene fliN 422077 421499 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844029.1 protein_id gnl|my_center|LOCUS_45020 423087 422140 gene locus_tag LOCUS_45030 423087 422140 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968727.1 protein_id gnl|my_center|LOCUS_45030 423963 423091 gene locus_tag LOCUS_45040 gene motA 423963 423091 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529914.1 protein_id gnl|my_center|LOCUS_45040 424136 424915 gene locus_tag LOCUS_45050 424136 424915 CDS product DUF1217 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327332.1 protein_id gnl|my_center|LOCUS_45050 424917 425642 gene locus_tag LOCUS_45060 gene flgF 424917 425642 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968729.1 protein_id gnl|my_center|LOCUS_45060 425649 427055 gene locus_tag LOCUS_45070 gene fliI 425649 427055 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327334.1 protein_id gnl|my_center|LOCUS_45070 427052 427618 gene locus_tag LOCUS_45080 427052 427618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529906.1 protein_id gnl|my_center|LOCUS_45080 427934 428317 gene locus_tag LOCUS_45090 gene flgB 427934 428317 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529904.1 protein_id gnl|my_center|LOCUS_45090 428321 428740 gene locus_tag LOCUS_45100 gene flgC 428321 428740 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529902.1 protein_id gnl|my_center|LOCUS_45100 428737 429075 gene locus_tag LOCUS_45110 428737 429075 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313017.1 protein_id gnl|my_center|LOCUS_45110 429085 429867 gene locus_tag LOCUS_45120 gene flgG 429085 429867 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974468.1 protein_id gnl|my_center|LOCUS_45120 430010 430396 gene locus_tag LOCUS_45130 430010 430396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 430396 431508 gene locus_tag LOCUS_45140 430396 431508 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392028.1 protein_id gnl|my_center|LOCUS_45140 431505 432053 gene locus_tag LOCUS_45150 431505 432053 CDS product MotE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968733.1 protein_id gnl|my_center|LOCUS_45150 432050 432760 gene locus_tag LOCUS_45160 gene flgH 432050 432760 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974472.1 protein_id gnl|my_center|LOCUS_45160 432790 433293 gene locus_tag LOCUS_45170 432790 433293 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974473.1 protein_id gnl|my_center|LOCUS_45170 433290 434036 gene locus_tag LOCUS_45180 gene fliP 433290 434036 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241360.1 protein_id gnl|my_center|LOCUS_45180 434429 435616 gene locus_tag LOCUS_45190 434429 435616 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974477.1 protein_id gnl|my_center|LOCUS_45190 435946 437142 gene locus_tag LOCUS_45200 435946 437142 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968737.1 protein_id gnl|my_center|LOCUS_45200 438378 437221 gene locus_tag LOCUS_45210 gene glf 438378 437221 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973473.1 protein_id gnl|my_center|LOCUS_45210 439683 438391 gene locus_tag LOCUS_45220 439683 438391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327299.1 protein_id gnl|my_center|LOCUS_45220 441779 439731 gene locus_tag LOCUS_45230 441779 439731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327298.1 protein_id gnl|my_center|LOCUS_45230 446058 441979 gene locus_tag LOCUS_45240 446058 441979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241405.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45240 446831 448015 gene locus_tag LOCUS_45250 446831 448015 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974477.1 protein_id gnl|my_center|LOCUS_45250 448328 448981 gene locus_tag LOCUS_45260 448328 448981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395309.1 protein_id gnl|my_center|LOCUS_45260 448978 450201 gene locus_tag LOCUS_45270 448978 450201 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974481.1 protein_id gnl|my_center|LOCUS_45270 450206 451519 gene locus_tag LOCUS_45280 gene motC 450206 451519 CDS product chemotaxis protein MotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974482.1 protein_id gnl|my_center|LOCUS_45280 451516 452937 gene locus_tag LOCUS_45290 451516 452937 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968743.1 protein_id gnl|my_center|LOCUS_45290 452861 453439 gene locus_tag LOCUS_45300 452861 453439 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018009722.1 protein_id gnl|my_center|LOCUS_45300 453721 454395 gene locus_tag LOCUS_45310 453721 454395 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395294.1 protein_id gnl|my_center|LOCUS_45310 454507 455706 gene locus_tag LOCUS_45320 454507 455706 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974486.1 protein_id gnl|my_center|LOCUS_45320 455751 457163 gene locus_tag LOCUS_45330 gene flgK 455751 457163 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974487.1 protein_id gnl|my_center|LOCUS_45330 457167 458234 gene locus_tag LOCUS_45340 457167 458234 CDS product flagellar hook-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241348.1 protein_id gnl|my_center|LOCUS_45340 458273 458626 gene locus_tag LOCUS_45350 gene flaF 458273 458626 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529863.1 protein_id gnl|my_center|LOCUS_45350 458623 459069 gene locus_tag LOCUS_45360 gene flbT 458623 459069 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706881.1 protein_id gnl|my_center|LOCUS_45360 459063 459509 gene locus_tag LOCUS_45370 gene flgD 459063 459509 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974491.1 protein_id gnl|my_center|LOCUS_45370 459506 459772 gene locus_tag LOCUS_45380 gene fliQ 459506 459772 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706883.1 protein_id gnl|my_center|LOCUS_45380 460058 462145 gene locus_tag LOCUS_45390 gene flhA 460058 462145 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968749.1 protein_id gnl|my_center|LOCUS_45390 462142 462894 gene locus_tag LOCUS_45400 gene fliR 462142 462894 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974493.1 protein_id gnl|my_center|LOCUS_45400 462897 463295 gene locus_tag LOCUS_45410 462897 463295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529852.1 protein_id gnl|my_center|LOCUS_45410 463575 464132 gene locus_tag LOCUS_45420 463575 464132 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968751.1 protein_id gnl|my_center|LOCUS_45420 464148 464516 gene locus_tag LOCUS_45430 464148 464516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529850.1 protein_id gnl|my_center|LOCUS_45430 464513 465043 gene locus_tag LOCUS_45440 464513 465043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968752.1 protein_id gnl|my_center|LOCUS_45440 465980 465177 gene locus_tag LOCUS_45450 465980 465177 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920693.1 protein_id gnl|my_center|LOCUS_45450 466507 467406 gene locus_tag LOCUS_45460 gene folD 466507 467406 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706891.1 protein_id gnl|my_center|LOCUS_45460 468732 467620 gene locus_tag LOCUS_45470 468732 467620 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968755.1 protein_id gnl|my_center|LOCUS_45470 468938 470317 gene locus_tag LOCUS_45480 468938 470317 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241336.1 protein_id gnl|my_center|LOCUS_45480 470505 471515 gene locus_tag LOCUS_45490 470505 471515 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395265.1 protein_id gnl|my_center|LOCUS_45490 471517 472662 gene locus_tag LOCUS_45500 471517 472662 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327372.1 protein_id gnl|my_center|LOCUS_45500 472689 474341 gene locus_tag LOCUS_45510 472689 474341 CDS product alpha glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027987980.1 protein_id gnl|my_center|LOCUS_45510 474363 475454 gene locus_tag LOCUS_45520 gene ugpC 474363 475454 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529832.1 protein_id gnl|my_center|LOCUS_45520 475561 475974 gene locus_tag LOCUS_45530 475561 475974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395319.1 protein_id gnl|my_center|LOCUS_45530 477986 476166 gene locus_tag LOCUS_45540 gene edd 477986 476166 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327377.1 protein_id gnl|my_center|LOCUS_45540 478808 478110 gene locus_tag LOCUS_45550 gene pgl 478808 478110 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527053.1 protein_id gnl|my_center|LOCUS_45550 480290 478818 gene locus_tag LOCUS_45560 gene zwf 480290 478818 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327380.1 protein_id gnl|my_center|LOCUS_45560 481670 480387 gene locus_tag LOCUS_45570 481670 480387 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327381.1 protein_id gnl|my_center|LOCUS_45570 483129 481768 gene locus_tag LOCUS_45580 483129 481768 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327382.1 protein_id gnl|my_center|LOCUS_45580 483377 484558 gene locus_tag LOCUS_45590 483377 484558 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968760.1 protein_id gnl|my_center|LOCUS_45590 484659 484856 gene locus_tag LOCUS_45600 484659 484856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 485094 487616 gene locus_tag LOCUS_45610 485094 487616 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327385.1 protein_id gnl|my_center|LOCUS_45610 487699 488313 gene locus_tag LOCUS_45620 487699 488313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 488338 488724 gene locus_tag LOCUS_45630 488338 488724 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067700.1 protein_id gnl|my_center|LOCUS_45630 489037 488798 gene locus_tag LOCUS_45640 489037 488798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706908.1 protein_id gnl|my_center|LOCUS_45640 490429 489140 gene locus_tag LOCUS_45650 gene aceA 490429 489140 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527089.1 protein_id gnl|my_center|LOCUS_45650 490649 492064 gene locus_tag LOCUS_45660 490649 492064 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395254.1 protein_id gnl|my_center|LOCUS_45660 492249 493343 gene locus_tag LOCUS_45670 492249 493343 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530248.1 protein_id gnl|my_center|LOCUS_45670 493423 494565 gene locus_tag LOCUS_45680 493423 494565 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974519.1 protein_id gnl|my_center|LOCUS_45680 494570 495481 gene locus_tag LOCUS_45690 494570 495481 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395250.1 protein_id gnl|my_center|LOCUS_45690 495486 496304 gene locus_tag LOCUS_45700 495486 496304 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527099.1 protein_id gnl|my_center|LOCUS_45700 498158 496320 gene locus_tag LOCUS_45710 498158 496320 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974522.1 protein_id gnl|my_center|LOCUS_45710 498340 500292 gene locus_tag LOCUS_45720 498340 500292 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395243.1 protein_id gnl|my_center|LOCUS_45720 502188 500554 gene locus_tag LOCUS_45730 502188 500554 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968770.1 protein_id gnl|my_center|LOCUS_45730 506080 502400 gene locus_tag LOCUS_45740 gene pdhS1 506080 502400 CDS product two-component system sensor histidine kinase PdhS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971015.1 protein_id gnl|my_center|LOCUS_45740 506322 506771 gene locus_tag LOCUS_45750 506322 506771 CDS product phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327400.1 protein_id gnl|my_center|LOCUS_45750 506916 506992 gene locus_tag LOCUS_t00450 506916 506992 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 507126 507701 gene locus_tag LOCUS_45760 507126 507701 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208184.1 protein_id gnl|my_center|LOCUS_45760 507698 508627 gene locus_tag LOCUS_45770 507698 508627 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183422.1 protein_id gnl|my_center|LOCUS_45770 508784 511045 gene locus_tag LOCUS_45780 gene bcsA 508784 511045 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970094.1 protein_id gnl|my_center|LOCUS_45780 511038 513383 gene locus_tag LOCUS_45790 511038 513383 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876943.1 protein_id gnl|my_center|LOCUS_45790 513380 515332 gene locus_tag LOCUS_45800 513380 515332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970097.1 protein_id gnl|my_center|LOCUS_45800 515340 516290 gene locus_tag LOCUS_45810 gene bcsN 515340 516290 CDS product cellulose biosynthesis protein BcsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970093.1 protein_id gnl|my_center|LOCUS_45810 517202 516294 gene locus_tag LOCUS_45820 517202 516294 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327401.1 protein_id gnl|my_center|LOCUS_45820 517281 518777 gene locus_tag LOCUS_45830 517281 518777 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968775.1 protein_id gnl|my_center|LOCUS_45830 518921 520012 gene locus_tag LOCUS_45840 518921 520012 CDS product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395239.1 protein_id gnl|my_center|LOCUS_45840 520002 521078 gene locus_tag LOCUS_45850 520002 521078 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968777.1 protein_id gnl|my_center|LOCUS_45850 522179 521136 gene locus_tag LOCUS_45860 522179 521136 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252071.1 protein_id gnl|my_center|LOCUS_45860 522359 522820 gene locus_tag LOCUS_45870 gene rirA 522359 522820 CDS product iron-responsive transcriptional regulator RirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527122.1 protein_id gnl|my_center|LOCUS_45870 523246 522839 gene locus_tag LOCUS_45880 523246 522839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 524091 523372 gene locus_tag LOCUS_45890 524091 523372 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314645.1 protein_id gnl|my_center|LOCUS_45890 524580 526175 gene locus_tag LOCUS_45900 524580 526175 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395213.1 protein_id gnl|my_center|LOCUS_45900 526278 527282 gene locus_tag LOCUS_45910 526278 527282 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527127.1 protein_id gnl|my_center|LOCUS_45910 527293 528201 gene locus_tag LOCUS_45920 527293 528201 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378916.1 protein_id gnl|my_center|LOCUS_45920 528201 529055 gene locus_tag LOCUS_45930 528201 529055 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527131.1 protein_id gnl|my_center|LOCUS_45930 529052 529882 gene locus_tag LOCUS_45940 529052 529882 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327411.1 protein_id gnl|my_center|LOCUS_45940 529896 530411 gene locus_tag LOCUS_45950 529896 530411 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991909.1 protein_id gnl|my_center|LOCUS_45950 530543 530887 gene locus_tag LOCUS_45960 530543 530887 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180940249.1 protein_id gnl|my_center|LOCUS_45960 531918 531118 gene locus_tag LOCUS_45970 531918 531118 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395198.1 protein_id gnl|my_center|LOCUS_45970 532044 532265 gene locus_tag LOCUS_45980 532044 532265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 532605 532345 gene locus_tag LOCUS_45990 532605 532345 CDS product glycine zipper domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527142.1 protein_id gnl|my_center|LOCUS_45990 532789 532634 gene locus_tag LOCUS_46000 532789 532634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 532967 533302 gene locus_tag LOCUS_46010 532967 533302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 533384 533581 gene locus_tag LOCUS_46020 533384 533581 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061019.1 protein_id gnl|my_center|LOCUS_46020 533831 533995 gene locus_tag LOCUS_46030 533831 533995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 534126 534626 gene locus_tag LOCUS_46040 534126 534626 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314646.1 protein_id gnl|my_center|LOCUS_46040 >Feature sequence31 1002 241 gene locus_tag LOCUS_46050 1002 241 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973948.1 protein_id gnl|my_center|LOCUS_46050 2129 1107 gene locus_tag LOCUS_46060 2129 1107 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529235.1 protein_id gnl|my_center|LOCUS_46060 2826 2173 gene locus_tag LOCUS_46070 2826 2173 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227935.1 protein_id gnl|my_center|LOCUS_46070 3580 2831 gene locus_tag LOCUS_46080 3580 2831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537473.1 protein_id gnl|my_center|LOCUS_46080 4542 3577 gene locus_tag LOCUS_46090 4542 3577 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088974.1 protein_id gnl|my_center|LOCUS_46090 5435 4539 gene locus_tag LOCUS_46100 5435 4539 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085968.1 protein_id gnl|my_center|LOCUS_46100 6785 5496 gene locus_tag LOCUS_46110 6785 5496 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085967.1 protein_id gnl|my_center|LOCUS_46110 7270 8796 gene locus_tag LOCUS_46120 7270 8796 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039291.1 protein_id gnl|my_center|LOCUS_46120 8789 9292 gene locus_tag LOCUS_46130 8789 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 9456 10682 gene locus_tag LOCUS_46140 gene accC 9456 10682 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064215.1 protein_id gnl|my_center|LOCUS_46140 11110 10616 gene locus_tag LOCUS_46150 11110 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 11051 11344 gene locus_tag LOCUS_46160 11051 11344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46160 11517 11912 gene locus_tag LOCUS_46170 11517 11912 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242238.1 protein_id gnl|my_center|LOCUS_46170 14225 12468 gene locus_tag LOCUS_46180 14225 12468 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807539.1 protein_id gnl|my_center|LOCUS_46180 15058 14228 gene locus_tag LOCUS_46190 15058 14228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159350744.1 protein_id gnl|my_center|LOCUS_46190 16392 15055 gene locus_tag LOCUS_46200 16392 15055 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810594.1 protein_id gnl|my_center|LOCUS_46200 18205 16394 gene locus_tag LOCUS_46210 18205 16394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372670.1 protein_id gnl|my_center|LOCUS_46210 19083 18208 gene locus_tag LOCUS_46220 19083 18208 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_46220 20018 19080 gene locus_tag LOCUS_46230 20018 19080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_46230 21641 20094 gene locus_tag LOCUS_46240 21641 20094 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080855420.1 protein_id gnl|my_center|LOCUS_46240 22574 21675 gene locus_tag LOCUS_46250 gene ilvE 22574 21675 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_46250 22786 23625 gene locus_tag LOCUS_46260 22786 23625 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808058.1 protein_id gnl|my_center|LOCUS_46260 24570 23941 gene locus_tag LOCUS_46270 24570 23941 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893820.1 protein_id gnl|my_center|LOCUS_46270 24709 26133 gene locus_tag LOCUS_46280 24709 26133 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385764.1 protein_id gnl|my_center|LOCUS_46280 26126 27802 gene locus_tag LOCUS_46290 26126 27802 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385777.1 protein_id gnl|my_center|LOCUS_46290 27863 28714 gene locus_tag LOCUS_46300 gene nocT 27863 28714 CDS product nopaline ABC transporter substrate-binding protein NocT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891637.1 protein_id gnl|my_center|LOCUS_46300 28784 29506 gene locus_tag LOCUS_46310 gene nocQ 28784 29506 CDS product nopaline ABC transporter permease NocQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891638.1 protein_id gnl|my_center|LOCUS_46310 29503 30225 gene locus_tag LOCUS_46320 gene nocM 29503 30225 CDS product nopaline ABC transporter permease NocM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523894.1 protein_id gnl|my_center|LOCUS_46320 30228 31001 gene locus_tag LOCUS_46330 30228 31001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133012.1 protein_id gnl|my_center|LOCUS_46330 31036 31878 gene locus_tag LOCUS_46340 gene nocT 31036 31878 CDS product nopaline ABC transporter substrate-binding protein NocT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891637.1 protein_id gnl|my_center|LOCUS_46340 33026 31965 gene locus_tag LOCUS_46350 33026 31965 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969672.1 protein_id gnl|my_center|LOCUS_46350 34088 33099 gene locus_tag LOCUS_46360 34088 33099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 34302 35504 gene locus_tag LOCUS_46370 34302 35504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 35632 36495 gene locus_tag LOCUS_46380 35632 36495 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_46380 36563 37063 gene locus_tag LOCUS_46390 36563 37063 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_46390 37060 39477 gene locus_tag LOCUS_46400 37060 39477 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_46400 39670 40548 gene locus_tag LOCUS_46410 39670 40548 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_46410 40545 41729 gene locus_tag LOCUS_46420 40545 41729 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967595.1 protein_id gnl|my_center|LOCUS_46420 41741 42571 gene locus_tag LOCUS_46430 41741 42571 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_46430 42585 43049 gene locus_tag LOCUS_46440 42585 43049 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528005.1 protein_id gnl|my_center|LOCUS_46440 44503 43445 gene locus_tag LOCUS_46450 44503 43445 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085467.1 protein_id gnl|my_center|LOCUS_46450 45394 44513 gene locus_tag LOCUS_46460 45394 44513 CDS product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533090.1 protein_id gnl|my_center|LOCUS_46460 45520 45825 gene locus_tag LOCUS_46470 45520 45825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 46034 45780 gene locus_tag LOCUS_46480 46034 45780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 46843 46082 gene locus_tag LOCUS_46490 46843 46082 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338633.1 protein_id gnl|my_center|LOCUS_46490 47313 46840 gene locus_tag LOCUS_46500 gene aroQ 47313 46840 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390186.1 protein_id gnl|my_center|LOCUS_46500 48176 47310 gene locus_tag LOCUS_46510 48176 47310 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743852.1 protein_id gnl|my_center|LOCUS_46510 48894 48238 gene locus_tag LOCUS_46520 48894 48238 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966152.1 protein_id gnl|my_center|LOCUS_46520 49743 48976 gene locus_tag LOCUS_46530 49743 48976 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007537433.1 protein_id gnl|my_center|LOCUS_46530 50138 51181 gene locus_tag LOCUS_46540 50138 51181 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976169.1 protein_id gnl|my_center|LOCUS_46540 51243 52025 gene locus_tag LOCUS_46550 51243 52025 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815603.1 protein_id gnl|my_center|LOCUS_46550 52808 52035 gene locus_tag LOCUS_46560 52808 52035 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976215.1 protein_id gnl|my_center|LOCUS_46560 52916 53722 gene locus_tag LOCUS_46570 52916 53722 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086437.1 protein_id gnl|my_center|LOCUS_46570 54561 53743 gene locus_tag LOCUS_46580 54561 53743 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973497.1 protein_id gnl|my_center|LOCUS_46580 55620 54670 gene locus_tag LOCUS_46590 55620 54670 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089136.1 protein_id gnl|my_center|LOCUS_46590 56563 55664 gene locus_tag LOCUS_46600 56563 55664 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814134.1 protein_id gnl|my_center|LOCUS_46600 57540 56695 gene locus_tag LOCUS_46610 57540 56695 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965663.1 protein_id gnl|my_center|LOCUS_46610 58261 57602 gene locus_tag LOCUS_46620 58261 57602 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967040.1 protein_id gnl|my_center|LOCUS_46620 58935 58267 gene locus_tag LOCUS_46630 58935 58267 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089138.1 protein_id gnl|my_center|LOCUS_46630 60128 58932 gene locus_tag LOCUS_46640 60128 58932 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338817.1 protein_id gnl|my_center|LOCUS_46640 61171 60170 gene locus_tag LOCUS_46650 gene iolG 61171 60170 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973498.1 protein_id gnl|my_center|LOCUS_46650 62191 61325 gene locus_tag LOCUS_46660 62191 61325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 63116 62226 gene locus_tag LOCUS_46670 63116 62226 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847985.1 protein_id gnl|my_center|LOCUS_46670 63647 63480 gene locus_tag LOCUS_46680 63647 63480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 65577 64357 gene locus_tag LOCUS_46690 65577 64357 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 protein_id gnl|my_center|LOCUS_46690 66738 65650 gene locus_tag LOCUS_46700 66738 65650 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198096.1 protein_id gnl|my_center|LOCUS_46700 68401 66731 gene locus_tag LOCUS_46710 68401 66731 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205449.1 protein_id gnl|my_center|LOCUS_46710 69665 68574 gene locus_tag LOCUS_46720 69665 68574 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198094.1 protein_id gnl|my_center|LOCUS_46720 70096 71217 gene locus_tag LOCUS_46730 70096 71217 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926593.1 protein_id gnl|my_center|LOCUS_46730 71260 72429 gene locus_tag LOCUS_46740 71260 72429 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_46740 72463 73455 gene locus_tag LOCUS_46750 72463 73455 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368483.1 protein_id gnl|my_center|LOCUS_46750 73502 74464 gene locus_tag LOCUS_46760 73502 74464 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931679.1 protein_id gnl|my_center|LOCUS_46760 75382 74480 gene locus_tag LOCUS_46770 75382 74480 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808790.1 protein_id gnl|my_center|LOCUS_46770 76760 75513 gene locus_tag LOCUS_46780 76760 75513 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_46780 78530 76788 gene locus_tag LOCUS_46790 78530 76788 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030534.1 protein_id gnl|my_center|LOCUS_46790 79826 78702 gene locus_tag LOCUS_46800 79826 78702 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198094.1 protein_id gnl|my_center|LOCUS_46800 80976 79858 gene locus_tag LOCUS_46810 80976 79858 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030533.1 protein_id gnl|my_center|LOCUS_46810 81965 81045 gene locus_tag LOCUS_46820 81965 81045 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533411.1 protein_id gnl|my_center|LOCUS_46820 82846 81962 gene locus_tag LOCUS_46830 82846 81962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 84981 83716 gene locus_tag LOCUS_46840 gene tet(V) 84981 83716 CDS product tetracycline efflux MFS transporter Tet(V) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896589.1 protein_id gnl|my_center|LOCUS_46840 86497 84986 gene locus_tag LOCUS_46850 gene aspA 86497 84986 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460903.1 protein_id gnl|my_center|LOCUS_46850 87905 86505 gene locus_tag LOCUS_46860 87905 86505 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383992.1 protein_id gnl|my_center|LOCUS_46860 89163 87949 gene locus_tag LOCUS_46870 89163 87949 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532426.1 protein_id gnl|my_center|LOCUS_46870 89277 90152 gene locus_tag LOCUS_46880 89277 90152 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808684.1 protein_id gnl|my_center|LOCUS_46880 90959 90183 gene locus_tag LOCUS_46890 90959 90183 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 protein_id gnl|my_center|LOCUS_46890 91875 90964 gene locus_tag LOCUS_46900 91875 90964 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776692.1 protein_id gnl|my_center|LOCUS_46900 92776 91880 gene locus_tag LOCUS_46910 92776 91880 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025221252.1 protein_id gnl|my_center|LOCUS_46910 93338 93649 gene locus_tag LOCUS_46920 93338 93649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 93690 94367 gene locus_tag LOCUS_46930 93690 94367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 94373 95905 gene locus_tag LOCUS_46940 94373 95905 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034857493.1 protein_id gnl|my_center|LOCUS_46940 95909 96883 gene locus_tag LOCUS_46950 95909 96883 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037471335.1 protein_id gnl|my_center|LOCUS_46950 96870 97658 gene locus_tag LOCUS_46960 96870 97658 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967867.1 protein_id gnl|my_center|LOCUS_46960 97843 97670 gene locus_tag LOCUS_46970 97843 97670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 98440 98192 gene locus_tag LOCUS_46980 98440 98192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 99037 98741 gene locus_tag LOCUS_46990 99037 98741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 99501 99232 gene locus_tag LOCUS_47000 99501 99232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 100661 99738 gene locus_tag LOCUS_47010 100661 99738 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819539.1 protein_id gnl|my_center|LOCUS_47010 100760 101662 gene locus_tag LOCUS_47020 100760 101662 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530541.1 protein_id gnl|my_center|LOCUS_47020 102787 101867 gene locus_tag LOCUS_47030 102787 101867 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464546.1 protein_id gnl|my_center|LOCUS_47030 103556 102840 gene locus_tag LOCUS_47040 103556 102840 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072642918.1 protein_id gnl|my_center|LOCUS_47040 104365 103769 gene locus_tag LOCUS_47050 104365 103769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974545.1 protein_id gnl|my_center|LOCUS_47050 104705 104388 gene locus_tag LOCUS_47060 104705 104388 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183828984.1 protein_id gnl|my_center|LOCUS_47060 105576 104833 gene locus_tag LOCUS_47070 105576 104833 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968220.1 protein_id gnl|my_center|LOCUS_47070 105705 105959 gene locus_tag LOCUS_47080 105705 105959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 105963 107000 gene locus_tag LOCUS_47090 gene coxB 105963 107000 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921746.1 protein_id gnl|my_center|LOCUS_47090 106997 109516 gene locus_tag LOCUS_47100 gene ctaD 106997 109516 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119895.1 protein_id gnl|my_center|LOCUS_47100 109520 109900 gene locus_tag LOCUS_47110 109520 109900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338005.1 protein_id gnl|my_center|LOCUS_47110 109897 110526 gene locus_tag LOCUS_47120 109897 110526 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119893.1 protein_id gnl|my_center|LOCUS_47120 110520 111569 gene locus_tag LOCUS_47130 110520 111569 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061689.1 protein_id gnl|my_center|LOCUS_47130 111749 111573 gene locus_tag LOCUS_47140 111749 111573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 112070 111777 gene locus_tag LOCUS_47150 112070 111777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970194.1 protein_id gnl|my_center|LOCUS_47150 112371 112141 gene locus_tag LOCUS_47160 112371 112141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 112961 112467 gene locus_tag LOCUS_47170 112961 112467 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061658.1 protein_id gnl|my_center|LOCUS_47170 113607 113095 gene locus_tag LOCUS_47180 113607 113095 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974715.1 protein_id gnl|my_center|LOCUS_47180 113747 113977 gene locus_tag LOCUS_47190 113747 113977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 114563 113970 gene locus_tag LOCUS_47200 114563 113970 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072642918.1 protein_id gnl|my_center|LOCUS_47200 115128 114880 gene locus_tag LOCUS_47210 115128 114880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 115423 115716 gene locus_tag LOCUS_47220 115423 115716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 115801 116301 gene locus_tag LOCUS_47230 115801 116301 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974537.1 protein_id gnl|my_center|LOCUS_47230 116380 116970 gene locus_tag LOCUS_47240 116380 116970 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067199.1 protein_id gnl|my_center|LOCUS_47240 118022 117057 gene locus_tag LOCUS_47250 118022 117057 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967099.1 protein_id gnl|my_center|LOCUS_47250 118782 118033 gene locus_tag LOCUS_47260 118782 118033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 119056 118793 gene locus_tag LOCUS_47270 119056 118793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254770.1 protein_id gnl|my_center|LOCUS_47270 119225 120763 gene locus_tag LOCUS_47280 119225 120763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 121318 120776 gene locus_tag LOCUS_47290 121318 120776 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253434.1 protein_id gnl|my_center|LOCUS_47290 122040 121333 gene locus_tag LOCUS_47300 122040 121333 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092734935.1 protein_id gnl|my_center|LOCUS_47300 122765 122040 gene locus_tag LOCUS_47310 122765 122040 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393113.1 protein_id gnl|my_center|LOCUS_47310 122915 123763 gene locus_tag LOCUS_47320 122915 123763 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253416.1 protein_id gnl|my_center|LOCUS_47320 123766 126315 gene locus_tag LOCUS_47330 gene ligD 123766 126315 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395526.1 protein_id gnl|my_center|LOCUS_47330 127114 126317 gene locus_tag LOCUS_47340 127114 126317 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395528.1 protein_id gnl|my_center|LOCUS_47340 127335 127114 gene locus_tag LOCUS_47350 127335 127114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 127451 128068 gene locus_tag LOCUS_47360 127451 128068 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531545.1 protein_id gnl|my_center|LOCUS_47360 128071 128367 gene locus_tag LOCUS_47370 128071 128367 CDS product DUF3175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243572.1 protein_id gnl|my_center|LOCUS_47370 128375 128890 gene locus_tag LOCUS_47380 128375 128890 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399415.1 protein_id gnl|my_center|LOCUS_47380 129327 128887 gene locus_tag LOCUS_47390 129327 128887 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170054.1 protein_id gnl|my_center|LOCUS_47390 129532 129795 gene locus_tag LOCUS_47400 129532 129795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975581.1 protein_id gnl|my_center|LOCUS_47400 130129 131505 gene locus_tag LOCUS_47410 130129 131505 CDS product M10 family metallopeptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392401.1 protein_id gnl|my_center|LOCUS_47410 131722 132057 gene locus_tag LOCUS_47420 131722 132057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536285.1 protein_id gnl|my_center|LOCUS_47420 132177 132923 gene locus_tag LOCUS_47430 132177 132923 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529221.1 protein_id gnl|my_center|LOCUS_47430 133038 132964 gene locus_tag LOCUS_t00460 133038 132964 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 133263 133559 gene locus_tag LOCUS_47440 133263 133559 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327634.1 protein_id gnl|my_center|LOCUS_47440 133556 134500 gene locus_tag LOCUS_47450 133556 134500 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327633.1 protein_id gnl|my_center|LOCUS_47450 135441 134530 gene locus_tag LOCUS_47460 135441 134530 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974753.1 protein_id gnl|my_center|LOCUS_47460 135701 136081 gene locus_tag LOCUS_47470 135701 136081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327631.1 protein_id gnl|my_center|LOCUS_47470 136294 136551 gene locus_tag LOCUS_47480 136294 136551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974751.1 protein_id gnl|my_center|LOCUS_47480 139230 136564 gene locus_tag LOCUS_47490 gene ppdK 139230 136564 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968929.1 protein_id gnl|my_center|LOCUS_47490 139529 139404 gene locus_tag LOCUS_47500 139529 139404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 143118 139654 gene locus_tag LOCUS_47510 gene smc 143118 139654 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392558.1 protein_id gnl|my_center|LOCUS_47510 144189 143359 gene locus_tag LOCUS_47520 144189 143359 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392553.1 protein_id gnl|my_center|LOCUS_47520 144906 144385 gene locus_tag LOCUS_47530 144906 144385 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974746.1 protein_id gnl|my_center|LOCUS_47530 145074 146171 gene locus_tag LOCUS_47540 