COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..132387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(256..1020) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066752.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1042..1617) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970094.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1617..1814) product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066750.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(1935..2780) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533481.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 2984..3949 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970093.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(3896..4804) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970092.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene gluQRS CDS 4860..5516 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970091.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 5618..6175 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310944.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(6191..6700) product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329529.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 tRNA 6916..7000 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(7118..8041) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972516.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene metA CDS complement(8263..10083) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970520.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(10087..10752) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393953.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 11046..12053 product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393959.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene thiB CDS 12064..13683 product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018013039.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene thiP CDS 13676..14419 product thiamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393967.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene thiQ CDS 14609..16114 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330170.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 tRNA complement(15846..15921) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(16200..17063) product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067318.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(17255..17824) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709746.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(18187..18525) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067320.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(18728..19147) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242426.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(19152..22214) product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563365.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(22455..22937) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242497.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene rlmH CDS complement(23039..23443) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186447663.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene rsfS CDS complement(23559..24197) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393806.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(24199..25482) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(25475..26641) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970464.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene proB CDS complement(26643..27653) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242500.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene obgE CDS 28102..30033 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972256.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(30094..32448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(32600..33091) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384678.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 33342..37046 product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384677.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene putA CDS 37287..38198 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061567.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 38258..39424 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532240.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 39421..40359 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975668.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 40356..41108 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975669.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 41286..42554 product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526928.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene macA CDS 42562..44502 product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397097.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(44590..45555) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(45587..46615) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721763.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(46602..48131) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338818.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(48128..49366) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(49526..50230) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180942960.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(50350..51234) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971057.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 51310..52344 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256280.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(52352..56137) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970331.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene metH CDS complement(56232..56447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 57042..65573 product cyclic beta-(1,2)-glucan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400777.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene ndvB CDS 65570..66730 product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400774.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene opgC CDS complement(66753..68510) product glucan ABC transporter ATP-binding protein/ permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330307.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 68687..69505 product autoinducer binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390409.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 69620..73075 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400767.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene pyc CDS 73165..73719 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393929.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(74022..74777) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085948.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(75340..76215) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066817.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(76243..76785) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967909.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 76887..77855 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017265782.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(77914..78597) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035335.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(78632..79570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(79574..80551) product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268189.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(80629..81639) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(81730..82845) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816851.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(82965..83876) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104938.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(84076..84411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 84687..85424 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530159.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 85421..85726 product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530160.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 tRNA complement(86059..86148) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(86390..87784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(88004..88138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 88339..88812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067196.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(88836..89276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 89510..90091 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531304.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(90448..91683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(92419..93411) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 93602..94702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 95523..96371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 96485..97255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 97252..98091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(98128..102201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 102613..103296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(103711..106830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(106820..107635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(107800..109248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210308580.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(109248..111068) product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(111144..112325) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974302.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(112784..113296) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036258.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 113450..114163 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036257.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene bdcA CDS 114227..114892 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(115081..115683) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402250.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 115836..116234 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315324.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 116751..116936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 116851..117702 product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387981.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene bla CDS complement(118121..118564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 118816..120276 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359439.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 120295..121197 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205484.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 121194..121874 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090698.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 121914..122609 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919949.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 123132..124064 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(124171..125091) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529395.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 125306..126052 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141422.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(126300..127289) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530164.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 127407..128036 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530163.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 128461..129132 product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086135.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 129173..129493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 129754..129969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 130157..130537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(130553..130840) product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538229.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 130870..131088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 131303..131575 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036743091.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 sequence02 source 1..121284 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 380..1783 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530415.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 1815..2603 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 2675..3550 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327738.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 3698..3874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527344.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(3905..4843) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327735.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 5168..7816 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060564028.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene pepN CDS 8112..10391 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391264.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(10404..13361) product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391265.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(13418..14833) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391266.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(14847..15530) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974840.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(15789..17354) product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327729.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(17474..17932) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241025.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(17929..19914) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391272.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(19911..20360) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527358.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene ccmE CDS complement(20357..21487) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968988.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene ccmI CDS complement(21589..22023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974834.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(22124..23539) product two-component system sensor histidine kinase FeuQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974833.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene feuQ CDS complement(23529..24200) product two-component system response regulator FeuP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974832.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene feuP CDS complement(24351..24602) product two-component system FeuPQ modulator FeuN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974831.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene feuN CDS complement(24680..24892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(24940..28773) product glycoside hydrolase TIM-barrel-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971295.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(28777..29217) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971294.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(29210..30100) product DUF2163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971293.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(30097..30732) product TIGR02217 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971292.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(30801..31337) product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972646.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(31341..31559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(31556..31909) product gene transfer agent family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719629.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(31909..32316) product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920622.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(32345..32755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(32752..33090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(33087..33656) product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975492.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(33742..34989) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971286.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(35039..35596) product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971285.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(35651..35959) product DUF6107 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971284.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(36162..37298) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971283.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(37375..38013) product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972645.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(38041..39609) product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235776816.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(39533..40126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(40394..40876) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968986.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 41055..43226 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968985.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 tRNA 42878..42951 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 43257..43850 product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527372.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 43843..44391 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527373.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(44414..44614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 44972..45925 product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968983.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(45968..46345) product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971254.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(46499..47197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(47169..48752) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391278.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 49228..49662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 49811..50230 product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527382.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(50247..51056) product DUF6456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971251.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(51079..51555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(51859..52296) product exopolysaccharide biosynthesis transcriptional regulator MucR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707336.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene mucR CDS complement(52672..53031) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974815.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene mnhG CDS complement(53028..53390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(53387..53863) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974813.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(53866..55413) product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974812.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(55433..55813) product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316622.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(55810..56235) product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316621.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(56232..58586) product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974809.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 58509..58676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 58954..59361 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968974.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene msrB CDS complement(59485..60150) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974807.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(60246..60569) product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379501.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(60682..61092) product DUF930 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971236.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 61354..63447 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170147.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 63542..64717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 64799..66322 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968967.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 66412..68745 product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968966.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 69091..69594 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537587.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(69717..70625) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327684.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(70779..71222) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974792.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(71431..72033) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974789.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 72253..72657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(72676..73557) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241072.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 73723..74769 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327675.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 74901..75551 product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241077.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 75581..76354 product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312207.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene tam CDS complement(76416..76811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536701.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 77021..78583 product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968956.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 78589..79992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(80153..80902) product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992241.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(80862..81239) product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531903.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(81456..81878) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974779.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 81995..82489 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327666.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(82535..83311) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033043067.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(83464..85101) product cisplatin damage response ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971187.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(85184..86194) product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992240.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(86246..88540) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968951.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 88788..90155 product TIGR03808 family TAT-translocated repetitive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532675.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(90261..90512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(90512..91033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(91135..91521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975354.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 91798..92457 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391320.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(92679..93686) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391327.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 93775..94512 product DUF3750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391328.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 94645..96072 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298733.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(96073..97074) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844124.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(97279..99078) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974769.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(99199..99588) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253076.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene crcB CDS complement(99843..100394) product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532362.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 100556..101209 product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968943.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene betI CDS 101253..102782 product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968942.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene betC CDS 102784..104247 product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327650.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene betB CDS 104298..105950 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971180.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene betA CDS 106290..107039 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974761.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 107084..108037 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974760.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene cysD CDS 108037..109524 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241104.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene cysN CDS complement(109848..110810) product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651842.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(110922..112238) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338571.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(112235..113995) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338570.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 tRNA 114216..114292 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(114445..114759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(114743..116431) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066521.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene betA CDS complement(116505..117587) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327741.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(117639..118568) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227993.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 118669..119529 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969978.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(119568..120566) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327741.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(120743..121075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 sequence03 source 1..104935 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 813..1871 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 note possible pseudo, frameshifted CDS 1919..2872 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532333.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 3397..3645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 4050..5027 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509960.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 5045..6739 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969669.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 6727..7785 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971997.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(7683..10016) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973280.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 10304..12766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 12885..13124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 13121..13897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 14023..14994 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973872.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 15082..16566 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970274.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene xylB CDS complement(16653..17609) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973872.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(17783..18553) product L-iditol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103118.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 18751..19530 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066695.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(19593..20537) product inner-membrane translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529340.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(20674..22179) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523590.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(22504..22722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 22613..23548 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173320.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 23804..24139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327643.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 tRNA complement(24258..24332) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 24732..25028 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327634.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 25036..25971 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327633.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(25972..26883) product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968931.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 27128..27520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327631.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 27655..27963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(27947..30613) product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968929.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene ppdK CDS complement(30748..30906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529552.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(31036..34500) product chromosome segregation SMC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974749.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(34597..35331) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968926.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(35479..35991) product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974746.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 36094..37188 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435801.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene mutY CDS 37185..37802 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968923.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(38120..39250) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311935.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 39475..40164 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971150.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(40244..40810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968920.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 41018..42415 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153458433.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene thrC CDS 42435..43736 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327609.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(43684..43956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 43846..44478 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974736.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 44591..47503 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392589.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(47615..47806) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309833.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(47900..48505) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974734.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 48651..49451 product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526639.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 49616..50101 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241131.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(50127..51323) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974706.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 51522..52202 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968897.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 52196..52801 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968896.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 52830..53393 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392649.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 53496..54425 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968890.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 54428..54682 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535810.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 54776..55699 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309798.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 55763..56224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 56401..58320 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033044606.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene dxs CDS 58491..58766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 58815..59564 product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971109.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 59561..60811 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327568.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(60894..62969) product methyl-accepting chemotaxis protein McpU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234705078.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene mcpU CDS complement(63173..63943) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968885.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(63989..65761) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392664.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(65928..66458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 66649..67734 product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844102.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(67775..68872) product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392670.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(68874..70118) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392671.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 70603..71577 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968877.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 71589..73019 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392675.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(73036..75618) product DUF1217 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971042.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 75889..76455 product DUF6101 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(76526..77476) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327555.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene ubiA CDS 77602..77841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529265.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 77999..79270 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene purD CDS 79365..79808 product plant virulence effector HPE1-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251710.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(79998..82112) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974669.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene glyS CDS complement(82238..84178) product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392706.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(84193..84741) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313108.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(84853..85398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(85400..86359) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844095.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(86448..87524) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene rfbB CDS complement(87730..87921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533286.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(87947..88771) product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991722.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(88929..89720) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379198.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(89755..89976) product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313100.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 90084..91100 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327536.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 91189..93099 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974660.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 93108..94025 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968859.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 94012..94560 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241194.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene moaB CDS 94689..95846 product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968856.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 95988..96650 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974654.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(96793..97278) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533637.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(97289..97942) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(98034..98261) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533642.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(98329..99081) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533645.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(99138..99650) product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968854.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(99804..100994) product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968853.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(101171..103135) product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327523.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(103201..103974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 misc_feature complement(104028..>104935) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003533658.1:Mrp/NBP35 family ATP-binding protein locus_tag LOCUS_03210 sequence04 source 1..87007 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 105..1241 product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 1244..1465 product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 1610..1882 product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530375.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(1872..3128) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530374.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(3448..5010) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397349.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene guaA CDS complement(5065..5709) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067713.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(5706..6155) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968499.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(6291..7439) product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397356.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(7439..8566) product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970794.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(8566..10101) product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081157931.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(10149..11429) product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968505.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 11428..11607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(11626..12915) product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067725.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(12991..13353) product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397379.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(13714..14589) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241624.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(14586..15734) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026363808.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene queG CDS complement(15744..16436) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529784.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 16622..17428 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067731.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(17512..17661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710132.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(17898..18878) product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241620.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(18994..19281) product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378049.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(19307..20008) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241618.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene pyrF CDS complement(20010..20591) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968511.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(20604..21206) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067737.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(21466..22629) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330763.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene dnaN CDS 22823..23746 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330764.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene rsmI CDS 23739..24107 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529772.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 24199..24705 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310156.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 24807..25751 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310157.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene gshB CDS 25928..27499 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529769.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(27572..28540) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310159.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene cysK CDS complement(28645..29532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(29536..29994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 30087..31667 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310162.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(31681..32085) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 32223..33041 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067759.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(33063..34268) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330814.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene coaBC CDS complement(34343..35152) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975239.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(35209..36783) product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397492.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene ubiB CDS complement(36852..37628) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310167.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene ubiE CDS 37828..38721 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330821.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene mutM CDS 38718..39515 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330822.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 39697..39963 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974216.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene rpsT CDS 40894..42342 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397512.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene dnaA CDS 42464..42961 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969353.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(42981..44174) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399647.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene hemW CDS complement(44179..44823) product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399607.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene rdgB CDS complement(44841..45257) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909757.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(45270..45986) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310174.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene rph CDS 46133..47215 product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378101.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene hrcA CDS 47315..47932 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974227.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene grpE CDS complement(48014..48475) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310177.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene ptsN CDS complement(48552..49127) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327046.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene raiA CDS complement(49375..50931) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974230.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene rpoN CDS complement(51108..51920) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527721.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene lptB CDS complement(51934..52491) product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974232.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(52498..53157) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327050.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene lptC CDS 53372..54310 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974235.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene sppA CDS 54339..54638 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493505.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 54691..55035 product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974237.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(55043..55495) product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327054.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 55633..56676 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241560.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 56673..57527 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241559.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 57524..58015 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399621.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene lspA CDS complement(58020..58391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 58293..60323 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013843850.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 60426..61298 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241556.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(61362..63647) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327060.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 63778..66513 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399627.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene mutS CDS 66678..69521 product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527696.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 69518..71089 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968549.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene murJ CDS 71242..72309 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399633.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene trpS CDS 72367..72858 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310195.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 72950..73516 product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527690.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 73547..74194 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974252.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene tsaB CDS 74199..74693 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327070.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 74734..75162 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310199.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 75197..75991 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399640.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 76047..77450 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974255.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene miaB CDS 77465..78520 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974256.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 78537..79040 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327074.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene ybeY CDS 79052..80221 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399659.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 80318..81898 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968556.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene lnt CDS 82058..82477 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527670.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 82662..83906 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974260.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene metK CDS 84026..84739 product tRNA (guanosine(46)-N(7))-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015007103.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(84868..85125) product DUF1150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706639.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(85258..85689) product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974263.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 85874..86818 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 sequence05 source 1..83881 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 323..2284 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329503.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(2478..5084) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970072.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene clpB CDS complement(5352..6056) product DUF4167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(6361..7254) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394746.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene prmC CDS complement(7251..8336) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973615.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene prfA CDS complement(8359..10626) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533522.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene ptsP CDS complement(10701..11975) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066725.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(12100..12873) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530340.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 13008..13778 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970352.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(13782..14777) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098988.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 14877..15770 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398030.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 15958..16437 product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530346.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 16434..17990 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970350.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 18051..20930 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970349.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene fdhF CDS 20939..21781 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528554.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene fdhD CDS 21781..22047 product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330009.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(22073..23836) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970347.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(24223..24699) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709572.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(24846..26051) product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398015.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene rocD CDS complement(26070..27005) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528561.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene rocF CDS 27138..27578 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528562.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(27633..31805) product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972439.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(31910..33829) product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577638.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(34076..34390) product glycine zipper domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528572.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 34799..35287 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242602.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 35319..37670 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397997.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 37686..38483 product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970338.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 38717..39952 product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844889.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene hemA CDS complement(40018..41193) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435056.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene dxr CDS 41381..42097 product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067091.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 42123..42503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 42593..43780 product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862709.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 tRNA complement(43918..43994) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(44064..45224) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133034483.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 45350..46465 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388639.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 46477..47601 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970130.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(47725..47973) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066791.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(47970..49208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 note possible pseudo, frameshifted CDS complement(49394..50347) product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394627.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(50424..51371) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970125.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene xerD CDS complement(51368..51517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066787.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 51659..52255 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066786.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 52252..53379 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577439.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene aroB CDS 53376..54269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(54276..54557) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240039.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 54677..55294 product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844827.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 55363..56352 product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709224.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene cobS CDS 56373..58274 product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388602.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene cobT CDS 58264..59298 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973193.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(59333..59971) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973191.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(60088..60372) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527451.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene rpmB CDS 60631..61407 product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018011273.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 61447..62322 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970113.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(62334..63104) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240047.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene gloB CDS 63240..64025 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394662.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 64035..64991 product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844824.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(65077..66084) product DUF2125 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329553.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 66171..66728 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066768.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(66703..67518) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970106.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(67604..68314) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329550.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(68385..69404) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066765.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(69397..70056) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072597092.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene ftsE CDS 70251..70922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240056.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 71079..71624 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003497442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene hpt CDS 71705..72064 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973178.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(72099..74654) product TIGR02302 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970102.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(74761..76029) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394686.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene lysA CDS complement(76056..76241) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066758.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(76337..77740) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970100.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene argH CDS 77765..78436 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970099.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(78466..79488) product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973093.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(79485..80423) product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973094.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene cysW CDS complement(80428..81249) product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973095.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene cysT CDS complement(81321..82229) product thiosulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973096.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene cysP CDS 82131..82328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(82449..83321) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394722.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 sequence06 source 1..52065 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1261..1500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 1624..1875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 1872..2162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 2159..2362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(3070..5058) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170118038.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(5173..6408) product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972738.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene chrA CDS complement(6593..6766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(7275..8069) product IS21-like element IS1326 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene istB CDS complement(8389..8583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(8607..10436) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene ftsH CDS complement(10559..10918) product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525020.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(10949..11263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(11273..11977) product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208851926.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(12076..12588) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242238.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(12685..13161) product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192281448.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 13381..13596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525027.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 13708..14016 product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530775.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(14010..14288) product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501657.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(14308..14652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525025.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 15073..15387 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530718.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene groES CDS 15444..17069 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530719.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene groL CDS 17141..17365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530720.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 17500..17979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(18008..18511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(18515..19333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(19330..21357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(21384..22367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532795.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 22717..23067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 23064..24875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 note possible pseudo, frameshifted CDS 24872..25519 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 25678..25932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(26037..26651) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383149.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(26653..27447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(27425..28336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 28892..29254 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 29247..29786 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085870.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 29795..30220 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969944.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene arsC CDS 30230..31285 product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164747183.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene arsB CDS 31285..31977 product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969023.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene arsH CDS complement(32127..32294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(32362..32754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967064.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(32829..34463) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530534.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene groL CDS complement(34515..34832) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530533.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 35311..35601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085033.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 35715..35900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 35893..36036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 36064..36315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 36312..36584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173518352.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 36637..36912 product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970187.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 36925..37737 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529017.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 38322..40301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(40497..40778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 43166..44482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 44400..45293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(45596..47146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 note possible pseudo, frameshifted CDS complement(47155..47709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 note possible pseudo, frameshifted CDS complement(47709..48632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 48959..49486 product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021204.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 49681..49896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 49988..50464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(50482..50967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 51232..51501 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036743091.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 sequence07 source 1..45915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(28..471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(786..1712) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393019.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 1874..3592 product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393021.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 3589..6102 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393063.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 6075..6452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 6681..9101 product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046033636.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(9339..9923) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339055.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(9971..10273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 10756..11301 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 11303..11725 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268368.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 11743..12600 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532447.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 12597..13700 product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437089.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(13822..14712) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618835.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(14762..15736) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225404.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(15852..16724) product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267511.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(16752..17879) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267094.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 18007..18894 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527624.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 19031..19330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(19311..20900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(21343..22881) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199730.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 22978..24330 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523978.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 24380..25654 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225996796.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(25848..26174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 note possible pseudo, frameshifted CDS 26255..26602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 26706..26888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 27139..27843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(27840..28025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(28539..29591) product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331256.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(29646..30437) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972743.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(30482..31300) product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880039.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 31510..31899 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143490.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 31971..32759 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene fabG CDS 32812..33657 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540892.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 33686..35194 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 35191..36636 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041937144.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(36655..37245) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868049.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 37604..38104 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 38221..39012 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228477.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 39009..39653 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003061805.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 39650..40306 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351086.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 40362..41168 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522303.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 41250..41741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(41811..42971) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104055.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(42997..44439) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225096.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(44459..45472) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898921.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 sequence08 source 1..43923 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 442..1071 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 1246..1443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 1588..3102 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399583.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene hisS CDS 3133..4266 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974609.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 4263..4955 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399577.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene hisG CDS 5078..5785 product glutathione binding-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399574.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 5871..7088 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968822.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(7184..7630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(8201..9841) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313163.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene groL CDS complement(9917..10213) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970827.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene groES CDS 10517..11365 product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399549.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 11384..12364 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252102.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 12651..15566 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399600.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene ileS CDS 15748..16359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974617.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 16367..16849 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241230.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(16856..17317) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971070.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 17379..19184 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563875.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 19191..19751 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968831.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene rsmD CDS 19838..20698 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974622.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(20702..22495) product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312313.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 22599..23945 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399518.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 23932..24762 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971076.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 24823..25059 product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313175.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 25221..26534 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399514.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene waaA CDS 26560..27279 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968837.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 27383..28423 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968838.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene lpxK CDS complement(28464..28697) product DUF2093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974631.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(28788..30629) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399508.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene mutL CDS 30871..32556 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327510.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 32706..34064 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313185.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 34242..34562 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972652.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(34587..35513) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844087.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 35684..37153 product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395758.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(37250..37942) product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968846.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(38073..38957) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(38954..39592) product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968849.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(39636..40550) product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968850.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 40736..41527 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 41851..42636 product autoinducer binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327519.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 42650..43465 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312317.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 sequence09 source 1..37414 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..912 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_184144746.1:electron transfer flavoprotein-ubiquinone oxidoreductase locus_tag LOCUS_06330 CDS complement(992..2371) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971322.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene mgtE CDS 2682..3311 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311709.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 3686..4684 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393023.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 4791..5678 product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241012.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(5734..6978) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050813472.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 7331..8269 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327745.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(8303..9661) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037491.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 9812..11185 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992255.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(11196..12698) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527321.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(12755..13075) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254519.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(13198..13374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441068.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(13407..13562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 13725..14426 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391247.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 14796..15071 product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440874.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(15104..16222) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971332.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(16510..17733) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 17958..18986 product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968031.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(19050..19844) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968519.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene iolB CDS complement(19887..20804) product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528373.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene iolE CDS complement(20962..22812) product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968521.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene iolD CDS complement(22876..24828) product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528371.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene iolC CDS complement(24925..25791) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968522.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 25946..27067 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973913.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(27279..29258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 tRNA 27549..27638 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(29255..29644) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051076796.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(29665..29979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(30228..30752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(33037..33279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 33742..33933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(33930..34154) product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(34157..35293) product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(35290..36291) product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368416.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene trbG CDS complement(36288..36977) product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene trbF sequence10 source 1..32074 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..582 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968812.1:L,D-transpeptidase locus_tag LOCUS_06670 CDS 728..1426 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399598.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(1455..2753) product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971053.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene glcF CDS complement(2868..4070) product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577785.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene glcE CDS complement(4067..5572) product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401220.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 5605..6501 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241247.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(6508..7785) product DUF3422 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974597.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 7943..8737 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327471.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 8849..9331 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909719.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 9424..10929 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527228.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 10937..11674 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241252.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 11858..13231 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974592.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 13334..14173 product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968801.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 14328..14741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 14797..15747 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327465.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(15956..17440) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968798.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene katA CDS 17701..18600 product hydrogen peroxide-inducible genes activator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527206.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene oxyR CDS complement(18622..19497) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527204.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(19591..20010) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527202.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(20146..21642) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241867.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene guaB CDS 21920..23326 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527196.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(23357..24091) product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968793.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(24088..25128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 note possible pseudo, internal stop codon, frameshifted tRNA 25148..25243 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 25984..26057 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(26221..26766) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028006006.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 27045..27347 product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531275.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 28580..31453 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918711.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 sequence11 source 1..1381115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1068..1349) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036743091.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(1493..1987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 note possible pseudo, frameshifted CDS complement(2382..2642) product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084140443.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(2736..3002) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387924.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(3248..3442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(3863..4264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 4735..5076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 5319..6074 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532582.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 6190..6540 product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967147.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 7031..7480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 7707..8039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(8085..8501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(8663..9592) product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082895.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(9921..10982) product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082896.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(10983..15422) product strawberry notch family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368629.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(15497..15895) product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017277562.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(15898..16161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(16229..16783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368626.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(16938..19109) product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368623.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(19240..20013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(20013..20966) product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368621.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 21278..21601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 21616..21873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(21766..22038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 22048..22251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 22332..22922 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970140.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 22932..23600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 23629..24012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(24032..24883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(24942..26204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 26091..26513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 26514..26717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 26778..26912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 27024..27311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(27384..30653) product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967470.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(30650..32173) product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257431.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(32088..32840) product ImuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967468.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(32934..33197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(33371..34534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(34558..35703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132517.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(35764..36537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(36530..37876) product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014498593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(37876..39117) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090895.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(39292..40011) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971736.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene radC CDS complement(40019..40846) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537051.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene map CDS complement(40877..41596) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene sfsA CDS complement(41615..43474) product poly(3-hydroxyalkanoate) polymerase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393363.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene phaC CDS 43661..43987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 44162..45379 product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707954.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 45433..46761 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975608.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 46859..48667 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393359.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene recJ tRNA complement(48736..48810) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(48942..49016) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(49159..49233) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(49372..50652) product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969420.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(50974..51414) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530919.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 51645..52190 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328282.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 52190..52687 product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393355.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 tRNA 52767..52843 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(52993..54216) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328326.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(54216..54707) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene moaC CDS complement(54704..55513) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969378.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene trpC CDS complement(55523..56545) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533254.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene trpD CDS complement(56562..58451) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037384373.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 58750..60399 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328331.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 60498..61880 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328332.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene glmU CDS 62016..63842 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969375.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene glmS CDS 63839..64333 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971864.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 64380..65069 product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392752.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(65094..65312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(65400..67439) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392753.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene recG CDS 67356..67595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 67613..67930 product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975556.