gene mutY 145074 146171 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435801.1 protein_id gnl|my_center|LOCUS_47540 146261 146878 gene locus_tag LOCUS_47550 146261 146878 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974744.1 protein_id gnl|my_center|LOCUS_47550 148376 147246 gene locus_tag LOCUS_47560 148376 147246 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311935.1 protein_id gnl|my_center|LOCUS_47560 148584 148880 gene locus_tag LOCUS_47570 148584 148880 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403413.1 protein_id gnl|my_center|LOCUS_47570 148880 149221 gene locus_tag LOCUS_47580 148880 149221 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_47580 149310 150980 gene locus_tag LOCUS_47590 149310 150980 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530233.1 protein_id gnl|my_center|LOCUS_47590 151622 151275 gene locus_tag LOCUS_47600 151622 151275 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392606.1 protein_id gnl|my_center|LOCUS_47600 151948 151619 gene locus_tag LOCUS_47610 151948 151619 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392608.1 protein_id gnl|my_center|LOCUS_47610 152054 152734 gene locus_tag LOCUS_47620 152054 152734 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974742.1 protein_id gnl|my_center|LOCUS_47620 153088 153777 gene locus_tag LOCUS_47630 153088 153777 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971150.1 protein_id gnl|my_center|LOCUS_47630 154419 153871 gene locus_tag LOCUS_47640 154419 153871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968920.1 protein_id gnl|my_center|LOCUS_47640 154753 156150 gene locus_tag LOCUS_47650 gene thrC 154753 156150 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153458433.1 protein_id gnl|my_center|LOCUS_47650 156251 157549 gene locus_tag LOCUS_47660 156251 157549 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327609.1 protein_id gnl|my_center|LOCUS_47660 157652 158290 gene locus_tag LOCUS_47670 157652 158290 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088106.1 protein_id gnl|my_center|LOCUS_47670 158302 158655 gene locus_tag LOCUS_47680 158302 158655 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922408.1 protein_id gnl|my_center|LOCUS_47680 158764 158913 gene locus_tag LOCUS_47690 158764 158913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 159169 159762 gene locus_tag LOCUS_47700 159169 159762 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327608.1 protein_id gnl|my_center|LOCUS_47700 159830 162727 gene locus_tag LOCUS_47710 159830 162727 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392589.1 protein_id gnl|my_center|LOCUS_47710 163040 162732 gene locus_tag LOCUS_47720 163040 162732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 163377 163042 gene locus_tag LOCUS_47730 163377 163042 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_47730 164474 163413 gene locus_tag LOCUS_47740 164474 163413 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309834.1 protein_id gnl|my_center|LOCUS_47740 164785 164591 gene locus_tag LOCUS_47750 164785 164591 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309833.1 protein_id gnl|my_center|LOCUS_47750 165413 164883 gene locus_tag LOCUS_47760 165413 164883 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974734.1 protein_id gnl|my_center|LOCUS_47760 165294 165662 gene locus_tag LOCUS_47770 165294 165662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 165659 166447 gene locus_tag LOCUS_47780 165659 166447 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974733.1 protein_id gnl|my_center|LOCUS_47780 166562 167047 gene locus_tag LOCUS_47790 166562 167047 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241131.1 protein_id gnl|my_center|LOCUS_47790 167554 167108 gene locus_tag LOCUS_47800 gene rnhA 167554 167108 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241132.1 protein_id gnl|my_center|LOCUS_47800 168516 167551 gene locus_tag LOCUS_47810 168516 167551 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968913.1 protein_id gnl|my_center|LOCUS_47810 168846 168526 gene locus_tag LOCUS_47820 168846 168526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 169851 168850 gene locus_tag LOCUS_47830 gene ispH 169851 168850 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974729.1 protein_id gnl|my_center|LOCUS_47830 170673 169945 gene locus_tag LOCUS_47840 170673 169945 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392596.1 protein_id gnl|my_center|LOCUS_47840 171073 170690 gene locus_tag LOCUS_47850 171073 170690 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974727.1 protein_id gnl|my_center|LOCUS_47850 172257 171379 gene locus_tag LOCUS_47860 172257 171379 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968909.1 protein_id gnl|my_center|LOCUS_47860 172936 172316 gene locus_tag LOCUS_47870 172936 172316 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392602.1 protein_id gnl|my_center|LOCUS_47870 173079 172939 gene locus_tag LOCUS_47880 173079 172939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003509137.1 protein_id gnl|my_center|LOCUS_47880 174023 173079 gene locus_tag LOCUS_47890 174023 173079 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170167.1 protein_id gnl|my_center|LOCUS_47890 175965 174298 gene locus_tag LOCUS_47900 gene ctaD 175965 174298 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241142.1 protein_id gnl|my_center|LOCUS_47900 176869 175985 gene locus_tag LOCUS_47910 gene coxB 176869 175985 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327593.1 protein_id gnl|my_center|LOCUS_47910 177277 177807 gene locus_tag LOCUS_47920 177277 177807 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532333.1 protein_id gnl|my_center|LOCUS_47920 177886 179301 gene locus_tag LOCUS_47930 gene tldD 177886 179301 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392640.1 protein_id gnl|my_center|LOCUS_47930 180541 179642 gene locus_tag LOCUS_47940 180541 179642 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531980.1 protein_id gnl|my_center|LOCUS_47940 180642 180770 gene locus_tag LOCUS_47950 180642 180770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 180805 181860 gene locus_tag LOCUS_47960 180805 181860 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968901.1 protein_id gnl|my_center|LOCUS_47960 182709 182089 gene locus_tag LOCUS_47970 gene pdxH 182709 182089 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309812.1 protein_id gnl|my_center|LOCUS_47970 182754 183200 gene locus_tag LOCUS_47980 182754 183200 CDS product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971129.1 protein_id gnl|my_center|LOCUS_47980 183299 184360 gene locus_tag LOCUS_47990 183299 184360 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968903.1 protein_id gnl|my_center|LOCUS_47990 184493 185311 gene locus_tag LOCUS_48000 gene fabI 184493 185311 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532347.1 protein_id gnl|my_center|LOCUS_48000 185341 185922 gene locus_tag LOCUS_48010 185341 185922 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974715.1 protein_id gnl|my_center|LOCUS_48010 186357 186097 gene locus_tag LOCUS_48020 186357 186097 CDS product DUF1344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707100.1 protein_id gnl|my_center|LOCUS_48020 186645 190199 gene locus_tag LOCUS_48030 186645 190199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 190287 191405 gene locus_tag LOCUS_48040 gene aroC 190287 191405 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392623.1 protein_id gnl|my_center|LOCUS_48040 191415 192515 gene locus_tag LOCUS_48050 gene ribB 191415 192515 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532339.1 protein_id gnl|my_center|LOCUS_48050 192620 193528 gene locus_tag LOCUS_48060 192620 193528 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762380.1 protein_id gnl|my_center|LOCUS_48060 193539 194357 gene locus_tag LOCUS_48070 193539 194357 CDS product phthiotriol/phenolphthiotriol dimycocerosates methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414900.1 protein_id gnl|my_center|LOCUS_48070 193641 193718 gene locus_tag LOCUS_t00470 193641 193718 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 195564 194368 gene locus_tag LOCUS_48080 195564 194368 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241156.1 protein_id gnl|my_center|LOCUS_48080 195746 196426 gene locus_tag LOCUS_48090 195746 196426 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392644.1 protein_id gnl|my_center|LOCUS_48090 196420 197025 gene locus_tag LOCUS_48100 196420 197025 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974704.1 protein_id gnl|my_center|LOCUS_48100 197041 197625 gene locus_tag LOCUS_48110 197041 197625 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392649.1 protein_id gnl|my_center|LOCUS_48110 197630 199117 gene locus_tag LOCUS_48120 197630 199117 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968894.1 protein_id gnl|my_center|LOCUS_48120 199095 200270 gene locus_tag LOCUS_48130 199095 200270 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968893.1 protein_id gnl|my_center|LOCUS_48130 200281 200676 gene locus_tag LOCUS_48140 200281 200676 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085839.1 protein_id gnl|my_center|LOCUS_48140 201126 200662 gene locus_tag LOCUS_48150 201126 200662 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251758.1 protein_id gnl|my_center|LOCUS_48150 201127 202035 gene locus_tag LOCUS_48160 201127 202035 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392658.1 protein_id gnl|my_center|LOCUS_48160 202105 203031 gene locus_tag LOCUS_48170 202105 203031 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392660.1 protein_id gnl|my_center|LOCUS_48170 203034 203285 gene locus_tag LOCUS_48180 203034 203285 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535810.1 protein_id gnl|my_center|LOCUS_48180 203331 203639 gene locus_tag LOCUS_48190 203331 203639 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228510.1 protein_id gnl|my_center|LOCUS_48190 203608 203982 gene locus_tag LOCUS_48200 203608 203982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 204088 205011 gene locus_tag LOCUS_48210 204088 205011 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974696.1 protein_id gnl|my_center|LOCUS_48210 205138 205461 gene locus_tag LOCUS_48220 205138 205461 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170107.1 protein_id gnl|my_center|LOCUS_48220 205458 205856 gene locus_tag LOCUS_48230 205458 205856 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061436.1 protein_id gnl|my_center|LOCUS_48230 205892 206110 gene locus_tag LOCUS_48240 205892 206110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089491.1 protein_id gnl|my_center|LOCUS_48240 206107 206526 gene locus_tag LOCUS_48250 206107 206526 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975963.1 protein_id gnl|my_center|LOCUS_48250 206544 206957 gene locus_tag LOCUS_48260 206544 206957 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089492.1 protein_id gnl|my_center|LOCUS_48260 207218 209137 gene locus_tag LOCUS_48270 gene dxs 207218 209137 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033044606.1 protein_id gnl|my_center|LOCUS_48270 209316 209588 gene locus_tag LOCUS_48280 209316 209588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 209631 210383 gene locus_tag LOCUS_48290 209631 210383 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968888.1 protein_id gnl|my_center|LOCUS_48290 210380 211630 gene locus_tag LOCUS_48300 210380 211630 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327568.1 protein_id gnl|my_center|LOCUS_48300 212057 211635 gene locus_tag LOCUS_48310 212057 211635 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_48310 212311 212057 gene locus_tag LOCUS_48320 212311 212057 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614401.1 protein_id gnl|my_center|LOCUS_48320 214513 212420 gene locus_tag LOCUS_48330 gene mcpU 214513 212420 CDS product methyl-accepting chemotaxis protein McpU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158072.1 protein_id gnl|my_center|LOCUS_48330 215470 214715 gene locus_tag LOCUS_48340 215470 214715 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327567.1 protein_id gnl|my_center|LOCUS_48340 217512 215716 gene locus_tag LOCUS_48350 217512 215716 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392664.1 protein_id gnl|my_center|LOCUS_48350 218307 217696 gene locus_tag LOCUS_48360 218307 217696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 218526 219620 gene locus_tag LOCUS_48370 218526 219620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 220734 219631 gene locus_tag LOCUS_48380 220734 219631 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392670.1 protein_id gnl|my_center|LOCUS_48380 221980 220736 gene locus_tag LOCUS_48390 221980 220736 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392671.1 protein_id gnl|my_center|LOCUS_48390 222556 223176 gene locus_tag LOCUS_48400 222556 223176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392673.1 protein_id gnl|my_center|LOCUS_48400 223332 224306 gene locus_tag LOCUS_48410 223332 224306 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968877.1 protein_id gnl|my_center|LOCUS_48410 224516 225946 gene locus_tag LOCUS_48420 224516 225946 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392675.1 protein_id gnl|my_center|LOCUS_48420 228373 226052 gene locus_tag LOCUS_48430 228373 226052 CDS product DUF1217 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241858.1 protein_id gnl|my_center|LOCUS_48430 228636 229199 gene locus_tag LOCUS_48440 228636 229199 CDS product DUF6101 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392689.1 protein_id gnl|my_center|LOCUS_48440 229365 229535 gene locus_tag LOCUS_48450 229365 229535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 230489 229536 gene locus_tag LOCUS_48460 gene ubiA 230489 229536 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327555.1 protein_id gnl|my_center|LOCUS_48460 231376 230567 gene locus_tag LOCUS_48470 231376 230567 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974679.1 protein_id gnl|my_center|LOCUS_48470 231544 231783 gene locus_tag LOCUS_48480 231544 231783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529265.1 protein_id gnl|my_center|LOCUS_48480 232089 233366 gene locus_tag LOCUS_48490 gene purD 232089 233366 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327551.1 protein_id gnl|my_center|LOCUS_48490 233472 233948 gene locus_tag LOCUS_48500 233472 233948 CDS product plant virulence effector HPE1-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251710.1 protein_id gnl|my_center|LOCUS_48500 234545 234051 gene locus_tag LOCUS_48510 234545 234051 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971034.1 protein_id gnl|my_center|LOCUS_48510 236673 234559 gene locus_tag LOCUS_48520 gene glyS 236673 234559 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392705.1 protein_id gnl|my_center|LOCUS_48520 237335 236856 gene locus_tag LOCUS_48530 237335 236856 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226527.1 protein_id gnl|my_center|LOCUS_48530 237667 237332 gene locus_tag LOCUS_48540 237667 237332 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226526.1 protein_id gnl|my_center|LOCUS_48540 239756 237813 gene locus_tag LOCUS_48550 239756 237813 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968865.1 protein_id gnl|my_center|LOCUS_48550 240384 239836 gene locus_tag LOCUS_48560 240384 239836 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313108.1 protein_id gnl|my_center|LOCUS_48560 240537 240782 gene locus_tag LOCUS_48570 240537 240782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 241872 241168 gene locus_tag LOCUS_48580 241872 241168 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180942960.1 protein_id gnl|my_center|LOCUS_48580 242863 241901 gene locus_tag LOCUS_48590 242863 241901 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392709.1 protein_id gnl|my_center|LOCUS_48590 244025 242955 gene locus_tag LOCUS_48600 gene rfbB 244025 242955 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889301.1 protein_id gnl|my_center|LOCUS_48600 244515 244324 gene locus_tag LOCUS_48610 244515 244324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327540.1 protein_id gnl|my_center|LOCUS_48610 245418 244543 gene locus_tag LOCUS_48620 245418 244543 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991722.1 protein_id gnl|my_center|LOCUS_48620 246276 245497 gene locus_tag LOCUS_48630 246276 245497 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379198.1 protein_id gnl|my_center|LOCUS_48630 246694 246473 gene locus_tag LOCUS_48640 246694 246473 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313100.1 protein_id gnl|my_center|LOCUS_48640 246851 247819 gene locus_tag LOCUS_48650 246851 247819 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327536.1 protein_id gnl|my_center|LOCUS_48650 247981 249834 gene locus_tag LOCUS_48660 247981 249834 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968860.1 protein_id gnl|my_center|LOCUS_48660 249841 250752 gene locus_tag LOCUS_48670 249841 250752 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392714.1 protein_id gnl|my_center|LOCUS_48670 250739 251287 gene locus_tag LOCUS_48680 gene moaB 250739 251287 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241194.1 protein_id gnl|my_center|LOCUS_48680 251923 251393 gene locus_tag LOCUS_48690 251923 251393 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327532.1 protein_id gnl|my_center|LOCUS_48690 252095 253252 gene locus_tag LOCUS_48700 252095 253252 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241196.1 protein_id gnl|my_center|LOCUS_48700 253518 254168 gene locus_tag LOCUS_48710 253518 254168 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971095.1 protein_id gnl|my_center|LOCUS_48710 254225 254560 gene locus_tag LOCUS_48720 254225 254560 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529706.1 protein_id gnl|my_center|LOCUS_48720 254557 254916 gene locus_tag LOCUS_48730 254557 254916 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970508.1 protein_id gnl|my_center|LOCUS_48730 254964 255587 gene locus_tag LOCUS_48740 254964 255587 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970507.1 protein_id gnl|my_center|LOCUS_48740 256152 255667 gene locus_tag LOCUS_48750 256152 255667 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533637.1 protein_id gnl|my_center|LOCUS_48750 256810 256163 gene locus_tag LOCUS_48760 256810 256163 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392730.1 protein_id gnl|my_center|LOCUS_48760 257125 256898 gene locus_tag LOCUS_48770 257125 256898 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707029.1 protein_id gnl|my_center|LOCUS_48770 257944 257192 gene locus_tag LOCUS_48780 257944 257192 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533645.1 protein_id gnl|my_center|LOCUS_48780 258401 258006 gene locus_tag LOCUS_48790 258401 258006 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379142.1 protein_id gnl|my_center|LOCUS_48790 259862 258672 gene locus_tag LOCUS_48800 259862 258672 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392737.1 protein_id gnl|my_center|LOCUS_48800 261972 260071 gene locus_tag LOCUS_48810 261972 260071 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327523.1 protein_id gnl|my_center|LOCUS_48810 262969 261986 gene locus_tag LOCUS_48820 262969 261986 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392739.1 protein_id gnl|my_center|LOCUS_48820 264290 263109 gene locus_tag LOCUS_48830 264290 263109 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528006.1 protein_id gnl|my_center|LOCUS_48830 265149 264406 gene locus_tag LOCUS_48840 gene nurR 265149 264406 CDS product LuxR family transcriptional regulator NurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533659.1 protein_id gnl|my_center|LOCUS_48840 265971 265234 gene locus_tag LOCUS_48850 265971 265234 CDS product autoinducer binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327519.1 protein_id gnl|my_center|LOCUS_48850 266374 266276 gene locus_tag LOCUS_t00480 266374 266276 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 267122 267883 gene locus_tag LOCUS_48860 267122 267883 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992231.1 protein_id gnl|my_center|LOCUS_48860 267883 268806 gene locus_tag LOCUS_48870 267883 268806 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241208.1 protein_id gnl|my_center|LOCUS_48870 268864 269502 gene locus_tag LOCUS_48880 268864 269502 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968849.1 protein_id gnl|my_center|LOCUS_48880 269499 270383 gene locus_tag LOCUS_48890 269499 270383 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399505.1 protein_id gnl|my_center|LOCUS_48890 270580 271293 gene locus_tag LOCUS_48900 270580 271293 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968846.1 protein_id gnl|my_center|LOCUS_48900 272991 271444 gene locus_tag LOCUS_48910 272991 271444 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968845.1 protein_id gnl|my_center|LOCUS_48910 273080 274006 gene locus_tag LOCUS_48920 273080 274006 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844087.1 protein_id gnl|my_center|LOCUS_48920 274345 274010 gene locus_tag LOCUS_48930 274345 274010 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972652.1 protein_id gnl|my_center|LOCUS_48930 275815 274460 gene locus_tag LOCUS_48940 275815 274460 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313185.1 protein_id gnl|my_center|LOCUS_48940 277653 275956 gene locus_tag LOCUS_48950 277653 275956 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844086.1 protein_id gnl|my_center|LOCUS_48950 277961 279769 gene locus_tag LOCUS_48960 gene mutL 277961 279769 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968841.1 protein_id gnl|my_center|LOCUS_48960 279976 280209 gene locus_tag LOCUS_48970 279976 280209 CDS product DUF2093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241218.1 protein_id gnl|my_center|LOCUS_48970 281323 280283 gene locus_tag LOCUS_48980 gene lpxK 281323 280283 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968838.1 protein_id gnl|my_center|LOCUS_48980 282389 281655 gene locus_tag LOCUS_48990 282389 281655 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327506.1 protein_id gnl|my_center|LOCUS_48990 283716 282403 gene locus_tag LOCUS_49000 gene waaA 283716 282403 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399514.1 protein_id gnl|my_center|LOCUS_49000 284061 283825 gene locus_tag LOCUS_49010 284061 283825 CDS product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379087.1 protein_id gnl|my_center|LOCUS_49010 284929 284123 gene locus_tag LOCUS_49020 284929 284123 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968835.1 protein_id gnl|my_center|LOCUS_49020 286280 284934 gene locus_tag LOCUS_49030 286280 284934 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399518.1 protein_id gnl|my_center|LOCUS_49030 286391 288175 gene locus_tag LOCUS_49040 286391 288175 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399519.1 protein_id gnl|my_center|LOCUS_49040 289247 288381 gene locus_tag LOCUS_49050 289247 288381 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968832.1 protein_id gnl|my_center|LOCUS_49050 289850 289290 gene locus_tag LOCUS_49060 gene rsmD 289850 289290 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968831.1 protein_id gnl|my_center|LOCUS_49060 291746 289857 gene locus_tag LOCUS_49070 291746 289857 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563875.1 protein_id gnl|my_center|LOCUS_49070 291808 292260 gene locus_tag LOCUS_49080 291808 292260 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537305.1 protein_id gnl|my_center|LOCUS_49080 292801 292316 gene locus_tag LOCUS_49090 292801 292316 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241230.1 protein_id gnl|my_center|LOCUS_49090 293396 292806 gene locus_tag LOCUS_49100 293396 292806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327495.1 protein_id gnl|my_center|LOCUS_49100 296481 293590 gene locus_tag LOCUS_49110 gene ileS 296481 293590 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971068.1 protein_id gnl|my_center|LOCUS_49110 297919 296900 gene locus_tag LOCUS_49120 297919 296900 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252102.1 protein_id gnl|my_center|LOCUS_49120 298743 297895 gene locus_tag LOCUS_49130 298743 297895 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399549.1 protein_id gnl|my_center|LOCUS_49130 299063 299359 gene locus_tag LOCUS_49140 gene groES 299063 299359 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003494080.1 protein_id gnl|my_center|LOCUS_49140 299413 301053 gene locus_tag LOCUS_49150 gene groL 299413 301053 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313163.1 protein_id gnl|my_center|LOCUS_49150 301649 302095 gene locus_tag LOCUS_49160 301649 302095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971066.1 protein_id gnl|my_center|LOCUS_49160 305094 302296 gene locus_tag LOCUS_49170 305094 302296 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399555.1 protein_id gnl|my_center|LOCUS_49170 306557 305280 gene locus_tag LOCUS_49180 306557 305280 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153423362.1 protein_id gnl|my_center|LOCUS_49180 307298 306591 gene locus_tag LOCUS_49190 307298 306591 CDS product glutathione binding-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027999614.1 protein_id gnl|my_center|LOCUS_49190 307925 307374 gene locus_tag LOCUS_49200 307925 307374 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971267.1 protein_id gnl|my_center|LOCUS_49200 308622 307927 gene locus_tag LOCUS_49210 gene hisG 308622 307927 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399577.1 protein_id gnl|my_center|LOCUS_49210 309752 308619 gene locus_tag LOCUS_49220 309752 308619 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974609.1 protein_id gnl|my_center|LOCUS_49220 311481 309958 gene locus_tag LOCUS_49230 gene hisS 311481 309958 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971061.1 protein_id gnl|my_center|LOCUS_49230 311834 312154 gene locus_tag LOCUS_49240 311834 312154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 312216 312593 gene locus_tag LOCUS_49250 312216 312593 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968815.1 protein_id gnl|my_center|LOCUS_49250 312882 312664 gene locus_tag LOCUS_49260 312882 312664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 313667 313041 gene locus_tag LOCUS_49270 313667 313041 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968813.1 protein_id gnl|my_center|LOCUS_49270 313963 314631 gene locus_tag LOCUS_49280 313963 314631 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252099.1 protein_id gnl|my_center|LOCUS_49280 315001 314756 gene locus_tag LOCUS_49290 315001 314756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 314886 315470 gene locus_tag LOCUS_49300 314886 315470 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399598.1 protein_id gnl|my_center|LOCUS_49300 317062 315764 gene locus_tag LOCUS_49310 gene glcF 317062 315764 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971053.1 protein_id gnl|my_center|LOCUS_49310 318442 317243 gene locus_tag LOCUS_49320 gene glcE 318442 317243 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577785.1 protein_id gnl|my_center|LOCUS_49320 319875 318439 gene locus_tag LOCUS_49330 319875 318439 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401220.1 protein_id gnl|my_center|LOCUS_49330 319980 320876 gene locus_tag LOCUS_49340 319980 320876 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974598.1 protein_id gnl|my_center|LOCUS_49340 321041 321532 gene locus_tag LOCUS_49350 321041 321532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 322902 321625 gene locus_tag LOCUS_49360 322902 321625 CDS product DUF3422 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974597.1 protein_id gnl|my_center|LOCUS_49360 323045 323839 gene locus_tag LOCUS_49370 323045 323839 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187292983.1 protein_id gnl|my_center|LOCUS_49370 323920 324423 gene locus_tag LOCUS_49380 323920 324423 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909719.1 protein_id gnl|my_center|LOCUS_49380 324668 326164 gene locus_tag LOCUS_49390 324668 326164 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974594.1 protein_id gnl|my_center|LOCUS_49390 326175 326912 gene locus_tag LOCUS_49400 326175 326912 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992221.1 protein_id gnl|my_center|LOCUS_49400 327077 328450 gene locus_tag LOCUS_49410 327077 328450 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974592.1 protein_id gnl|my_center|LOCUS_49410 328534 329379 gene locus_tag LOCUS_49420 328534 329379 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401209.1 protein_id gnl|my_center|LOCUS_49420 329829 329533 gene locus_tag LOCUS_49430 329829 329533 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706964.1 protein_id gnl|my_center|LOCUS_49430 330104 331057 gene locus_tag LOCUS_49440 330104 331057 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527211.1 protein_id gnl|my_center|LOCUS_49440 331051 331626 gene locus_tag LOCUS_49450 331051 331626 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388274.1 protein_id gnl|my_center|LOCUS_49450 332523 331648 gene locus_tag LOCUS_49460 332523 331648 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527204.1 protein_id gnl|my_center|LOCUS_49460 333026 332607 gene locus_tag LOCUS_49470 333026 332607 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527202.1 protein_id gnl|my_center|LOCUS_49470 333483 333124 gene locus_tag LOCUS_49480 333483 333124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531701.1 protein_id gnl|my_center|LOCUS_49480 335127 333631 gene locus_tag LOCUS_49490 gene guaB 335127 333631 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241867.1 protein_id gnl|my_center|LOCUS_49490 336387 335392 gene locus_tag LOCUS_49500 336387 335392 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401180.1 protein_id gnl|my_center|LOCUS_49500 336781 336464 gene locus_tag LOCUS_49510 336781 336464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 336693 338102 gene locus_tag LOCUS_49520 336693 338102 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527196.1 protein_id gnl|my_center|LOCUS_49520 338303 338465 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcctcctcgcggaggcgtggattgaaacc 338971 338588 gene locus_tag LOCUS_49530 338971 338588 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241260.1 protein_id gnl|my_center|LOCUS_49530 339687 338971 gene locus_tag LOCUS_49540 339687 338971 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180940261.1 protein_id gnl|my_center|LOCUS_49540 341234 339684 gene locus_tag LOCUS_49550 341234 339684 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018009496.1 protein_id gnl|my_center|LOCUS_49550 341484 341557 gene locus_tag LOCUS_t00490 341484 341557 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 342196 341771 gene locus_tag LOCUS_49560 342196 341771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 344265 342382 gene locus_tag LOCUS_49570 344265 342382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 344842 344483 gene locus_tag LOCUS_49580 344842 344483 CDS product DUF1515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456612.1 protein_id gnl|my_center|LOCUS_49580 345226 344945 gene locus_tag LOCUS_49590 345226 344945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 345609 345223 gene locus_tag LOCUS_49600 345609 345223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 345824 346252 gene locus_tag LOCUS_49610 345824 346252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 346269 346706 gene locus_tag LOCUS_49620 346269 346706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 347422 346778 gene locus_tag LOCUS_49630 347422 346778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 347742 347503 gene locus_tag LOCUS_49640 347742 347503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 349276 347627 gene locus_tag LOCUS_49650 349276 347627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 349832 349464 gene locus_tag LOCUS_49660 349832 349464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49660 350390 349839 gene locus_tag LOCUS_49670 350390 349839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49670 352465 350678 gene locus_tag LOCUS_49680 352465 350678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 353533 353243 gene locus_tag LOCUS_49690 353533 353243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 353850 353638 gene locus_tag LOCUS_49700 353850 353638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 354437 354030 gene locus_tag LOCUS_49710 354437 354030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 354637 354434 gene locus_tag LOCUS_49720 354637 354434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 354751 355194 gene locus_tag LOCUS_49730 354751 355194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 355258 355539 gene locus_tag LOCUS_49740 355258 355539 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085796.1 protein_id gnl|my_center|LOCUS_49740 355551 355841 gene locus_tag LOCUS_49750 355551 355841 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531910.1 protein_id gnl|my_center|LOCUS_49750 356846 357034 gene locus_tag LOCUS_49760 356846 357034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 357216 357485 gene locus_tag LOCUS_49770 357216 357485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 357511 357699 gene locus_tag LOCUS_49780 357511 357699 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327642.1 protein_id gnl|my_center|LOCUS_49780 358301 357753 gene locus_tag LOCUS_49790 358301 357753 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180939484.1 protein_id gnl|my_center|LOCUS_49790 358447 359784 gene locus_tag LOCUS_49800 358447 359784 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037403150.1 protein_id gnl|my_center|LOCUS_49800 359872 360231 gene locus_tag LOCUS_49810 359872 360231 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526986.1 protein_id gnl|my_center|LOCUS_49810 361308 360235 gene locus_tag LOCUS_49820 gene modC 361308 360235 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972403.1 protein_id gnl|my_center|LOCUS_49820 362006 361305 gene locus_tag LOCUS_49830 gene modB 362006 361305 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972402.1 protein_id gnl|my_center|LOCUS_49830 362948 362175 gene locus_tag LOCUS_49840 gene modA 362948 362175 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972401.1 protein_id gnl|my_center|LOCUS_49840 364902 363199 gene locus_tag LOCUS_49850 364902 363199 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389150.1 protein_id gnl|my_center|LOCUS_49850 365289 365615 gene locus_tag LOCUS_49860 365289 365615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 365615 365983 gene locus_tag LOCUS_49870 365615 365983 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626162.1 protein_id gnl|my_center|LOCUS_49870 365980 367974 gene locus_tag LOCUS_49880 365980 367974 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389153.1 protein_id gnl|my_center|LOCUS_49880 367971 368483 gene locus_tag LOCUS_49890 367971 368483 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389154.1 protein_id gnl|my_center|LOCUS_49890 368501 370198 gene locus_tag LOCUS_49900 368501 370198 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389155.1 protein_id gnl|my_center|LOCUS_49900 370383 372188 gene locus_tag LOCUS_49910 370383 372188 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389158.1 protein_id gnl|my_center|LOCUS_49910 372191 372685 gene locus_tag LOCUS_49920 372191 372685 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389156.1 protein_id gnl|my_center|LOCUS_49920 372720 373553 gene locus_tag LOCUS_49930 372720 373553 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389159.1 protein_id gnl|my_center|LOCUS_49930 373553 374641 gene locus_tag LOCUS_49940 373553 374641 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389160.1 protein_id gnl|my_center|LOCUS_49940 374764 375474 gene locus_tag LOCUS_49950 374764 375474 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529183.1 protein_id gnl|my_center|LOCUS_49950 376039 375893 gene locus_tag LOCUS_49960 376039 375893 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077068125.1 protein_id gnl|my_center|LOCUS_49960 376438 377007 gene locus_tag LOCUS_49970 376438 377007 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895555.1 protein_id gnl|my_center|LOCUS_49970 378411 377011 gene locus_tag LOCUS_49980 gene chrA 378411 377011 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969287.1 protein_id gnl|my_center|LOCUS_49980 378545 378886 gene locus_tag LOCUS_49990 378545 378886 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224368.1 protein_id gnl|my_center|LOCUS_49990 378901 379374 gene locus_tag LOCUS_50000 378901 379374 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976305.1 protein_id gnl|my_center|LOCUS_50000 379371 379790 gene locus_tag LOCUS_50010 379371 379790 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969810.1 protein_id gnl|my_center|LOCUS_50010 380257 379793 gene locus_tag LOCUS_50020 380257 379793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 380365 381369 gene locus_tag LOCUS_50030 380365 381369 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525362.1 protein_id