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 67927..71439 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969372.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene mfd CDS complement(71479..72150) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240310.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(72259..74070) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577290.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 74335..74961 product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528049.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(75097..76098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400430.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 76222..76806 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534715.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 76799..77416 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975234.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(77420..78058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 78189..79316 product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969219.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(79329..79757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400454.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(79803..81857) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400485.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene parE CDS 82121..82972 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129793.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 83078..83848 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400467.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene tpiA CDS 83947..84384 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975245.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene secG CDS 84521..86158 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975246.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(86297..87706) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528053.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene glnA CDS complement(87766..88104) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975544.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 88466..89962 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969363.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(89972..90775) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969299.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(90799..93717) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529545.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene uvrA CDS 93986..94486 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240374.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(94707..95369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 95646..96482 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 96529..97602 product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209066719.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 97583..98353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183806723.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 tRNA complement(98462..98537) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 98702..99508 product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401893.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(99621..100823) product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844473.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 101074..101808 product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975576.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene pcs CDS 101935..102906 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401901.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 102957..104531 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401904.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 104521..105615 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328321.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 105615..106535 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328322.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 106580..107650 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975571.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 107809..108546 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975570.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(108620..109141) product DUF992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 tRNA 109322..109411 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 109684..109926 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003496145.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene hfq CDS 110002..111333 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244647.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene hflX CDS complement(111372..112208) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383231.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene mazG CDS complement(112223..112810) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969240.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 113091..114530 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971633.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene cysG CDS 114532..114849 product DUF2849 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328167.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 114862..116532 product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315345.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 116544..117056 product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975276.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 117204..118016 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393477.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(118028..118648) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244654.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(118783..119412) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969300.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 119652..122435 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene gyrA CDS complement(122547..122693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 123076..123570 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383413.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene coaD CDS 123606..124175 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969321.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 124218..124733 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529604.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 124811..125260 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531824.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 125268..126335 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975428.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene queA CDS 126332..127462 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328449.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene tgt CDS complement(127584..127829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(128104..128520) product DUF4864 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909625.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(128664..128909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 129340..129582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 129801..130781 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032931383.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(130807..131643) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975448.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(131648..132427) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528321.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(132434..133984) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396456.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene metG CDS complement(134080..135111) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975451.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(135108..135797) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969339.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene tmk CDS complement(135926..137083) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969340.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(137193..138155) product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969341.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(138437..138652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(138798..139382) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970153.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(139494..140870) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535437.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene trkA CDS complement(141075..142439) product two-component system response regulator NtrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328161.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene ntrX CDS complement(142429..144729) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244644.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(144827..146281) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975265.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene ntrC CDS complement(146278..147429) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393483.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(147426..148424) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383211.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene dusB CDS 148597..149808 product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975262.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 149805..150302 product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971625.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(150291..150749) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315362.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(150927..151904) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971620.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene lipA CDS complement(152019..153464) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312480.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene lpdA CDS complement(153522..154163) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328148.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(154179..155528) product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874322.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(155543..156922) product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312484.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(156941..157993) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535472.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene pdhA CDS complement(158142..158450) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400478.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(158589..159863) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975249.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene eno CDS complement(160000..160839) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034854711.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene kdsA CDS complement(160841..161731) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328141.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(162143..163753) product M10 family metallopeptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392401.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 164010..164177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 164305..164637 product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528052.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene hspQ CDS complement(164711..166687) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975231.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene thrS CDS complement(166835..167215) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314346.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene yidD CDS complement(167231..167677) product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328120.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 168009..168620 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026613810.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene folE CDS 168656..169102 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400419.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene hisI CDS 169469..170428 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328117.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(170511..170939) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534694.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(171104..171856) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328114.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 172219..172758 product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577809.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 172893..173504 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534682.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 173953..174555 product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969216.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 174805..175557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401782.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 175697..177124 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975217.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 177295..177567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969213.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(177580..178017) product DUF1489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536712.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(178199..179599) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328106.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 180218..180907 product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844304.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 180989..182008 product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244595.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 182013..182486 product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969210.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(182517..182903) product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975211.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(182966..184396) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969209.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene mgtE CDS 184832..185545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 tRNA complement(185662..185738) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(185750..186055) product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393354.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 186373..187086 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528303.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene lexA CDS complement(187080..189557) product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129945.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 189988..191277 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328205.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene gltA CDS complement(191311..192483) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393442.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene lpxB CDS complement(192529..193431) product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969262.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(193436..194248) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162142244.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene lpxA CDS complement(194245..194718) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969260.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene fabZ CDS complement(194711..195778) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969259.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene lpxD CDS complement(195828..198104) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969258.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene bamA CDS complement(198405..199538) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312540.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene rseP CDS complement(199563..200378) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328198.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(200396..201142) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969256.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(201181..201741) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975304.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene frr CDS complement(201796..202518) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534989.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene pyrH CDS complement(202705..203628) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534991.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene tsf CDS complement(203876..204640) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534993.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene rpsB CDS complement(204814..205632) product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975294.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 205798..206262 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969255.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 206262..206984 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328190.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 206998..208182 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969253.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 208196..208621 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971569.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(208631..208972) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975289.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(208969..209724) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393451.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(209797..212307) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969251.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene clpA CDS complement(212318..212647) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975286.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene clpS CDS complement(212938..213354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(213474..213677) product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535016.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(213773..214606) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975284.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene cysE CDS complement(214723..215514) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975283.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 215606..215926 product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535025.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 215950..217116 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969248.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(217120..218310) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312602.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 218648..219676 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535031.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 219775..220983 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874276.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 221000..222142 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969245.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 222161..222937 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874280.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 223121..223540 product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975918.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(223658..223849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530427.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 224109..224471 product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502741.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 224589..224828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 224832..225317 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968781.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 tRNA complement(225395..225479) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 225676..226395 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536740.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene lipB CDS complement(226414..227370) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992293.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 227530..227934 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536742.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 228016..229143 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969205.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 229253..229708 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315321.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 229708..230364 product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537409.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 230384..231217 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328087.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene fghA CDS 231383..231697 product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene sugE CDS complement(231761..232546) product ATP12 family chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975194.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(232539..233204) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975195.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(233204..234199) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537406.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(234281..234607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 234730..235017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 235423..236562 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650750.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene gcvT CDS 236646..237008 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971640.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene gcvH CDS 237008..239878 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253203.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene gcvP CDS complement(239992..240384) product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975618.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene sufA CDS complement(240517..240897) product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969429.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(240909..242156) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393009.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(242178..243452) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531484.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene sufD tRNA complement(243107..243183) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(243475..244230) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240388.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene sufC CDS complement(244308..245777) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975623.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene sufB CDS complement(245915..247084) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253209.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 247300..247977 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531477.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(248041..249213) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975626.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(249297..250430) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975627.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 250565..251818 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240393.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene tyrS CDS complement(251863..255252) product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392970.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 255402..255869 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971896.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene bcp CDS 255892..256719 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650909.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 256807..258105 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971898.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 258272..259759 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969437.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(259839..260174) product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969438.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(260178..261794) product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969439.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(261791..262489) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532111.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(262489..262821) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(262832..264091) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531444.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(264095..265021) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392946.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(265050..265547) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975641.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 265714..266787 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969442.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 266784..267797 product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526837.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 267867..268544 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975644.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene rpe CDS 268541..269275 product DUF2259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392934.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 269405..270712 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383544.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene purB CDS complement(270758..271564) product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975649.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 271729..272286 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971907.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 272370..274955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(275037..275357) product ATPase inhibitor subunit zeta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531408.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 275583..276347 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975652.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 276374..276616 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531405.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene purS CDS 276730..277401 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975654.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene purQ CDS 277467..277853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314093.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 277867..278217 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852799.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene arsC CDS 278320..280539 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969461.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene purL CDS 280680..280913 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 281315..281650 product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708163.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene grxD CDS 281776..282981 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971915.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(283048..283869) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396522.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(283856..284728) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240432.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene ttcA CDS complement(284782..285711) product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969466.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(285799..286416) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533017.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene rpsD CDS complement(286642..288153) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240434.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(288266..289057) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969468.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene murI CDS complement(289044..289877) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240436.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(289952..290536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992313.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 290756..291970 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975672.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 292085..292714 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314066.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 292847..294517 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969476.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(294655..297429) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969477.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene alaS CDS complement(297629..298678) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969478.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene recA CDS 298959..299906 product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396535.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 299940..300866 product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969480.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(300993..303542) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396673.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 303809..304714 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328556.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 304787..305320 product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975734.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene mobB CDS complement(305369..307954) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396539.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 308278..309282 product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396540.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(309436..309855) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708186.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene dksA CDS 310180..310704 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396541.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 310786..312261 product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975679.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 312258..313322 product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396545.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 313472..314017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396548.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(314054..314569) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969486.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene folK CDS complement(314559..314927) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708193.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene folB CDS complement(314947..315819) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396569.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene folP CDS 315948..316559 product DUF922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396555.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(316932..317612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(317638..317958) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532979.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(318162..318530) product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312581.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 319043..324790 product kinesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975688.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 325007..325993 product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975992.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(326109..326687) product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969501.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(326865..328235) product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534122.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(328244..329080) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(329091..330242) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240468.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(330370..331200) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534112.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 331416..333731 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534110.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 333842..334945 product DUF2865 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992300.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(334973..335803) product TolB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396629.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(335807..337486) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975715.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 337725..339665 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086018623.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 339838..340260 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969515.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 340263..341999 product TadG family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969516.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(342083..342478) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240481.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(342600..343973) product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975719.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(344090..345478) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene gor CDS 345726..346061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330487.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(346093..346983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(347065..347598) product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975721.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(347616..348314) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975722.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene rpiA CDS 348515..349198 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975723.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(349290..351167) product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396644.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 351673..353064 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535082.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene fumC CDS 353214..354281 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396658.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(354297..354671) product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328553.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 354819..355865 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969526.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene moaA CDS complement(356007..357983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(358150..359472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 359590..360132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 360433..361209 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535100.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 361371..362174 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975738.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 362264..363001 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969531.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 363163..363429 product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975740.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(363446..364174) product DUF2270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240630.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 364323..365138 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400622.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 365227..366099 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000663.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(366178..366663) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507846.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(366730..367371) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992314.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(367385..367954) product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063167987.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 368124..369659 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400593.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(369668..370057) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312153.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(370129..371145) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328572.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene cobT CDS 371291..372076 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969539.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 372115..372336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 372333..373034 product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969540.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(373047..373808) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975755.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(373805..374731) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975756.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(374825..375646) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971950.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(376019..377116) product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535329.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 377351..377755 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975762.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(377768..378118) product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535339.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 378289..381186 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535341.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene uvrB CDS complement(381448..381660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311877.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(382028..382237) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003508146.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(382610..383224) product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969551.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(383363..384457) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395492.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene dusA CDS 384557..385087 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240524.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(385095..385490) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975836.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(385487..386317) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975837.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene znuB CDS complement(386310..387245) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844580.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 387347..388450 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240528.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(388526..389557) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395477.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene mgrA CDS complement(389781..391211) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969572.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene gndA CDS complement(391411..391566) product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180937871.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene ccoS CDS complement(391563..393854) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971692.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(393851..394351) product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(394351..395922) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967640.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene ccoG CDS 396122..396541 product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969575.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 396683..397420 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528483.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(397502..398365) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316282.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene ccoP CDS complement(398368..398520) product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967402.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(398531..399262) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970734.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene ccoO CDS complement(399274..400896) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967644.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene ccoN CDS 400801..401007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 401089..401568 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563285.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(401593..402534) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395424.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(402545..403573) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969578.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(403587..404873) product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975877.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(404884..406086) product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969579.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(406089..406571) product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316342.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(406694..406978) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495848.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 407410..408138 product transcriptional regulator FnrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971734.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene fnrN CDS complement(408148..408576) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531220.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(408680..409660) product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395421.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene cbiB CDS complement(409663..410688) product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969583.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene cobD CDS complement(410688..411998) product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328702.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(411995..412834) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395418.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene cobA CDS complement(412834..413322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 413556..414377 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975886.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(414397..415038) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530731.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene cobO CDS complement(415068..418817) product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969595.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene cobN CDS complement(418927..419976) product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969596.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene cobW CDS complement(419981..420505) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530724.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene cobU CDS complement(420505..421284) product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396855.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(421296..421472) product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708714.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(421556..421807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(421974..423512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(423661..425121) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240566.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 425366..425509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975904.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 426026..427054 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395398.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 427185..428228 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975906.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 428355..429374 product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240571.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene bmt CDS complement(429402..430535) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(430532..431170) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 431300..431647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240572.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(431632..432519) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529404.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 432621..432947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(432904..434856) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395394.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(434862..435398) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240574.