gnl|my_center|LOCUS_50030 381466 382068 gene locus_tag LOCUS_50040 381466 382068 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612593.1 protein_id gnl|my_center|LOCUS_50040 382239 384800 gene locus_tag LOCUS_50050 382239 384800 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394293.1 protein_id gnl|my_center|LOCUS_50050 386423 385224 gene locus_tag LOCUS_50060 386423 385224 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086627.1 protein_id gnl|my_center|LOCUS_50060 387168 386515 gene locus_tag LOCUS_50070 387168 386515 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969819.1 protein_id gnl|my_center|LOCUS_50070 388235 387234 gene locus_tag LOCUS_50080 388235 387234 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210030.1 protein_id gnl|my_center|LOCUS_50080 388658 389074 gene locus_tag LOCUS_50090 388658 389074 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971227.1 protein_id gnl|my_center|LOCUS_50090 389638 389081 gene locus_tag LOCUS_50100 389638 389081 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384122.1 protein_id gnl|my_center|LOCUS_50100 391926 389635 gene locus_tag LOCUS_50110 391926 389635 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399174.1 protein_id gnl|my_center|LOCUS_50110 392461 393561 gene locus_tag LOCUS_50120 gene nspC 392461 393561 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973611.1 protein_id gnl|my_center|LOCUS_50120 393598 394836 gene locus_tag LOCUS_50130 393598 394836 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976328.1 protein_id gnl|my_center|LOCUS_50130 396637 395024 gene locus_tag LOCUS_50140 gene araB 396637 395024 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_50140 396524 396754 gene locus_tag LOCUS_50150 396524 396754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 398845 397082 gene locus_tag LOCUS_50160 398845 397082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528963.1 protein_id gnl|my_center|LOCUS_50160 400558 399104 gene locus_tag LOCUS_50170 400558 399104 CDS product UdgX family uracil-DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972121.1 protein_id gnl|my_center|LOCUS_50170 401787 400558 gene locus_tag LOCUS_50180 401787 400558 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972122.1 protein_id gnl|my_center|LOCUS_50180 403554 401896 gene locus_tag LOCUS_50190 403554 401896 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184144746.1 protein_id gnl|my_center|LOCUS_50190 404497 403568 gene locus_tag LOCUS_50200 404497 403568 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394692.1 protein_id gnl|my_center|LOCUS_50200 405274 404525 gene locus_tag LOCUS_50210 405274 404525 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970096.1 protein_id gnl|my_center|LOCUS_50210 406143 405286 gene locus_tag LOCUS_50220 406143 405286 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967736.1 protein_id gnl|my_center|LOCUS_50220 407295 406147 gene locus_tag LOCUS_50230 407295 406147 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967737.1 protein_id gnl|my_center|LOCUS_50230 408084 407305 gene locus_tag LOCUS_50240 408084 407305 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967738.1 protein_id gnl|my_center|LOCUS_50240 409223 408081 gene locus_tag LOCUS_50250 409223 408081 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967739.1 protein_id gnl|my_center|LOCUS_50250 409377 410393 gene locus_tag LOCUS_50260 409377 410393 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 protein_id gnl|my_center|LOCUS_50260 411555 410434 gene locus_tag LOCUS_50270 411555 410434 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967741.1 protein_id gnl|my_center|LOCUS_50270 411436 411714 gene locus_tag LOCUS_50280 411436 411714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 412506 411733 gene locus_tag LOCUS_50290 412506 411733 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967742.1 protein_id gnl|my_center|LOCUS_50290 414074 412503 gene locus_tag LOCUS_50300 414074 412503 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967743.1 protein_id gnl|my_center|LOCUS_50300 414212 415030 gene locus_tag LOCUS_50310 414212 415030 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845505.1 protein_id gnl|my_center|LOCUS_50310 416677 415082 gene locus_tag LOCUS_50320 416677 415082 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967746.1 protein_id gnl|my_center|LOCUS_50320 418173 416677 gene locus_tag LOCUS_50330 418173 416677 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967747.1 protein_id gnl|my_center|LOCUS_50330 419231 418197 gene locus_tag LOCUS_50340 419231 418197 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528693.1 protein_id gnl|my_center|LOCUS_50340 420182 419241 gene locus_tag LOCUS_50350 420182 419241 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967749.1 protein_id gnl|my_center|LOCUS_50350 421696 420191 gene locus_tag LOCUS_50360 421696 420191 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967750.1 protein_id gnl|my_center|LOCUS_50360 422670 421705 gene locus_tag LOCUS_50370 422670 421705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527033.1 protein_id gnl|my_center|LOCUS_50370 423858 422749 gene locus_tag LOCUS_50380 423858 422749 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528694.1 protein_id gnl|my_center|LOCUS_50380 424114 424773 gene locus_tag LOCUS_50390 424114 424773 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967752.1 protein_id gnl|my_center|LOCUS_50390 424798 425805 gene locus_tag LOCUS_50400 424798 425805 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529706.1 protein_id gnl|my_center|LOCUS_50400 425900 427531 gene locus_tag LOCUS_50410 425900 427531 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970552.1 protein_id gnl|my_center|LOCUS_50410 427557 428072 gene locus_tag LOCUS_50420 427557 428072 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967754.1 protein_id gnl|my_center|LOCUS_50420 428165 429565 gene locus_tag LOCUS_50430 428165 429565 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967707.1 protein_id gnl|my_center|LOCUS_50430 429695 430585 gene locus_tag LOCUS_50440 429695 430585 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_50440 430590 431414 gene locus_tag LOCUS_50450 430590 431414 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253348.1 protein_id gnl|my_center|LOCUS_50450 431425 432498 gene locus_tag LOCUS_50460 gene ugpC 431425 432498 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975559.1 protein_id gnl|my_center|LOCUS_50460 432516 433514 gene locus_tag LOCUS_50470 432516 433514 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967753.1 protein_id gnl|my_center|LOCUS_50470 434347 433646 gene locus_tag LOCUS_50480 434347 433646 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969922.1 protein_id gnl|my_center|LOCUS_50480 435084 434386 gene locus_tag LOCUS_50490 435084 434386 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036036.1 protein_id gnl|my_center|LOCUS_50490 436052 435081 gene locus_tag LOCUS_50500 436052 435081 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969921.1 protein_id gnl|my_center|LOCUS_50500 437035 436058 gene locus_tag LOCUS_50510 437035 436058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 437817 437044 gene locus_tag LOCUS_50520 437817 437044 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969919.1 protein_id gnl|my_center|LOCUS_50520 439124 437814 gene locus_tag LOCUS_50530 gene hisD 439124 437814 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969917.1 protein_id gnl|my_center|LOCUS_50530 439659 439129 gene locus_tag LOCUS_50540 439659 439129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50540 440729 439665 gene locus_tag LOCUS_50550 gene ugpC 440729 439665 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969916.1 protein_id gnl|my_center|LOCUS_50550 441616 440735 gene locus_tag LOCUS_50560 441616 440735 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969915.1 protein_id gnl|my_center|LOCUS_50560 442655 441627 gene locus_tag LOCUS_50570 442655 441627 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969914.1 protein_id gnl|my_center|LOCUS_50570 443983 442739 gene locus_tag LOCUS_50580 443983 442739 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969913.1 protein_id gnl|my_center|LOCUS_50580 444177 445253 gene locus_tag LOCUS_50590 444177 445253 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902083.1 protein_id gnl|my_center|LOCUS_50590 446148 445234 gene locus_tag LOCUS_50600 446148 445234 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969920.1 protein_id gnl|my_center|LOCUS_50600 447108 446455 gene locus_tag LOCUS_50610 447108 446455 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162995.1 protein_id gnl|my_center|LOCUS_50610 447932 447150 gene locus_tag LOCUS_50620 447932 447150 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201787933.1 protein_id gnl|my_center|LOCUS_50620 449682 447982 gene locus_tag LOCUS_50630 449682 447982 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_50630 450767 449679 gene locus_tag LOCUS_50640 450767 449679 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405591.1 protein_id gnl|my_center|LOCUS_50640 452470 450764 gene locus_tag LOCUS_50650 452470 450764 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782273.1 protein_id gnl|my_center|LOCUS_50650 453533 452463 gene locus_tag LOCUS_50660 453533 452463 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400387.1 protein_id gnl|my_center|LOCUS_50660 454642 453545 gene locus_tag LOCUS_50670 454642 453545 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400384.1 protein_id gnl|my_center|LOCUS_50670 455387 454734 gene locus_tag LOCUS_50680 455387 454734 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218129451.1 protein_id gnl|my_center|LOCUS_50680 457166 455451 gene locus_tag LOCUS_50690 457166 455451 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968847.1 protein_id gnl|my_center|LOCUS_50690 457327 458355 gene locus_tag LOCUS_50700 457327 458355 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_50700 460343 458523 gene locus_tag LOCUS_50710 460343 458523 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973857.1 protein_id gnl|my_center|LOCUS_50710 460709 460416 gene locus_tag LOCUS_50720 gene catC 460709 460416 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728004.1 protein_id gnl|my_center|LOCUS_50720 462331 460721 gene locus_tag LOCUS_50730 462331 460721 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_50730 463366 462392 gene locus_tag LOCUS_50740 463366 462392 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807397.1 protein_id gnl|my_center|LOCUS_50740 464168 463389 gene locus_tag LOCUS_50750 464168 463389 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816301.1 protein_id gnl|my_center|LOCUS_50750 464928 464179 gene locus_tag LOCUS_50760 464928 464179 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085620.1 protein_id gnl|my_center|LOCUS_50760 466088 465063 gene locus_tag LOCUS_50770 466088 465063 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 protein_id gnl|my_center|LOCUS_50770 467632 466112 gene locus_tag LOCUS_50780 467632 466112 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243012.1 protein_id gnl|my_center|LOCUS_50780 468591 467644 gene locus_tag LOCUS_50790 468591 467644 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969282.1 protein_id gnl|my_center|LOCUS_50790 469480 468596 gene locus_tag LOCUS_50800 469480 468596 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_50800 470229 469507 gene locus_tag LOCUS_50810 470229 469507 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868218.1 protein_id gnl|my_center|LOCUS_50810 471851 470271 gene locus_tag LOCUS_50820 471851 470271 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727398.1 protein_id gnl|my_center|LOCUS_50820 472014 473009 gene locus_tag LOCUS_50830 472014 473009 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243788.1 protein_id gnl|my_center|LOCUS_50830 474167 473016 gene locus_tag LOCUS_50840 474167 473016 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974269.1 protein_id gnl|my_center|LOCUS_50840 475193 474186 gene locus_tag LOCUS_50850 475193 474186 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_50850 476715 475207 gene locus_tag LOCUS_50860 476715 475207 CDS product amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970683.1 protein_id gnl|my_center|LOCUS_50860 477608 476772 gene locus_tag LOCUS_50870 477608 476772 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970684.1 protein_id gnl|my_center|LOCUS_50870 477834 478904 gene locus_tag LOCUS_50880 477834 478904 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970685.1 protein_id gnl|my_center|LOCUS_50880 479940 479101 gene locus_tag LOCUS_50890 479940 479101 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970333.1 protein_id gnl|my_center|LOCUS_50890 481508 479982 gene locus_tag LOCUS_50900 481508 479982 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163897449.1 protein_id gnl|my_center|LOCUS_50900 481168 481072 gene locus_tag LOCUS_t00500 481168 481072 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 481660 482661 gene locus_tag LOCUS_50910 481660 482661 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970331.1 protein_id gnl|my_center|LOCUS_50910 482680 483390 gene locus_tag LOCUS_50920 482680 483390 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970330.1 protein_id gnl|my_center|LOCUS_50920 483401 484339 gene locus_tag LOCUS_50930 483401 484339 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970329.1 protein_id gnl|my_center|LOCUS_50930 485218 484433 gene locus_tag LOCUS_50940 485218 484433 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234820896.1 protein_id gnl|my_center|LOCUS_50940 486141 485218 gene locus_tag LOCUS_50950 486141 485218 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970327.1 protein_id gnl|my_center|LOCUS_50950 487112 486267 gene locus_tag LOCUS_50960 487112 486267 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970326.1 protein_id gnl|my_center|LOCUS_50960 487449 488462 gene locus_tag LOCUS_50970 487449 488462 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970325.1 protein_id gnl|my_center|LOCUS_50970 488587 489474 gene locus_tag LOCUS_50980 488587 489474 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970324.1 protein_id gnl|my_center|LOCUS_50980 491016 489970 gene locus_tag LOCUS_50990 491016 489970 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336817.1 protein_id gnl|my_center|LOCUS_50990 493405 491006 gene locus_tag LOCUS_51000 493405 491006 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974690.1 protein_id gnl|my_center|LOCUS_51000 494058 493402 gene locus_tag LOCUS_51010 494058 493402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140035.1 protein_id gnl|my_center|LOCUS_51010 496521 494332 gene locus_tag LOCUS_51020 496521 494332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 497347 496547 gene locus_tag LOCUS_51030 497347 496547 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 protein_id gnl|my_center|LOCUS_51030 498424 497405 gene locus_tag LOCUS_51040 498424 497405 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898152.1 protein_id gnl|my_center|LOCUS_51040 499814 498483 gene locus_tag LOCUS_51050 499814 498483 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729038.1 protein_id gnl|my_center|LOCUS_51050 500919 499885 gene locus_tag LOCUS_51060 500919 499885 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083793.1 protein_id gnl|my_center|LOCUS_51060 501626 500931 gene locus_tag LOCUS_51070 gene urtE 501626 500931 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974753.1 protein_id gnl|my_center|LOCUS_51070 502383 501619 gene locus_tag LOCUS_51080 gene urtD 502383 501619 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974752.1 protein_id gnl|my_center|LOCUS_51080 503507 502380 gene locus_tag LOCUS_51090 gene urtC 503507 502380 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974751.1 protein_id gnl|my_center|LOCUS_51090 504405 503536 gene locus_tag LOCUS_51100 gene urtB 504405 503536 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215689.1 protein_id gnl|my_center|LOCUS_51100 505717 504470 gene locus_tag LOCUS_51110 505717 504470 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974749.1 protein_id gnl|my_center|LOCUS_51110 506703 505999 gene locus_tag LOCUS_51120 506703 505999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 507780 506704 gene locus_tag LOCUS_51130 507780 506704 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770316.1 protein_id gnl|my_center|LOCUS_51130 508483 510012 gene locus_tag LOCUS_51140 508483 510012 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562511.1 protein_id gnl|my_center|LOCUS_51140 510081 511070 gene locus_tag LOCUS_51150 510081 511070 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722098.1 protein_id gnl|my_center|LOCUS_51150 511079 511990 gene locus_tag LOCUS_51160 511079 511990 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336751.1 protein_id gnl|my_center|LOCUS_51160 511990 513858 gene locus_tag LOCUS_51170 511990 513858 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336752.1 protein_id gnl|my_center|LOCUS_51170 513855 515033 gene locus_tag LOCUS_51180 513855 515033 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_51180 515050 515808 gene locus_tag LOCUS_51190 515050 515808 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018238032.1 protein_id gnl|my_center|LOCUS_51190 515859 516470 gene locus_tag LOCUS_51200 515859 516470 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167367.1 protein_id gnl|my_center|LOCUS_51200 516675 516599 gene locus_tag LOCUS_t00510 516675 516599 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence32 962 246 gene locus_tag LOCUS_51210 962 246 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531512.1 protein_id gnl|my_center|LOCUS_51210 1767 994 gene locus_tag LOCUS_51220 1767 994 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531511.1 protein_id gnl|my_center|LOCUS_51220 2299 1754 gene locus_tag LOCUS_51230 2299 1754 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827403.1 protein_id gnl|my_center|LOCUS_51230 2791 2354 gene locus_tag LOCUS_51240 2791 2354 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970461.1 protein_id gnl|my_center|LOCUS_51240 3626 2796 gene locus_tag LOCUS_51250 3626 2796 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531742.1 protein_id gnl|my_center|LOCUS_51250 4327 3641 gene locus_tag LOCUS_51260 4327 3641 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_51260 5073 4324 gene locus_tag LOCUS_51270 5073 4324 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_51270 6040 5066 gene locus_tag LOCUS_51280 6040 5066 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040564.1 protein_id gnl|my_center|LOCUS_51280 6963 6043 gene locus_tag LOCUS_51290 6963 6043 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_51290 8169 7033 gene locus_tag LOCUS_51300 8169 7033 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815015.1 protein_id gnl|my_center|LOCUS_51300 8633 8388 gene locus_tag LOCUS_51310 8633 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 9446 8733 gene locus_tag LOCUS_51320 9446 8733 CDS product TfuA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975567.1 protein_id gnl|my_center|LOCUS_51320 10651 9443 gene locus_tag LOCUS_51330 10651 9443 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396845.1 protein_id gnl|my_center|LOCUS_51330 10908 10648 gene locus_tag LOCUS_51340 10908 10648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969830.1 protein_id gnl|my_center|LOCUS_51340 12749 10938 gene locus_tag LOCUS_51350 12749 10938 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396844.1 protein_id gnl|my_center|LOCUS_51350 13199 12756 gene locus_tag LOCUS_51360 13199 12756 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396295.1 protein_id gnl|my_center|LOCUS_51360 14096 13335 gene locus_tag LOCUS_51370 14096 13335 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242414.1 protein_id gnl|my_center|LOCUS_51370 14773 14093 gene locus_tag LOCUS_51380 14773 14093 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136505321.1 protein_id gnl|my_center|LOCUS_51380 15653 14880 gene locus_tag LOCUS_51390 15653 14880 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067343.1 protein_id gnl|my_center|LOCUS_51390 15934 17529 gene locus_tag LOCUS_51400 15934 17529 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975714.1 protein_id gnl|my_center|LOCUS_51400 17592 18515 gene locus_tag LOCUS_51410 gene oppB 17592 18515 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529067.1 protein_id gnl|my_center|LOCUS_51410 18508 19638 gene locus_tag LOCUS_51420 18508 19638 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391736.1 protein_id gnl|my_center|LOCUS_51420 19640 21256 gene locus_tag LOCUS_51430 19640 21256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975716.1 protein_id gnl|my_center|LOCUS_51430 21284 22426 gene locus_tag LOCUS_51440 gene yvcK 21284 22426 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224648.1 protein_id gnl|my_center|LOCUS_51440 25079 22404 gene locus_tag LOCUS_51450 25079 22404 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984024.1 protein_id gnl|my_center|LOCUS_51450 25285 26193 gene locus_tag LOCUS_51460 gene paaX 25285 26193 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527995.1 protein_id gnl|my_center|LOCUS_51460 26362 27567 gene locus_tag LOCUS_51470 gene pcaF 26362 27567 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522007.1 protein_id gnl|my_center|LOCUS_51470 27591 28595 gene locus_tag LOCUS_51480 gene paaA 27591 28595 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329399.1 protein_id gnl|my_center|LOCUS_51480 28609 28893 gene locus_tag LOCUS_51490 gene paaB 28609 28893 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069460051.1 protein_id gnl|my_center|LOCUS_51490 28893 29675 gene locus_tag LOCUS_51500 gene paaC 28893 29675 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329397.1 protein_id gnl|my_center|LOCUS_51500 29685 30209 gene locus_tag LOCUS_51510 gene paaJ 29685 30209 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153451216.1 protein_id gnl|my_center|LOCUS_51510 30230 31306 gene locus_tag LOCUS_51520 gene paaK 30230 31306 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329395.1 protein_id gnl|my_center|LOCUS_51520 31318 32073 gene locus_tag LOCUS_51530 31318 32073 CDS product phenylacetate-CoA oxygenase subunit PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399747.1 protein_id gnl|my_center|LOCUS_51530 32117 34174 gene locus_tag LOCUS_51540 gene paaZ 32117 34174 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399720.1 protein_id gnl|my_center|LOCUS_51540 34182 34694 gene locus_tag LOCUS_51550 34182 34694 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528002.1 protein_id gnl|my_center|LOCUS_51550 35405 34809 gene locus_tag LOCUS_51560 35405 34809 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329392.1 protein_id gnl|my_center|LOCUS_51560 36909 35599 gene locus_tag LOCUS_51570 gene paaF 36909 35599 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329391.1 protein_id gnl|my_center|LOCUS_51570 37391 36951 gene locus_tag LOCUS_51580 gene paaI 37391 36951 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577719.1 protein_id gnl|my_center|LOCUS_51580 38176 37388 gene locus_tag LOCUS_51590 gene paaG 38176 37388 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117561.1 protein_id gnl|my_center|LOCUS_51590 38279 39940 gene locus_tag LOCUS_51600 gene paaN 38279 39940 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813288.1 protein_id gnl|my_center|LOCUS_51600 39988 41139 gene locus_tag LOCUS_51610 39988 41139 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040052.1 protein_id gnl|my_center|LOCUS_51610 41210 42082 gene locus_tag LOCUS_51620 41210 42082 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 protein_id gnl|my_center|LOCUS_51620 42079 43041 gene locus_tag LOCUS_51630 42079 43041 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810748.1 protein_id gnl|my_center|LOCUS_51630 43038 43823 gene locus_tag LOCUS_51640 43038 43823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816696.1 protein_id gnl|my_center|LOCUS_51640 43810 44511 gene locus_tag LOCUS_51650 43810 44511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810743.1 protein_id gnl|my_center|LOCUS_51650 44516 46576 gene locus_tag LOCUS_51660 44516 46576 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399723.1 protein_id gnl|my_center|LOCUS_51660 46725 47651 gene locus_tag LOCUS_51670 46725 47651 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920257.1 protein_id gnl|my_center|LOCUS_51670 47753 49174 gene locus_tag LOCUS_51680 47753 49174 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 protein_id gnl|my_center|LOCUS_51680 49203 51182 gene locus_tag LOCUS_51690 gene tynA 49203 51182 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206905.1 protein_id gnl|my_center|LOCUS_51690 52761 51388 gene locus_tag LOCUS_51700 52761 51388 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982254.1 protein_id gnl|my_center|LOCUS_51700 53228 52758 gene locus_tag LOCUS_51710 53228 52758 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173512341.1 protein_id gnl|my_center|LOCUS_51710 53519 54463 gene locus_tag LOCUS_51720 53519 54463 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061567.1 protein_id gnl|my_center|LOCUS_51720 54518 55678 gene locus_tag LOCUS_51730 54518 55678 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061568.1 protein_id gnl|my_center|LOCUS_51730 55675 56613 gene locus_tag LOCUS_51740 55675 56613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975668.1 protein_id gnl|my_center|LOCUS_51740 56610 57353 gene locus_tag LOCUS_51750 56610 57353 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532238.1 protein_id gnl|my_center|LOCUS_51750 57670 57350 gene locus_tag LOCUS_51760 57670 57350 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398599.1 protein_id gnl|my_center|LOCUS_51760 59334 57679 gene locus_tag LOCUS_51770 59334 57679 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970552.1 protein_id gnl|my_center|LOCUS_51770 60276 59497 gene locus_tag LOCUS_51780 60276 59497 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970553.1 protein_id gnl|my_center|LOCUS_51780 61781 60273 gene locus_tag LOCUS_51790 61781 60273 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445683.1 protein_id gnl|my_center|LOCUS_51790 62905 61790 gene locus_tag LOCUS_51800 62905 61790 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242400.1 protein_id gnl|my_center|LOCUS_51800 63791 62910 gene locus_tag LOCUS_51810 63791 62910 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535874.1 protein_id gnl|my_center|LOCUS_51810 64669 63788 gene locus_tag LOCUS_51820 64669 63788 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067374.1 protein_id gnl|my_center|LOCUS_51820 66085 64835 gene locus_tag LOCUS_51830 66085 64835 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508652.1 protein_id gnl|my_center|LOCUS_51830 66392 67444 gene locus_tag LOCUS_51840 66392 67444 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398617.1 protein_id gnl|my_center|LOCUS_51840 68997 67492 gene locus_tag LOCUS_51850 68997 67492 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398620.1 protein_id gnl|my_center|LOCUS_51850 69776 68997 gene locus_tag LOCUS_51860 69776 68997 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251864.1 protein_id gnl|my_center|LOCUS_51860 71382 69769 gene locus_tag LOCUS_51870 71382 69769 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251863.1 protein_id gnl|my_center|LOCUS_51870 72389 71388 gene locus_tag LOCUS_51880 72389 71388 CDS product 1,5-anhydro-D-fructose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535887.1 protein_id gnl|my_center|LOCUS_51880 73432 72386 gene locus_tag LOCUS_51890 73432 72386 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535888.1 protein_id gnl|my_center|LOCUS_51890 73806 74978 gene locus_tag LOCUS_51900 73806 74978 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970560.1 protein_id gnl|my_center|LOCUS_51900 75064 75759 gene locus_tag LOCUS_51910 gene ung 75064 75759 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528805.1 protein_id gnl|my_center|LOCUS_51910 75792 76766 gene locus_tag LOCUS_51920 75792 76766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775834.1 protein_id gnl|my_center|LOCUS_51920 77741 76791 gene locus_tag LOCUS_51930 77741 76791 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255265.1 protein_id gnl|my_center|LOCUS_51930 79034 77799 gene locus_tag LOCUS_51940 79034 77799 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394078.1 protein_id gnl|my_center|LOCUS_51940 80011 79157 gene locus_tag LOCUS_51950 80011 79157 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973876.1 protein_id gnl|my_center|LOCUS_51950 80880 80008 gene locus_tag LOCUS_51960 80880 80008 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970362.1 protein_id gnl|my_center|LOCUS_51960 81746 80877 gene locus_tag LOCUS_51970 81746 80877 CDS product manganese/iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992451.1 protein_id gnl|my_center|LOCUS_51970 82645 81743 gene locus_tag LOCUS_51980 82645 81743 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162688119.1 protein_id gnl|my_center|LOCUS_51980 82858 83520 gene locus_tag LOCUS_51990 82858 83520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243271.1 protein_id gnl|my_center|LOCUS_51990 85217 83724 gene locus_tag LOCUS_52000 gene lysS 85217 83724 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509030.1 protein_id gnl|my_center|LOCUS_52000 86700 85231 gene locus_tag LOCUS_52010 gene gltX 86700 85231 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970278.1 protein_id gnl|my_center|LOCUS_52010 88648 86876 gene locus_tag LOCUS_52020 88648 86876 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328762.1 protein_id gnl|my_center|LOCUS_52020 89695 88946 gene locus_tag LOCUS_52030 89695 88946 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973884.1 protein_id gnl|my_center|LOCUS_52030 90500 89841 gene locus_tag LOCUS_52040 90500 89841 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394092.1 protein_id gnl|my_center|LOCUS_52040 90644 91846 gene locus_tag LOCUS_52050 90644 91846 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435151.1 protein_id gnl|my_center|LOCUS_52050 91873 93462 gene locus_tag LOCUS_52060 91873 93462 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394130.1 protein_id gnl|my_center|LOCUS_52060 93533 94645 gene locus_tag LOCUS_52070 93533 94645 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984026.1 protein_id gnl|my_center|LOCUS_52070 94729 95778 gene locus_tag LOCUS_52080 94729 95778 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970275.1 protein_id gnl|my_center|LOCUS_52080 95789 97243 gene locus_tag LOCUS_52090 gene xylB 95789 97243 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970274.1 protein_id gnl|my_center|LOCUS_52090 97271 98581 gene locus_tag LOCUS_52100 gene xylA 97271 98581 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394143.1 protein_id gnl|my_center|LOCUS_52100 98930 100438 gene locus_tag LOCUS_52110 98930 100438 CDS product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971342.1 protein_id gnl|my_center|LOCUS_52110 101504 100473 gene locus_tag LOCUS_52120 101504 100473 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976232.1 protein_id gnl|my_center|LOCUS_52120 101725 103251 gene locus_tag LOCUS_52130 101725 103251 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976233.1 protein_id gnl|my_center|LOCUS_52130 103286 104308 gene locus_tag LOCUS_52140 103286 104308 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969889.1 protein_id gnl|my_center|LOCUS_52140 104402 105355 gene locus_tag LOCUS_52150 104402 105355 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173518343.1 protein_id gnl|my_center|LOCUS_52150 105644 106696 gene locus_tag LOCUS_52160 105644 106696 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509042.1 protein_id gnl|my_center|LOCUS_52160 106874 108058 gene locus_tag LOCUS_52170 106874 108058 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970271.1 protein_id gnl|my_center|LOCUS_52170 108967 108101 gene locus_tag LOCUS_52180 108967 108101 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972201.1 protein_id gnl|my_center|LOCUS_52180 109222 110595 gene locus_tag LOCUS_52190 109222 110595 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329855.1 protein_id gnl|my_center|LOCUS_52190 110683 112878 gene locus_tag LOCUS_52200 110683 112878 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316667.1 protein_id gnl|my_center|LOCUS_52200 113832 112879 gene locus_tag LOCUS_52210 113832 112879 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153436966.1 protein_id gnl|my_center|LOCUS_52210 114403 113867 gene locus_tag LOCUS_52220 114403 113867 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970265.1 protein_id gnl|my_center|LOCUS_52220 114507 115145 gene locus_tag LOCUS_52230 114507 115145 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243294.1 protein_id gnl|my_center|LOCUS_52230 115281 115973 gene locus_tag LOCUS_52240 115281 115973 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329844.1 protein_id gnl|my_center|LOCUS_52240 116070 116759 gene locus_tag LOCUS_52250 116070 116759 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066992.1 protein_id gnl|my_center|LOCUS_52250 116756 116968 gene locus_tag LOCUS_52260 116756 116968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389420.1 protein_id gnl|my_center|LOCUS_52260 117977 116979 gene locus_tag LOCUS_52270 117977 116979 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243298.1 protein_id gnl|my_center|LOCUS_52270 118612 117971 gene locus_tag LOCUS_52280 118612 117971 CDS product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394164.1 protein_id gnl|my_center|LOCUS_52280 119605 118700 gene locus_tag LOCUS_52290 119605 118700 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389413.1 protein_id gnl|my_center|LOCUS_52290 120166 121299 gene locus_tag LOCUS_52300 gene odc2 120166 121299 CDS product ornithine/lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970259.1 protein_id gnl|my_center|LOCUS_52300 121392 121982 gene locus_tag LOCUS_52310 121392 121982 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970258.1 protein_id gnl|my_center|LOCUS_52310 122198 122869 gene locus_tag LOCUS_52320 122198 122869 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972835.1 protein_id gnl|my_center|LOCUS_52320 123071 124009 gene locus_tag LOCUS_52330 123071 124009 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850559.1 protein_id gnl|my_center|LOCUS_52330 124279 124725 gene locus_tag LOCUS_52340 124279 124725 CDS product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389404.1 protein_id gnl|my_center|LOCUS_52340 125933 124803 gene locus_tag LOCUS_52350 125933 124803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 126219 126503 gene locus_tag LOCUS_52360 126219 126503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 127315 126581 gene locus_tag LOCUS_52370 127315 126581 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937665.1 protein_id gnl|my_center|LOCUS_52370 128499 127510 gene locus_tag LOCUS_52380 128499 127510 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970256.1 protein_id gnl|my_center|LOCUS_52380 129688 128558 gene locus_tag LOCUS_52390 129688 128558 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243306.1 protein_id gnl|my_center|LOCUS_52390 130615 129824 gene locus_tag LOCUS_52400 130615 129824 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970254.1 protein_id gnl|my_center|LOCUS_52400 130721 131248 gene locus_tag LOCUS_52410 130721 131248 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066980.1 protein_id gnl|my_center|LOCUS_52410 131307 132335 gene locus_tag LOCUS_52420 131307 132335 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970253.1 protein_id gnl|my_center|LOCUS_52420 132364 133353 gene locus_tag LOCUS_52430 132364 133353 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066978.1 protein_id gnl|my_center|LOCUS_52430 133415 133822 gene locus_tag LOCUS_52440 133415 133822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 134606 133827 gene locus_tag LOCUS_52450 134606 133827 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970251.1 protein_id gnl|my_center|LOCUS_52450 135061 137370 gene locus_tag LOCUS_52460 135061 137370 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329826.1 protein_id gnl|my_center|LOCUS_52460 137552 138325 gene locus_tag LOCUS_52470 137552 138325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329825.1 protein_id gnl|my_center|LOCUS_52470 138554 138778 gene locus_tag LOCUS_52480 138554 138778 CDS product aa3-type cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528928.1 protein_id gnl|my_center|LOCUS_52480 138865 140019 gene locus_tag LOCUS_52490 138865 140019 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209603474.1 protein_id gnl|my_center|LOCUS_52490 140019 140429 gene locus_tag LOCUS_52500 140019 140429 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709410.1 protein_id gnl|my_center|LOCUS_52500 140440 141837 gene locus_tag LOCUS_52510 140440 141837 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528935.1 protein_id gnl|my_center|LOCUS_52510 142807 141908 gene locus_tag LOCUS_52520 142807 141908 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844854.1 protein_id gnl|my_center|LOCUS_52520 143347 143120 gene locus_tag LOCUS_52530 gene rpsU 143347 143120 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313768.1 protein_id gnl|my_center|LOCUS_52530 143678 144931 gene locus_tag LOCUS_52540 143678 144931 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003522141.1 protein_id gnl|my_center|LOCUS_52540 144931 145329 gene locus_tag LOCUS_52550 144931 145329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992432.1 protein_id gnl|my_center|LOCUS_52550 145344 145688 gene locus_tag LOCUS_52560 145344 145688 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970243.1 protein_id gnl|my_center|LOCUS_52560 145685 148678 gene locus_tag LOCUS_52570 145685 148678 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329816.1 protein_id gnl|my_center|LOCUS_52570 148671 149219 gene locus_tag LOCUS_52580 148671 149219 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329815.1 protein_id gnl|my_center|LOCUS_52580 149865 149380 gene locus_tag LOCUS_52590 149865 149380 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970238.1 protein_id gnl|my_center|LOCUS_52590 151896 149929 gene locus_tag LOCUS_52600 gene glgX 151896 149929 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394194.1 protein_id gnl|my_center|LOCUS_52600 153535 151904 gene locus_tag LOCUS_52610 153535 151904 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394196.1 protein_id gnl|my_center|LOCUS_52610 154997 153549 gene locus_tag LOCUS_52620 gene glgA 154997 153549 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040961719.1 protein_id gnl|my_center|LOCUS_52620 156268 155006 gene locus_tag LOCUS_52630 gene glgC 156268 155006 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533906.1 protein_id gnl|my_center|LOCUS_52630 158504 156291 gene locus_tag LOCUS_52640 gene glgB 158504 156291 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533907.1 protein_id gnl|my_center|LOCUS_52640 160963 158504 gene locus_tag LOCUS_52650 160963 158504 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394244.1 protein_id gnl|my_center|LOCUS_52650 162378 161167 gene locus_tag LOCUS_52660 162378 161167 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066953.1 protein_id gnl|my_center|LOCUS_52660 163407 162520 gene locus_tag LOCUS_52670 163407 162520 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394246.1 protein_id gnl|my_center|LOCUS_52670 165826 163430 gene locus_tag LOCUS_52680 165826 163430 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394219.1 protein_id gnl|my_center|LOCUS_52680 169165 165848 gene locus_tag LOCUS_52690 169165 165848 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243330.1 protein_id gnl|my_center|LOCUS_52690 170068 169295 gene locus_tag LOCUS_52700 170068 169295 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970229.1 protein_id gnl|my_center|LOCUS_52700 170847 170113 gene locus_tag LOCUS_52710 170847 170113 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038724.1 protein_id gnl|my_center|LOCUS_52710 171390 170929 gene locus_tag LOCUS_52720 171390 170929 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394231.1 protein_id gnl|my_center|LOCUS_52720 171477 171881 gene locus_tag LOCUS_52730 171477 171881 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066939.1 protein_id gnl|my_center|LOCUS_52730 173760 171925 gene locus_tag LOCUS_52740 gene ilvD 173760 171925 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971959.1 protein_id gnl|my_center|LOCUS_52740 173952 175001 gene locus_tag LOCUS_52750 173952 175001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 175012 175362 gene locus_tag LOCUS_52760 175012 175362 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528790.1 protein_id gnl|my_center|LOCUS_52760 176895 175366 gene locus_tag LOCUS_52770 176895 175366 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311047.1 protein_id gnl|my_center|LOCUS_52770 177061 177807 gene locus_tag LOCUS_52780 177061 177807 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975370.1 protein_id gnl|my_center|LOCUS_52780 177868 179016 gene locus_tag LOCUS_52790 gene dgoD 177868 179016 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975371.1 protein_id gnl|my_center|LOCUS_52790 179139 179273 gene locus_tag LOCUS_52800 179139 179273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 180367 179336 gene locus_tag LOCUS_52810 180367 179336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 182112 180628 gene locus_tag LOCUS_52820 182112 180628 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970358.1 protein_id gnl|my_center|LOCUS_52820 182684 182610 gene locus_tag LOCUS_t00520 182684 182610 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 183102 182779 gene locus_tag LOCUS_52830 gene cpdR1 183102 182779 CDS product response regulator CpdR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531148.1 protein_id gnl|my_center|LOCUS_52830 183332 184216 gene locus_tag LOCUS_52840 183332 184216 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066934.1 protein_id gnl|my_center|LOCUS_52840 184485 185258 gene locus_tag LOCUS_52850 gene hisN 184485 185258 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970219.1 protein_id gnl|my_center|LOCUS_52850 186278 185316 gene locus_tag LOCUS_52860 186278 185316 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393510.1 protein_id gnl|my_center|LOCUS_52860 186727 187188 gene locus_tag LOCUS_52870 186727 187188 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709372.1 protein_id gnl|my_center|LOCUS_52870 188311 187265 gene locus_tag LOCUS_52880 188311 187265 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970208.1 protein_id gnl|my_center|LOCUS_52880 188825 193549 gene locus_tag LOCUS_52890 gene gltB 188825 193549 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066927.1 protein_id gnl|my_center|LOCUS_52890 193776 195233 gene locus_tag LOCUS_52900 193776 195233 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970206.1 protein_id gnl|my_center|LOCUS_52900 196340 195375 gene locus_tag LOCUS_52910 196340 195375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 196655 196392 gene locus_tag LOCUS_52920 196655 196392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 196955 196728 gene locus_tag LOCUS_52930 196955 196728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 196839 197102 gene locus_tag LOCUS_52940 196839 197102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 197102 197767 gene locus_tag LOCUS_52950 197102 197767 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339372.1 protein_id gnl|my_center|LOCUS_52950 197764 199107 gene locus_tag LOCUS_52960 197764 199107 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339373.1 protein_id gnl|my_center|LOCUS_52960 200284 199154 gene locus_tag LOCUS_52970 200284 199154 CDS product DUF459 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970205.1 protein_id gnl|my_center|LOCUS_52970 201655 200435 gene locus_tag LOCUS_52980 201655 200435 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531122.1 protein_id gnl|my_center|LOCUS_52980 201874 202761 gene locus_tag LOCUS_52990 gene galU 201874 202761 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066923.1 protein_id gnl|my_center|LOCUS_52990 204261 202765 gene locus_tag LOCUS_53000 204261 202765 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970203.1 protein_id gnl|my_center|LOCUS_53000 204408 205403 gene locus_tag LOCUS_53010 204408 205403 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973310.1 protein_id gnl|my_center|LOCUS_53010 206024 205566 gene locus_tag LOCUS_53020 206024 205566 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531117.1 protein_id gnl|my_center|LOCUS_53020 207073 206027 gene locus_tag LOCUS_53030 207073 206027 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531115.1 protein_id gnl|my_center|LOCUS_53030 208235 207171 gene locus_tag LOCUS_53040 gene hemH 208235 207171 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393586.1 protein_id gnl|my_center|LOCUS_53040 210345 208399 gene locus_tag LOCUS_53050 210345 208399 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970201.1 protein_id gnl|my_center|LOCUS_53050 210922 210551 gene locus_tag LOCUS_53060 gene omp10 210922 210551 CDS product outer membrane lipoprotein Omp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531074.1 protein_id gnl|my_center|LOCUS_53060 212647 211196 gene locus_tag LOCUS_53070 212647 211196 CDS product homospermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970200.1 protein_id gnl|my_center|LOCUS_53070 213674 212781 gene locus_tag LOCUS_53080 213674 212781 CDS product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393562.1 protein_id gnl|my_center|LOCUS_53080 214444 213671 gene locus_tag LOCUS_53090 214444 213671 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531062.1 protein_id gnl|my_center|LOCUS_53090 215586 214429 gene locus_tag LOCUS_53100 215586 214429 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066901.1 protein_id gnl|my_center|LOCUS_53100 217455 215608 gene locus_tag LOCUS_53110 217455 215608 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066900.1 protein_id gnl|my_center|LOCUS_53110 217622 219151 gene locus_tag LOCUS_53120 217622 219151 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393570.1 protein_id gnl|my_center|LOCUS_53120 219393 221120 gene locus_tag LOCUS_53130 219393 221120 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531050.1 protein_id gnl|my_center|LOCUS_53130 221510 221247 gene locus_tag LOCUS_53140 221510 221247 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970195.1 protein_id gnl|my_center|LOCUS_53140 221914 221609 gene locus_tag LOCUS_53150 221914 221609 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970194.1 protein_id gnl|my_center|LOCUS_53150 222740 221925 gene locus_tag LOCUS_53160 222740 221925 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066894.1 protein_id gnl|my_center|LOCUS_53160 223011 223487 gene locus_tag LOCUS_53170 223011 223487 CDS product DUF1036 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066893.1 protein_id gnl|my_center|LOCUS_53170 223550 224926 gene locus_tag LOCUS_53180 gene pyk 223550 224926 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066892.1 protein_id gnl|my_center|LOCUS_53180 226039 225032 gene locus_tag LOCUS_53190 226039 225032 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393578.1 protein_id gnl|my_center|LOCUS_53190 226726 226118 gene locus_tag LOCUS_53200 226726 226118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970192.1 protein_id gnl|my_center|LOCUS_53200 226943 226818 gene locus_tag LOCUS_53210 gene ykgO 226943 226818 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003497670.1 protein_id gnl|my_center|LOCUS_53210 228171 227113 gene locus_tag LOCUS_53220 228171 227113 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970190.1 protein_id gnl|my_center|LOCUS_53220 228671 228168 gene locus_tag LOCUS_53230 gene purE 228671 228168 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077767952.1 protein_id gnl|my_center|LOCUS_53230 228891 228688 gene locus_tag LOCUS_53240 228891 228688 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066888.1 protein_id gnl|my_center|LOCUS_53240 229110 229283 gene locus_tag LOCUS_53250 229110 229283 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709330.1 protein_id gnl|my_center|LOCUS_53250 229732 229472 gene locus_tag LOCUS_53260 229732 229472 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536024.1 protein_id gnl|my_center|LOCUS_53260 230571 229801 gene locus_tag LOCUS_53270 230571 229801 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563385.1 protein_id gnl|my_center|LOCUS_53270 230661 231314 gene locus_tag LOCUS_53280 230661 231314 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243372.1 protein_id gnl|my_center|LOCUS_53280 231324 232469 gene locus_tag LOCUS_53290 231324 232469 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066884.1 protein_id gnl|my_center|LOCUS_53290 232650 233450 gene locus_tag LOCUS_53300 232650 233450 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329745.1 protein_id gnl|my_center|LOCUS_53300 233560 234639 gene locus_tag LOCUS_53310 233560 234639 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393599.1 protein_id gnl|my_center|LOCUS_53310 234642 235673 gene locus_tag LOCUS_53320 234642 235673 CDS product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243374.1 protein_id gnl|my_center|LOCUS_53320 236667 235675 gene locus_tag LOCUS_53330 236667 235675 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526811.1 protein_id gnl|my_center|LOCUS_53330 238567 236744 gene locus_tag LOCUS_53340 238567 236744 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066880.1 protein_id gnl|my_center|LOCUS_53340 238758 238979 gene locus_tag LOCUS_53350 gene rpmE 238758 238979 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970183.1 protein_id gnl|my_center|LOCUS_53350 239795 239277 gene locus_tag LOCUS_53360 239795 239277 CDS product DUF1465 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066879.1 protein_id gnl|my_center|LOCUS_53360 240365 240177 gene locus_tag LOCUS_53370 240365 240177 CDS product DUF1192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018235560.1 protein_id gnl|my_center|LOCUS_53370 241516 240362 gene locus_tag LOCUS_53380 241516 240362 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536011.1 protein_id gnl|my_center|LOCUS_53380 241430 241669 gene locus_tag LOCUS_53390 241430 241669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 241792 241947 gene locus_tag LOCUS_53400 241792 241947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066876.1 protein_id gnl|my_center|LOCUS_53400 243530 242331 gene locus_tag LOCUS_53410 243530 242331 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393616.1 protein_id gnl|my_center|LOCUS_53410 244110 243547 gene locus_tag LOCUS_53420 244110 243547 CDS product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970178.1 protein_id gnl|my_center|LOCUS_53420 245123 244122 gene locus_tag LOCUS_53430 gene gap 245123 244122 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384869.1 protein_id gnl|my_center|LOCUS_53430 247144 245189 gene locus_tag LOCUS_53440 gene tkt 247144 245189 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535989.1 protein_id gnl|my_center|LOCUS_53440 247501 247773 gene locus_tag LOCUS_53450 247501 247773 CDS product DUF4164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066868.1 protein_id gnl|my_center|LOCUS_53450 247797 248168 gene locus_tag LOCUS_53460 247797 248168 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066867.1 protein_id gnl|my_center|LOCUS_53460 248831 248487 gene locus_tag LOCUS_53470 248831 248487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 250011 249049 gene locus_tag LOCUS_53480 gene tal 250011 249049 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309875.1 protein_id gnl|my_center|LOCUS_53480 250301 251287 gene locus_tag LOCUS_53490 250301 251287 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973872.1 protein_id gnl|my_center|LOCUS_53490 251513 251292 gene locus_tag LOCUS_53500 251513 251292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 251733 252317 gene locus_tag LOCUS_53510 251733 252317 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243388.1 protein_id gnl|my_center|LOCUS_53510 252327 253151 gene locus_tag LOCUS_53520 252327 253151 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066864.1 protein_id gnl|my_center|LOCUS_53520 253785 253249 gene locus_tag LOCUS_53530 253785 253249 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973282.1 protein_id gnl|my_center|LOCUS_53530 253952 254788 gene locus_tag LOCUS_53540 253952 254788 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258152.1 protein_id gnl|my_center|LOCUS_53540 254804 255298 gene locus_tag LOCUS_53550 254804 255298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 255468 256214 gene locus_tag LOCUS_53560 255468 256214 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970171.1 protein_id gnl|my_center|LOCUS_53560 257371 256376 gene locus_tag LOCUS_53570 257371 256376 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393661.1 protein_id gnl|my_center|LOCUS_53570 257543 258055 gene locus_tag LOCUS_53580 gene ruvC 257543 258055 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709296.1 protein_id gnl|my_center|LOCUS_53580 258111 258371 gene locus_tag LOCUS_53590 258111 258371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53590 258352 258768 gene locus_tag LOCUS_53600 258352 258768 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529139.1 protein_id gnl|my_center|LOCUS_53600 258828 259397 gene locus_tag LOCUS_53610 gene ruvA 258828 259397 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393643.1 protein_id gnl|my_center|LOCUS_53610 259438 260478 gene locus_tag LOCUS_53620 gene ruvB 259438 260478 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243394.1 protein_id gnl|my_center|LOCUS_53620 260479 261381 gene locus_tag LOCUS_53630 260479 261381 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970168.1 protein_id gnl|my_center|LOCUS_53630 261433 261918 gene locus_tag LOCUS_53640 gene ybgC 261433 261918 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527598.1 protein_id gnl|my_center|LOCUS_53640 262233 262949 gene locus_tag LOCUS_53650 gene tolQ 262233 262949 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527594.1 protein_id gnl|my_center|LOCUS_53650 263048 263428 gene locus_tag LOCUS_53660 gene tolR 263048 263428 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310275.1 protein_id gnl|my_center|LOCUS_53660 263438 264550 gene locus_tag LOCUS_53670 263438 264550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527590.1 protein_id gnl|my_center|LOCUS_53670 264835 266139 gene locus_tag LOCUS_53680 gene tolB 264835 266139 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041409417.1 protein_id gnl|my_center|LOCUS_53680 266383 266919 gene locus_tag LOCUS_53690 gene pal 266383 266919 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527588.1 protein_id gnl|my_center|LOCUS_53690 267071 268066 gene locus_tag LOCUS_53700 gene ybgF 267071 268066 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329703.1 protein_id gnl|my_center|LOCUS_53700 268087 269373 gene locus_tag LOCUS_53710 gene tilS 268087 269373 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393675.1 protein_id gnl|my_center|LOCUS_53710 269574 271496 gene locus_tag LOCUS_53720 gene ftsH 269574 271496 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709279.1 protein_id gnl|my_center|LOCUS_53720 271779 273131 gene locus_tag LOCUS_53730 gene glmM 271779 273131 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527581.1 protein_id gnl|my_center|LOCUS_53730 273404 274225 gene locus_tag LOCUS_53740 273404 274225 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970160.1 protein_id gnl|my_center|LOCUS_53740 274433 275266 gene locus_tag LOCUS_53750 274433 275266 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984017.1 protein_id gnl|my_center|LOCUS_53750 275444 276625 gene locus_tag LOCUS_53760 275444 276625 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970159.1 protein_id gnl|my_center|LOCUS_53760 276701 278296 gene locus_tag LOCUS_53770 gene serA 276701 278296 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243413.1 protein_id gnl|my_center|LOCUS_53770 279408 278515 gene locus_tag LOCUS_53780 279408 278515 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970157.1 protein_id gnl|my_center|LOCUS_53780 279630 280934 gene locus_tag LOCUS_53790 279630 280934 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243415.1 protein_id gnl|my_center|LOCUS_53790 281037 283256 gene locus_tag LOCUS_53800 281037 283256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 283866 283318 gene locus_tag LOCUS_53810 283866 283318 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974264.1 protein_id gnl|my_center|LOCUS_53810 284936 284031 gene locus_tag LOCUS_53820 gene rpoH 284936 284031 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314928.1 protein_id gnl|my_center|LOCUS_53820 286220 285195 gene locus_tag LOCUS_53830 286220 285195 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527565.1 protein_id gnl|my_center|LOCUS_53830 286256 286648 gene locus_tag LOCUS_53840 286256 286648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393682.1 protein_id gnl|my_center|LOCUS_53840 286655 287485 gene locus_tag LOCUS_53850 286655 287485 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066830.1 protein_id gnl|my_center|LOCUS_53850 287904 287521 gene locus_tag LOCUS_53860 287904 287521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 289077 287929 gene locus_tag LOCUS_53870 289077 287929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329649.1 protein_id gnl|my_center|LOCUS_53870 289814 289215 gene locus_tag LOCUS_53880 289814 289215 CDS product DUF1134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066828.1 protein_id gnl|my_center|LOCUS_53880 290013 290666 gene locus_tag LOCUS_53890 290013 290666 CDS product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393686.1 protein_id gnl|my_center|LOCUS_53890 290782 291144 gene locus_tag LOCUS_53900 290782 291144 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066826.1 protein_id gnl|my_center|LOCUS_53900 292009 291311 gene locus_tag LOCUS_53910 gene ctrA 292009 291311 CDS product cell cycle two-component system response regulator CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527557.1 protein_id gnl|my_center|LOCUS_53910 292537 292887 gene locus_tag LOCUS_53920 292537 292887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329643.1 protein_id gnl|my_center|LOCUS_53920 293253 292972 gene locus_tag LOCUS_53930 293253 292972 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972317.1 protein_id gnl|my_center|LOCUS_53930 293395 293856 gene locus_tag LOCUS_53940 293395 293856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 294197 293922 gene locus_tag LOCUS_53950 294197 293922 CDS product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527546.1 protein_id gnl|my_center|LOCUS_53950 294634 295383 gene locus_tag LOCUS_53960 294634 295383 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527543.1 protein_id gnl|my_center|LOCUS_53960 295609 296805 gene locus_tag LOCUS_53970 gene mnmA 295609 296805 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970150.1 protein_id gnl|my_center|LOCUS_53970 296937 297013 gene locus_tag LOCUS_t00530 296937 297013 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 297324 297581 gene locus_tag LOCUS_53980 297324 297581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 297568 298545 gene locus_tag LOCUS_53990 297568 298545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53990 299139 298933 gene locus_tag LOCUS_54000 299139 298933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 300152 299139 gene locus_tag LOCUS_54010 300152 299139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 300380 300156 gene locus_tag LOCUS_54020 300380 300156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 300847 300377 gene locus_tag LOCUS_54030 300847 300377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54030 303246 300844 gene locus_tag LOCUS_54040 303246 300844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54040 303874 303374 gene locus_tag LOCUS_54050 303874 303374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 304494 303952 gene locus_tag LOCUS_54060 304494 303952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 305763 304507 gene locus_tag LOCUS_54070 305763 304507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 306353 305928 gene locus_tag LOCUS_54080 306353 305928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 307110 306355 gene locus_tag LOCUS_54090 307110 306355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 308256 307123 gene locus_tag LOCUS_54100 308256 307123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 308964 308257 gene locus_tag LOCUS_54110 308964 308257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 313022 308982 gene locus_tag LOCUS_54120 313022 308982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 314026 313019 gene locus_tag LOCUS_54130 314026 313019 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268327.1 protein_id gnl|my_center|LOCUS_54130 314427 314029 gene locus_tag LOCUS_54140 314427 314029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 314668 314441 gene locus_tag LOCUS_54150 314668 314441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 315192 314680 gene locus_tag LOCUS_54160 315192 314680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 315808 315185 gene locus_tag LOCUS_54170 315808 315185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 316284 315805 gene locus_tag LOCUS_54180 316284 315805 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072637.1 protein_id gnl|my_center|LOCUS_54180 316742 316284 gene locus_tag LOCUS_54190 316742 316284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 317261 317004 gene locus_tag LOCUS_54200 317261 317004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54200 318278 317382 gene locus_tag LOCUS_54210 318278 317382 CDS product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070999.1 protein_id gnl|my_center|LOCUS_54210 318706 318302 gene locus_tag LOCUS_54220 318706 318302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54220 319648 318725 gene locus_tag LOCUS_54230 319648 318725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 319991 320449 gene locus_tag LOCUS_54240 319991 320449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 321807 320560 gene locus_tag LOCUS_54250 321807 320560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 323475 321811 gene locus_tag LOCUS_54260 323475 321811 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072627.1 protein_id gnl|my_center|LOCUS_54260 324806 323469 gene locus_tag LOCUS_54270 324806 323469 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889353.1 protein_id gnl|my_center|LOCUS_54270 325387 324803 gene locus_tag LOCUS_54280 325387 324803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54280 325688 325389 gene locus_tag LOCUS_54290 325688 325389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 326014 325685 gene locus_tag LOCUS_54300 326014 325685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 326295 326014 gene locus_tag LOCUS_54310 326295 326014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54310 326590 326228 gene locus_tag LOCUS_54320 326590 326228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 326874 326587 gene locus_tag LOCUS_54330 326874 326587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 327602 326871 gene locus_tag LOCUS_54340 327602 326871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 328112 327714 gene locus_tag LOCUS_54350 328112 327714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 328309 328109 gene locus_tag LOCUS_54360 328309 328109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 328551 328309 gene locus_tag LOCUS_54370 328551 328309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 329201 328548 gene locus_tag LOCUS_54380 329201 328548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 329482 329198 gene locus_tag LOCUS_54390 329482 329198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 329762 329475 gene locus_tag LOCUS_54400 329762 329475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 329991 329755 gene locus_tag LOCUS_54410 329991 329755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 330355 329984 gene locus_tag LOCUS_54420 330355 329984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 330558 330352 gene locus_tag LOCUS_54430 330558 330352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 330821 330555 gene locus_tag LOCUS_54440 330821 330555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 331590 330832 gene locus_tag LOCUS_54450 331590 330832 CDS product DUF3164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070973.1 protein_id gnl|my_center|LOCUS_54450 331896 331603 gene locus_tag LOCUS_54460 331896 331603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 332204 331893 gene locus_tag LOCUS_54470 332204 331893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 333238 332201 gene locus_tag LOCUS_54480 333238 332201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54480 335318 333360 gene locus_tag LOCUS_54490 335318 333360 CDS product transposase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072599.1 protein_id gnl|my_center|LOCUS_54490 335542 335315 gene locus_tag LOCUS_54500 335542 335315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 336218 335763 gene locus_tag LOCUS_54510 336218 335763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 337093 336215 gene locus_tag LOCUS_54520 337093 336215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 337446 337093 gene locus_tag LOCUS_54530 337446 337093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54530 337760 337443 gene locus_tag LOCUS_54540 337760 337443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 338092 337760 gene locus_tag LOCUS_54550 338092 337760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54550 338268 338753 gene locus_tag LOCUS_54560 338268 338753 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971902.1 protein_id gnl|my_center|LOCUS_54560 339441 339208 gene locus_tag LOCUS_54570 339441 339208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 340026 339883 gene locus_tag LOCUS_54580 340026 339883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 340315 341508 gene locus_tag LOCUS_54590 340315 341508 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399216.1 protein_id gnl|my_center|LOCUS_54590 341530 342402 gene locus_tag LOCUS_54600 341530 342402 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709905.1 protein_id gnl|my_center|LOCUS_54600 342478 343464 gene locus_tag LOCUS_54610 342478 343464 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399212.1 protein_id gnl|my_center|LOCUS_54610 343461 344234 gene locus_tag LOCUS_54620 343461 344234 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399209.1 protein_id gnl|my_center|LOCUS_54620 344224 344967 gene locus_tag LOCUS_54630 344224 344967 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399206.1 protein_id gnl|my_center|LOCUS_54630 344990 346198 gene locus_tag LOCUS_54640 344990 346198 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399197.1 protein_id gnl|my_center|LOCUS_54640 346468 347406 gene locus_tag LOCUS_54650 gene nac 346468 347406 CDS product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399193.1 protein_id gnl|my_center|LOCUS_54650 347725 349788 gene locus_tag LOCUS_54660 347725 349788 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399237.1 protein_id gnl|my_center|LOCUS_54660 349800 351470 gene locus_tag LOCUS_54670 349800 351470 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399188.1 protein_id gnl|my_center|LOCUS_54670 351541 352353 gene locus_tag LOCUS_54680 351541 352353 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251678.1 protein_id gnl|my_center|LOCUS_54680 352350 353054 gene locus_tag LOCUS_54690 352350 353054 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399178.1 protein_id gnl|my_center|LOCUS_54690 354570 353824 gene locus_tag LOCUS_54700 354570 353824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54700 354956 355525 gene locus_tag LOCUS_54710 354956 355525 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844626.1 protein_id gnl|my_center|LOCUS_54710 355635 355796 gene locus_tag LOCUS_54720 355635 355796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531192.1 protein_id gnl|my_center|LOCUS_54720 356698 355859 gene locus_tag LOCUS_54730 356698 355859 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338042.1 protein_id gnl|my_center|LOCUS_54730 356812 357486 gene locus_tag LOCUS_54740 356812 357486 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402117.1 protein_id gnl|my_center|LOCUS_54740 359003 357606 gene locus_tag LOCUS_54750 359003 357606 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972396.1 protein_id gnl|my_center|LOCUS_54750 359690 359908 gene locus_tag LOCUS_54760 359690 359908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327249.1 protein_id gnl|my_center|LOCUS_54760 360064 361620 gene locus_tag LOCUS_54770 360064 361620 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969972.1 protein_id gnl|my_center|LOCUS_54770 362224 361667 gene locus_tag LOCUS_54780 362224 361667 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066626.1 protein_id gnl|my_center|LOCUS_54780 363252 362299 gene locus_tag LOCUS_54790 363252 362299 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969975.1 protein_id gnl|my_center|LOCUS_54790 363601 365919 gene locus_tag LOCUS_54800 gene mcpU 363601 365919 CDS product methyl-accepting chemotaxis protein McpU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158072.1 protein_id gnl|my_center|LOCUS_54800 366510 367550 gene locus_tag LOCUS_54810 366510 367550 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527919.1 protein_id gnl|my_center|LOCUS_54810 367547 368620 gene locus_tag LOCUS_54820 367547 368620 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973327.1 protein_id gnl|my_center|LOCUS_54820 368617 371700 gene locus_tag LOCUS_54830 368617 371700 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973326.1 protein_id gnl|my_center|LOCUS_54830 372239 373378 gene locus_tag LOCUS_54840 372239 373378 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968675.1 protein_id gnl|my_center|LOCUS_54840 373482 375509 gene locus_tag LOCUS_54850 373482 375509 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930473.1 protein_id gnl|my_center|LOCUS_54850 375686 377098 gene locus_tag LOCUS_54860 375686 377098 CDS product capsular biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161827.1 protein_id gnl|my_center|LOCUS_54860 377866 377183 gene locus_tag LOCUS_54870 377866 377183 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867744.1 protein_id gnl|my_center|LOCUS_54870 378657 377866 gene locus_tag LOCUS_54880 378657 377866 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930466.1 protein_id gnl|my_center|LOCUS_54880 380094 378682 gene locus_tag LOCUS_54890 380094 378682 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061905.1 protein_id gnl|my_center|LOCUS_54890 381104 380277 gene locus_tag LOCUS_54900 gene cysQ 381104 380277 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061494.1 protein_id gnl|my_center|LOCUS_54900 381298 382548 gene locus_tag LOCUS_54910 381298 382548 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067492.1 protein_id gnl|my_center|LOCUS_54910 382556 382831 gene locus_tag LOCUS_54920 382556 382831 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973656.1 protein_id gnl|my_center|LOCUS_54920 382828 385785 gene locus_tag LOCUS_54930 382828 385785 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968344.1 protein_id gnl|my_center|LOCUS_54930 385795 386349 gene locus_tag LOCUS_54940 385795 386349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54940 386472 388898 gene locus_tag LOCUS_54950 386472 388898 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_54950 389182 390084 gene locus_tag LOCUS_54960 389182 390084 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525638.1 protein_id gnl|my_center|LOCUS_54960 390088 391476 gene locus_tag LOCUS_54970 gene livM 390088 391476 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394369.1 protein_id gnl|my_center|LOCUS_54970 391476 392384 gene locus_tag LOCUS_54980 391476 392384 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066618.1 protein_id gnl|my_center|LOCUS_54980 392384 393109 gene locus_tag LOCUS_54990 392384 393109 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314982.1 protein_id gnl|my_center|LOCUS_54990 393216 393560 gene locus_tag LOCUS_55000 393216 393560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329310.1 protein_id gnl|my_center|LOCUS_55000 393673 394791 gene locus_tag LOCUS_55010 393673 394791 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525631.1 protein_id gnl|my_center|LOCUS_55010 395001 395846 gene locus_tag LOCUS_55020 395001 395846 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969965.1 protein_id gnl|my_center|LOCUS_55020 395944 396246 gene locus_tag LOCUS_55030 395944 396246 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525618.1 protein_id gnl|my_center|LOCUS_55030 396251 396505 gene locus_tag LOCUS_55040 396251 396505 CDS product DUF1272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528396.1 protein_id gnl|my_center|LOCUS_55040 396516 396821 gene locus_tag LOCUS_55050 396516 396821 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240195.1 protein_id gnl|my_center|LOCUS_55050 396823 397257 gene locus_tag LOCUS_55060 396823 397257 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255339.1 protein_id gnl|my_center|LOCUS_55060 397269 397889 gene locus_tag LOCUS_55070 397269 397889 CDS product Urease operon accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132073684.1 protein_id gnl|my_center|LOCUS_55070 398014 399720 gene locus_tag LOCUS_55080 gene ureC 398014 399720 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315008.1 protein_id gnl|my_center|LOCUS_55080 399858 400691 gene locus_tag LOCUS_55090 399858 400691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 400800 401270 gene locus_tag LOCUS_55100 gene ureE 400800 401270 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394424.1 protein_id gnl|my_center|LOCUS_55100 401263 401934 gene locus_tag LOCUS_55110 401263 401934 