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(435474..436226) product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969609.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(436280..436972) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969610.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(437080..438651) product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328727.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 438992..439690 product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386375.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(439745..439903) product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530686.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 439921..440562 product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395377.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 440826..441128 product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969616.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 441121..441696 product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530675.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 441700..442794 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530674.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 442977..443933 product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066873494.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 444115..446193 product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153435973.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(446313..447230) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969621.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 447346..447591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 447654..447848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 448161..449171 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311620.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(449205..450032) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258644.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(450138..450392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844605.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(450526..452994) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240604.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(453101..453658) product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328761.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 tRNA complement(454142..454217) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(454331..455248) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530005.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(455338..456444) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397197.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(456562..457800) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972000.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(458381..459400) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972004.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene ilvC CDS complement(459462..460109) product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 460505..460888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 461135..461344 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970295.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(461424..461888) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018011899.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 462059..462772 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328869.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(462795..464042) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531061.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(464063..464470) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252508.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 464615..465502 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328871.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(465551..466303) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243095.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 466533..467609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969692.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(467625..468815) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400932.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 468959..469981 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969701.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(470016..470609) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533855.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 470733..471578 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976137.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(471746..472318) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507555.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene ilvN CDS complement(472338..474116) product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386810.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 474459..476492 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969709.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(476526..477437) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534915.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene miaA CDS 477439..478332 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972017.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene serB CDS complement(478455..479987) product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534918.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(480120..480305) product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976146.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(480314..481237) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534924.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(481238..482368) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534926.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene hflK CDS complement(482502..483056) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976149.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(483078..483872) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972021.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(484021..484332) product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311776.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(484860..485063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 484950..485468 product SspB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400983.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 485478..485675 product DUF4169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242963.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 485773..485997 product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328916.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(485990..489778) product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976160.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(489915..491333) product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400989.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(491426..494584) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969721.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(494584..495753) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242957.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 496042..498528 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976167.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(498538..499737) product DUF2778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972032.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(499991..501484) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115242.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 501602..501781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 501796..503013 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(503072..504496) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188164.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 504725..505639 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565322.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 505636..506469 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720158.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 506470..507579 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337929.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(507659..508741) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719295.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(508772..509461) product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564165.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 509816..511435 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 511422..512999 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966434.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 512996..514219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 514225..514491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(514501..515154) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255068.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(515159..518293) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398234.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(518305..519567) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255119.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(519758..520759) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844988.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(520771..521835) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533467.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(521832..522674) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(522691..523641) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330567.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(523863..525122) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067607.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(525166..526059) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533457.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 526254..527159 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400508.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 527156..527920 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533454.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 527958..528980 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183532.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 528977..530137 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400512.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene nagA CDS 530255..531310 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394527.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 531374..531880 product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969727.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(532106..532459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(532631..533095) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708610.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 533273..533431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 533577..534176 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976183.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 534282..535160 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972037.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 535664..537499 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969733.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(537489..537803) product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969734.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(537806..538540) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396901.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(538667..539491) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708620.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene panB CDS complement(539493..540368) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242940.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene panC CDS 540661..542610 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528794.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 542727..543590 product TIGR02587 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973592.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 543598..544008 product TIGR02588 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973591.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 544111..545025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(545028..547184) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242938.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene ligA CDS complement(547257..548927) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242937.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene recN CDS complement(548947..549771) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529108.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(549963..550919) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386944.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene lpxC CDS complement(551248..552948) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037431030.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene ftsZ CDS complement(553043..554374) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242933.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene ftsA CDS complement(554371..555219) product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976206.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene ftsQ CDS complement(555282..556208) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242931.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(556601..557287) product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313332.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene aqpZ CDS complement(557457..558431) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969746.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene murB CDS complement(558428..559843) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529126.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene murC CDS complement(559840..560961) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252472.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene murG CDS complement(561008..562159) product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529129.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene ftsW CDS complement(562224..563624) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969748.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene murD CDS complement(563632..564732) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328954.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene mraY CDS complement(564857..566290) product UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diaminopimelate--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969749.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(566287..567738) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969750.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(567805..569553) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396975.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(569553..569942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529141.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(569946..570971) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529142.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene rsmH CDS complement(570986..571426) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708642.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene mraZ CDS complement(572266..573444) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328959.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(573517..574200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(574489..575253) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976234.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(575250..575990) product DnaJ family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328962.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 576226..577440 product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969756.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 577552..578181 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252464.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 578299..579180 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396982.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(579274..579861) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992379.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 579945..580346 product ketosteroid isomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(580331..581722) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969758.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(581791..583347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 583611..584387 product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529163.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 584484..585692 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969761.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 585770..586726 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529170.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(587139..588041) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992324.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene metF CDS complement(588043..589065) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328973.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(589394..591043) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242905.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene ettA CDS 591246..592205 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396993.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 592202..593143 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976250.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(593077..593325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 593294..594490 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972076.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 594487..596136 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969768.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(596210..596548) product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976253.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(596635..597489) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 597752..599182 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397006.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(599307..600830) product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918316.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(601114..602259) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969773.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(602265..603644) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969774.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(603708..605078) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(605191..606258) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(606386..607714) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(607711..608223) product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(608343..609113) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969776.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 609306..610184 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529191.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 610284..611387 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976264.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 611464..612339 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529194.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 612336..613124 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976266.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 613138..614199 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972096.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 614537..615004 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844648.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(615296..615736) product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976279.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(615765..616532) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393133.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(616529..617284) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393168.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(617519..618232) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976165.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(618420..619427) product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534666.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(619559..620569) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969802.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 620648..621562 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397047.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 621610..623103 product carnitine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976304.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 623226..624386 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242878.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 624389..626455 product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969805.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 626452..627243 product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387085.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 627512..629101 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536654.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 629101..630216 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242874.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 630213..631040 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976310.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 631033..632664 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242873.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(632669..633103) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969811.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(633100..634053) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976315.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 634216..634389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 634492..635007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969820.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(635139..636683) product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396876.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(636722..637951) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528000.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(638055..640505) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969823.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 640635..641489 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329023.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 641546..641803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(641864..642625) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392253.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(642721..644043) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973503.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(644073..644729) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313721.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(644848..646476) product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970803.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(646588..647484) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529342.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(647576..648514) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529341.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(648583..649566) product inner-membrane translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529340.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(649613..651154) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529339.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(651151..652548) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(652551..653330) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529337.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 653535..654653 product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969789.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 654650..655936 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976284.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 655933..656778 product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969787.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(656806..658470) product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167355198.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(658484..660007) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533079.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(660080..660934) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533078.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(661053..662000) product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(662123..663163) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533073.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(663176..664717) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533074.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(664714..665352) product DUF2291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533075.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 666112..667662 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533071.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 667712..669223 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533070.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 669231..670166 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533069.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 670234..671178 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536397.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 671363..671578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 671831..673201 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338075.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 673357..673548 product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263379.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 673615..673854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 673851..676211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 676596..677006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 677003..677206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 677203..678717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 678872..679339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 679336..679725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 679728..680177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 680186..680404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 680401..680592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 680826..681056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(681025..681300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 tRNA complement(681441..681516) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 681671..682420 product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976345.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(682559..682945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026617897.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(683052..683408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(683477..683899) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396765.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(683903..684031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(684139..684714) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537532.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 684995..686104 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314633.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(686193..687836) product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976330.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 687941..688333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(688401..690452) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976352.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene rpoD CDS complement(690857..691204) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189643.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 691390..692160 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314989.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(692171..694018) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969854.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene recQ CDS complement(694117..696084) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242755.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene dnaG CDS complement(696181..696630) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242754.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 696969..698177 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396757.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene carA CDS complement(698287..699675) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969319.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(700047..700283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 700165..700968 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083056.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(700982..701920) product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969317.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 702150..702809 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254574.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 702887..703915 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975419.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 704145..707627 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972119.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene carB CDS 707787..708263 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529568.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene greA CDS 708317..709417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 709653..710651 product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867763.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene pseB CDS 710651..711814 product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene pseC CDS 711811..712515 product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene pseF CDS 712520..713620 product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867753.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene pseG CDS 713617..714132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 714137..715195 product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867750.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene pseI CDS complement(715227..715694) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310592.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 715950..716924 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240370.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene trxB CDS 717026..717934 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529555.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 718408..718743 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969306.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 718778..719899 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969305.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 720093..721193 product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311098.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(721262..722464) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969860.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 722781..723668 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 723839..724039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 724107..725282 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396744.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 725487..726386 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976366.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 726799..727014 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003494703.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 727148..727591 product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532907.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(727624..728271) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396738.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(728450..728614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 728854..729117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976371.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(729294..730181) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530016.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 730423..730929 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316379.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 730926..731696 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532900.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 731719..733101 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329094.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(733105..733446) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242740.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 tRNA complement(733565..733657) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(734352..734852) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532890.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(735240..735497) product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972666.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 735710..736555 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969868.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene lgt CDS 736569..737669 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844743.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 737754..738545 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969870.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene pgeF CDS 738572..739723 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976382.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 739845..740570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972146.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 740700..741632 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532875.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 741806..742291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 742442..743626 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028054209.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 743834..744448 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532863.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 744660..747056 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400820.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 747072..747824 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243752.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 747896..748612 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037437113.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene pth CDS 748716..749819 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329132.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene ychF CDS complement(749952..750494) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400797.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(750609..751487) product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975689.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(751515..752774) product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240454.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(752789..753367) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534144.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene petA CDS complement(753617..755485) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972168.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(755575..757425) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975693.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 757802..758266 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969494.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(758280..759659) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530058.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(759682..759939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975698.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 760099..761010 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396602.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene hemF CDS 761109..761357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 761524..761715 product DUF1059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708848.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(761895..763154) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976399.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(763151..763786) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329137.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(763783..764394) product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534495.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 764582..765595 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400794.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 765610..766530 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969883.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 766527..769328 product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969884.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 769294..771402 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969885.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 771611..772153 product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254559.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(772178..772684) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028001159.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 772984..773973 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969887.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(773980..774480) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969890.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 774590..775492 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329147.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 775626..775976 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969891.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 775978..776817 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396124.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(776898..778604) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969894.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene leuA CDS complement(779102..779680) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066512.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(779827..780747) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066517.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(780911..783094) product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396108.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(783359..785578) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066519.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 785781..786608 product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190311202.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(786616..788295) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396100.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(788515..789648) product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242696.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(789641..790942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969905.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(791031..792938) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066525.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(792943..794091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066526.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(794150..795238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969909.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(795416..795805) product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242689.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 796105..797055 product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066528.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 797146..798021 product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene choW CDS 798018..799061 product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329172.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene choV CDS 799187..799957 product HugZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066531.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 800137..800475 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844758.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 800658..802361 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992329.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene ade CDS complement(802378..804021) product alpha-glucosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396066.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 804198..805112 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066544.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(805127..806557) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396062.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene der CDS complement(806593..807267) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061446.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(807356..808093) product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972211.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 808077..809117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975956.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(809125..810390) product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242673.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene sbmA CDS complement(810700..811452) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061441.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene map CDS complement(811555..813048) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975967.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene glpK CDS 813313..814086 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396047.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 814225..814707 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967080.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene greA CDS complement(814727..815341) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197184.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 815634..816941 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975974.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene guaD CDS complement(816970..817479) product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061424.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(817561..818067) product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972234.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene uraD CDS complement(818064..819062) product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976001.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene puuE CDS 819196..819513 product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214685.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(819518..820624) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976003.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 820764..821423 product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972237.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene mnmD CDS complement(821427..824609) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972238.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(824728..825180) product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240113.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 825580..827019 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976005.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(827083..827979) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329207.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(828126..829871) product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037429073.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene araD CDS complement(829925..831358) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329213.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(831410..832405) product GguC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976015.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene gguC CDS complement(832511..833719) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329215.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene gguB CDS complement(833719..835254) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061407.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene gguA CDS complement(835370..836440) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535531.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene chvE CDS 836677..837687 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387533.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 837703..838188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061404.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(838219..838446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329220.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(838509..839303) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393072.