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394469.1 protein_id gnl|my_center|LOCUS_55110 402029 402640 gene locus_tag LOCUS_55120 gene ureG 402029 402640 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394427.1 protein_id gnl|my_center|LOCUS_55120 403345 402662 gene locus_tag LOCUS_55130 403345 402662 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315015.1 protein_id gnl|my_center|LOCUS_55130 406806 403495 gene locus_tag LOCUS_55140 406806 403495 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969955.1 protein_id gnl|my_center|LOCUS_55140 408166 407009 gene locus_tag LOCUS_55150 408166 407009 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066597.1 protein_id gnl|my_center|LOCUS_55150 409526 408534 gene locus_tag LOCUS_55160 409526 408534 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969953.1 protein_id gnl|my_center|LOCUS_55160 410419 409550 gene locus_tag LOCUS_55170 410419 409550 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969952.1 protein_id gnl|my_center|LOCUS_55170 411300 410416 gene locus_tag LOCUS_55180 411300 410416 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394444.1 protein_id gnl|my_center|LOCUS_55180 411639 411304 gene locus_tag LOCUS_55190 411639 411304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528672.1 protein_id gnl|my_center|LOCUS_55190 412442 411639 gene locus_tag LOCUS_55200 412442 411639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066592.1 protein_id gnl|my_center|LOCUS_55200 412565 412978 gene locus_tag LOCUS_55210 412565 412978 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530912.1 protein_id gnl|my_center|LOCUS_55210 413559 413194 gene locus_tag LOCUS_55220 413559 413194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 415010 413556 gene locus_tag LOCUS_55230 gene hydA 415010 413556 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651148.1 protein_id gnl|my_center|LOCUS_55230 415648 415007 gene locus_tag LOCUS_55240 415648 415007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 416903 415653 gene locus_tag LOCUS_55250 416903 415653 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394455.1 protein_id gnl|my_center|LOCUS_55250 417172 417822 gene locus_tag LOCUS_55260 gene rutR 417172 417822 CDS product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525590.1 protein_id gnl|my_center|LOCUS_55260 418999 417803 gene locus_tag LOCUS_55270 gene opgC 418999 417803 CDS product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973266.1 protein_id gnl|my_center|LOCUS_55270 420034 419105 gene locus_tag LOCUS_55280 420034 419105 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114958.1 protein_id gnl|my_center|LOCUS_55280 420197 420835 gene locus_tag LOCUS_55290 420197 420835 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971485.1 protein_id gnl|my_center|LOCUS_55290 422430 421117 gene locus_tag LOCUS_55300 gene preA 422430 421117 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969942.1 protein_id gnl|my_center|LOCUS_55300 423807 422446 gene locus_tag LOCUS_55310 423807 422446 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563248.1 protein_id gnl|my_center|LOCUS_55310 424054 425007 gene locus_tag LOCUS_55320 424054 425007 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329274.1 protein_id gnl|my_center|LOCUS_55320 425167 426480 gene locus_tag LOCUS_55330 425167 426480 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387630.1 protein_id gnl|my_center|LOCUS_55330 >Feature sequence33 1184 282 gene locus_tag LOCUS_55340 1184 282 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035566.1 protein_id gnl|my_center|LOCUS_55340 1279 2031 gene locus_tag LOCUS_55350 1279 2031 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035567.1 protein_id gnl|my_center|LOCUS_55350 3113 2190 gene locus_tag LOCUS_55360 3113 2190 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109873241.1 protein_id gnl|my_center|LOCUS_55360 3235 3960 gene locus_tag LOCUS_55370 3235 3960 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971202.1 protein_id gnl|my_center|LOCUS_55370 4849 4535 gene locus_tag LOCUS_55380 4849 4535 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810016.1 protein_id gnl|my_center|LOCUS_55380 5640 4888 gene locus_tag LOCUS_55390 5640 4888 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_55390 6450 5650 gene locus_tag LOCUS_55400 6450 5650 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195445.1 protein_id gnl|my_center|LOCUS_55400 7240 6440 gene locus_tag LOCUS_55410 7240 6440 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853567.1 protein_id gnl|my_center|LOCUS_55410 7771 7256 gene locus_tag LOCUS_55420 7771 7256 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384583.1 protein_id gnl|my_center|LOCUS_55420 9528 7783 gene locus_tag LOCUS_55430 gene betA 9528 7783 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763658.1 protein_id gnl|my_center|LOCUS_55430 10572 9538 gene locus_tag LOCUS_55440 10572 9538 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252895.1 protein_id gnl|my_center|LOCUS_55440 11727 10681 gene locus_tag LOCUS_55450 11727 10681 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243759.1 protein_id gnl|my_center|LOCUS_55450 11924 13225 gene locus_tag LOCUS_55460 11924 13225 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976921.1 protein_id gnl|my_center|LOCUS_55460 13400 14233 gene locus_tag LOCUS_55470 13400 14233 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_55470 14245 15084 gene locus_tag LOCUS_55480 14245 15084 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253348.1 protein_id gnl|my_center|LOCUS_55480 15097 16182 gene locus_tag LOCUS_55490 15097 16182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250726.1 protein_id gnl|my_center|LOCUS_55490 16218 17699 gene locus_tag LOCUS_55500 16218 17699 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967747.1 protein_id gnl|my_center|LOCUS_55500 17819 19264 gene locus_tag LOCUS_55510 17819 19264 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776403.1 protein_id gnl|my_center|LOCUS_55510 19267 19926 gene locus_tag LOCUS_55520 19267 19926 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162995.1 protein_id gnl|my_center|LOCUS_55520 20196 21803 gene locus_tag LOCUS_55530 gene betA 20196 21803 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974764.1 protein_id gnl|my_center|LOCUS_55530 22146 23219 gene locus_tag LOCUS_55540 gene xylF 22146 23219 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535546.1 protein_id gnl|my_center|LOCUS_55540 23283 24083 gene locus_tag LOCUS_55550 23283 24083 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972912.1 protein_id gnl|my_center|LOCUS_55550 24076 25299 gene locus_tag LOCUS_55560 24076 25299 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972911.1 protein_id gnl|my_center|LOCUS_55560 26390 25425 gene locus_tag LOCUS_55570 26390 25425 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973600.1 protein_id gnl|my_center|LOCUS_55570 26641 27492 gene locus_tag LOCUS_55580 26641 27492 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092846703.1 protein_id gnl|my_center|LOCUS_55580 27501 28724 gene locus_tag LOCUS_55590 27501 28724 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391159.1 protein_id gnl|my_center|LOCUS_55590 29171 28680 gene locus_tag LOCUS_55600 29171 28680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55600 29538 29227 gene locus_tag LOCUS_55610 29538 29227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55610 29735 29929 gene locus_tag LOCUS_55620 29735 29929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 29987 30214 gene locus_tag LOCUS_55630 29987 30214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 30600 31055 gene locus_tag LOCUS_55640 30600 31055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 31091 31498 gene locus_tag LOCUS_55650 31091 31498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55650 31495 32136 gene locus_tag LOCUS_55660 31495 32136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55660 32130 32504 gene locus_tag LOCUS_55670 32130 32504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 33708 32407 gene locus_tag LOCUS_55680 33708 32407 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528948.1 protein_id gnl|my_center|LOCUS_55680 34647 33715 gene locus_tag LOCUS_55690 34647 33715 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528947.1 protein_id gnl|my_center|LOCUS_55690 34852 35910 gene locus_tag LOCUS_55700 34852 35910 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528946.1 protein_id gnl|my_center|LOCUS_55700 36019 36885 gene locus_tag LOCUS_55710 36019 36885 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528945.1 protein_id gnl|my_center|LOCUS_55710 36882 37673 gene locus_tag LOCUS_55720 36882 37673 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528944.1 protein_id gnl|my_center|LOCUS_55720 37670 38716 gene locus_tag LOCUS_55730 37670 38716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528943.1 protein_id gnl|my_center|LOCUS_55730 38734 40026 gene locus_tag LOCUS_55740 38734 40026 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528942.1 protein_id gnl|my_center|LOCUS_55740 40019 40381 gene locus_tag LOCUS_55750 40019 40381 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528941.1 protein_id gnl|my_center|LOCUS_55750 40411 40758 gene locus_tag LOCUS_55760 40411 40758 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528939.1 protein_id gnl|my_center|LOCUS_55760 40905 42410 gene locus_tag LOCUS_55770 40905 42410 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528938.1 protein_id gnl|my_center|LOCUS_55770 42547 42846 gene locus_tag LOCUS_55780 42547 42846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 43382 42933 gene locus_tag LOCUS_55790 43382 42933 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268734.1 protein_id gnl|my_center|LOCUS_55790 43545 43904 gene locus_tag LOCUS_55800 43545 43904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 43976 44257 gene locus_tag LOCUS_55810 43976 44257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55810 44476 44342 gene locus_tag LOCUS_55820 44476 44342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55820 44638 44519 gene locus_tag LOCUS_55830 44638 44519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55830 45009 46556 gene locus_tag LOCUS_55840 45009 46556 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339154.1 protein_id gnl|my_center|LOCUS_55840 46618 47556 gene locus_tag LOCUS_55850 46618 47556 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723873.1 protein_id gnl|my_center|LOCUS_55850 47568 48419 gene locus_tag LOCUS_55860 47568 48419 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339156.1 protein_id gnl|my_center|LOCUS_55860 48416 50062 gene locus_tag LOCUS_55870 48416 50062 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339155.1 protein_id gnl|my_center|LOCUS_55870 50067 51518 gene locus_tag LOCUS_55880 50067 51518 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031772.1 protein_id gnl|my_center|LOCUS_55880 51525 52460 gene locus_tag LOCUS_55890 51525 52460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 52497 53687 gene locus_tag LOCUS_55900 52497 53687 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529818.1 protein_id gnl|my_center|LOCUS_55900 54920 53958 gene locus_tag LOCUS_55910 54920 53958 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531517.1 protein_id gnl|my_center|LOCUS_55910 55688 54996 gene locus_tag LOCUS_55920 55688 54996 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314733.1 protein_id gnl|my_center|LOCUS_55920 56383 55685 gene locus_tag LOCUS_55930 56383 55685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085934.1 protein_id gnl|my_center|LOCUS_55930 57144 56380 gene locus_tag LOCUS_55940 57144 56380 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705575.1 protein_id gnl|my_center|LOCUS_55940 57997 57227 gene locus_tag LOCUS_55950 gene hisP 57997 57227 CDS product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293609.1 protein_id gnl|my_center|LOCUS_55950 59095 58199 gene locus_tag LOCUS_55960 gene gcvA 59095 58199 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528439.1 protein_id gnl|my_center|LOCUS_55960 59310 59699 gene locus_tag LOCUS_55970 59310 59699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 60163 59753 gene locus_tag LOCUS_55980 60163 59753 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222863.1 protein_id gnl|my_center|LOCUS_55980 60886 60566 gene locus_tag LOCUS_55990 gene sugE 60886 60566 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123025.1 protein_id gnl|my_center|LOCUS_55990 61310 60990 gene locus_tag LOCUS_56000 61310 60990 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035726.1 protein_id gnl|my_center|LOCUS_56000 61632 61829 gene locus_tag LOCUS_56010 61632 61829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 62685 61795 gene locus_tag LOCUS_56020 gene gcvA 62685 61795 CDS product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044409.1 protein_id gnl|my_center|LOCUS_56020 63604 62717 gene locus_tag LOCUS_56030 gene gcvA 63604 62717 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528439.1 protein_id gnl|my_center|LOCUS_56030 63732 64406 gene locus_tag LOCUS_56040 63732 64406 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528962.1 protein_id gnl|my_center|LOCUS_56040 64403 64714 gene locus_tag LOCUS_56050 64403 64714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 64821 65660 gene locus_tag LOCUS_56060 64821 65660 CDS product glutamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930601.1 protein_id gnl|my_center|LOCUS_56060 65679 66356 gene locus_tag LOCUS_56070 65679 66356 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086094.1 protein_id gnl|my_center|LOCUS_56070 66382 67146 gene locus_tag LOCUS_56080 66382 67146 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316326.1 protein_id gnl|my_center|LOCUS_56080 67385 67179 gene locus_tag LOCUS_56090 67385 67179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56090 67299 67880 gene locus_tag LOCUS_56100 67299 67880 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528280.1 protein_id gnl|my_center|LOCUS_56100 69157 67883 gene locus_tag LOCUS_56110 69157 67883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 70875 69592 gene locus_tag LOCUS_56120 70875 69592 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970031.1 protein_id gnl|my_center|LOCUS_56120 71063 71581 gene locus_tag LOCUS_56130 71063 71581 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970030.1 protein_id gnl|my_center|LOCUS_56130 71578 72279 gene locus_tag LOCUS_56140 71578 72279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 73474 72344 gene locus_tag LOCUS_56150 73474 72344 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970993.1 protein_id gnl|my_center|LOCUS_56150 73602 74369 gene locus_tag LOCUS_56160 73602 74369 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967206.1 protein_id gnl|my_center|LOCUS_56160 74709 74443 gene locus_tag LOCUS_56170 74709 74443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56170 74614 75747 gene locus_tag LOCUS_56180 74614 75747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970991.1 protein_id gnl|my_center|LOCUS_56180 75780 76895 gene locus_tag LOCUS_56190 75780 76895 CDS product PotD/PotF family extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970990.1 protein_id gnl|my_center|LOCUS_56190 76961 77905 gene locus_tag LOCUS_56200 76961 77905 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526864.1 protein_id gnl|my_center|LOCUS_56200 77902 78702 gene locus_tag LOCUS_56210 77902 78702 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967209.1 protein_id gnl|my_center|LOCUS_56210 78735 80063 gene locus_tag LOCUS_56220 gene hisD 78735 80063 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970988.1 protein_id gnl|my_center|LOCUS_56220 80069 81082 gene locus_tag LOCUS_56230 80069 81082 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967211.1 protein_id gnl|my_center|LOCUS_56230 81135 81866 gene locus_tag LOCUS_56240 gene hutC 81135 81866 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970986.1 protein_id gnl|my_center|LOCUS_56240 81892 83184 gene locus_tag LOCUS_56250 81892 83184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193377946.1 protein_id gnl|my_center|LOCUS_56250 83186 84343 gene locus_tag LOCUS_56260 83186 84343 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967214.1 protein_id gnl|my_center|LOCUS_56260 86228 84624 gene locus_tag LOCUS_56270 86228 84624 CDS product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895690.1 protein_id gnl|my_center|LOCUS_56270 86978 86256 gene locus_tag LOCUS_56280 86978 86256 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894753.1 protein_id gnl|my_center|LOCUS_56280 87666 86971 gene locus_tag LOCUS_56290 87666 86971 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562698.1 protein_id gnl|my_center|LOCUS_56290 88790 87681 gene locus_tag LOCUS_56300 88790 87681 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140151.1 protein_id gnl|my_center|LOCUS_56300 89896 88868 gene locus_tag LOCUS_56310 89896 88868 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946872.1 protein_id gnl|my_center|LOCUS_56310 90712 89924 gene locus_tag LOCUS_56320 90712 89924 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106179.1 protein_id gnl|my_center|LOCUS_56320 91569 90709 gene locus_tag LOCUS_56330 gene potB 91569 90709 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715491.1 protein_id gnl|my_center|LOCUS_56330 92258 91566 gene locus_tag LOCUS_56340 92258 91566 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391478.1 protein_id gnl|my_center|LOCUS_56340 92549 94087 gene locus_tag LOCUS_56350 gene tcuA 92549 94087 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_56350 94131 95066 gene locus_tag LOCUS_56360 94131 95066 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210056.1 protein_id gnl|my_center|LOCUS_56360 95063 95770 gene locus_tag LOCUS_56370 95063 95770 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086405.1 protein_id gnl|my_center|LOCUS_56370 95807 96520 gene locus_tag LOCUS_56380 95807 96520 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086423.1 protein_id gnl|my_center|LOCUS_56380 96541 98019 gene locus_tag LOCUS_56390 96541 98019 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243012.1 protein_id gnl|my_center|LOCUS_56390 98149 98598 gene locus_tag LOCUS_56400 98149 98598 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050979900.1 protein_id gnl|my_center|LOCUS_56400 98598 100100 gene locus_tag LOCUS_56410 98598 100100 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034850911.1 protein_id gnl|my_center|LOCUS_56410 100203 101150 gene locus_tag LOCUS_56420 gene cysB 100203 101150 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634254.1 protein_id gnl|my_center|LOCUS_56420 101295 102293 gene locus_tag LOCUS_56430 101295 102293 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 protein_id gnl|my_center|LOCUS_56430 102395 102925 gene locus_tag LOCUS_56440 102395 102925 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183459532.1 protein_id gnl|my_center|LOCUS_56440 102922 103527 gene locus_tag LOCUS_56450 102922 103527 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135175700.1 protein_id gnl|my_center|LOCUS_56450 103645 104946 gene locus_tag LOCUS_56460 103645 104946 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533420.1 protein_id gnl|my_center|LOCUS_56460 104981 106372 gene locus_tag LOCUS_56470 104981 106372 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731591.1 protein_id gnl|my_center|LOCUS_56470 106369 109071 gene locus_tag LOCUS_56480 gene acnA 106369 109071 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_56480 109143 109523 gene locus_tag LOCUS_56490 109143 109523 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814363.1 protein_id gnl|my_center|LOCUS_56490 109620 110699 gene locus_tag LOCUS_56500 109620 110699 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114172.1 protein_id gnl|my_center|LOCUS_56500 111435 110839 gene locus_tag LOCUS_56510 111435 110839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56510 112488 111577 gene locus_tag LOCUS_56520 112488 111577 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064335.1 protein_id gnl|my_center|LOCUS_56520 113219 112518 gene locus_tag LOCUS_56530 113219 112518 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809388.1 protein_id gnl|my_center|LOCUS_56530 113421 116105 gene locus_tag LOCUS_56540 gene acnA 113421 116105 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447633.1 protein_id gnl|my_center|LOCUS_56540 116105 117478 gene locus_tag LOCUS_56550 116105 117478 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_56550 117505 118227 gene locus_tag LOCUS_56560 117505 118227 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809371.1 protein_id gnl|my_center|LOCUS_56560 118267 119814 gene locus_tag LOCUS_56570 118267 119814 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243012.1 protein_id gnl|my_center|LOCUS_56570 119836 120999 gene locus_tag LOCUS_56580 119836 120999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 121022 121756 gene locus_tag LOCUS_56590 121022 121756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 121838 122893 gene locus_tag LOCUS_56600 121838 122893 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040409.1 protein_id gnl|my_center|LOCUS_56600 122925 123701 gene locus_tag LOCUS_56610 122925 123701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 protein_id gnl|my_center|LOCUS_56610 123714 124484 gene locus_tag LOCUS_56620 123714 124484 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529864.1 protein_id gnl|my_center|LOCUS_56620 124567 125856 gene locus_tag LOCUS_56630 gene hemL 124567 125856 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_56630 126847 125915 gene locus_tag LOCUS_56640 gene hemC 126847 125915 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139943.1 protein_id gnl|my_center|LOCUS_56640 127804 126965 gene locus_tag LOCUS_56650 127804 126965 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970341.1 protein_id gnl|my_center|LOCUS_56650 128805 127900 gene locus_tag LOCUS_56660 gene dapA 128805 127900 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970340.1 protein_id gnl|my_center|LOCUS_56660 130643 128874 gene locus_tag LOCUS_56670 130643 128874 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121537498.1 protein_id gnl|my_center|LOCUS_56670 131748 130648 gene locus_tag LOCUS_56680 131748 130648 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970338.1 protein_id gnl|my_center|LOCUS_56680 132905 131823 gene locus_tag LOCUS_56690 132905 131823 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970337.1 protein_id gnl|my_center|LOCUS_56690 134407 132977 gene locus_tag LOCUS_56700 134407 132977 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970336.1 protein_id gnl|my_center|LOCUS_56700 134630 135778 gene locus_tag LOCUS_56710 134630 135778 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970343.1 protein_id gnl|my_center|LOCUS_56710 135875 136663 gene locus_tag LOCUS_56720 135875 136663 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808097.1 protein_id gnl|my_center|LOCUS_56720 136869 137882 gene locus_tag LOCUS_56730 136869 137882 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532423.1 protein_id gnl|my_center|LOCUS_56730 138769 137933 gene locus_tag LOCUS_56740 gene proC 138769 137933 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970342.1 protein_id gnl|my_center|LOCUS_56740 139535 138771 gene locus_tag LOCUS_56750 139535 138771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 139803 140552 gene locus_tag LOCUS_56760 139803 140552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 140633 141490 gene locus_tag LOCUS_56770 140633 141490 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_56770 141487 142593 gene locus_tag LOCUS_56780 141487 142593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56780 142595 143344 gene locus_tag LOCUS_56790 142595 143344 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776973.1 protein_id gnl|my_center|LOCUS_56790 143395 144090 gene locus_tag LOCUS_56800 143395 144090 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267425.1 protein_id gnl|my_center|LOCUS_56800 144176 144973 gene locus_tag LOCUS_56810 144176 144973 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808900.1 protein_id gnl|my_center|LOCUS_56810 145106 145879 gene locus_tag LOCUS_56820 145106 145879 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_56820 145923 147467 gene locus_tag LOCUS_56830 145923 147467 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 protein_id gnl|my_center|LOCUS_56830 147464 148567 gene locus_tag LOCUS_56840 147464 148567 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170159.1 protein_id gnl|my_center|LOCUS_56840 148592 150025 gene locus_tag LOCUS_56850 148592 150025 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 protein_id gnl|my_center|LOCUS_56850 150113 150808 gene locus_tag LOCUS_56860 150113 150808 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089765.1 protein_id gnl|my_center|LOCUS_56860 150835 151623 gene locus_tag LOCUS_56870 150835 151623 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067241.1 protein_id gnl|my_center|LOCUS_56870 151757 152872 gene locus_tag LOCUS_56880 151757 152872 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195843.1 protein_id gnl|my_center|LOCUS_56880 152938 153888 gene locus_tag LOCUS_56890 152938 153888 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526290.1 protein_id gnl|my_center|LOCUS_56890 153892 154887 gene locus_tag LOCUS_56900 153892 154887 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064073.1 protein_id gnl|my_center|LOCUS_56900 154863 155687 gene locus_tag LOCUS_56910 154863 155687 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142277.1 protein_id gnl|my_center|LOCUS_56910 155626 156327 gene locus_tag LOCUS_56920 155626 156327 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810743.1 protein_id gnl|my_center|LOCUS_56920 156348 157115 gene locus_tag LOCUS_56930 156348 157115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 157230 157814 gene locus_tag LOCUS_56940 157230 157814 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210333952.1 protein_id gnl|my_center|LOCUS_56940 157843 158607 gene locus_tag LOCUS_56950 157843 158607 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969328.1 protein_id gnl|my_center|LOCUS_56950 159713 158655 gene locus_tag LOCUS_56960 159713 158655 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893107.1 protein_id gnl|my_center|LOCUS_56960 160232 161188 gene locus_tag LOCUS_56970 160232 161188 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401718.1 protein_id gnl|my_center|LOCUS_56970 161185 162087 gene locus_tag LOCUS_56980 161185 162087 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206745.1 protein_id gnl|my_center|LOCUS_56980 162087 163898 gene locus_tag LOCUS_56990 162087 163898 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206746.1 protein_id gnl|my_center|LOCUS_56990 163923 164780 gene locus_tag LOCUS_57000 163923 164780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57000 164808 166367 gene locus_tag LOCUS_57010 164808 166367 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206743.1 protein_id gnl|my_center|LOCUS_57010 166568 167170 gene locus_tag LOCUS_57020 166568 167170 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531379.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57020 167827 167174 gene locus_tag LOCUS_57030 167827 167174 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229311.1 protein_id gnl|my_center|LOCUS_57030 167961 169010 gene locus_tag LOCUS_57040 167961 169010 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_57040 169061 169450 gene locus_tag LOCUS_57050 169061 169450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57050 169487 170608 gene locus_tag LOCUS_57060 169487 170608 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813262.1 protein_id gnl|my_center|LOCUS_57060 170610 171641 gene locus_tag LOCUS_57070 170610 171641 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384466.1 protein_id gnl|my_center|LOCUS_57070 171679 172467 gene locus_tag LOCUS_57080 171679 172467 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973355.1 protein_id gnl|my_center|LOCUS_57080 172732 172475 gene locus_tag LOCUS_57090 172732 172475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 172898 173398 gene locus_tag LOCUS_57100 172898 173398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57100 173507 174346 gene locus_tag LOCUS_57110 173507 174346 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230916.1 protein_id gnl|my_center|LOCUS_57110 174362 175210 gene locus_tag LOCUS_57120 174362 175210 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230915.1 protein_id gnl|my_center|LOCUS_57120 175207 175965 gene locus_tag LOCUS_57130 175207 175965 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 protein_id gnl|my_center|LOCUS_57130 176076 176513 gene locus_tag LOCUS_57140 176076 176513 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525161.1 protein_id gnl|my_center|LOCUS_57140 176522 177424 gene locus_tag LOCUS_57150 176522 177424 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174794.1 protein_id gnl|my_center|LOCUS_57150 177720 178370 gene locus_tag LOCUS_57160 177720 178370 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722779.1 protein_id gnl|my_center|LOCUS_57160 178625 179647 gene locus_tag LOCUS_57170 178625 179647 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098477.1 protein_id gnl|my_center|LOCUS_57170 179689 180684 gene locus_tag LOCUS_57180 179689 180684 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098478.1 protein_id gnl|my_center|LOCUS_57180 180681 181442 gene locus_tag LOCUS_57190 180681 181442 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098479.1 protein_id gnl|my_center|LOCUS_57190 181673 182698 gene locus_tag LOCUS_57200 181673 182698 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969874.1 protein_id gnl|my_center|LOCUS_57200 182841 184175 gene locus_tag LOCUS_57210 182841 184175 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626135.1 protein_id gnl|my_center|LOCUS_57210 184237 185169 gene locus_tag LOCUS_57220 184237 185169 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_57220 185162 185986 gene locus_tag LOCUS_57230 185162 185986 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253348.1 protein_id gnl|my_center|LOCUS_57230 186014 186778 gene locus_tag LOCUS_57240 186014 186778 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067240.1 protein_id gnl|my_center|LOCUS_57240 186837 187955 gene locus_tag LOCUS_57250 186837 187955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337989.1 protein_id gnl|my_center|LOCUS_57250 187984 188754 gene locus_tag LOCUS_57260 187984 188754 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970038.1 protein_id gnl|my_center|LOCUS_57260 188874 189743 gene locus_tag LOCUS_57270 188874 189743 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974125.1 protein_id gnl|my_center|LOCUS_57270 189863 190531 gene locus_tag LOCUS_57280 189863 190531 CDS product nucleoside triphosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974124.1 protein_id gnl|my_center|LOCUS_57280 191008 190676 gene locus_tag LOCUS_57290 191008 190676 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402120.1 protein_id gnl|my_center|LOCUS_57290 191567 191013 gene locus_tag LOCUS_57300 191567 191013 CDS product gluconokinase, GntK/IdnK-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967265.1 protein_id gnl|my_center|LOCUS_57300 191601 192113 gene locus_tag LOCUS_57310 191601 192113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57310 192110 192424 gene locus_tag LOCUS_57320 192110 192424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57320 192445 192927 gene locus_tag LOCUS_57330 192445 192927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57330 193250 194461 gene locus_tag LOCUS_57340 gene moeA 193250 194461 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097438.1 protein_id gnl|my_center|LOCUS_57340 194565 195596 gene locus_tag LOCUS_57350 194565 195596 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390967.1 protein_id gnl|my_center|LOCUS_57350 195597 196613 gene locus_tag LOCUS_57360 195597 196613 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392937.1 protein_id gnl|my_center|LOCUS_57360 196876 196667 gene locus_tag LOCUS_57370 196876 196667 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531022.1 protein_id gnl|my_center|LOCUS_57370 197098 198156 gene locus_tag LOCUS_57380 gene molA 197098 198156 CDS product molybdate ABC transporter substrate-binding protein MolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693488.1 protein_id gnl|my_center|LOCUS_57380 198153 199187 gene locus_tag LOCUS_57390 gene molB 198153 199187 CDS product molybdate ABC transporter permease MolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693487.1 protein_id gnl|my_center|LOCUS_57390 199177 199968 gene locus_tag LOCUS_57400 gene molC 199177 199968 CDS product molybdate ABC transporter ATP-binding protein MolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693486.1 protein_id gnl|my_center|LOCUS_57400 199961 200737 gene locus_tag LOCUS_57410 199961 200737 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073705.1 protein_id gnl|my_center|LOCUS_57410 201351 200890 gene locus_tag LOCUS_57420 201351 200890 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328737.1 protein_id gnl|my_center|LOCUS_57420 201440 202675 gene locus_tag LOCUS_57430 201440 202675 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395366.1 protein_id gnl|my_center|LOCUS_57430 202672 203859 gene locus_tag LOCUS_57440 202672 203859 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395362.1 protein_id gnl|my_center|LOCUS_57440 202959 202863 gene locus_tag LOCUS_t00540 202959 202863 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 203856 204299 gene locus_tag LOCUS_57450 gene dtd 203856 204299 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384885.1 protein_id gnl|my_center|LOCUS_57450 204554 206968 gene locus_tag LOCUS_57460 204554 206968 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973252.1 protein_id gnl|my_center|LOCUS_57460 207022 207957 gene locus_tag LOCUS_57470 207022 207957 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973253.1 protein_id gnl|my_center|LOCUS_57470 208161 209000 gene locus_tag LOCUS_57480 208161 209000 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973254.1 protein_id gnl|my_center|LOCUS_57480 208997 209983 gene locus_tag LOCUS_57490 208997 209983 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973255.1 protein_id gnl|my_center|LOCUS_57490 209970 210767 gene locus_tag LOCUS_57500 209970 210767 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973256.1 protein_id gnl|my_center|LOCUS_57500 211036 211584 gene locus_tag LOCUS_57510 211036 211584 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973257.1 protein_id gnl|my_center|LOCUS_57510 211646 212596 gene locus_tag LOCUS_57520 211646 212596 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973258.1 protein_id gnl|my_center|LOCUS_57520 212596 212940 gene locus_tag LOCUS_57530 212596 212940 CDS product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339024.1 protein_id gnl|my_center|LOCUS_57530 213101 214948 gene locus_tag LOCUS_57540 213101 214948 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970956.1 protein_id gnl|my_center|LOCUS_57540 215975 215061 gene locus_tag LOCUS_57550 215975 215061 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324409.1 protein_id gnl|my_center|LOCUS_57550 216231 216998 gene locus_tag LOCUS_57560 216231 216998 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399793.1 protein_id gnl|my_center|LOCUS_57560 217021 218205 gene locus_tag LOCUS_57570 217021 218205 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162180331.1 protein_id gnl|my_center|LOCUS_57570 218229 219356 gene locus_tag LOCUS_57580 218229 219356 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973070.1 protein_id gnl|my_center|LOCUS_57580 219421 220653 gene locus_tag LOCUS_57590 219421 220653 CDS product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067041.1 protein_id gnl|my_center|LOCUS_57590 220655 221668 gene locus_tag LOCUS_57600 220655 221668 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394030.1 protein_id gnl|my_center|LOCUS_57600 221672 223003 gene locus_tag LOCUS_57610 221672 223003 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970299.1 protein_id gnl|my_center|LOCUS_57610 223008 224396 gene locus_tag LOCUS_57620 gene lpdA 223008 224396 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528744.1 protein_id gnl|my_center|LOCUS_57620 224380 225462 gene locus_tag LOCUS_57630 224380 225462 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392140.1 protein_id gnl|my_center|LOCUS_57630 225464 226354 gene locus_tag LOCUS_57640 gene mmsB 225464 226354 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973583.1 protein_id gnl|my_center|LOCUS_57640 226375 227145 gene locus_tag LOCUS_57650 226375 227145 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730436.1 protein_id gnl|my_center|LOCUS_57650 228401 227301 gene locus_tag LOCUS_57660 228401 227301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651870.1 protein_id gnl|my_center|LOCUS_57660 230162 229101 gene locus_tag LOCUS_57670 230162 229101 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530320.1 protein_id gnl|my_center|LOCUS_57670 231109 230189 gene locus_tag LOCUS_57680 gene rocF 231109 230189 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313710.1 protein_id gnl|my_center|LOCUS_57680 231230 231667 gene locus_tag LOCUS_57690 231230 231667 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313709.1 protein_id gnl|my_center|LOCUS_57690 232377 231727 gene locus_tag LOCUS_57700 232377 231727 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968191.1 protein_id gnl|my_center|LOCUS_57700 233714 232518 gene locus_tag LOCUS_57710 233714 232518 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532171.1 protein_id gnl|my_center|LOCUS_57710 234879 233701 gene locus_tag LOCUS_57720 234879 233701 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532172.1 protein_id gnl|my_center|LOCUS_57720 235716 234913 gene locus_tag LOCUS_57730 gene eutA 235716 234913 CDS product ectoine utilization protein EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969332.1 protein_id gnl|my_center|LOCUS_57730 237222 235840 gene locus_tag LOCUS_57740 237222 235840 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401297.1 protein_id gnl|my_center|LOCUS_57740 237381 237530 gene locus_tag LOCUS_57750 237381 237530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57750 239892 237772 gene locus_tag LOCUS_57760 gene mcpU 239892 237772 CDS product methyl-accepting chemotaxis protein McpU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158072.1 protein_id gnl|my_center|LOCUS_57760 239849 240028 gene locus_tag LOCUS_57770 239849 240028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 240733 240104 gene locus_tag LOCUS_57780 240733 240104 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384669.1 protein_id gnl|my_center|LOCUS_57780 240881 242917 gene locus_tag LOCUS_57790 240881 242917 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972390.1 protein_id gnl|my_center|LOCUS_57790 243369 243536 gene locus_tag LOCUS_57800 243369 243536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57800 243729 244607 gene locus_tag LOCUS_57810 243729 244607 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533591.1 protein_id gnl|my_center|LOCUS_57810 245834 244695 gene locus_tag LOCUS_57820 245834 244695 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243488.1 protein_id gnl|my_center|LOCUS_57820 246969 245869 gene locus_tag LOCUS_57830 246969 245869 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969593.1 protein_id gnl|my_center|LOCUS_57830 248813 246969 gene locus_tag LOCUS_57840 248813 246969 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969594.1 protein_id gnl|my_center|LOCUS_57840 249817 248855 gene locus_tag LOCUS_57850 gene phnD 249817 248855 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808591.1 protein_id gnl|my_center|LOCUS_57850 249917 250597 gene locus_tag LOCUS_57860 249917 250597 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038450.1 protein_id gnl|my_center|LOCUS_57860 250597 251985 gene locus_tag LOCUS_57870 250597 251985 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038449.1 protein_id gnl|my_center|LOCUS_57870 251985 252986 gene locus_tag LOCUS_57880 251985 252986 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038448.1 protein_id gnl|my_center|LOCUS_57880 253046 253570 gene locus_tag LOCUS_57890 253046 253570 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974030.1 protein_id gnl|my_center|LOCUS_57890 254465 253590 gene locus_tag LOCUS_57900 254465 253590 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018209712.1 protein_id gnl|my_center|LOCUS_57900 254580 256232 gene locus_tag LOCUS_57910 254580 256232 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975820.1 protein_id gnl|my_center|LOCUS_57910 256336 257538 gene locus_tag LOCUS_57920 256336 257538 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456681.1 protein_id gnl|my_center|LOCUS_57920 257558 258820 gene locus_tag LOCUS_57930 gene phnA 257558 258820 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975822.1 protein_id gnl|my_center|LOCUS_57930 258831 260285 gene locus_tag LOCUS_57940 gene phnY 258831 260285 CDS product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975823.1 protein_id gnl|my_center|LOCUS_57940 260582 261604 gene locus_tag LOCUS_57950 260582 261604 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061793.1 protein_id gnl|my_center|LOCUS_57950 261685 262848 gene locus_tag LOCUS_57960 261685 262848 CDS product putative 2-aminoethylphosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527142.1 protein_id gnl|my_center|LOCUS_57960 262851 264866 gene locus_tag LOCUS_57970 262851 264866 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061795.1 protein_id gnl|my_center|LOCUS_57970 265949 264906 gene locus_tag LOCUS_57980 265949 264906 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100003259.1 protein_id gnl|my_center|LOCUS_57980 266232 266933 gene locus_tag LOCUS_57990 266232 266933 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975817.1 protein_id gnl|my_center|LOCUS_57990 267022 269472 gene locus_tag LOCUS_58000 267022 269472 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975818.1 protein_id gnl|my_center|LOCUS_58000 270000 269554 gene locus_tag LOCUS_58010 270000 269554 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970165.1 protein_id gnl|my_center|LOCUS_58010 271588 270209 gene locus_tag LOCUS_58020 271588 270209 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969803.1 protein_id gnl|my_center|LOCUS_58020 273426 271585 gene locus_tag LOCUS_58030 273426 271585 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398965.1 protein_id gnl|my_center|LOCUS_58030 273651 274982 gene locus_tag LOCUS_58040 273651 274982 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033042429.1 protein_id gnl|my_center|LOCUS_58040 275492 275034 gene locus_tag LOCUS_58050 275492 275034 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329027.1 protein_id gnl|my_center|LOCUS_58050 275618 276901 gene locus_tag LOCUS_58060 275618 276901 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313410.1 protein_id gnl|my_center|LOCUS_58060 277174 276905 gene locus_tag LOCUS_58070 277174 276905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58070 278124 277249 gene locus_tag LOCUS_58080 278124 277249 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071494957.1 protein_id gnl|my_center|LOCUS_58080 279065 278181 gene locus_tag LOCUS_58090 gene choW 279065 278181 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200833.1 protein_id gnl|my_center|LOCUS_58090 280322 279090 gene locus_tag LOCUS_58100 gene proV 280322 279090 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173037.1 protein_id gnl|my_center|LOCUS_58100 280773 281438 gene locus_tag LOCUS_58110 gene ric 280773 281438 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967631.1 protein_id gnl|my_center|LOCUS_58110 282387 281521 gene locus_tag LOCUS_58120 282387 281521 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967620.1 protein_id gnl|my_center|LOCUS_58120 282589 284808 gene locus_tag LOCUS_58130 282589 284808 CDS product regulatory protein NosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967621.1 protein_id gnl|my_center|LOCUS_58130 284831 286744 gene locus_tag LOCUS_58140 gene nosZ 284831 286744 CDS product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967622.1 protein_id gnl|my_center|LOCUS_58140 286746 288119 gene locus_tag LOCUS_58150 286746 288119 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967623.1 protein_id gnl|my_center|LOCUS_58150 288116 289018 gene locus_tag LOCUS_58160 288116 289018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967624.1 protein_id gnl|my_center|LOCUS_58160 289015 289830 gene locus_tag LOCUS_58170 289015 289830 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083150.1 protein_id gnl|my_center|LOCUS_58170 289827 290360 gene locus_tag LOCUS_58180 289827 290360 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967626.1 protein_id gnl|my_center|LOCUS_58180 290357 291334 gene locus_tag LOCUS_58190 290357 291334 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967627.1 protein_id gnl|my_center|LOCUS_58190 292601 291381 gene locus_tag LOCUS_58200 292601 291381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58200 292995 294302 gene locus_tag LOCUS_58210 gene ugpB 292995 294302 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975290.1 protein_id gnl|my_center|LOCUS_58210 294387 295268 gene locus_tag LOCUS_58220 gene ugpA 294387 295268 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975291.1 protein_id gnl|my_center|LOCUS_58220 295278 296126 gene locus_tag LOCUS_58230 gene ugpE 295278 296126 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972831.1 protein_id gnl|my_center|LOCUS_58230 296126 297172 gene locus_tag LOCUS_58240 gene ugpC 296126 297172 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972832.1 protein_id gnl|my_center|LOCUS_58240 298082 297198 gene locus_tag LOCUS_58250 298082 297198 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393373.1 protein_id gnl|my_center|LOCUS_58250 299113 298079 gene locus_tag LOCUS_58260 299113 298079 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577349.1 protein_id gnl|my_center|LOCUS_58260 299279 300073 gene locus_tag LOCUS_58270 299279 300073 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887692.1 protein_id gnl|my_center|LOCUS_58270 300773 300084 gene locus_tag LOCUS_58280 300773 300084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393402.1 protein_id gnl|my_center|LOCUS_58280 301150 302952 gene locus_tag LOCUS_58290 301150 302952 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393370.1 protein_id gnl|my_center|LOCUS_58290 303044 304357 gene locus_tag LOCUS_58300 gene hisD 303044 304357 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328258.1 protein_id gnl|my_center|LOCUS_58300 304418 305665 gene locus_tag LOCUS_58310 304418 305665 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328259.1 protein_id gnl|my_center|LOCUS_58310 305734 306627 gene locus_tag LOCUS_58320 305734 306627 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328260.1 protein_id gnl|my_center|LOCUS_58320 306620 307495 gene locus_tag LOCUS_58330 306620 307495 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082912452.1 protein_id gnl|my_center|LOCUS_58330 307500 308600 gene locus_tag LOCUS_58340 gene ugpC 307500 308600 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328262.1 protein_id gnl|my_center|LOCUS_58340 308611 310113 gene locus_tag LOCUS_58350 308611 310113 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393367.1 protein_id gnl|my_center|LOCUS_58350 310113 311759 gene locus_tag LOCUS_58360 310113 311759 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328264.1 protein_id gnl|my_center|LOCUS_58360 311835 312464 gene locus_tag LOCUS_58370 311835 312464 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 protein_id gnl|my_center|LOCUS_58370 312461 313243 gene locus_tag LOCUS_58380 312461 313243 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388934.1 protein_id gnl|my_center|LOCUS_58380 313262 314266 gene locus_tag LOCUS_58390 313262 314266 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606692.1 protein_id gnl|my_center|LOCUS_58390 314307 315515 gene locus_tag LOCUS_58400 314307 315515 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254121.1 protein_id gnl|my_center|LOCUS_58400 315629 317203 gene locus_tag LOCUS_58410 315629 317203 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254871.1 protein_id gnl|my_center|LOCUS_58410 318033 317101 gene locus_tag LOCUS_58420 318033 317101 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975013.1 protein_id gnl|my_center|LOCUS_58420 318393 318977 gene locus_tag LOCUS_58430 318393 318977 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037716.1 protein_id gnl|my_center|LOCUS_58430 318955 319767 gene locus_tag LOCUS_58440 318955 319767 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037717.1 protein_id gnl|my_center|LOCUS_58440 319781 320719 gene locus_tag LOCUS_58450 319781 320719 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037718.1 protein_id gnl|my_center|LOCUS_58450 321297 320800 gene locus_tag LOCUS_58460 321297 320800 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967764.1 protein_id gnl|my_center|LOCUS_58460 321656 321306 gene locus_tag LOCUS_58470 321656 321306 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969987.1 protein_id gnl|my_center|LOCUS_58470 322689 321781 gene locus_tag LOCUS_58480 322689 321781 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528171.1 protein_id gnl|my_center|LOCUS_58480 324305 322686 gene locus_tag LOCUS_58490 324305 322686 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525262.1 protein_id gnl|my_center|LOCUS_58490 325455 324307 gene locus_tag LOCUS_58500 gene dgoD 325455 324307 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199088.1 protein_id gnl|my_center|LOCUS_58500 326516 325452 gene locus_tag LOCUS_58510 gene ugpC 326516 325452 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392167.1 protein_id gnl|my_center|LOCUS_58510 327336 326518 gene locus_tag LOCUS_58520 327336 326518 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066677.1 protein_id gnl|my_center|LOCUS_58520 328238 327342 gene locus_tag LOCUS_58530 328238 327342 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_58530 329661 328300 gene locus_tag LOCUS_58540 329661 328300 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967606.1 protein_id gnl|my_center|LOCUS_58540 329891 330601 gene locus_tag LOCUS_58550 329891 330601 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918668.1 protein_id gnl|my_center|LOCUS_58550 331114 330620 gene locus_tag LOCUS_58560 331114 330620 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387969.1 protein_id gnl|my_center|LOCUS_58560 331261 333621 gene locus_tag LOCUS_58570 331261 333621 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725056.1 protein_id gnl|my_center|LOCUS_58570 334268 333765 gene locus_tag LOCUS_58580 334268 333765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58580 335735 334404 gene locus_tag LOCUS_58590 335735 334404 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330452.1 protein_id gnl|my_center|LOCUS_58590 336557 335769 gene locus_tag LOCUS_58600 336557 335769 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525022.1 protein_id gnl|my_center|LOCUS_58600 337582 336554 gene locus_tag LOCUS_58610 gene benC 337582 336554 CDS product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109537.1 protein_id gnl|my_center|LOCUS_58610 338107 337619 gene locus_tag LOCUS_58620 gene benB 338107 337619 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366457.1 protein_id gnl|my_center|LOCUS_58620 339462 338104 gene locus_tag LOCUS_58630 339462 338104 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705527.1 protein_id gnl|my_center|LOCUS_58630 340477 339539 gene locus_tag LOCUS_58640 gene catA 340477 339539 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113307.1 protein_id gnl|my_center|LOCUS_58640 340816 340526 gene locus_tag LOCUS_58650 gene catC 340816 340526 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897236.1 protein_id gnl|my_center|LOCUS_58650 342010 340829 gene locus_tag LOCUS_58660 342010 340829 CDS product muconate/chloromuconate family cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190537.1 protein_id gnl|my_center|LOCUS_58660 343271 342489 gene locus_tag LOCUS_58670 gene pcaD 343271 342489 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969833.1 protein_id gnl|my_center|LOCUS_58670 343450 344373 gene locus_tag LOCUS_58680 343450 344373 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204291.1 protein_id gnl|my_center|LOCUS_58680 344775 344389 gene locus_tag LOCUS_58690 344775 344389 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976106.1 protein_id gnl|my_center|LOCUS_58690 346331 344928 gene locus_tag LOCUS_58700 346331 344928 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304032.1 protein_id gnl|my_center|LOCUS_58700 347311 346445 gene locus_tag LOCUS_58710 347311 346445 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395396.1 protein_id gnl|my_center|LOCUS_58710 347781 348308 gene locus_tag LOCUS_58720 347781 348308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 348305 349573 gene locus_tag LOCUS_58730 348305 349573 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084676.1 protein_id gnl|my_center|LOCUS_58730 349712 350833 gene locus_tag LOCUS_58740 349712 350833 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731115.1 protein_id gnl|my_center|LOCUS_58740 351243 352370 gene locus_tag LOCUS_58750 gene repA 351243 352370 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969718.1 protein_id gnl|my_center|LOCUS_58750 352374 353390 gene locus_tag LOCUS_58760 gene repB 352374 353390 CDS product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243826.1 protein_id gnl|my_center|LOCUS_58760 353583 354755 gene locus_tag LOCUS_58770 gene repC 353583 354755 CDS product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244395.1 protein_id gnl|my_center|LOCUS_58770 355722 355907 gene locus_tag LOCUS_58780 355722 355907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 355904 356542 gene locus_tag LOCUS_58790 355904 356542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58790 356999 358189 gene locus_tag LOCUS_58800 gene fdhA 356999 358189 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035216779.1 protein_id gnl|my_center|LOCUS_58800 358857 358516 gene locus_tag LOCUS_58810 358857 358516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58810 359290 359595 gene locus_tag LOCUS_58820 359290 359595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58820 360102 359833 gene locus_tag LOCUS_58830 360102 359833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58830 361459 360284 gene locus_tag LOCUS_58840 361459 360284 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529310.1 protein_id gnl|my_center|LOCUS_58840 362211 361468 gene locus_tag LOCUS_58850 362211 361468 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529311.1 protein_id gnl|my_center|LOCUS_58850 363056 362250 gene locus_tag LOCUS_58860 363056 362250 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529312.1 protein_id gnl|my_center|LOCUS_58860 363339 364418 gene locus_tag LOCUS_58870 gene pstS 363339 364418 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438693.1 protein_id gnl|my_center|LOCUS_58870 364462 366195 gene locus_tag LOCUS_58880 364462 366195 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329982.1 protein_id gnl|my_center|LOCUS_58880 366308 367336 gene locus_tag LOCUS_58890 366308 367336 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337878.1 protein_id gnl|my_center|LOCUS_58890 367396 368844 gene locus_tag LOCUS_58900 367396 368844 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254000.1 protein_id gnl|my_center|LOCUS_58900 368893 369933 gene locus_tag LOCUS_58910 368893 369933 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921017.1 protein_id gnl|my_center|LOCUS_58910 370182 371090 gene locus_tag LOCUS_58920 gene ppk2 370182 371090 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965809.1 protein_id gnl|my_center|LOCUS_58920 371136 372113 gene locus_tag LOCUS_58930 371136 372113 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241170.1 protein_id gnl|my_center|LOCUS_58930 372431 372219 gene locus_tag LOCUS_58940 372431 372219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 372393 372977 gene locus_tag LOCUS_58950 372393 372977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58950 373044 374162 gene locus_tag LOCUS_58960 373044 374162 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385515.1 protein_id gnl|my_center|LOCUS_58960 374156 375115 gene locus_tag LOCUS_58970 374156 375115 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385516.1 protein_id gnl|my_center|LOCUS_58970 375125 376804 gene locus_tag LOCUS_58980 375125 376804 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385517.1 protein_id gnl|my_center|LOCUS_58980 377870 377382 gene locus_tag LOCUS_58990 377870 377382 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931206.1 protein_id gnl|my_center|LOCUS_58990 378633 377848 gene locus_tag LOCUS_59000 378633 377848 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975387.1 protein_id gnl|my_center|LOCUS_59000 379374 378637 gene locus_tag LOCUS_59010 379374 378637 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534478.1 protein_id gnl|my_center|LOCUS_59010 379258 379482 gene locus_tag LOCUS_59020 379258 379482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 379841 379560 gene locus_tag LOCUS_59030 379841 379560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59030 380068 380622 gene locus_tag LOCUS_59040 380068 380622 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085822.1 protein_id gnl|my_center|LOCUS_59040 380624 381259 gene locus_tag LOCUS_59050 380624 381259 CDS product NrsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529421.1 protein_id gnl|my_center|LOCUS_59050 381584 382777 gene locus_tag LOCUS_59060 381584 382777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59060 382832 383875 gene locus_tag LOCUS_59070 382832 383875 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969456.1 protein_id gnl|my_center|LOCUS_59070 >Feature sequence34 1499 627 gene locus_tag LOCUS_59080 1499 627 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016558605.1 protein_id gnl|my_center|LOCUS_59080 1770 2630 gene locus_tag LOCUS_59090 1770 2630 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311158.1 protein_id gnl|my_center|LOCUS_59090 2627 3985 gene locus_tag LOCUS_59100 2627 3985 CDS product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227202.1 protein_id gnl|my_center|LOCUS_59100 3978 4280 gene locus_tag LOCUS_59110 3978 4280 CDS product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227201.1 protein_id gnl|my_center|LOCUS_59110 4638 5591 gene locus_tag LOCUS_59120 4638 5591 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384590.1 protein_id gnl|my_center|LOCUS_59120 5622 6095 gene locus_tag LOCUS_59130 5622 6095 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537806.1 protein_id gnl|my_center|LOCUS_59130 6097 7614 gene locus_tag LOCUS_59140 6097 7614 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384588.1 protein_id gnl|my_center|LOCUS_59140 7697 8776 gene locus_tag LOCUS_59150 7697 8776 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137395785.1 protein_id gnl|my_center|LOCUS_59150 8776 9561 gene locus_tag LOCUS_59160 8776 9561 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137395784.1 protein_id gnl|my_center|LOCUS_59160 9558 10934 gene locus_tag LOCUS_59170 9558 10934 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 protein_id gnl|my_center|LOCUS_59170 10943 11350 gene locus_tag LOCUS_59180 10943 11350 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253940.1 protein_id gnl|my_center|LOCUS_59180 12711 11632 gene locus_tag LOCUS_59190 12711 11632 CDS product threonine aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967204.1 protein_id gnl|my_center|LOCUS_59190 14197 12788 gene locus_tag LOCUS_59200 14197 12788 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392126.1 protein_id gnl|my_center|LOCUS_59200 14317 15849 gene locus_tag LOCUS_59210 14317 15849 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244072.1 protein_id gnl|my_center|LOCUS_59210 15864 16166 gene locus_tag LOCUS_59220 15864 16166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 16166 18184 gene locus_tag LOCUS_59230 16166 18184 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392124.1 protein_id gnl|my_center|LOCUS_59230 18240 20378 gene locus_tag LOCUS_59240 gene scpA 18240 20378 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392131.1 protein_id gnl|my_center|LOCUS_59240 20386 20787 gene locus_tag LOCUS_59250 gene mce 20386 20787 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328000.1 protein_id gnl|my_center|LOCUS_59250 21799 20801 gene locus_tag LOCUS_59260 21799 20801 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324409.1 protein_id gnl|my_center|LOCUS_59260 22120 23238 gene locus_tag LOCUS_59270 22120 23238 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394374.1 protein_id gnl|my_center|LOCUS_59270 24265 23408 gene locus_tag LOCUS_59280 24265 23408 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969978.1 protein_id gnl|my_center|LOCUS_59280 24358 25689 gene locus_tag LOCUS_59290 24358 25689 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969977.1 protein_id gnl|my_center|LOCUS_59290 25703 26161 gene locus_tag LOCUS_59300 25703 26161 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969976.1 protein_id gnl|my_center|LOCUS_59300 26158 27150 gene locus_tag LOCUS_59310 gene meaB 26158 27150 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969975.1 protein_id gnl|my_center|LOCUS_59310 27147 28847 gene locus_tag LOCUS_59320 27147 28847 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210246.1 protein_id gnl|my_center|LOCUS_59320 28856 29605 gene locus_tag LOCUS_59330 28856 29605 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969973.1 protein_id gnl|my_center|LOCUS_59330 29608 31239 gene locus_tag LOCUS_59340 29608 31239 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 protein_id gnl|my_center|LOCUS_59340 31474 33336 gene locus_tag LOCUS_59350 31474 33336 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536736.1 protein_id gnl|my_center|LOCUS_59350 33362 34684 gene locus_tag LOCUS_59360 33362 34684 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536733.1 protein_id gnl|my_center|LOCUS_59360 34697 36238 gene locus_tag LOCUS_59370 34697 36238 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328096.1 protein_id gnl|my_center|LOCUS_59370 38867 36492 gene locus_tag LOCUS_59380 gene exoP 38867 36492 CDS product succinoglycan biosynthesis transport protein ExoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975922.1 protein_id gnl|my_center|LOCUS_59380 39851 38946 gene locus_tag LOCUS_59390 39851 38946 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975921.1 protein_id gnl|my_center|LOCUS_59390 40887 39856 gene locus_tag LOCUS_59400 gene exoO 40887 39856 CDS product succinoglycan biosynthesis glycosyltransferase ExoO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975920.1 protein_id gnl|my_center|LOCUS_59400 41810 40884 gene locus_tag LOCUS_59410 41810 40884 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393323.1 protein_id gnl|my_center|LOCUS_59410 42805 41807 gene locus_tag LOCUS_59420 gene exoA 42805 41807 CDS product succinoglycan biosynthesis glycosyltransferase ExoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434899.1 protein_id gnl|my_center|LOCUS_59420 43994 42795 gene locus_tag LOCUS_59430 gene exoL 43994 42795 CDS product succinoglycan biosynthesis glycosyltransferase ExoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975918.1 protein_id gnl|my_center|LOCUS_59430 44794 44009 gene locus_tag LOCUS_59440 gene exoK 44794 44009 CDS product endo-1,3-1,4-beta-glycanase ExoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975917.1 protein_id gnl|my_center|LOCUS_59440 45966 44800 gene locus_tag LOCUS_59450 gene exoH 45966 44800 CDS product succinoglycan biosynthesis protein ExoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975916.1 protein_id gnl|my_center|LOCUS_59450 47768 46296 gene locus_tag LOCUS_59460 gene exoT 47768 46296 CDS product succinoglycan biosynthesis transport protein ExoT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975911.1 protein_id gnl|my_center|LOCUS_59460 47891 48850 gene locus_tag LOCUS_59470 gene exoW 47891 48850 CDS product succinoglycan biosynthesis glycosyltransferase ExoW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434930.1 protein_id gnl|my_center|LOCUS_59470 48914 49876 gene locus_tag LOCUS_59480 48914 49876 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061859.1 protein_id gnl|my_center|LOCUS_59480 50896 49901 gene locus_tag LOCUS_59490 50896 49901 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393305.1 protein_id gnl|my_center|LOCUS_59490 51323 50997 gene locus_tag LOCUS_59500 51323 50997 CDS product exopolysaccharide production repressor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254797.1 protein_id gnl|my_center|LOCUS_59500 52130 51909 gene locus_tag LOCUS_59510 52130 51909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59510 52105 52680 gene locus_tag LOCUS_59520 gene exoY 52105 52680 CDS product exopolysaccharide production protein ExoY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393302.1 protein_id gnl|my_center|LOCUS_59520 52737 54008 gene locus_tag LOCUS_59530 gene exoF 52737 54008 CDS product exopolysaccharide production protein ExoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975906.1 protein_id gnl|my_center|LOCUS_59530 54016 55293 gene locus_tag LOCUS_59540 54016 55293 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975905.1 protein_id gnl|my_center|LOCUS_59540 55290 56321 gene locus_tag LOCUS_59550 gene exoZ 55290 56321 CDS product exopolysaccharide production protein ExoZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850573.1 protein_id gnl|my_center|LOCUS_59550 58762 56645 gene locus_tag LOCUS_59560 58762 56645 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974154.1 protein_id gnl|my_center|LOCUS_59560 59496 58759 gene locus_tag LOCUS_59570 59496 58759 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974155.1 protein_id gnl|my_center|LOCUS_59570 59733 60755 gene locus_tag LOCUS_59580 59733 60755 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974156.1 protein_id gnl|my_center|LOCUS_59580 60875 61903 gene locus_tag LOCUS_59590 60875 61903 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974157.1 protein_id gnl|my_center|LOCUS_59590 61976 64189 gene locus_tag LOCUS_59600 61976 64189 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974158.1 protein_id gnl|my_center|LOCUS_59600 64186 65247 gene locus_tag LOCUS_59610 64186 65247 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974159.1 protein_id gnl|my_center|LOCUS_59610 65363 66163 gene locus_tag LOCUS_59620 65363 66163 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975240.1 protein_id gnl|my_center|LOCUS_59620 66386 68212 gene locus_tag LOCUS_59630 66386 68212 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969594.1 protein_id gnl|my_center|LOCUS_59630 68212 69333 gene locus_tag LOCUS_59640 68212 69333 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975068.1 protein_id gnl|my_center|LOCUS_59640 69406 70512 gene locus_tag LOCUS_59650 69406 70512 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969592.1 protein_id gnl|my_center|LOCUS_59650 70606 71451 gene locus_tag LOCUS_59660 70606 71451 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975064.1 protein_id gnl|my_center|LOCUS_59660 71448 72089 gene locus_tag LOCUS_59670 71448 72089 CDS product dual specificity protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969589.1 protein_id gnl|my_center|LOCUS_59670 72086 73675 gene locus_tag LOCUS_59680 72086 73675 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973771.1 protein_id gnl|my_center|LOCUS_59680 74788 73772 gene locus_tag LOCUS_59690 74788 73772 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975244.1 protein_id gnl|my_center|LOCUS_59690 75010 75843 gene locus_tag LOCUS_59700 75010 75843 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018209695.1 protein_id gnl|my_center|LOCUS_59700 75840 77693 gene locus_tag LOCUS_59710 75840 77693 CDS product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397828.1 protein_id gnl|my_center|LOCUS_59710 77704 78753 gene locus_tag LOCUS_59720 77704 78753 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973597.1 protein_id gnl|my_center|LOCUS_59720 80194 78773 gene locus_tag LOCUS_59730 80194 78773 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729346.1 protein_id gnl|my_center|LOCUS_59730 80585 80217 gene locus_tag LOCUS_59740 80585 80217 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537641.1 protein_id gnl|my_center|LOCUS_59740 80734 81339 gene locus_tag LOCUS_59750 80734 81339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59750 83010 81415 gene locus_tag LOCUS_59760 gene ctaD 83010 81415 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974721.1 protein_id gnl|my_center|LOCUS_59760 83167 84021 gene locus_tag LOCUS_59770 83167 84021 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082145856.1 protein_id gnl|my_center|LOCUS_59770 84200 85810 gene locus_tag LOCUS_59780 84200 85810 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257436.1 protein_id gnl|my_center|LOCUS_59780 86078 87067 gene locus_tag LOCUS_59790 86078 87067 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972850.1 protein_id gnl|my_center|LOCUS_59790 87064 88896 gene locus_tag LOCUS_59800 87064 88896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59800 88893 89690 gene locus_tag LOCUS_59810 88893 89690 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972853.1 protein_id gnl|my_center|LOCUS_59810 89680 90777 gene locus_tag LOCUS_59820 89680 90777 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972854.1 protein_id gnl|my_center|LOCUS_59820 91386 92000 gene locus_tag LOCUS_59830 91386 92000 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 protein_id gnl|my_center|LOCUS_59830 91997 93208 gene locus_tag LOCUS_59840 91997 93208 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160926.1 protein_id gnl|my_center|LOCUS_59840 93522 94748 gene locus_tag LOCUS_59850 93522 94748 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525898.1 protein_id gnl|my_center|LOCUS_59850 94765 97215 gene locus_tag LOCUS_59860 gene nirB 94765 97215 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243547.1 protein_id gnl|my_center|LOCUS_59860 97227 97556 gene locus_tag LOCUS_59870 gene nirD 97227 97556 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396314.1 protein_id gnl|my_center|LOCUS_59870 97906 100557 gene locus_tag LOCUS_59880 97906 100557 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982243.1 protein_id gnl|my_center|LOCUS_59880 101402 100614 gene locus_tag LOCUS_59890 101402 100614 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897225.1 protein_id gnl|my_center|LOCUS_59890 102352 101399 gene locus_tag LOCUS_59900 102352 101399 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267759.1 protein_id gnl|my_center|LOCUS_59900 103178 102339 gene locus_tag LOCUS_59910 103178 102339 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385673.1 protein_id gnl|my_center|LOCUS_59910 104197 103175 gene locus_tag LOCUS_59920 104197 103175 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385674.1 protein_id gnl|my_center|LOCUS_59920 106150 104585 gene locus_tag LOCUS_59930 106150 104585 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830550.1 protein_id gnl|my_center|LOCUS_59930 107305 106184 gene locus_tag LOCUS_59940 107305 106184 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311988.1 protein_id gnl|my_center|LOCUS_59940 108846 107302 gene locus_tag LOCUS_59950 108846 107302 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972706.1 protein_id gnl|my_center|LOCUS_59950 109365 108850 gene locus_tag LOCUS_59960 109365 108850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59960 110645 109599 gene locus_tag LOCUS_59970 110645 109599 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973889.1 protein_id gnl|my_center|LOCUS_59970 110933 112267 gene locus_tag LOCUS_59980 110933 112267 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528077.1 protein_id gnl|my_center|LOCUS_59980 112689 113636 gene locus_tag LOCUS_59990 112689 113636 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243183.1 protein_id gnl|my_center|LOCUS_59990 113633 114574 gene locus_tag LOCUS_60000 113633 114574 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086350.1 protein_id gnl|my_center|LOCUS_60000 114571 114759 gene locus_tag LOCUS_60010 114571 114759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086351.1 protein_id gnl|my_center|LOCUS_60010 114764 115861 gene locus_tag LOCUS_60020 114764 115861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086352.1 protein_id gnl|my_center|LOCUS_60020 115854 116849 gene locus_tag LOCUS_60030 115854 116849 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615005.1 protein_id gnl|my_center|LOCUS_60030 116863 118482 gene locus_tag LOCUS_60040 116863 118482 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528083.1 protein_id gnl|my_center|LOCUS_60040 121987 118805 gene locus_tag LOCUS_60050 121987 118805 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972354.1 protein_id gnl|my_center|LOCUS_60050 123497 122307 gene locus_tag LOCUS_60060 123497 122307 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312103.1 protein_id gnl|my_center|LOCUS_60060 124365 123544 gene locus_tag LOCUS_60070 124365 123544 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972353.1 protein_id gnl|my_center|LOCUS_60070 124507 125445 gene locus_tag LOCUS_60080 124507 125445 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527624.1 protein_id gnl|my_center|LOCUS_60080 127147 125822 gene locus_tag LOCUS_60090 127147 125822 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392424.1 protein_id gnl|my_center|LOCUS_60090 127444 128538 gene locus_tag LOCUS_60100 gene cyoA 127444 128538 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392423.1 protein_id gnl|my_center|LOCUS_60100 128584 130626 gene locus_tag LOCUS_60110 gene cyoB 128584 130626 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392422.1 protein_id