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(839326..840552) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456630.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(840561..840878) product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061915.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(840917..842008) product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061916.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 842173..843204 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244167.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 843361..844173 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392194.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 844421..845350 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530542.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 845442..846980 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392224.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 847006..848037 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530546.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 848138..849130 product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387540.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene iolG CDS complement(849342..850385) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033050513.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(850393..851178) product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243776.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(851326..851667) product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536339.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(851729..852289) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329246.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 tRNA 852873..852945 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(852928..853203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(853200..853805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(853960..854835) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066558.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(854914..855345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394543.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 855567..856613 product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324128.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 856640..857584 product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329256.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 857571..858692 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240161.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 858704..859504 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969935.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 859647..860045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 860178..860615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(860637..862151) product HWE histidine kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969936.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(862219..862773) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329263.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(862781..862942) product anti-sigma factor RsiA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525565.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene rsiA1 CDS 863128..863916 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394504.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(864215..865798) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969937.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(865822..866490) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394499.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(866527..868011) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394496.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(868202..868975) product L-iditol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525570.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(868972..869973) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240171.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(870014..870838) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528415.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(870854..871726) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972813.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(871930..873240) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973859.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(873394..874347) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329274.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 874599..875960 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563248.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 875974..877287 product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240176.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene preA CDS complement(877342..877980) product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330704.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 878074..879003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(879004..879678) product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066588.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 879950..881200 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969946.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 881265..882719 product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969947.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene hydA CDS 882716..883093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 883254..884066 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066592.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 884066..884401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528672.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 884404..885288 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066594.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 885285..886157 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969952.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 886186..887178 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394438.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 887497..888690 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066597.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 888809..892120 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969955.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 892290..892973 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315015.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(893015..893911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(893995..894621) product Urease operon accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132073684.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(894726..895829) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394374.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(895959..896303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525632.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(896324..897049) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525634.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(897049..897927) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(897927..899318) product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394369.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene livM CDS complement(899323..900225) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525638.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 900865..902262 product Vi polysaccharide ABC transporter inner membrane protein VexD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431675.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene vexD CDS 902285..903079 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243611.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 903076..903753 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867744.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(903770..905791) product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537791.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(905853..907067) product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968675.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(907661..909982) product methyl-accepting chemotaxis protein McpU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968886.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene mcpU CDS 910366..911319 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 911407..911988 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329321.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 912180..913202 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528882.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(913180..914736) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969972.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(914883..915095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327249.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(915578..915778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 915744..917174 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972396.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(917228..917902) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402117.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 918032..918871 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528568.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(918973..919134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531192.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(919254..919880) product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386733.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 920056..920484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 920481..921482 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090258.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 921479..922987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 922996..923745 product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090259.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(923982..926429) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095521294.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 926680..927285 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019995459.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 927372..928376 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100003259.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(928434..929384) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254038.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(929420..930967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(930972..932033) product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331284.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(932051..934384) product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968355.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 934524..935522 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243759.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(935558..936361) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338992.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 936525..937661 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791554.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 937708..938817 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 938869..939762 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528934.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 939800..940597 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112952.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 940744..942153 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531377.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(942308..943339) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973349.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(943367..944353) product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973350.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 tRNA complement(945027..945103) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(945240..946436) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066820.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene mnmA CDS 946731..947006 product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527546.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(947178..947624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 947745..948026 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393688.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(948134..948484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527555.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 949006..949704 product cell cycle two-component system response regulator CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709262.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene ctrA CDS complement(949860..950222) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066826.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(950327..950998) product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066827.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 951216..951800 product EipA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329648.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 951922..953010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066829.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(953018..953842) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527563.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(953848..954234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393682.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 954273..955316 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527565.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 955541..956446 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066833.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene rpoH CDS complement(956543..958681) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970156.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(958750..960054) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527570.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 960254..961138 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970157.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(961211..962806) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243413.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene serA CDS complement(962882..964063) product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970159.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(964284..964433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 964392..964619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(964650..965489) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984017.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(965789..966619) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973269.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(966882..968234) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973270.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene glmM CDS complement(968533..970455) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709279.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene ftsH CDS complement(970632..971909) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393675.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene tilS CDS complement(971929..972921) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329703.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene ybgF CDS complement(973072..973605) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527588.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene pal CDS complement(973823..975127) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066846.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene tolB CDS complement(975149..976213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388820.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(976223..976672) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527592.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene tolR CDS complement(976704..977420) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527594.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene tolQ CDS complement(977742..978197) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393663.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene ybgC CDS complement(978230..978727) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973276.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(978720..979760) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243394.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene ruvB CDS complement(979801..980418) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066857.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene ruvA CDS complement(980500..981012) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018011849.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene ruvC CDS 981271..982272 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393661.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(982309..983055) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970171.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(983219..984043) product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066864.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(984053..984637) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243388.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(984746..985732) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973872.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 986023..986985 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309875.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene tal CDS complement(987130..987318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(987337..987708) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066867.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(987844..988116) product DUF4164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535987.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 988436..990418 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535989.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene tkt CDS 990492..991493 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384869.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene gap CDS 991571..992770 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973289.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(993002..993157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 993310..994587 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536011.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 994584..994772 product DUF1192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018235560.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 995155..995673 product DUF1465 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066879.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(995856..996077) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970183.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene rpmE CDS 996267..998096 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(998158..999189) product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536016.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(999192..1000247) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536017.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(1000366..1001166) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329745.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(1001313..1002482) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970186.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(1002492..1003145) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970187.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 1003253..1004023 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066886.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(1004233..1004406) product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709330.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 1004590..1004826 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066888.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 1004842..1005345 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077767952.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene purE CDS 1005342..1006400 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970190.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 1006581..1006706 product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709334.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene ykgO CDS 1006774..1007382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970192.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1007446..1008822) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066892.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene pyk CDS complement(1008885..1009313) product DUF1036 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066893.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 1009526..1010314 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066894.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 1010331..1010636 product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970194.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 1010842..1011111 product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314683.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(1011270..1013015) product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531050.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1013246..1014796) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393570.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 1014971..1016827 product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066900.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 1016849..1018006 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066901.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 1017991..1018605 product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531062.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 1018602..1019501 product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393562.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 1019605..1019976 product outer membrane lipoprotein Omp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531074.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene omp10 CDS 1020131..1021162 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531079.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene hemH CDS 1021255..1022286 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066920.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 1022290..1022748 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531117.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(1022776..1023771) product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973310.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 1023929..1025419 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970203.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(1025455..1026342) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066923.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene galU CDS 1026547..1027767 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531122.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(1027764..1027937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 1027997..1029157 product DUF459 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310995.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(1029185..1030642) product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970206.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(1030741..1035441) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066927.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene gltB CDS 1035933..1036979 product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970208.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(1037047..1037508) product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709372.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 1038168..1039130 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393510.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(1039171..1039944) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393508.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene hisN CDS complement(1040044..1040928) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312898.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 1041115..1041477 product response regulator CpdR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531148.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene cpdR1 tRNA 1041572..1041646 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(1041671..1042957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(1043157..1043411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(1043723..1044079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(1044076..1044438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 1044809..1045045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 1045035..1045343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(1045456..1046892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(1047034..1047345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528153.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(1047458..1048192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 1048275..1048511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 1048508..1048693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 1048690..1048920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 1048923..1049681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 1049683..1051422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 1051419..1051679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 1051676..1051906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 1051903..1052940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(1053042..1053344) product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243280.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 1053482..1053667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 1053804..1054091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173515444.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 1054088..1054633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(1054741..1055115) product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067589.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(1055231..1055674) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725092.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 1055982..1056362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 1056368..1056538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(1056696..1056983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 1057485..1057919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 1058005..1059717 product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384775.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 1059827..1060990 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466243.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 1060987..1061841 product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337208.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 1061851..1063167 product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971286.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 1063216..1063554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 1063554..1064162 product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975492.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 1064165..1064371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 1064355..1064720 product head-tail adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384770.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 1064720..1065196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 1065193..1065621 product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975485.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(1065624..1065803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 1065896..1066348 product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975484.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 1066345..1066707 product gene transfer agent family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975483.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 1066713..1066913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(1066916..1067182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 1067222..1070011 product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384764.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 1070011..1070649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 1070651..1071298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 1071295..1071726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 1071739..1076745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 1076776..1077462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 1077586..1078422 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975779.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 1078419..1078700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 1078794..1079108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 1079296..1079796 product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143885.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 1079877..1080146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 1080439..1080669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(1080630..1080839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 1081196..1081417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 1081543..1081734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530427.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(1081844..1082056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(1082217..1082588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(1082978..1083316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(1083598..1084797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(1085023..1085262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(1085262..1085414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 1085523..1085804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(1085815..1086741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(1086819..1090466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(1090476..1092140) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140144.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(1092144..1092467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(1092467..1092877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(1092874..1093278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(1093281..1093583) product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003570.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 1093730..1094233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(1094242..1094805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(1094802..1095140) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337425.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(1095140..1095358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(1095360..1095944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337426.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(1095941..1096678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(1096709..1097095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(1097126..1098286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(1098283..1098816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(1098813..1099142) product gene transfer agent family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337428.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(1099135..1100355) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337429.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(1100453..1101409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(1101736..1102134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 note possible pseudo, frameshifted CDS complement(1102131..1102466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 note possible pseudo, frameshifted CDS complement(1102625..1103113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(1103095..1103394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(1103336..1103881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 note possible pseudo, frameshifted CDS 1104213..1105031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(1105179..1105844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(1105841..1106104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 1106015..1106596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 1106912..1107124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(1107341..1107805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(1108041..1108175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 1108525..1108740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(1108877..1110061) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067002.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(1110184..1111236) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509042.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(1111369..1112826) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970274.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene xylB CDS complement(1113014..1114603) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394130.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(1114632..1115837) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067010.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 1115992..1116696 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394092.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 1116772..1117521 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973884.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 1117821..1119593 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973883.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 1119769..1121238 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394117.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene gltX CDS 1121251..1122744 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509030.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene lysS CDS complement(1122839..1123468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243271.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 1123674..1124573 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242572.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 1124570..1125439 product manganese/iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992451.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 1125436..1126308 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970362.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 1126305..1127147 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973876.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 1127227..1128468 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394078.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(1128474..1129163) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528805.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene ung CDS complement(1129330..1130496) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970560.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 1130872..1131903 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535888.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 1131900..1132901 product 1,5-anhydro-D-fructose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067379.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 1132909..1134522 product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251863.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 1134515..1135294 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251864.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 1135294..1136796 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067376.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(1136817..1137863) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398617.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 1138169..1139419 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508652.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 1139573..1140454 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067374.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 1140451..1141332 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535874.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 1141339..1142484 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242400.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 1142492..1144000 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445683.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 1143997..1144776 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970553.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 1144813..1146468 product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970552.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 1146478..1146804 product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398599.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 1146936..1149617 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067020.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(1149595..1150737) product GAK system CofD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938386.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 1150986..1151759 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535753.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 1151864..1152544 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067344.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 1152541..1153338 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970537.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 1153444..1153893 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061463.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 1153902..1155716 product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969831.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 1155747..1156022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 1156009..1156251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(1156298..1157542) product LVIVD repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097619.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(1157613..1158653) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532920.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(1158680..1159717) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456749.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(1159714..1161195) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164830060.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 1161615..1162082 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975952.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(1162209..1163564) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967123.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene gdhA CDS complement(1163650..1164801) product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968340.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 1165070..1165513 product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252133.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(1165577..1166092) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313899.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 1166354..1168438 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976095.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene glgX CDS complement(1168458..1168709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(1168931..1169713) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967928.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(1169717..1170895) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967929.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(1170892..1171959) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051076795.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(1172080..1173129) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967931.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(1173358..1174098) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170044.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(1174189..1174869) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967933.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 1175029..1176078 product phosphotransferase enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169989.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 1176082..1177404 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967935.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(1177481..1177858) product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388894.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(1177942..1178742) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388893.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(1178739..1179749) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388892.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(1179764..1180774) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973003.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 1181357..1182262 product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833899.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 1182265..1182546 product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389769.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(1182594..1183106) product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063705.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(1183226..1184824) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241142.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene ctaD CDS 1185487..1186353 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382910.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 1186494..1186718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 1186761..1187240 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339224.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(1187260..1187559) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528646.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(1187565..1188098) product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327929.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(1188104..1189456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967665.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(1189547..1189822) product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017264174.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 1190057..1191601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 1191752..1193149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 1193346..1194857 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776487.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(1194950..1195957) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967055.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(1195954..1196862) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967054.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(1196859..1197680) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967053.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(1197685..1198620) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967052.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(1198718..1200310) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967051.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(1200368..1201996) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 1202303..1203250 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967049.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(1203287..1204087) product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889182.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(1204084..1205073) product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967048.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(1205139..1206002) product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967047.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(1206151..1206591) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812030.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(1206691..1208364) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191611.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene ilvD CDS 1208592..1208801 product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531022.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(1208814..1209305) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806996.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(1209391..1209852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(1209969..1211264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193377946.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(1211469..1212482) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970987.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(1212487..1213815) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970988.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene hisD CDS complement(1213849..1214649) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967209.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(1214646..1215590) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526864.