gnl|my_center|LOCUS_60110 130631 131254 gene locus_tag LOCUS_60120 gene cyoC 130631 131254 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976136.1 protein_id gnl|my_center|LOCUS_60120 131251 131649 gene locus_tag LOCUS_60130 gene cyoD 131251 131649 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242014.1 protein_id gnl|my_center|LOCUS_60130 131840 131592 gene locus_tag LOCUS_60140 131840 131592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60140 131887 132606 gene locus_tag LOCUS_60150 131887 132606 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392415.1 protein_id gnl|my_center|LOCUS_60150 133206 132610 gene locus_tag LOCUS_60160 133206 132610 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090341.1 protein_id gnl|my_center|LOCUS_60160 133312 133989 gene locus_tag LOCUS_60170 133312 133989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60170 134011 134289 gene locus_tag LOCUS_60180 134011 134289 CDS product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090339.1 protein_id gnl|my_center|LOCUS_60180 134465 137863 gene locus_tag LOCUS_60190 134465 137863 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085112.1 protein_id gnl|my_center|LOCUS_60190 139060 138053 gene locus_tag LOCUS_60200 139060 138053 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530666.1 protein_id gnl|my_center|LOCUS_60200 140160 139057 gene locus_tag LOCUS_60210 140160 139057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60210 141346 140144 gene locus_tag LOCUS_60220 141346 140144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60220 142215 141343 gene locus_tag LOCUS_60230 142215 141343 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877180.1 protein_id gnl|my_center|LOCUS_60230 143156 142212 gene locus_tag LOCUS_60240 143156 142212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240 145109 143484 gene locus_tag LOCUS_60250 145109 143484 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969597.1 protein_id gnl|my_center|LOCUS_60250 145600 145115 gene locus_tag LOCUS_60260 145600 145115 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310724.1 protein_id gnl|my_center|LOCUS_60260 146952 145609 gene locus_tag LOCUS_60270 146952 145609 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061522.1 protein_id gnl|my_center|LOCUS_60270 147119 148216 gene locus_tag LOCUS_60280 147119 148216 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975616.1 protein_id gnl|my_center|LOCUS_60280 148213 148947 gene locus_tag LOCUS_60290 148213 148947 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061519.1 protein_id gnl|my_center|LOCUS_60290 150005 149586 gene locus_tag LOCUS_60300 150005 149586 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531302.1 protein_id gnl|my_center|LOCUS_60300 152764 150053 gene locus_tag LOCUS_60310 152764 150053 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310719.1 protein_id gnl|my_center|LOCUS_60310 153986 152835 gene locus_tag LOCUS_60320 153986 152835 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972423.1 protein_id gnl|my_center|LOCUS_60320 155443 153983 gene locus_tag LOCUS_60330 155443 153983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60330 156662 155460 gene locus_tag LOCUS_60340 156662 155460 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531308.1 protein_id gnl|my_center|LOCUS_60340 157911 156736 gene locus_tag LOCUS_60350 157911 156736 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061528.1 protein_id gnl|my_center|LOCUS_60350 158906 157908 gene locus_tag LOCUS_60360 158906 157908 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241956.1 protein_id gnl|my_center|LOCUS_60360 161037 159133 gene locus_tag LOCUS_60370 161037 159133 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972420.1 protein_id gnl|my_center|LOCUS_60370 162944 161034 gene locus_tag LOCUS_60380 162944 161034 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972419.1 protein_id gnl|my_center|LOCUS_60380 163192 164154 gene locus_tag LOCUS_60390 163192 164154 CDS product glycosyltransferase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992352.1 protein_id gnl|my_center|LOCUS_60390 164580 165923 gene locus_tag LOCUS_60400 164580 165923 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313911.1 protein_id gnl|my_center|LOCUS_60400 165920 166933 gene locus_tag LOCUS_60410 165920 166933 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327780.1 protein_id gnl|my_center|LOCUS_60410 167204 167839 gene locus_tag LOCUS_60420 167204 167839 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973031.1 protein_id gnl|my_center|LOCUS_60420 169172 167892 gene locus_tag LOCUS_60430 169172 167892 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857525.1 protein_id gnl|my_center|LOCUS_60430 169513 169172 gene locus_tag LOCUS_60440 169513 169172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60440 170601 169639 gene locus_tag LOCUS_60450 170601 169639 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312440.1 protein_id gnl|my_center|LOCUS_60450 171477 170647 gene locus_tag LOCUS_60460 171477 170647 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969350.1 protein_id gnl|my_center|LOCUS_60460 171983 171474 gene locus_tag LOCUS_60470 171983 171474 CDS product acetone carboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975282.1 protein_id gnl|my_center|LOCUS_60470 174179 171987 gene locus_tag LOCUS_60480 174179 171987 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969352.1 protein_id gnl|my_center|LOCUS_60480 176324 174195 gene locus_tag LOCUS_60490 176324 174195 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170065.1 protein_id gnl|my_center|LOCUS_60490 176422 177216 gene locus_tag LOCUS_60500 176422 177216 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975279.1 protein_id gnl|my_center|LOCUS_60500 177780 177535 gene locus_tag LOCUS_60510 177780 177535 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084508.1 protein_id gnl|my_center|LOCUS_60510 178286 179539 gene locus_tag LOCUS_60520 gene repA 178286 179539 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253454.1 protein_id gnl|my_center|LOCUS_60520 179539 180603 gene locus_tag LOCUS_60530 gene repB 179539 180603 CDS product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117338.1 protein_id gnl|my_center|LOCUS_60530 180865 182088 gene locus_tag LOCUS_60540 gene repC 180865 182088 CDS product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313545.1 protein_id gnl|my_center|LOCUS_60540 182406 182158 gene locus_tag LOCUS_60550 182406 182158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60550 182932 183876 gene locus_tag LOCUS_60560 182932 183876 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833899.1 protein_id gnl|my_center|LOCUS_60560 183879 184160 gene locus_tag LOCUS_60570 183879 184160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60570 184389 186005 gene locus_tag LOCUS_60580 184389 186005 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530047.1 protein_id gnl|my_center|LOCUS_60580 187540 186020 gene locus_tag LOCUS_60590 187540 186020 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173520038.1 protein_id gnl|my_center|LOCUS_60590 187623 188804 gene locus_tag LOCUS_60600 gene dgoD 187623 188804 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_60600 188806 190302 gene locus_tag LOCUS_60610 188806 190302 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448980.1 protein_id gnl|my_center|LOCUS_60610 190476 191552 gene locus_tag LOCUS_60620 190476 191552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60620 191635 192708 gene locus_tag LOCUS_60630 191635 192708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 protein_id gnl|my_center|LOCUS_60630 192714 193583 gene locus_tag LOCUS_60640 192714 193583 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530806.1 protein_id gnl|my_center|LOCUS_60640 193586 194443 gene locus_tag LOCUS_60650 193586 194443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60650 195375 194479 gene locus_tag LOCUS_60660 195375 194479 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529342.1 protein_id gnl|my_center|LOCUS_60660 196395 195457 gene locus_tag LOCUS_60670 196395 195457 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529341.1 protein_id gnl|my_center|LOCUS_60670 197444 196461 gene locus_tag LOCUS_60680 197444 196461 CDS product inner-membrane translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529340.1 protein_id gnl|my_center|LOCUS_60680 198998 197472 gene locus_tag LOCUS_60690 198998 197472 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529339.1 protein_id gnl|my_center|LOCUS_60690 200389 198995 gene locus_tag LOCUS_60700 200389 198995 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529338.1 protein_id gnl|my_center|LOCUS_60700 201165 200386 gene locus_tag LOCUS_60710 201165 200386 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529337.1 protein_id gnl|my_center|LOCUS_60710 201356 202438 gene locus_tag LOCUS_60720 201356 202438 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969789.1 protein_id gnl|my_center|LOCUS_60720 202435 203712 gene locus_tag LOCUS_60730 202435 203712 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173812.1 protein_id gnl|my_center|LOCUS_60730 203709 204551 gene locus_tag LOCUS_60740 203709 204551 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976283.1 protein_id gnl|my_center|LOCUS_60740 206205 204718 gene locus_tag LOCUS_60750 gene otsA 206205 204718 CDS product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037403146.1 protein_id gnl|my_center|LOCUS_60750 209576 206427 gene locus_tag LOCUS_60760 gene nolG 209576 206427 CDS product nodulation protein NolG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967460.1 protein_id gnl|my_center|LOCUS_60760 210689 209580 gene locus_tag LOCUS_60770 gene nolF 210689 209580 CDS product nodulation protein NolF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970885.1 protein_id gnl|my_center|LOCUS_60770 211780 210986 gene locus_tag LOCUS_60780 211780 210986 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724163.1 protein_id gnl|my_center|LOCUS_60780 212737 211874 gene locus_tag LOCUS_60790 212737 211874 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339272.1 protein_id gnl|my_center|LOCUS_60790 213807 212734 gene locus_tag LOCUS_60800 213807 212734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339273.1 protein_id gnl|my_center|LOCUS_60800 214982 213927 gene locus_tag LOCUS_60810 214982 213927 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339274.1 protein_id gnl|my_center|LOCUS_60810 215703 215041 gene locus_tag LOCUS_60820 215703 215041 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562698.1 protein_id gnl|my_center|LOCUS_60820 216618 215815 gene locus_tag LOCUS_60830 216618 215815 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339275.1 protein_id gnl|my_center|LOCUS_60830 217619 216723 gene locus_tag LOCUS_60840 217619 216723 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339276.1 protein_id gnl|my_center|LOCUS_60840 218477 217707 gene locus_tag LOCUS_60850 218477 217707 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894753.1 protein_id gnl|my_center|LOCUS_60850 218653 220203 gene locus_tag LOCUS_60860 218653 220203 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217481233.1 protein_id gnl|my_center|LOCUS_60860 220224 221168 gene locus_tag LOCUS_60870 220224 221168 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970012.1 protein_id gnl|my_center|LOCUS_60870 221165 221980 gene locus_tag LOCUS_60880 221165 221980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066662.1 protein_id gnl|my_center|LOCUS_60880 221985 223646 gene locus_tag LOCUS_60890 221985 223646 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972985.1 protein_id gnl|my_center|LOCUS_60890 223643 225211 gene locus_tag LOCUS_60900 223643 225211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60900 225204 226067 gene locus_tag LOCUS_60910 225204 226067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60910 226060 226746 gene locus_tag LOCUS_60920 226060 226746 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562698.1 protein_id gnl|my_center|LOCUS_60920 226743 227618 gene locus_tag LOCUS_60930 226743 227618 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368433.1 protein_id gnl|my_center|LOCUS_60930 227642 228475 gene locus_tag LOCUS_60940 227642 228475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227200.1 protein_id gnl|my_center|LOCUS_60940 229350 228478 gene locus_tag LOCUS_60950 229350 228478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60950 230303 229359 gene locus_tag LOCUS_60960 230303 229359 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047183.1 protein_id gnl|my_center|LOCUS_60960 230511 231083 gene locus_tag LOCUS_60970 230511 231083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60970 231224 232555 gene locus_tag LOCUS_60980 231224 232555 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113879.1 protein_id gnl|my_center|LOCUS_60980 233329 232556 gene locus_tag LOCUS_60990 233329 232556 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252448.1 protein_id gnl|my_center|LOCUS_60990 233522 234973 gene locus_tag LOCUS_61000 233522 234973 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004215.1 protein_id gnl|my_center|LOCUS_61000 235198 236307 gene locus_tag LOCUS_61010 235198 236307 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031356.1 protein_id gnl|my_center|LOCUS_61010 236378 237322 gene locus_tag LOCUS_61020 236378 237322 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192875.1 protein_id gnl|my_center|LOCUS_61020 237409 238530 gene locus_tag LOCUS_61030 237409 238530 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192697.1 protein_id gnl|my_center|LOCUS_61030 238530 239306 gene locus_tag LOCUS_61040 238530 239306 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193469.1 protein_id gnl|my_center|LOCUS_61040 239442 240563 gene locus_tag LOCUS_61050 239442 240563 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330812.1 protein_id gnl|my_center|LOCUS_61050 240583 241572 gene locus_tag LOCUS_61060 240583 241572 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255196.1 protein_id gnl|my_center|LOCUS_61060 241713 243149 gene locus_tag LOCUS_61070 241713 243149 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927099.1 protein_id gnl|my_center|LOCUS_61070 243161 243976 gene locus_tag LOCUS_61080 243161 243976 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_61080 243977 244966 gene locus_tag LOCUS_61090 243977 244966 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970705.1 protein_id gnl|my_center|LOCUS_61090 244969 246477 gene locus_tag LOCUS_61100 244969 246477 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338818.1 protein_id gnl|my_center|LOCUS_61100 246474 247490 gene locus_tag LOCUS_61110 246474 247490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721763.1 protein_id gnl|my_center|LOCUS_61110 247521 248468 gene locus_tag LOCUS_61120 247521 248468 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563288.1 protein_id gnl|my_center|LOCUS_61120 248638 249549 gene locus_tag LOCUS_61130 248638 249549 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098260.1 protein_id gnl|my_center|LOCUS_61130 250676 249675 gene locus_tag LOCUS_61140 gene iolG 250676 249675 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387540.1 protein_id gnl|my_center|LOCUS_61140 250806 251981 gene locus_tag LOCUS_61150 250806 251981 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858057.1 protein_id gnl|my_center|LOCUS_61150 252071 253912 gene locus_tag LOCUS_61160 gene iolD 252071 253912 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223774.1 protein_id gnl|my_center|LOCUS_61160 254012 254503 gene locus_tag LOCUS_61170 254012 254503 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530535.1 protein_id gnl|my_center|LOCUS_61170 254819 254556 gene locus_tag LOCUS_61180 gene minE 254819 254556 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887983.1 protein_id gnl|my_center|LOCUS_61180 255631 254816 gene locus_tag LOCUS_61190 gene minD 255631 254816 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314831.1 protein_id gnl|my_center|LOCUS_61190 256412 255663 gene locus_tag LOCUS_61200 gene minC 256412 255663 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311178.1 protein_id gnl|my_center|LOCUS_61200 258714 256912 gene locus_tag LOCUS_61210 258714 256912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974102.1 protein_id gnl|my_center|LOCUS_61210 259577 258717 gene locus_tag LOCUS_61220 259577 258717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314855.1 protein_id gnl|my_center|LOCUS_61220 260524 259574 gene locus_tag LOCUS_61230 260524 259574 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972897.1 protein_id gnl|my_center|LOCUS_61230 262053 260536 gene locus_tag LOCUS_61240 262053 260536 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972898.1 protein_id gnl|my_center|LOCUS_61240 263642 262113 gene locus_tag LOCUS_61250 263642 262113 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973438.1 protein_id gnl|my_center|LOCUS_61250 264369 265232 gene locus_tag LOCUS_61260 264369 265232 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331848.1 protein_id gnl|my_center|LOCUS_61260 265651 265352 gene locus_tag LOCUS_61270 265651 265352 CDS product DUF6522 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967629.1 protein_id gnl|my_center|LOCUS_61270 266115 265648 gene locus_tag LOCUS_61280 266115 265648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61280 266900 266112 gene locus_tag LOCUS_61290 266900 266112 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329369.1 protein_id gnl|my_center|LOCUS_61290 267122 266913 gene locus_tag LOCUS_61300 267122 266913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61300 267997 267119 gene locus_tag LOCUS_61310 gene ccoP 267997 267119 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329370.1 protein_id gnl|my_center|LOCUS_61310 268171 268001 gene locus_tag LOCUS_61320 268171 268001 CDS product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329371.1 protein_id gnl|my_center|LOCUS_61320 268907 268176 gene locus_tag LOCUS_61330 gene ccoO 268907 268176 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970725.1 protein_id gnl|my_center|LOCUS_61330 270568 268910 gene locus_tag LOCUS_61340 gene ccoN 270568 268910 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967313.1 protein_id gnl|my_center|LOCUS_61340 271032 270589 gene locus_tag LOCUS_61350 gene nsrR 271032 270589 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_61350 271879 271205 gene locus_tag LOCUS_61360 271879 271205 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337078.1 protein_id gnl|my_center|LOCUS_61360 272433 271891 gene locus_tag LOCUS_61370 272433 271891 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063705.1 protein_id gnl|my_center|LOCUS_61370 273296 272580 gene locus_tag LOCUS_61380 273296 272580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444153.1 protein_id gnl|my_center|LOCUS_61380 273979 273332 gene locus_tag LOCUS_61390 273979 273332 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204186.1 protein_id gnl|my_center|LOCUS_61390 275541 274147 gene locus_tag LOCUS_61400 275541 274147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61400 276342 275746 gene locus_tag LOCUS_61410 276342 275746 CDS product DUF4360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028347.1 protein_id gnl|my_center|LOCUS_61410 276563 276820 gene locus_tag LOCUS_61420 276563 276820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61420 277948 276830 gene locus_tag LOCUS_61430 277948 276830 CDS product 5-methylthioribulose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389751.1 protein_id gnl|my_center|LOCUS_61430 278949 277948 gene locus_tag LOCUS_61440 278949 277948 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893542.1 protein_id gnl|my_center|LOCUS_61440 279887 278952 gene locus_tag LOCUS_61450 279887 278952 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098399.1 protein_id gnl|my_center|LOCUS_61450 280986 279892 gene locus_tag LOCUS_61460 gene mtnA 280986 279892 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970692.1 protein_id gnl|my_center|LOCUS_61460 282254 280983 gene locus_tag LOCUS_61470 gene mtnK 282254 280983 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529407.1 protein_id gnl|my_center|LOCUS_61470 282401 283918 gene locus_tag LOCUS_61480 282401 283918 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976317.1 protein_id gnl|my_center|LOCUS_61480 283915 284964 gene locus_tag LOCUS_61490 283915 284964 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456749.1 protein_id gnl|my_center|LOCUS_61490 285011 286054 gene locus_tag LOCUS_61500 285011 286054 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976315.1 protein_id gnl|my_center|LOCUS_61500 286172 286447 gene locus_tag LOCUS_61510 286172 286447 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888120.1 protein_id gnl|my_center|LOCUS_61510 286447 286770 gene locus_tag LOCUS_61520 286447 286770 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_61520 288874 286820 gene locus_tag LOCUS_61530 288874 286820 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532918.1 protein_id gnl|my_center|LOCUS_61530 289906 288935 gene locus_tag LOCUS_61540 289906 288935 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970687.1 protein_id gnl|my_center|LOCUS_61540 290826 290086 gene locus_tag LOCUS_61550 290826 290086 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975316.1 protein_id gnl|my_center|LOCUS_61550 290928 291551 gene locus_tag LOCUS_61560 290928 291551 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531693.1 protein_id gnl|my_center|LOCUS_61560 291971 291555 gene locus_tag LOCUS_61570 291971 291555 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082428.1 protein_id gnl|my_center|LOCUS_61570 292102 292593 gene locus_tag LOCUS_61580 292102 292593 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266867.1 protein_id gnl|my_center|LOCUS_61580 293529 292609 gene locus_tag LOCUS_61590 293529 292609 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047183.1 protein_id gnl|my_center|LOCUS_61590 293663 294847 gene locus_tag LOCUS_61600 293663 294847 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257273.1 protein_id gnl|my_center|LOCUS_61600 294829 295770 gene locus_tag LOCUS_61610 294829 295770 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066663.1 protein_id gnl|my_center|LOCUS_61610 295767 296600 gene locus_tag LOCUS_61620 295767 296600 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066662.1 protein_id gnl|my_center|LOCUS_61620 296605 298275 gene locus_tag LOCUS_61630 296605 298275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972985.1 protein_id gnl|my_center|LOCUS_61630 298303 299154 gene locus_tag LOCUS_61640 298303 299154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227200.1 protein_id gnl|my_center|LOCUS_61640 299188 300732 gene locus_tag LOCUS_61650 299188 300732 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217481233.1 protein_id gnl|my_center|LOCUS_61650 300903 301988 gene locus_tag LOCUS_61660 300903 301988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61660 302547 302197 gene locus_tag LOCUS_61670 302547 302197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61670 303150 302821 gene locus_tag LOCUS_61680 303150 302821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61680 303981 303277 gene locus_tag LOCUS_61690 303981 303277 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104658.1 protein_id gnl|my_center|LOCUS_61690 304127 304558 gene locus_tag LOCUS_61700 304127 304558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312655.1 protein_id gnl|my_center|LOCUS_61700 304819 305463 gene locus_tag LOCUS_61710 304819 305463 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067653415.1 protein_id gnl|my_center|LOCUS_61710 305557 307056 gene locus_tag LOCUS_61720 305557 307056 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970602.1 protein_id gnl|my_center|LOCUS_61720 307207 308562 gene locus_tag LOCUS_61730 307207 308562 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393205.1 protein_id gnl|my_center|LOCUS_61730 308629 309093 gene locus_tag LOCUS_61740 308629 309093 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003509013.1 protein_id gnl|my_center|LOCUS_61740 309163 310476 gene locus_tag LOCUS_61750 309163 310476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61750 310720 311745 gene locus_tag LOCUS_61760 310720 311745 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310267.1 protein_id gnl|my_center|LOCUS_61760 311751 312614 gene locus_tag LOCUS_61770 gene cysT 311751 312614 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530875.1 protein_id gnl|my_center|LOCUS_61770 312604 313464 gene locus_tag LOCUS_61780 gene cysW 312604 313464 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396228.1 protein_id gnl|my_center|LOCUS_61780 313483 314535 gene locus_tag LOCUS_61790 313483 314535 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971173.1 protein_id gnl|my_center|LOCUS_61790 315477 314575 gene locus_tag LOCUS_61800 315477 314575 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196222.1 protein_id gnl|my_center|LOCUS_61800 315733 316509 gene locus_tag LOCUS_61810 315733 316509 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103315.1 protein_id gnl|my_center|LOCUS_61810 316533 316775 gene locus_tag LOCUS_61820 316533 316775 CDS product acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533152.1 protein_id gnl|my_center|LOCUS_61820 316772 318157 gene locus_tag LOCUS_61830 316772 318157 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533153.1 protein_id gnl|my_center|LOCUS_61830 318157 319032 gene locus_tag LOCUS_61840 318157 319032 CDS product carboxyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533154.1 protein_id gnl|my_center|LOCUS_61840 319022 319993 gene locus_tag LOCUS_61850 319022 319993 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533155.1 protein_id gnl|my_center|LOCUS_61850 321330 320320 gene locus_tag LOCUS_61860 321330 320320 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010207837.1 protein_id gnl|my_center|LOCUS_61860 321909 322955 gene locus_tag LOCUS_61870 321909 322955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811606.1 protein_id gnl|my_center|LOCUS_61870 323007 323906 gene locus_tag LOCUS_61880 323007 323906 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561538.1 protein_id gnl|my_center|LOCUS_61880 323910 324755 gene locus_tag LOCUS_61890 323910 324755 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855566.1 protein_id gnl|my_center|LOCUS_61890 324755 325489 gene locus_tag LOCUS_61900 324755 325489 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764784.1 protein_id gnl|my_center|LOCUS_61900 325716 326483 gene locus_tag LOCUS_61910 325716 326483 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764783.1 protein_id gnl|my_center|LOCUS_61910 326583 327815 gene locus_tag LOCUS_61920 326583 327815 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175401.1 protein_id gnl|my_center|LOCUS_61920 327873 328967 gene locus_tag LOCUS_61930 327873 328967 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887944.1 protein_id gnl|my_center|LOCUS_61930 328999 329880 gene locus_tag LOCUS_61940 328999 329880 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554892.1 protein_id gnl|my_center|LOCUS_61940 330071 330403 gene locus_tag LOCUS_61950 330071 330403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339639.1 protein_id gnl|my_center|LOCUS_61950 330396 331472 gene locus_tag LOCUS_61960 330396 331472 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268747.1 protein_id gnl|my_center|LOCUS_61960 331472 332704 gene locus_tag LOCUS_61970 331472 332704 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764787.1 protein_id gnl|my_center|LOCUS_61970 332707 334068 gene locus_tag LOCUS_61980 332707 334068 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972875.1 protein_id gnl|my_center|LOCUS_61980 335297 334104 gene locus_tag LOCUS_61990 gene lhgO 335297 334104 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198032110.1 protein_id gnl|my_center|LOCUS_61990 335700 336614 gene locus_tag LOCUS_62000 gene yghU 335700 336614 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973164.1 protein_id gnl|my_center|LOCUS_62000 337786 336620 gene locus_tag LOCUS_62010 337786 336620 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166648346.1 protein_id gnl|my_center|LOCUS_62010 338013 337810 gene locus_tag LOCUS_62020 338013 337810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62020 338146 339651 gene locus_tag LOCUS_62030 338146 339651 CDS product winged helix-turn-helix domain-containing tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095517487.1 protein_id gnl|my_center|LOCUS_62030 339722 340618 gene locus_tag LOCUS_62040 339722 340618 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 protein_id gnl|my_center|LOCUS_62040 340740 342032 gene locus_tag LOCUS_62050 340740 342032 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969686.1 protein_id gnl|my_center|LOCUS_62050 342243 343079 gene locus_tag LOCUS_62060 342243 343079 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974327.1 protein_id gnl|my_center|LOCUS_62060 343104 344225 gene locus_tag LOCUS_62070 343104 344225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62070 344278 346023 gene locus_tag LOCUS_62080 344278 346023 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967271.1 protein_id gnl|my_center|LOCUS_62080 346020 347120 gene locus_tag LOCUS_62090 346020 347120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967272.1 protein_id gnl|my_center|LOCUS_62090 347117 347722 gene locus_tag LOCUS_62100 347117 347722 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967273.1 protein_id gnl|my_center|LOCUS_62100 348396 347812 gene locus_tag LOCUS_62110 348396 347812 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970153.1 protein_id gnl|my_center|LOCUS_62110 >Feature sequence35 159 803 gene locus_tag LOCUS_62120 gene ccmA 159 803 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067291.1 protein_id gnl|my_center|LOCUS_62120 803 1459 gene locus_tag LOCUS_62130 gene ccmB 803 1459 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982179.1 protein_id gnl|my_center|LOCUS_62130 1533 2303 gene locus_tag LOCUS_62140 1533 2303 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970511.1 protein_id gnl|my_center|LOCUS_62140 2300 2467 gene locus_tag LOCUS_62150 gene ccmD 2300 2467 CDS product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529719.1 protein_id gnl|my_center|LOCUS_62150 2464 3081 gene locus_tag LOCUS_62160 2464 3081 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067295.1 protein_id gnl|my_center|LOCUS_62160 5186 3126 gene locus_tag LOCUS_62170 5186 3126 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398653.1 protein_id gnl|my_center|LOCUS_62170 5578 6696 gene locus_tag LOCUS_62180 5578 6696 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061326.1 protein_id gnl|my_center|LOCUS_62180 7039 6875 gene locus_tag LOCUS_62190 7039 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164497529.1 protein_id gnl|my_center|LOCUS_62190 8720 7203 gene locus_tag LOCUS_62200 8720 7203 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530573.1 protein_id gnl|my_center|LOCUS_62200 9216 8731 gene locus_tag LOCUS_62210 9216 8731 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969883.1 protein_id gnl|my_center|LOCUS_62210 10193 9213 gene locus_tag LOCUS_62220 10193 9213 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530569.1 protein_id gnl|my_center|LOCUS_62220 11441 10374 gene locus_tag LOCUS_62230 11441 10374 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101804541.1 protein_id gnl|my_center|LOCUS_62230 11520 12194 gene locus_tag LOCUS_62240 11520 12194 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972345.1 protein_id gnl|my_center|LOCUS_62240 12191 13582 gene locus_tag LOCUS_62250 12191 13582 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392187.1 protein_id gnl|my_center|LOCUS_62250 13872 14357 gene locus_tag LOCUS_62260 13872 14357 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876608.1 protein_id gnl|my_center|LOCUS_62260 14354 15571 gene locus_tag LOCUS_62270 14354 15571 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393947.1 protein_id gnl|my_center|LOCUS_62270 16836 15643 gene locus_tag LOCUS_62280 16836 15643 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330161.1 protein_id gnl|my_center|LOCUS_62280 17051 17902 gene locus_tag LOCUS_62290 17051 17902 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972478.1 protein_id gnl|my_center|LOCUS_62290 18050 18691 gene locus_tag LOCUS_62300 18050 18691 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252343.1 protein_id gnl|my_center|LOCUS_62300 19309 18698 gene locus_tag LOCUS_62310 19309 18698 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_62310 20163 19369 gene locus_tag LOCUS_62320 20163 19369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529683.1 protein_id gnl|my_center|LOCUS_62320 21041 20163 gene locus_tag LOCUS_62330 21041 20163 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067273.1 protein_id gnl|my_center|LOCUS_62330 22121 21168 gene locus_tag LOCUS_62340 22121 21168 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529687.1 protein_id gnl|my_center|LOCUS_62340 23697 22459 gene locus_tag LOCUS_62350 gene rlmN 23697 22459 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970499.1 protein_id gnl|my_center|LOCUS_62350 24740 23847 gene locus_tag LOCUS_62360 24740 23847 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968433.1 protein_id gnl|my_center|LOCUS_62360 24870 26258 gene locus_tag LOCUS_62370 24870 26258 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968432.1 protein_id gnl|my_center|LOCUS_62370 26825 26322 gene locus_tag LOCUS_62380 26825 26322 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330158.1 protein_id gnl|my_center|LOCUS_62380 27632 27243 gene locus_tag LOCUS_62390 27632 27243 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242441.1 protein_id gnl|my_center|LOCUS_62390 28013 27705 gene locus_tag LOCUS_62400 28013 27705 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709729.1 protein_id gnl|my_center|LOCUS_62400 28802 28092 gene locus_tag LOCUS_62410 28802 28092 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709750.1 protein_id gnl|my_center|LOCUS_62410 30086 28905 gene locus_tag LOCUS_62420 30086 28905 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390321.1 protein_id gnl|my_center|LOCUS_62420 30378 30956 gene locus_tag LOCUS_62430 gene phaR 30378 30956 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065997962.1 protein_id gnl|my_center|LOCUS_62430 31397 30990 gene locus_tag LOCUS_62440 31397 30990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529226.1 protein_id gnl|my_center|LOCUS_62440 31919 31734 gene locus_tag LOCUS_62450 gene rpmF 31919 31734 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535764.1 protein_id gnl|my_center|LOCUS_62450 32714 32067 gene locus_tag LOCUS_62460 32714 32067 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390319.1 protein_id gnl|my_center|LOCUS_62460 33546 32791 gene locus_tag LOCUS_62470 gene mtgA 33546 32791 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067328.1 protein_id gnl|my_center|LOCUS_62470 33682 34599 gene locus_tag LOCUS_62480 33682 34599 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970531.1 protein_id gnl|my_center|LOCUS_62480 34604 35659 gene locus_tag LOCUS_62490 gene hisC 34604 35659 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390315.1 protein_id gnl|my_center|LOCUS_62490 36985 35732 gene locus_tag LOCUS_62500 gene ispG 36985 35732 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067340.1 protein_id gnl|my_center|LOCUS_62500 38316 37123 gene locus_tag LOCUS_62510 38316 37123 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535755.1 protein_id gnl|my_center|LOCUS_62510 39123 38350 gene locus_tag LOCUS_62520 39123 38350 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577770.1 protein_id gnl|my_center|LOCUS_62520 40140 39280 gene locus_tag LOCUS_62530 40140 39280 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970526.1 protein_id gnl|my_center|LOCUS_62530 40973 40404 gene locus_tag LOCUS_62540 40973 40404 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709746.1 protein_id gnl|my_center|LOCUS_62540 41732 41343 gene locus_tag LOCUS_62550 41732 41343 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067320.1 protein_id gnl|my_center|LOCUS_62550 42293 41874 gene locus_tag LOCUS_62560 42293 41874 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242426.1 protein_id gnl|my_center|LOCUS_62560 45357 42298 gene locus_tag LOCUS_62570 45357 42298 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563365.1 protein_id gnl|my_center|LOCUS_62570 45742 46380 gene locus_tag LOCUS_62580 45742 46380 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531515.1 protein_id gnl|my_center|LOCUS_62580 46994 46413 gene locus_tag LOCUS_62590 gene thpR 46994 46413 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972484.1 protein_id gnl|my_center|LOCUS_62590 47670 47077 gene locus_tag LOCUS_62600 47670 47077 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067280.1 protein_id gnl|my_center|LOCUS_62600 47781 48497 gene locus_tag LOCUS_62610 47781 48497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330154.1 protein_id gnl|my_center|LOCUS_62610 