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(1215783..1216898) product PotD/PotF family extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970990.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(1216928..1218061) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970991.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(1218297..1219067) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967206.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(1219276..1220007) product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035216417.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene hutC CDS complement(1220066..1221418) product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973445.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 1221540..1222769 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242190.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene hutI CDS 1222766..1224301 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973443.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene hutH CDS 1224303..1225130 product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973442.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene hutG CDS 1225127..1226803 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982256.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(1226856..1227602) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528170.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(1227636..1228538) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526374.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(1228558..1229493) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331332.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(1229568..1230884) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244134.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(1231028..1232095) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061266.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene ugpC CDS complement(1232190..1233191) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244131.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(1233239..1233991) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061263.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 1234211..1235515 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085115.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene pncB CDS 1235601..1236950 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930606.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(1237121..1237441) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975476.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(1237496..1239058) product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975475.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene lsrK CDS complement(1239064..1240011) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975474.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 1240251..1241753 product autoinducer 2 ABC transporter ATP-binding protein LsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170086.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene lsrA CDS 1241746..1242777 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975472.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 1242774..1243787 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975471.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 1243790..1244821 product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975470.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene lsrB CDS 1244893..1246146 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975469.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(1246269..1247360) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967425.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(1247357..1248157) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254901.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(1248161..1249015) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967423.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(1249090..1250100) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397735.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(1250140..1250475) product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397896.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(1250475..1251932) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397733.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(1251946..1252983) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397730.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(1252988..1253911) product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397727.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(1253901..1254707) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397724.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(1254682..1255284) product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973670.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 1255382..1256071 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703493.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(1256095..1257312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(1257664..1259121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 1260613..1261758 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222174.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene glf CDS complement(1261808..1262140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967267.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(1262137..1263024) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967266.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(1263021..1263539) product gluconokinase, GntK/IdnK-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967265.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(1263541..1264296) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967264.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(1264307..1265338) product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967263.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(1265348..1266298) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967262.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(1266364..1267095) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967261.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(1267148..1267939) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967260.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(1268020..1268676) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967259.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(1268678..1269364) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967258.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(1269407..1270039) product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967257.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 1270143..1271042 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967256.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(1271113..1271916) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(1271927..1272574) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974074.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(1272574..1273200) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530557.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(1273272..1274120) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416527.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(1274156..1275166) product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064572.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(1275163..1276455) product selenocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665736.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(1276452..1277582) product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255173.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(1277624..1279129) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808822.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(1279157..1280050) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523211.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene mmsB CDS 1280252..1281169 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446568.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(1281203..1282210) product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014530717.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene doeB CDS complement(1282214..1283395) product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975302.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene doeA CDS complement(1283440..1284432) product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975301.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene eutC CDS complement(1284429..1285436) product hydroxyectoine utilization dehydratase EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975300.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene eutB CDS complement(1285440..1286216) product ectoine utilization protein EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401284.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene eutA CDS complement(1286216..1286878) product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969333.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene ehuD CDS complement(1286881..1287540) product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525889.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene ehuC CDS complement(1287635..1288486) product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969335.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene ehuB CDS complement(1288545..1289330) product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401294.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene ehuA CDS complement(1289454..1290809) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401297.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 1290941..1291423 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525883.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 1291550..1293046 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969339.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 1293077..1294450 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975296.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(1294552..1296084) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164610598.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 1296401..1297276 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967926.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(1297330..1299462) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169987.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 1299793..1300791 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445481.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 1300788..1301825 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014531406.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 1301822..1302862 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967922.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 1302859..1303704 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967921.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 1303701..1304777 product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967920.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(1304822..1306216) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847132.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(1306213..1307850) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815792.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(1307861..1308391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 1308694..1309719 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529350.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(1309762..1310184) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383119.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 repeat_region 1310309..1313777 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcgatccacgcctccgtg CDS complement(1314005..1314295) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384683.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene cas2 CDS complement(1314305..1315339) product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388588.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene cas1c CDS complement(1315336..1316007) product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388587.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene cas4 CDS complement(1316011..1316961) product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384680.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene cas7c CDS complement(1316958..1318133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(1318703..1319371) product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384678.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene cas5c CDS complement(1319740..1321980) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388583.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(1322068..1322955) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970223.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(1322977..1323807) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(1323804..1324958) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528425.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(1324978..1326852) product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350675.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 1327020..1327901 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530319.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 1327931..1328593 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099724.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 1328617..1329963 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530317.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 1329978..1330781 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036073.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(1330856..1331635) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137395784.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 1332003..1333064 product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139076345.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 1333140..1334234 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366951.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 1334257..1335945 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205449.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 1335938..1337008 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198096.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(1337319..1337984) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243016.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 repeat_region 1338092..1339644 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcggttggcctgcgatttctgaactgctaggct CDS complement(1339717..1340091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(1340088..1341014) product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene cas1 CDS complement(1341068..1344421) product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene cas9 CDS complement(1345018..1345221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 1345147..1345320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(1345503..1346729) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(1346948..1347838) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971057.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(1347906..1349366) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389417.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(1349396..1350037) product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528133.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(1350037..1351323) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494209.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(1351338..1352711) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877503.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(1352814..1354070) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206502.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 1354154..1354585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(1354515..1355495) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973346.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(1355495..1356487) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815254.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene rbsC CDS complement(1356484..1357998) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104585.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(1358054..1359130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(1359438..1360454) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210221.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(1360467..1361999) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583992.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene gguA CDS complement(1362016..1362915) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975799.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(1363094..1364152) product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085973.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(1364308..1364826) product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816246.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene rutF CDS complement(1365446..1366387) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533047.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(1366414..1367187) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533049.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 1367400..1368056 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533053.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(1368057..1368815) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087125.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(1368886..1369812) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173320.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(1369887..1370903) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551207.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(1370918..1372480) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523590.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(1372498..1374273) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930025.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(1374291..1376354) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 1376574..1378529 product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530253.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(1378526..1379131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 1379749..1379997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 note possible pseudo, frameshifted CDS 1379994..1380122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 note possible pseudo, frameshifted CDS 1380124..1380501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 note possible pseudo, internal stop codon, frameshifted CDS 1380508..1380834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 sequence12 source 1..18348 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(942..1208) product putative entry exclusion protein TrbK-alt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368413.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene trbK-alt CDS complement(1223..1996) product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene trbJ CDS complement(1993..4485) product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene trbE CDS complement(4496..4777) product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368410.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(4777..5109) product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388565.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(5106..6089) product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene trbB CDS 6298..6867 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390781.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(6885..7337) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337179.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(7465..7944) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538234.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(7955..9943) product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368406.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(10075..11028) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368405.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(11327..11761) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075144.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 12015..12635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(12750..14804) product DUF3363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538232.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(15118..15885) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368399.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(15920..16465) product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368397.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(16462..16977) product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368643.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(17108..17524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 sequence13 source 1..14189 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 260..916 product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082882.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene parA CDS 913..1164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082881.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 1161..1682 product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082880.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 1679..2224 product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368397.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 2293..2640 product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368398.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 2710..3423 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368399.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 3667..5406 product VirD2 family relaxase/mobilization nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018269524.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 5431..7416 product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645922.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 7413..7850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974253.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 8087..9022 product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene trbB CDS 9019..9351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 9351..9629 product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368410.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 9644..12088 product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene trbE CDS 12091..12858 product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene trbJ CDS 12879..13184 product putative entry exclusion protein TrbK-alt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368413.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene trbK-alt sequence14 source 1..12734 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 196..714 product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368643.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 711..1256 product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368397.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 1290..1625 product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082878.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 1622..2554 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368399.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 2868..4922 product DUF3363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538232.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 5139..6353 product CmlA/FloR family chloramphenicol efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531251.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene cml CDS 6381..6563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(6560..7186) product tetracycline resistance transcriptional repressor TetR(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470728.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene tetR(A) CDS 7291..8466 product tetracycline efflux MFS transporter Tet(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804064.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene tet(A) CDS 8556..9473 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368405.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(9508..10770) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040678856.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene fabF CDS complement(10775..11284) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085317.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 11480..12439 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368405.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 sequence15 source 1..8579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 199..717 product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368643.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 714..1259 product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368397.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 1295..1630 product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082878.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 1627..2559 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368399.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 3065..4927 product DUF3363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538232.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 5102..5551 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337179.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 5636..5938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 5951..6952 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368405.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 sequence16 source 1..7596 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2005 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083188.1:efflux RND transporter permease subunit locus_tag LOCUS_20710 CDS complement(2023..4077) product DUF3363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538232.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(4391..5146) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368399.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(5168..5713) product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368397.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(5710..6225) product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368643.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(6222..6413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(6356..6916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 sequence17 source 1..7480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 122..598 product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538234.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(595..1164) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390781.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 1374..2369 product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene trbB CDS 2366..2698 product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388565.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 2698..2979 product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368410.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 2993..5485 product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene trbE CDS 5482..6258 product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene trbJ CDS 6273..6539 product putative entry exclusion protein TrbK-alt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368413.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene trbK-alt sequence18 source 1..6566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(1..77) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 rRNA complement(125..234) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA complement(449..3055) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 tRNA complement(4067..4142) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(4365..4441) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 rRNA complement(4687..6184) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence19 source 1..5695 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(340..1215) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368405.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(1913..2548) product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059796.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 2964..3134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 3450..4481 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837901.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 4481..5662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 sequence20 source 1..2882 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(541..822) product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368410.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(822..1154) product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388565.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(1151..2134) product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene trbB CDS complement(2282..2761) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538234.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 sequence21 source 1..2120 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 470..1159 product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene trbF CDS complement(1165..1542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 sequence22 source 1..839825 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 393..1793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(2287..2436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(2714..2971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(2994..3281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(3384..3797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(3914..4483) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969819.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(4823..5710) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268101.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 5856..6962 product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104374.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 6986..7864 product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267511.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 8023..8973 product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973721.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(8980..9915) product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014963.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(9972..10352) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533454.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(10472..10849) product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918905.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 11674..13296 product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525002.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene ccoN CDS 13308..14039 product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533257.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene ccoO CDS 14051..14203 product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316283.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 14205..15074 product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524999.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene ccoP CDS 15175..16734 product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164757824.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene ccoG CDS 16731..17225 product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524997.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 17222..19489 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524996.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(19572..20456) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994149.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 20601..21977 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338979.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 21993..22994 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064421.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(23259..24194) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969895.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(24485..25381) product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528373.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene iolE CDS 25593..26714 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330812.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 26763..27752 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255196.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 27885..29321 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927099.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 29332..30147 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 30148..31137 product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064247.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 31142..32632 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338818.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 32632..33648 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721763.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 33696..34643 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563288.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 34855..35766 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210296.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(35916..36917) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061402.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene iolG CDS 37046..38236 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858057.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 38331..40172 product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223774.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene iolD CDS 40218..41027 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969509.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 41044..42096 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972870.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 42107..43282 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338817.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(43292..44227) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077984631.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 44501..45472 product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014235.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 45544..46371 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972912.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 46368..47372 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210221.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 47400..48617 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972869.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(48767..49768) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434654.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(49836..50630) product pyrroline-5-carboxylate reductase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384670.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(50644..51273) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992350.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 51420..53456 product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972390.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 53459..54061 product dimethylsulfoniopropionate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975853.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(54076..54870) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972916.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene thiD CDS complement(54867..55529) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972915.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene thiE CDS complement(55516..56268) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972914.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(56265..57254) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257402.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(57251..57994) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972912.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(58293..58589) product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530160.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(58586..59335) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550326.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(59479..60276) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408460.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 60628..61773 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339206.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 61777..64932 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339205.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(64998..65639) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067297.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(65636..67111) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067298.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene ftsY CDS complement(67125..68402) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393886.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene mtaB CDS complement(68399..69298) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972495.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene dapF CDS 69647..71188 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242460.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene ffh CDS 71199..71522 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529740.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 71559..71924 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529742.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene rpsP CDS 72009..72581 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393867.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene rimM CDS 72583..73290 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393864.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene trmD CDS 73520..74047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 74299..76908 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970484.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 77008..77667 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529654.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 77757..78563 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529670.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(78586..79041) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067262.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(79110..79793) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310886.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 79900..80445 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092733832.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 80580..81410 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(81463..82932) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067258.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(83159..84007) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970482.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene tesB CDS 84118..85356 product ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393779.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(85395..85583) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537577.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(85598..86278) product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970480.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(86414..87373) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970479.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene trxA CDS complement(87471..87980) product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844917.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 tRNA 88192..88266 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 88673..90142 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391605.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 90205..91113 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331879.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 91110..92000 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532185.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 91997..92884 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529211.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 92881..93831 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529210.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 93828..95276 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920797.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene gatA CDS 95273..95761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 95807..96880 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086694.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene ugpC CDS complement(96873..97676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(97839..98567) product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190973.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene glnQ CDS complement(98564..99220) product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202330.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene glnP CDS complement(99297..100025) product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388693.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene glnH CDS 100184..100672 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328737.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 100817..102028 product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395366.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 102025..103245 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 103242..104399 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395362.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 104792..104938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 note possible pseudo, frameshifted CDS complement(105035..105481) product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(105498..106211) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975382.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(106381..106626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 note possible pseudo, frameshifted CDS 106773..106967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 107268..108968 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670404.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene ggt CDS 109008..109196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 109676..110797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803682.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 110856..111740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(112180..112449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(112522..113433) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530746.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene gcvA CDS 113540..114244 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180942960.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 114249..115187 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113238.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(115270..115512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(115733..116176) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967549.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(116176..116604) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184577.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(116601..116741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(116758..117072) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975757.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(117072..117956) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529254.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(118147..118434) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383178.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 118564..118758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(118978..119919) product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975284.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(119986..121656) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene betA CDS 121914..122456 product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096684.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene betI CDS 123525..124886 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242500.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 124903..125895 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206906.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 125907..127511 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918829.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(127591..129018) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(129015..130115) product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971231.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(130112..130849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 note possible pseudo, frameshifted CDS complement(130804..131163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(131274..132245) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393023.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 132331..133353 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303519.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(134008..134187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 134154..135515 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331272.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 135625..136473 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819839.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 136490..136843 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813850.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 136875..137900 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405534.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 137970..138854 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160916.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 138856..139635 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552009.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 139632..140738 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530466.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 140760..142220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 142217..143371 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267522.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 143397..144827 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530546.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 144862..145875 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525216.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 145946..146689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(146905..147168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(147292..148434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(148660..149418) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266698.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(149415..151178) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870477.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(151204..153270) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(153290..154189) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030805.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(154241..154945) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(154932..155687) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879470.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(155674..156660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 note possible pseudo, frameshifted CDS complement(156667..157530) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886926.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(157674..158882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 159175..159900 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267484.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 159935..160327 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532092.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(160344..160886) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399415.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 161025..162173 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(162213..162836) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970348.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene mobA CDS complement(163033..164172) product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992331.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(164314..165354) product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391732.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene fba CDS complement(165581..168148) product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456746.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(168421..168822) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970945.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene mnhG CDS complement(168819..169100) product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313274.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(169097..169573) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970946.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(169575..171224) product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687984.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(171221..171559) product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493763.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(171559..174462) product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972638.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(174565..174951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 175234..175674 product DUF3597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973558.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(175736..176284) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180939484.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 176433..177770 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970550.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 177832..178242 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324376.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(178220..179293) product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972403.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene modC CDS complement(179290..179991) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972402.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene modB CDS complement(180076..180849) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972401.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene modA CDS 181761..184322 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969994.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(184470..185270) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514079.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(185401..186465) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974159.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(186462..188687) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974158.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(188816..189841) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974157.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(189905..190933) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974156.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 191148..191888 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974155.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 191885..193993 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974154.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 194248..195087 product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976208.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 195757..196986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 196988..199525 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975745.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 199778..200725 product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970329.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(200835..201611) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970268.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(201654..202322) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973896.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(202312..203346) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257698.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(203667..204440) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970017.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(204523..205959) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066669.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene aldA CDS complement(205996..206991) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066670.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(207008..208681) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066673.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(208678..209772) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066674.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(209776..210885) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066675.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(210885..211127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066676.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(211132..211992) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066677.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(212003..212944) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066678.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(213043..214461) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066679.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(214524..215603) product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844796.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 215719..216429 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970019.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 216667..217437 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970020.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 217499..218593 product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970021.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 218637..219341 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066684.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 219356..220120 product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066685.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 220150..220794 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970025.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 220853..221806 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066688.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 221811..222746 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970028.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 222743..223603 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 223617..224507 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066691.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 224510..225265 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066692.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene deoC CDS 225270..226817 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066693.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 226814..228343 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066694.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 228376..229134 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970034.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(229216..230304) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970021.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(230349..231338) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066696.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(231335..232840) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970036.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(233000..233965) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970037.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(234031..234831) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970038.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(234972..237347) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975661.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(237372..238394) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061561.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene deoC CDS 238600..239334 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066700.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(239384..240685) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975268.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(240689..241945) product ribulose-bisphosphate carboxylase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398928.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 242081..242803 product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398931.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(242808..244676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398936.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(244673..245707) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975231.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(245710..246774) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969403.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(246774..248318) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398941.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(248318..248959) product DUF2291 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969405.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(249027..249968) product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975228.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(250089..250916) product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975227.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 251189..252211 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313850.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 252344..253183 product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808900.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(253244..254281) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253376.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 254449..255681 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963751.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 255774..256652 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014989919.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 256649..257473 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969227.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 257551..258645 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086694.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene ugpC CDS 258642..260216 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163897449.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 260301..261638 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974675.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 261689..264697 product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975932.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 264740..266395 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975065.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(266500..267531) product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114965.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 267748..268416 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114953.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 268498..269202 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969508.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 269315..270277 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969507.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(270348..270950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400564.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(271082..272119) product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974066.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 272269..273786 product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975153.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 273972..274781 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975154.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 274854..275519 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312403.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 275532..276185 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312400.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 276178..276900 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975156.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 276905..278155 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975157.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 278166..279860 product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975159.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(279892..280905) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862432.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 281103..282203 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086412.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 282212..284278 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368527.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 284275..286254 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538267.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 286264..287355 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339376.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 287410..288255 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086028.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 288257..289063 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089929.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 289060..289710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 289707..291029 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390624.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 291026..291703 product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106037.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(291794..293101) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974965.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 293344..294243 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531253.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 294404..295606 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010204046.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(295596..296297) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537996.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 296392..297171 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401675.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS 297164..298786 product urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401683.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 298783..300495 product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255177.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 300569..301429 product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971568.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(301487..302278) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976312.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 302385..303944 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976313.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 304027..306024 product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397063.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(306141..306671) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109279.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(306772..308214) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972714.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS 308451..309380 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383681.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 309571..310434 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327693.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 310445..311410 product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383683.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(311432..311920) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243293.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 312194..313999 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730611.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(314078..314764) product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812253.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 314925..315914 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 315911..317680 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812261.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 317677..318807 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812264.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 318812..319924 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812266.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(319968..320270) product DUF3861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209910.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 320413..320787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 321209..322843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 323143..323313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 323648..324013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 324010..324807 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532381.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 324804..325751 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532380.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 325754..326758 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532379.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(326904..327680) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193469.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(327680..328801) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192697.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(328874..329818) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192875.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(329882..330991) product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031356.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(331335..331484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 331884..333125 product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992327.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(333153..333746) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067295.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(333743..333922) product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529719.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene ccmD CDS complement(333919..334689) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970511.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(334762..335421) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982179.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene ccmB CDS 335420..335653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(335546..336187) product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529713.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene ccmA CDS 336499..339147 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529712.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene acnA CDS 339319..340080 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393976.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 340417..340791 product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310858.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(340879..341712) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391823.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(341702..342742) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081159170.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(342739..343581) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973970.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(343578..344399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(344482..345618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(345644..346801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(346896..347375) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878483.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(347417..348214) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384907.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(348243..348917) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088106.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(348914..349642) product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384906.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 349732..350394 product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930032.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 350546..352297 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389044.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 352377..352835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389045.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 352838..353503 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389046.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 353517..354821 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389047.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 354923..356284 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389413.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(356382..358469) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970510.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(358623..359690) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 359937..361268 product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724359.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(361425..361889) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206374.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(361980..362570) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529435.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(362957..363853) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529342.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(363870..364901) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066665.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(365010..366494) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066666.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(366642..367829) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970016.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 368262..368927 product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368060.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene csiR CDS 368972..370534 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385655.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 370676..371707 product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086752.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 371697..372746 product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970208.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 373351..374835 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803911.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 374976..376040 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(376204..376992) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401384.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(377005..377745) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399298.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(377738..378487) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399300.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 378586..381642 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399302.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 381646..382398 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399305.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(382441..383124) product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395144.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(383170..384390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241289.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 384545..384796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 384799..385491 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112385.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(385616..386263) product nucleoside triphosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974124.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(386433..387302) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974125.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(387414..388184) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970038.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(388215..389333) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240171.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(389391..390155) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067240.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(390183..391007) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253348.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(391000..391854) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972367.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(391994..393328) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626135.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(393470..394495) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969874.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(394939..395385) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966456.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(395385..396335) product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030804.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 396480..397400 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242371.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 397597..398481 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523151.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(398586..399383) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388812.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 399688..400494 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191784.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 400626..401405 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085932.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 401445..402122 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105443.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 402122..402832 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967252.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 403036..403734 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722857.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 403755..404384 product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722856.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 404718..405794 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 405791..406906 product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene pimD CDS 406906..408963 product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748465.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 409004..409819 product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004377.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene caiD CDS complement(409965..410198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 410366..410611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(410777..411700) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530401.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(411766..412971) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399310.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(412968..413786) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530391.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(413798..415003) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530392.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(415000..416619) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530393.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(416622..418700) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530394.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(418697..420352) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530395.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(420363..420971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(421091..421822) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089550.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(421982..422824) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973666.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(422856..423506) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339331.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(423503..424144) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105543.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(424144..424938) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230914.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(425075..425230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(425626..426855) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066877.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(427139..427675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(428065..432438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(432438..433268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(433271..434524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(434521..435453) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878124.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(435463..436251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 436973..437272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(437256..438155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(438145..438324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 438571..439650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 439640..440485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 440482..443022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 443026..444897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(444903..445799) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969794.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(445796..446632) product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135173535.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene pdxY CDS complement(446629..447396) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388896.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(447480..448736) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331261.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 448981..449730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(449749..450906) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(450963..451865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 note possible pseudo, internal stop codon, frameshifted CDS complement(451862..452689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(452686..453534) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(453531..454511) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(454512..456059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(456089..457510) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 457720..460257 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(460383..460814) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236987.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(461171..462412) product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976328.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(462464..463564) product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528007.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene nspC CDS 464085..466289 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399174.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(466304..466747) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974731.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene rnhA CDS complement(466744..467709) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392593.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(467814..468818) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974729.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene ispH CDS complement(468890..469627) product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392596.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(469620..470003) product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974727.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(470221..471135) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974725.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(471155..471760) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968908.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(471764..471904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003509137.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(471904..472848) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241141.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(472945..474603) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241142.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene ctaD CDS complement(474623..475507) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974720.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene coxB CDS 475899..476429 product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532333.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 476505..477920 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974707.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene tldD CDS 478020..479084 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968901.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(479081..479701) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974711.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene pdxH CDS 479831..480196 product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392629.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 480294..481331 product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968903.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 481463..482281 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532347.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene fabI CDS 482290..482871 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974715.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(482894..483154) product DUF1344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532345.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 483424..484521 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392623.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene aroC CDS 484549..485649 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392622.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene ribB CDS complement(485677..486093) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971227.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 486444..487463 product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210030.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(487442..488860) product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392280.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 488971..489495 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087894.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene tsaA CDS complement(489607..490890) product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651334.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(490931..491665) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534628.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 491832..492626 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975556.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(492745..494874) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973160.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene scpA CDS complement(494871..496865) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973161.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(496891..497121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 note possible pseudo, internal stop codon CDS complement(497194..498726) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244072.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(498908..499207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(499249..500244) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234705479.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 500355..501311 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 501594..502508 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976192.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 502505..503389 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976193.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 503421..504773 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976194.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 504896..506500 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234705053.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 506542..507594 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976196.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene ugpC CDS complement(507642..508436) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724379.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(508438..509271) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339378.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(509276..510310) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339377.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(510338..511354) product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339379.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(511434..512387) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339376.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 512594..513529 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532333.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(513492..514409) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808684.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 514676..515536 product nopaline ABC transporter substrate-binding protein NocT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891637.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene nocT CDS 515600..516700 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726713.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 516751..517047 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089927.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 517044..518501 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040457.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 518595..519668 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089925.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 519697..520653 product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530334.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene doeB CDS 520718..521437 product nopaline ABC transporter permease NocQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891638.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene nocQ CDS 521437..522159 product nopaline ABC transporter permease NocM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523894.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene nocM CDS 522156..522938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 523184..524662 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533774.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 524717..525721 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530262.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 525807..526796 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388000.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 526863..527636 product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729199.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 527673..528665 product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975196.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 528680..529321 product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015008606.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene dhaL CDS 529470..531587 product bifunctional sugar-binding transcriptional regulator/dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975194.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 531617..532252 product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015008607.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene dhaL CDS complement(532267..533604) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243036.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 533734..534525 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 534677..535378 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243033.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(535450..536247) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383134.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(536351..537613) product ribulose-bisphosphate carboxylase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975267.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(537615..538361) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243741.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(538373..539032) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971589.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(539041..539724) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383131.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(540415..541650) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338577.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(541668..542603) product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064007.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(542603..543367) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(543374..544795) product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707523.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(544795..545727) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(545729..546529) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(546590..547729) product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704973.