48494 51046 gene locus_tag LOCUS_62620 48494 51046 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970504.1 protein_id gnl|my_center|LOCUS_62620 51228 51971 gene locus_tag LOCUS_62630 51228 51971 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508710.1 protein_id gnl|my_center|LOCUS_62630 53693 52215 gene locus_tag LOCUS_62640 53693 52215 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330170.1 protein_id gnl|my_center|LOCUS_62640 54603 53884 gene locus_tag LOCUS_62650 gene thiQ 54603 53884 CDS product thiamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393967.1 protein_id gnl|my_center|LOCUS_62650 56221 54596 gene locus_tag LOCUS_62660 gene thiP 56221 54596 CDS product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970523.1 protein_id gnl|my_center|LOCUS_62660 57230 56223 gene locus_tag LOCUS_62670 gene thiB 57230 56223 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393959.1 protein_id gnl|my_center|LOCUS_62670 58931 57624 gene locus_tag LOCUS_62680 58931 57624 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969983.1 protein_id gnl|my_center|LOCUS_62680 60280 58931 gene locus_tag LOCUS_62690 60280 58931 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969984.1 protein_id gnl|my_center|LOCUS_62690 60417 61112 gene locus_tag LOCUS_62700 60417 61112 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969985.1 protein_id gnl|my_center|LOCUS_62700 61821 61114 gene locus_tag LOCUS_62710 61821 61114 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529020.1 protein_id gnl|my_center|LOCUS_62710 61972 63240 gene locus_tag LOCUS_62720 61972 63240 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527152.1 protein_id gnl|my_center|LOCUS_62720 63925 63485 gene locus_tag LOCUS_62730 63925 63485 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242567.1 protein_id gnl|my_center|LOCUS_62730 64038 65138 gene locus_tag LOCUS_62740 64038 65138 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970366.1 protein_id gnl|my_center|LOCUS_62740 66525 65293 gene locus_tag LOCUS_62750 66525 65293 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330316.1 protein_id gnl|my_center|LOCUS_62750 68055 66532 gene locus_tag LOCUS_62760 68055 66532 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242406.1 protein_id gnl|my_center|LOCUS_62760 69495 68077 gene locus_tag LOCUS_62770 69495 68077 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330314.1 protein_id gnl|my_center|LOCUS_62770 70904 69507 gene locus_tag LOCUS_62780 70904 69507 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242408.1 protein_id gnl|my_center|LOCUS_62780 71075 71971 gene locus_tag LOCUS_62790 71075 71971 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535214.1 protein_id gnl|my_center|LOCUS_62790 72092 73375 gene locus_tag LOCUS_62800 72092 73375 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972400.1 protein_id gnl|my_center|LOCUS_62800 73494 73664 gene locus_tag LOCUS_62810 73494 73664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62810 73813 73622 gene locus_tag LOCUS_62820 73813 73622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62820 73797 74180 gene locus_tag LOCUS_62830 73797 74180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62830 75378 74200 gene locus_tag LOCUS_62840 75378 74200 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066792.1 protein_id gnl|my_center|LOCUS_62840 76497 75418 gene locus_tag LOCUS_62850 76497 75418 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970131.1 protein_id gnl|my_center|LOCUS_62850 76665 77825 gene locus_tag LOCUS_62860 76665 77825 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133034483.1 protein_id gnl|my_center|LOCUS_62860 77872 77948 gene locus_tag LOCUS_t00550 77872 77948 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 78640 78260 gene locus_tag LOCUS_62870 78640 78260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62870 79387 78671 gene locus_tag LOCUS_62880 79387 78671 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067091.1 protein_id gnl|my_center|LOCUS_62880 79578 80753 gene locus_tag LOCUS_62890 gene dxr 79578 80753 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329990.1 protein_id gnl|my_center|LOCUS_62890 81988 80774 gene locus_tag LOCUS_62900 gene hemA 81988 80774 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312336.1 protein_id gnl|my_center|LOCUS_62900 83028 82231 gene locus_tag LOCUS_62910 83028 82231 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970338.1 protein_id gnl|my_center|LOCUS_62910 85391 83040 gene locus_tag LOCUS_62920 85391 83040 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067095.1 protein_id gnl|my_center|LOCUS_62920 85990 85499 gene locus_tag LOCUS_62930 85990 85499 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242602.1 protein_id gnl|my_center|LOCUS_62930 86454 86717 gene locus_tag LOCUS_62940 86454 86717 CDS product glycine zipper domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312335.1 protein_id gnl|my_center|LOCUS_62940 87078 88913 gene locus_tag LOCUS_62950 87078 88913 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577638.1 protein_id gnl|my_center|LOCUS_62950 89018 93187 gene locus_tag LOCUS_62960 89018 93187 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972439.1 protein_id gnl|my_center|LOCUS_62960 93376 93852 gene locus_tag LOCUS_62970 93376 93852 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709572.1 protein_id gnl|my_center|LOCUS_62970 94247 96016 gene locus_tag LOCUS_62980 94247 96016 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970347.1 protein_id gnl|my_center|LOCUS_62980 96347 96078 gene locus_tag LOCUS_62990 96347 96078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62990 97190 96357 gene locus_tag LOCUS_63000 gene fdhD 97190 96357 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398018.1 protein_id gnl|my_center|LOCUS_63000 100079 97200 gene locus_tag LOCUS_63010 gene fdhF 100079 97200 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970349.1 protein_id gnl|my_center|LOCUS_63010 100350 100135 gene locus_tag LOCUS_63020 100350 100135 CDS product DUF4287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061368.1 protein_id gnl|my_center|LOCUS_63020 101903 100347 gene locus_tag LOCUS_63030 101903 100347 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970350.1 protein_id gnl|my_center|LOCUS_63030 102379 101900 gene locus_tag LOCUS_63040 102379 101900 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530346.1 protein_id gnl|my_center|LOCUS_63040 103453 102560 gene locus_tag LOCUS_63050 103453 102560 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398030.1 protein_id gnl|my_center|LOCUS_63050 103550 104545 gene locus_tag LOCUS_63060 103550 104545 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085331.1 protein_id gnl|my_center|LOCUS_63060 105330 104560 gene locus_tag LOCUS_63070 105330 104560 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398033.1 protein_id gnl|my_center|LOCUS_63070 105477 106247 gene locus_tag LOCUS_63080 105477 106247 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330015.1 protein_id gnl|my_center|LOCUS_63080 106361 107878 gene locus_tag LOCUS_63090 gene glpD 106361 107878 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398036.1 protein_id gnl|my_center|LOCUS_63090 107919 109001 gene locus_tag LOCUS_63100 107919 109001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390044.1 protein_id gnl|my_center|LOCUS_63100 109012 110082 gene locus_tag LOCUS_63110 109012 110082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242578.1 protein_id gnl|my_center|LOCUS_63110 110085 110951 gene locus_tag LOCUS_63120 110085 110951 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067118.1 protein_id gnl|my_center|LOCUS_63120 110963 111844 gene locus_tag LOCUS_63130 110963 111844 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067119.1 protein_id gnl|my_center|LOCUS_63130 111844 112263 gene locus_tag LOCUS_63140 111844 112263 CDS product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067120.1 protein_id gnl|my_center|LOCUS_63140 112339 114060 gene locus_tag LOCUS_63150 112339 114060 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530325.1 protein_id gnl|my_center|LOCUS_63150 114831 114202 gene locus_tag LOCUS_63160 114831 114202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63160 114922 115890 gene locus_tag LOCUS_63170 114922 115890 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902312.1 protein_id gnl|my_center|LOCUS_63170 115887 116453 gene locus_tag LOCUS_63180 115887 116453 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090887.1 protein_id gnl|my_center|LOCUS_63180 116572 117846 gene locus_tag LOCUS_63190 116572 117846 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709166.1 protein_id gnl|my_center|LOCUS_63190 117933 120200 gene locus_tag LOCUS_63200 gene ptsP 117933 120200 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329508.1 protein_id gnl|my_center|LOCUS_63200 120223 121305 gene locus_tag LOCUS_63210 gene prfA 120223 121305 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973615.1 protein_id gnl|my_center|LOCUS_63210 121302 122174 gene locus_tag LOCUS_63220 gene prmC 121302 122174 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970073.1 protein_id gnl|my_center|LOCUS_63220 122503 123165 gene locus_tag LOCUS_63230 122503 123165 CDS product DUF4167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066721.1 protein_id gnl|my_center|LOCUS_63230 123416 126022 gene locus_tag LOCUS_63240 gene clpB 123416 126022 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970072.1 protein_id gnl|my_center|LOCUS_63240 126162 126827 gene locus_tag LOCUS_63250 126162 126827 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393953.1 protein_id gnl|my_center|LOCUS_63250 126831 128657 gene locus_tag LOCUS_63260 126831 128657 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970520.1 protein_id gnl|my_center|LOCUS_63260 128788 129033 gene locus_tag LOCUS_63270 128788 129033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63270 129272 130195 gene locus_tag LOCUS_63280 gene metA 129272 130195 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972516.1 protein_id gnl|my_center|LOCUS_63280 130199 130651 gene locus_tag LOCUS_63290 130199 130651 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529104.1 protein_id gnl|my_center|LOCUS_63290 130745 131761 gene locus_tag LOCUS_63300 130745 131761 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252333.1 protein_id gnl|my_center|LOCUS_63300 132005 133912 gene locus_tag LOCUS_63310 132005 133912 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968581.1 protein_id gnl|my_center|LOCUS_63310 135047 133980 gene locus_tag LOCUS_63320 135047 133980 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398980.1 protein_id gnl|my_center|LOCUS_63320 135189 136199 gene locus_tag LOCUS_63330 135189 136199 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068883688.1 protein_id gnl|my_center|LOCUS_63330 138419 136932 gene locus_tag LOCUS_63340 138419 136932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63340 140821 138440 gene locus_tag LOCUS_63350 140821 138440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63350 142272 140821 gene locus_tag LOCUS_63360 142272 140821 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939433.1 protein_id gnl|my_center|LOCUS_63360 143006 142269 gene locus_tag LOCUS_63370 143006 142269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63370 145438 143006 gene locus_tag LOCUS_63380 145438 143006 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_63380 146196 146390 gene locus_tag LOCUS_63390 146196 146390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63390 146387 148975 gene locus_tag LOCUS_63400 146387 148975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63400 149366 150640 gene locus_tag LOCUS_63410 149366 150640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63410 150780 150974 gene locus_tag LOCUS_63420 150780 150974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63420 151680 151126 gene locus_tag LOCUS_63430 151680 151126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63430 152466 151741 gene locus_tag LOCUS_63440 152466 151741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63440 153003 153530 gene locus_tag LOCUS_63450 153003 153530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63450 153692 154894 gene locus_tag LOCUS_63460 153692 154894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63460 155201 155127 gene locus_tag LOCUS_t00560 155201 155127 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 155422 155931 gene locus_tag LOCUS_63470 155422 155931 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330108.1 protein_id gnl|my_center|LOCUS_63470 155989 156951 gene locus_tag LOCUS_63480 gene trxA 155989 156951 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970479.1 protein_id gnl|my_center|LOCUS_63480 157080 157760 gene locus_tag LOCUS_63490 157080 157760 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970480.1 protein_id gnl|my_center|LOCUS_63490 157771 157959 gene locus_tag LOCUS_63500 157771 157959 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709672.1 protein_id gnl|my_center|LOCUS_63500 159269 158034 gene locus_tag LOCUS_63510 159269 158034 CDS product ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393779.1 protein_id gnl|my_center|LOCUS_63510 159384 160241 gene locus_tag LOCUS_63520 gene tesB 159384 160241 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970482.1 protein_id gnl|my_center|LOCUS_63520 160472 160810 gene locus_tag LOCUS_63530 160472 160810 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709636.1 protein_id gnl|my_center|LOCUS_63530 160840 162201 gene locus_tag LOCUS_63540 160840 162201 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970483.1 protein_id gnl|my_center|LOCUS_63540 162443 165109 gene locus_tag LOCUS_63550 162443 165109 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970484.1 protein_id gnl|my_center|LOCUS_63550 165208 165879 gene locus_tag LOCUS_63560 165208 165879 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082910010.1 protein_id gnl|my_center|LOCUS_63560 165974 166780 gene locus_tag LOCUS_63570 165974 166780 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529670.1 protein_id gnl|my_center|LOCUS_63570 167386 166931 gene locus_tag LOCUS_63580 167386 166931 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067262.1 protein_id gnl|my_center|LOCUS_63580 168140 167457 gene locus_tag LOCUS_63590 168140 167457 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310886.1 protein_id gnl|my_center|LOCUS_63590 168251 168796 gene locus_tag LOCUS_63600 168251 168796 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092733832.1 protein_id gnl|my_center|LOCUS_63600 168927 169757 gene locus_tag LOCUS_63610 168927 169757 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 protein_id gnl|my_center|LOCUS_63610 170436 169888 gene locus_tag LOCUS_63620 170436 169888 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 protein_id gnl|my_center|LOCUS_63620 171884 170475 gene locus_tag LOCUS_63630 gene leuC 171884 170475 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393760.1 protein_id gnl|my_center|LOCUS_63630 172957 172151 gene locus_tag LOCUS_63640 172957 172151 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529754.1 protein_id gnl|my_center|LOCUS_63640 173764 172967 gene locus_tag LOCUS_63650 173764 172967 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970519.1 protein_id gnl|my_center|LOCUS_63650 174433 173915 gene locus_tag LOCUS_63660 174433 173915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63660 174869 174609 gene locus_tag LOCUS_63670 174869 174609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63670 174838 175584 gene locus_tag LOCUS_63680 174838 175584 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970518.1 protein_id gnl|my_center|LOCUS_63680 176327 175566 gene locus_tag LOCUS_63690 gene trmD 176327 175566 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067306.1 protein_id gnl|my_center|LOCUS_63690 176841 176263 gene locus_tag LOCUS_63700 gene rimM 176841 176263 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310897.1 protein_id gnl|my_center|LOCUS_63700 177322 176957 gene locus_tag LOCUS_63710 gene rpsP 177322 176957 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529742.1 protein_id gnl|my_center|LOCUS_63710 177682 177359 gene locus_tag LOCUS_63720 177682 177359 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310875.1 protein_id gnl|my_center|LOCUS_63720 179250 177694 gene locus_tag LOCUS_63730 gene ffh 179250 177694 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242460.1 protein_id gnl|my_center|LOCUS_63730 179517 179876 gene locus_tag LOCUS_63740 179517 179876 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087188.1 protein_id gnl|my_center|LOCUS_63740 179908 181020 gene locus_tag LOCUS_63750 179908 181020 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972496.1 protein_id gnl|my_center|LOCUS_63750 181100 181999 gene locus_tag LOCUS_63760 gene dapF 181100 181999 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972495.1 protein_id gnl|my_center|LOCUS_63760 181996 183273 gene locus_tag LOCUS_63770 gene mtaB 181996 183273 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393886.1 protein_id gnl|my_center|LOCUS_63770 183288 184811 gene locus_tag LOCUS_63780 183288 184811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63780 184808 185458 gene locus_tag LOCUS_63790 184808 185458 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970512.1 protein_id gnl|my_center|LOCUS_63790 185575 187137 gene locus_tag LOCUS_63800 185575 187137 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067187.1 protein_id gnl|my_center|LOCUS_63800 187272 189101 gene locus_tag LOCUS_63810 gene typA 187272 189101 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330113.1 protein_id gnl|my_center|LOCUS_63810 189318 189824 gene locus_tag LOCUS_63820 189318 189824 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531187.1 protein_id gnl|my_center|LOCUS_63820 190443 189841 gene locus_tag LOCUS_63830 190443 189841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531186.1 protein_id gnl|my_center|LOCUS_63830 190578 191114 gene locus_tag LOCUS_63840 gene ppa 190578 191114 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310823.1 protein_id gnl|my_center|LOCUS_63840 191446 191120 gene locus_tag LOCUS_63850 191446 191120 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242528.1 protein_id gnl|my_center|LOCUS_63850 191739 191443 gene locus_tag LOCUS_63860 191739 191443 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310858.1 protein_id gnl|my_center|LOCUS_63860 192581 191865 gene locus_tag LOCUS_63870 192581 191865 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970397.1 protein_id gnl|my_center|LOCUS_63870 193070 192585 gene locus_tag LOCUS_63880 193070 192585 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067180.1 protein_id gnl|my_center|LOCUS_63880 194774 193167 gene locus_tag LOCUS_63890 194774 193167 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330120.1 protein_id gnl|my_center|LOCUS_63890 196077 194788 gene locus_tag LOCUS_63900 196077 194788 CDS product COG4223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310857.1 protein_id gnl|my_center|LOCUS_63900 196901 196176 gene locus_tag LOCUS_63910 196901 196176 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067177.1 protein_id gnl|my_center|LOCUS_63910 197836 196907 gene locus_tag LOCUS_63920 gene hemC 197836 196907 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970392.1 protein_id gnl|my_center|LOCUS_63920 197912 199006 gene locus_tag LOCUS_63930 gene tsaD 197912 199006 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393860.1 protein_id gnl|my_center|LOCUS_63930 199003 199989 gene locus_tag LOCUS_63940 199003 199989 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330125.1 protein_id gnl|my_center|LOCUS_63940 200008 200301 gene locus_tag LOCUS_63950 200008 200301 CDS product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330126.1 protein_id gnl|my_center|LOCUS_63950 200307 200738 gene locus_tag LOCUS_63960 200307 200738 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389839.1 protein_id gnl|my_center|LOCUS_63960 200773 201456 gene locus_tag LOCUS_63970 200773 201456 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508815.1 protein_id gnl|my_center|LOCUS_63970 201936 201472 gene locus_tag LOCUS_63980 201936 201472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63980 202237 202629 gene locus_tag LOCUS_63990 gene sdhC 202237 202629 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067169.1 protein_id gnl|my_center|LOCUS_63990 202640 203020 gene locus_tag LOCUS_64000 gene sdhD 202640 203020 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615499.1 protein_id gnl|my_center|LOCUS_64000 203027 204868 gene locus_tag LOCUS_64010 gene sdhA 203027 204868 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067167.1 protein_id gnl|my_center|LOCUS_64010 204887 205666 gene locus_tag LOCUS_64020 204887 205666 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531162.1 protein_id gnl|my_center|LOCUS_64020 205843 206343 gene locus_tag LOCUS_64030 205843 206343 CDS product protease inhibitor Inh/omp19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037456298.1 protein_id gnl|my_center|LOCUS_64030 206382 207575 gene locus_tag LOCUS_64040 gene zapE 206382 207575 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972456.1 protein_id gnl|my_center|LOCUS_64040 207742 208704 gene locus_tag LOCUS_64050 gene mdh 207742 208704 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393726.1 protein_id gnl|my_center|LOCUS_64050 208732 209925 gene locus_tag LOCUS_64060 gene sucC 208732 209925 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242550.1 protein_id gnl|my_center|LOCUS_64060 209943 210845 gene locus_tag LOCUS_64070 gene sucD 209943 210845 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034802559.1 protein_id gnl|my_center|LOCUS_64070 210980 213976 gene locus_tag LOCUS_64080 210980 213976 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970380.1 protein_id gnl|my_center|LOCUS_64080 214076 215314 gene locus_tag LOCUS_64090 214076 215314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_64090 215357 215758 gene locus_tag LOCUS_64100 215357 215758 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972451.1 protein_id gnl|my_center|LOCUS_64100 215755 216399 gene locus_tag LOCUS_64110 215755 216399 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067150.1 protein_id gnl|my_center|LOCUS_64110 216403 216891 gene locus_tag LOCUS_64120 216403 216891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984018.1 protein_id gnl|my_center|LOCUS_64120 216879 217640 gene locus_tag LOCUS_64130 216879 217640 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393736.1 protein_id gnl|my_center|LOCUS_64130 217666 219072 gene locus_tag LOCUS_64140 gene lpdA 217666 219072 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393711.1 protein_id gnl|my_center|LOCUS_64140 219147 219653 gene locus_tag LOCUS_64150 219147 219653 CDS product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330046.1 protein_id gnl|my_center|LOCUS_64150 220739 219657 gene locus_tag LOCUS_64160 220739 219657 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393706.1 protein_id gnl|my_center|LOCUS_64160 221855 220920 gene locus_tag LOCUS_64170 221855 220920 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393732.1 protein_id gnl|my_center|LOCUS_64170 222002 223138 gene locus_tag LOCUS_64180 222002 223138 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067142.1 protein_id gnl|my_center|LOCUS_64180 223197 225401 gene locus_tag LOCUS_64190 223197 225401 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067138.1 protein_id gnl|my_center|LOCUS_64190 225505 225888 gene locus_tag LOCUS_64200 225505 225888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330039.1 protein_id gnl|my_center|LOCUS_64200 226150 226716 gene locus_tag LOCUS_64210 226150 226716 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330038.1 protein_id gnl|my_center|LOCUS_64210 226716 228245 gene locus_tag LOCUS_64220 gene atpA 226716 228245 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530298.1 protein_id gnl|my_center|LOCUS_64220 228361 229242 gene locus_tag LOCUS_64230 228361 229242 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389782.1 protein_id gnl|my_center|LOCUS_64230 229269 230798 gene locus_tag LOCUS_64240 gene atpD 229269 230798 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067133.1 protein_id gnl|my_center|LOCUS_64240 230903 231310 gene locus_tag LOCUS_64250 230903 231310 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242660.1 protein_id gnl|my_center|LOCUS_64250 231533 232960 gene locus_tag LOCUS_64260 231533 232960 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655408.1 protein_id gnl|my_center|LOCUS_64260 233716 232967 gene locus_tag LOCUS_64270 233716 232967 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315679.1 protein_id gnl|my_center|LOCUS_64270 234468 233839 gene locus_tag LOCUS_64280 234468 233839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64280 235229 234468 gene locus_tag LOCUS_64290 235229 234468 CDS product DUF6030 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970364.1 protein_id gnl|my_center|LOCUS_64290 236287 235376 gene locus_tag LOCUS_64300 236287 235376 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331304.1 protein_id gnl|my_center|LOCUS_64300 236391 237533 gene locus_tag LOCUS_64310 236391 237533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64310 237542 239041 gene locus_tag LOCUS_64320 237542 239041 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339389.1 protein_id gnl|my_center|LOCUS_64320 239067 240191 gene locus_tag LOCUS_64330 239067 240191 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 protein_id gnl|my_center|LOCUS_64330 240286 241035 gene locus_tag LOCUS_64340 240286 241035 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066727.1 protein_id gnl|my_center|LOCUS_64340 241639 241061 gene locus_tag LOCUS_64350 241639 241061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64350 242067 241639 gene locus_tag LOCUS_64360 242067 241639 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394735.1 protein_id gnl|my_center|LOCUS_64360 242921 242064 gene locus_tag LOCUS_64370 242921 242064 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394733.1 protein_id gnl|my_center|LOCUS_64370 243189 242932 gene locus_tag LOCUS_64380 gene grxC 243189 242932 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844816.1 protein_id gnl|my_center|LOCUS_64380 244016 243225 gene locus_tag LOCUS_64390 244016 243225 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066731.1 protein_id gnl|my_center|LOCUS_64390 244079 244948 gene locus_tag LOCUS_64400 244079 244948 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970081.1 protein_id gnl|my_center|LOCUS_64400 245132 244950 gene locus_tag LOCUS_64410 245132 244950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64410 245488 245171 gene locus_tag LOCUS_64420 245488 245171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329520.1 protein_id gnl|my_center|LOCUS_64420 246019 245597 gene locus_tag LOCUS_64430 gene mutT 246019 245597 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709175.1 protein_id gnl|my_center|LOCUS_64430 246774 246016 gene locus_tag LOCUS_64440 246774 246016 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394699.1 protein_id gnl|my_center|LOCUS_64440 248095 246863 gene locus_tag LOCUS_64450 gene argJ 248095 246863 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970084.1 protein_id gnl|my_center|LOCUS_64450 249045 248146 gene locus_tag LOCUS_64460 249045 248146 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066738.1 protein_id gnl|my_center|LOCUS_64460 249283 252009 gene locus_tag LOCUS_64470 gene secA 249283 252009 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533499.1 protein_id gnl|my_center|LOCUS_64470 252286 253713 gene locus_tag LOCUS_64480 252286 253713 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533497.1 protein_id gnl|my_center|LOCUS_64480 253703 254971 gene locus_tag LOCUS_64490 253703 254971 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970087.1 protein_id gnl|my_center|LOCUS_64490 256663 255020 gene locus_tag LOCUS_64500 256663 255020 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329527.1 protein_id gnl|my_center|LOCUS_64500 257003 256740 gene locus_tag LOCUS_64510 257003 256740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64510 257711 257379 gene locus_tag LOCUS_64520 257711 257379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64520 258123 258680 gene locus_tag LOCUS_64530 258123 258680 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266826.1 protein_id gnl|my_center|LOCUS_64530 258667 261234 gene locus_tag LOCUS_64540 258667 261234 CDS product HWE histidine kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972107.1 protein_id gnl|my_center|LOCUS_64540 261454 261711 gene locus_tag LOCUS_64550 261454 261711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64550 261986 261639 gene locus_tag LOCUS_64560 261986 261639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64560 262442 262056 gene locus_tag LOCUS_64570 262442 262056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64570 262592 262774 gene locus_tag LOCUS_64580 262592 262774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64580 262940 262856 gene locus_tag LOCUS_t00570 262940 262856 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 263111 263620 gene locus_tag LOCUS_64590 263111 263620 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329529.1 protein_id gnl|my_center|LOCUS_64590 264248 263691 gene locus_tag LOCUS_64600 264248 263691 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310944.1 protein_id gnl|my_center|LOCUS_64600 265011 264355 gene locus_tag LOCUS_64610 265011 264355 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970091.1 protein_id gnl|my_center|LOCUS_64610 265156 266064 gene locus_tag LOCUS_64620 gene gluQRS 265156 266064 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970092.1 protein_id gnl|my_center|LOCUS_64620 266955 266011 gene locus_tag LOCUS_64630 266955 266011 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970093.1 protein_id gnl|my_center|LOCUS_64630 267145 267993 gene locus_tag LOCUS_64640 267145 267993 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533481.1 protein_id gnl|my_center|LOCUS_64640 268095 268292 gene locus_tag LOCUS_64650 268095 268292 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533478.1 protein_id gnl|my_center|LOCUS_64650 268300 268878 gene locus_tag LOCUS_64660 268300 268878 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970094.1 protein_id gnl|my_center|LOCUS_64660 268913 269698 gene locus_tag LOCUS_64670 268913 269698 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970095.1 protein_id gnl|my_center|LOCUS_64670 269882 270631 gene locus_tag LOCUS_64680 269882 270631 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982194.1 protein_id gnl|my_center|LOCUS_64680 270655 271584 gene locus_tag LOCUS_64690 270655 271584 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066754.1 protein_id gnl|my_center|LOCUS_64690 271733 272605 gene locus_tag LOCUS_64700 271733 272605 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066755.1 protein_id gnl|my_center|LOCUS_64700 272748 273731 gene locus_tag LOCUS_64710 gene cysP 272748 273731 CDS product thiosulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973096.1 protein_id gnl|my_center|LOCUS_64710 273864 274685 gene locus_tag LOCUS_64720 gene cysT 273864 274685 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973095.1 protein_id gnl|my_center|LOCUS_64720 274688 275575 gene locus_tag LOCUS_64730 gene cysW 274688 275575 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973094.1 protein_id gnl|my_center|LOCUS_64730 275580 276602 gene locus_tag LOCUS_64740 275580 276602 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973093.1 protein_id gnl|my_center|LOCUS_64740 277419 276622 gene locus_tag LOCUS_64750 277419 276622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64750 277319 278722 gene locus_tag LOCUS_64760 gene argH 277319 278722 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441598.1 protein_id gnl|my_center|LOCUS_64760 278827 279012 gene locus_tag LOCUS_64770 278827 279012 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066758.1 protein_id gnl|my_center|LOCUS_64770 279086 280354 gene locus_tag LOCUS_64780 gene lysA 279086 280354 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394686.1 protein_id gnl|my_center|LOCUS_64780 280473 283103 gene locus_tag LOCUS_64790 280473 283103 CDS product TIGR02302 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970102.1 protein_id gnl|my_center|LOCUS_64790 283493 283110 gene locus_tag LOCUS_64800 283493 283110 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066761.1 protein_id gnl|my_center|LOCUS_64800 284193 283645 gene locus_tag LOCUS_64810 gene hpt 284193 283645 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003497442.1 protein_id gnl|my_center|LOCUS_64810 284960 284286 gene locus_tag LOCUS_64820 284960 284286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64820 285165 285824 gene locus_tag LOCUS_64830 gene ftsE 285165 285824 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066764.1 protein_id gnl|my_center|LOCUS_64830 285817 286824 gene locus_tag LOCUS_64840 285817 286824 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066765.1 protein_id gnl|my_center|LOCUS_64840 286895 287608 gene locus_tag LOCUS_64850 286895 287608 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329550.1 protein_id gnl|my_center|LOCUS_64850 287744 288532 gene locus_tag LOCUS_64860 287744 288532 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970106.1 protein_id gnl|my_center|LOCUS_64860 289093 288533 gene locus_tag LOCUS_64870 289093 288533 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329552.1 protein_id gnl|my_center|LOCUS_64870 289170 290177 gene locus_tag LOCUS_64880 289170 290177 CDS product DUF2125 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066769.1 protein_id gnl|my_center|LOCUS_64880 291109 290180 gene locus_tag LOCUS_64890 291109 290180 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844824.1 protein_id gnl|my_center|LOCUS_64890 291923 291174 gene locus_tag LOCUS_64900 291923 291174 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394662.1 protein_id gnl|my_center|LOCUS_64900 292013 292777 gene locus_tag LOCUS_64910 gene gloB 292013 292777 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240047.1 protein_id gnl|my_center|LOCUS_64910 292777 293199 gene locus_tag LOCUS_64920 292777 293199 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394656.1 protein_id gnl|my_center|LOCUS_64920 294081 293200 gene locus_tag LOCUS_64930 294081 293200 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970113.1 protein_id gnl|my_center|LOCUS_64930 294913 294122 gene locus_tag LOCUS_64940 294913 294122 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394650.1 protein_id gnl|my_center|LOCUS_64940 295155 295445 gene locus_tag LOCUS_64950 gene rpmB 295155 295445 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527451.1 protein_id gnl|my_center|LOCUS_64950 295606 296244 gene locus_tag LOCUS_64960 295606 296244 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973191.1 protein_id gnl|my_center|LOCUS_64960 297292 296366 gene locus_tag LOCUS_64970 297292 296366 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394645.1 protein_id gnl|my_center|LOCUS_64970 299258 297399 gene locus_tag LOCUS_64980 gene cobT 299258 297399 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066780.1 protein_id gnl|my_center|LOCUS_64980 300315 299317 gene locus_tag LOCUS_64990 gene cobS 300315 299317 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709224.1 protein_id gnl|my_center|LOCUS_64990 301056 300433 gene locus_tag LOCUS_65000 301056 300433 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844827.1 protein_id gnl|my_center|LOCUS_65000 301175 301456 gene locus_tag LOCUS_65010 301175 301456 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066783.1 protein_id gnl|my_center|LOCUS_65010 302479 301559 gene locus_tag LOCUS_65020 302479 301559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65020 303603 302476 gene locus_tag LOCUS_65030 gene aroB 303603 302476 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577439.1 protein_id gnl|my_center|LOCUS_65030 304195 303614 gene locus_tag LOCUS_65040 304195 303614 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066786.1 protein_id gnl|my_center|LOCUS_65040 304256 304639 gene locus_tag LOCUS_65050 304256 304639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65050 304681 305583 gene locus_tag LOCUS_65060 gene xerD 304681 305583 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970125.1 protein_id gnl|my_center|LOCUS_65060 305659 306612 gene locus_tag LOCUS_65070 305659 306612 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394627.1 protein_id gnl|my_center|LOCUS_65070 306817 308319 gene locus_tag LOCUS_65080 306817 308319 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240034.1 protein_id gnl|my_center|LOCUS_65080 308316 308564 gene locus_tag LOCUS_65090 308316 308564 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066791.1 protein_id gnl|my_center|LOCUS_65090 310612 308657 gene locus_tag LOCUS_65100 310612 308657 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329503.1 protein_id gnl|my_center|LOCUS_65100