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(547862..548872) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530232.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 548978..549940 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 549951..551003 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 551069..553102 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 553279..554865 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528248.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 554957..555727 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267485.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(555732..557489) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971835.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(557701..558978) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089551.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(559371..560750) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969957.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(560743..560913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(561107..561856) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090839.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(562156..562929) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090841.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(562926..563594) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090840.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(563621..565366) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807539.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 565524..566441 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969963.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(566523..567281) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338989.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(567307..568113) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723474.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(568128..568979) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723477.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(568991..570148) product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338990.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(570211..571305) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640832.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 571396..572175 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338992.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(572232..573263) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(573420..573845) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253940.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(573842..575224) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(575253..575726) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399786.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene rraA CDS complement(575737..576375) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965772.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(576372..577643) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266421.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(577664..578329) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(578393..579466) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198096.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(579459..581219) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205449.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(581284..582390) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198094.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(582517..583611) product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139076345.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(583697..584623) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016558605.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 584804..587380 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974570.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene acnA CDS complement(587513..588247) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(588244..588978) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331278.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(588996..590000) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331287.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(589997..590983) product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331286.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene proX CDS complement(590980..591948) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331285.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(591948..593036) product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331284.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 593166..593873 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140454.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 593883..594788 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331282.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 594790..596289 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331281.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 596286..597632 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331280.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 597739..599292 product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331276.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 599344..600450 product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331277.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(600439..601149) product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013653842.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 601690..603609 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 603609..604478 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388248.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 604475..605473 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 605470..606261 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(606387..607754) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339306.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(607754..608413) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140383.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 608527..610371 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958394.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene dsbD CDS 610371..611216 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172934.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 611216..611827 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965344.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 611924..613453 product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311047.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(613474..614508) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032699633.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 614717..616552 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971959.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene ilvD CDS 616747..617946 product TadE/TadG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394216.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 618165..620624 product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970234.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 620624..622837 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533907.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene glgB CDS 622859..624121 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026616211.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene glgC CDS 624130..625569 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970235.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene glgA CDS 625573..627204 product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066958.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 627207..629180 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970237.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene glgX CDS 629312..629797 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970238.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 629971..630870 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930014.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 631000..631332 product RcnB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969558.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(631433..632662) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868921.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 632818..634377 product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727845.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene araB CDS 634552..635565 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731545.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 635817..636719 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731544.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 636716..637510 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230844.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 637561..638592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 638589..639608 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209518.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 639830..640888 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061288.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 640897..642852 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392336.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene asnB CDS 642855..643109 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392338.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 643156..644655 product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525355.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 644652..645632 product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254737.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene nadE CDS 645868..646725 product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494889.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene tcyJ CDS 646812..648341 product amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315104.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 648345..648995 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027773.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 649042..650370 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063875.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 650390..650776 product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464385.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 651035..652150 product transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528537.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 652147..652752 product transcriptional antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528536.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 652730..653629 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013891920.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 653626..654546 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528534.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 654565..656202 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528533.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 656192..657136 product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528532.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 657133..658926 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528531.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(658948..659772) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201854.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 660152..661357 product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173037.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene proV CDS 661380..662264 product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200833.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene choW CDS 662335..663204 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071494957.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 663396..664637 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103754.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(664647..665762) product RHE_PE00001 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221101572.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(666013..667299) product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858027.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene repC CDS complement(667455..668510) product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525329.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene repB CDS complement(668498..669691) product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525328.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene repA CDS complement(669959..670519) product DUF2585 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242455.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS 670624..671487 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067047.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(671555..673036) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242183.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(673128..674405) product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975708.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 674570..675388 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331794.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(675392..675700) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531854.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 675935..676309 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531853.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 676371..676901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531852.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 676986..678557 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531851.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 678694..679065 product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242689.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(679192..680091) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396441.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 680266..682050 product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967127.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(682067..683050) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969981.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(683269..684702) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969982.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(684874..686052) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969980.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(686065..687081) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066634.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 687260..688318 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329331.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene speB CDS 688391..689479 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969978.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 689584..690621 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434020.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 690618..691472 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329325.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 691469..692266 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525654.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 692325..693107 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066628.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(693130..694803) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529813.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(694823..696004) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529819.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(696081..697115) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531376.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(697133..697945) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529816.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS complement(697938..698864) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529815.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(698867..699970) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529814.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(700221..701240) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086178.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 701446..702480 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612347.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 702583..703539 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524842.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 703557..704333 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970636.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 704333..705307 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082684.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 705318..706328 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255196.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 706337..707296 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399741.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 707385..707735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(707701..708003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 708172..708933 product ImuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967468.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 708977..710368 product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257431.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 710368..713538 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972863.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 713653..715101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 715189..715494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(715499..716143) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243010.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(716140..717405) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194989.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(717419..718420) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253376.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 718528..719472 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061260.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 719475..720242 product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976193.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 720307..720561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 720650..720865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396422.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 720998..721312 product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153354109.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(721328..722056) product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970710.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene phnF CDS 722254..722733 product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530625.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene phnG CDS 722733..723341 product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976254.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene phnH CDS 723346..724446 product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440333.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 724446..725330 product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530631.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 725327..726103 product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969858.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene phnK CDS 726167..726874 product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976256.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene phnL CDS 726871..727485 product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529516.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 727622..728464 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970704.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene phnC CDS 728544..729449 product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975698.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene phnD CDS 729524..730486 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061596.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene phnE CDS 730496..732004 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061595.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene phnE CDS 732088..732795 product DUF1045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061594.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 732797..733936 product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061593.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 733933..734508 product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391674.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene phnN CDS complement(734535..734951) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327944.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(735063..735347) product DUF2934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257319.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 735792..737786 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970041.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene tkt CDS 737816..739261 product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066701.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(739362..740075) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815288.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 740187..740981 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533156.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 740983..741894 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533158.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 741891..742967 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533159.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(743057..744196) product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975975.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(744298..746112) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929991.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(746142..748208) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(748242..748973) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(749101..750315) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533160.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(750607..751371) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971780.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(751391..751975) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210333952.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(752095..752865) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(752908..753609) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185649.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(753548..754372) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082083.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene livG CDS complement(754348..755343) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064073.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(755347..756297) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526290.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(756368..757483) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704142.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(757621..758409) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067241.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(758437..759132) product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089765.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(759220..760653) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(760680..761783) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170159.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(761834..763360) product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892286.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(763411..764184) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687994.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(764325..765350) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395757.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS 765529..766524 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252613.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 766671..768563 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395834.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(768633..769520) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968408.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 769826..771379 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037836.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(771476..771664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 771805..772674 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171431162.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 772859..773380 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(773454..773909) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316661.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(773906..774655) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(774655..776172) product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(776487..777521) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103675015.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(777706..778089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 778167..778418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(778361..778588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(778585..778851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(778844..779335) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926422.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(779335..780210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(780203..780589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 780711..781781 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703864.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(781722..782225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(782225..782665) product recombination protein NinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098063.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(782674..782997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(783000..783854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(783857..784333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039672.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(784333..785319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(785481..785933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(785930..786568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(786979..787383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(787424..787618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS 787798..788049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(788075..788446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 788534..788749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS 788746..789012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 789096..789389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS 789393..790742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 790870..791046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 791300..791719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 791744..792754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 792751..792936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 792933..793499 product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS 793496..793888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 793885..794607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 794549..795013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 795023..795475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 795472..795672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 795669..795917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 796170..796685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(797178..797639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(797639..797863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(797863..798177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 798303..798614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 798769..799014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(799081..799311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 799335..799733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 799895..801151 product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204794.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 801151..802590 product DUF4055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115366076.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 802663..803418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931443.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 803529..804518 product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039670.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 804607..805134 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931436.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 805202..806041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 806223..806840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 806844..807218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(807220..807729) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192886228.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 807800..808867 product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976020.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 808860..809318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976019.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 809315..809770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS 809780..809962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 810035..810742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 810825..811262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 811608..814190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 814191..814910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975480.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 814910..815491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 815476..815892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975476.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 815897..818002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975475.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 818071..821442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(821488..822099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 822172..822963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 823642..824229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 824317..824970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 824967..825272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 825336..825638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 825763..826128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 826125..826478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(826627..826839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(827012..827644) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251639.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(827882..828370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008874702.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 tRNA complement(828626..828700) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 828852..829049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 829205..830497 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706806.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene murA CDS complement(830501..830656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 830597..831034 product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974418.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 831083..832381 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391986.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene hisD CDS 832384..832860 product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327288.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 832907..833329 product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327289.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 833473..833691 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435948.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene infA CDS 833753..834373 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378465.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 tRNA 834754..834829 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 835020..836330 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073624.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(836305..837915) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003660.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 837814..838329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(838260..839717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28980 sequence23 source 1..1586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(408..1466) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084361.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 sequence24 source 1..1332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..726 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970096.1:electron transfer flavoprotein subunit beta/FixA family protein locus_tag LOCUS_29000 sequence25 source 1..1321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 51..380 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS 377..1282 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349104.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 sequence26 source 1..931 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence27 source 1..826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence28 source 1..548 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence29 source 1..519 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3..488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 sequence30 source 1..509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence31 source 1..448442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 419..1108 product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene trbF CDS 1105..2064 product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368416.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene trbG CDS 2061..3212 product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 3215..3451 product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(3384..4178) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226696.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 4065..4325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(4360..5013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(5013..5813) product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173829.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(5885..6289) product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(6299..6646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(6721..11097) product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167355187.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS complement(11527..12024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(12024..12443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 12570..13109 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315770.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 13106..14887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 14884..15963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 16143..16493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS complement(16964..17428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(17438..17566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(17656..17847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 18457..18687 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082899.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(19249..20019) product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene istB CDS complement(20016..21005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 note possible pseudo, internal stop codon CDS complement(21006..21509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29270 note possible pseudo, internal stop codon CDS complement(21588..21776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(21794..21982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(21885..22811) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265901.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(22843..23361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29310 note possible pseudo, frameshifted CDS complement(23358..25049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29320 note possible pseudo, frameshifted CDS complement(25062..25598) product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202123.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(25796..26128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(26129..26641) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706837.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(26685..27068) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201003.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 27232..27882 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331306.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 27879..29210 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140446.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(29317..29622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 30007..31266 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400619.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(31296..33260) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170118038.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(33290..33985) product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(34402..34782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(34797..35489) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(35495..36628) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(36625..37770) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941617.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(37774..38370) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267233.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 38577..38741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 38992..39219 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082899.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 39323..39487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 39621..41027 product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393365.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 gene sthA CDS complement(41127..42608) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328265.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene tig tRNA complement(42886..42970) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(43102..43689) product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083237.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(43692..44795) product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531316.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 45533..45676 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328243.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS 46013..46156 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003515516.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 46288..47697 product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328241.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene trmFO CDS complement(47714..48136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328238.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(48366..49223) product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529514.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(49242..49628) product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975345.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(49621..52113) product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971714.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 gene secDF CDS complement(52208..52540) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975343.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene yajC CDS 52717..53586 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975342.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(53625..55031) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393411.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(55322..55864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(56021..56674) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526709.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(56671..57441) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971810.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene surE CDS complement(57463..58746) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534571.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene serS CDS complement(58809..59645) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534569.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene tatC CDS complement(59642..60325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(60375..60566) product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314389.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS complement(60599..61711) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328224.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(61771..62484) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969279.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene scpB CDS complement(62477..63340) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129796.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(63458..64477) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969277.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene nagZ CDS complement(64629..67568) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975329.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(67632..69425) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969275.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene argS CDS complement(69461..70678) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534550.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS 70895..71227 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393432.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene erpA CDS 71261..72058 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971819.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene xth CDS complement(72069..72761) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244692.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(73209..74372) product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244691.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(74639..77482) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393433.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(77624..78295) product PopZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969271.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(78480..79877) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975319.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene tolC CDS complement(79975..80628) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969269.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 80936..81976 product tonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528968.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene exbB CDS 81981..82412 product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037384564.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene exbD tRNA complement(82517..82590) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(82716..83195) product DUF2938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972115.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(83277..83558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312250.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 tRNA 83723..83797 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(83891..84100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 84448..85488 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328363.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS 85495..86238 product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969351.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 86250..87110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29940 note possible pseudo, frameshifted CDS 87107..87697 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969353.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 87795..88346 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531463.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 88520..89542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(89705..90976) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240324.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(91110..91427) product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975528.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(91582..92829) product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328353.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene ilvA CDS 92967..94421 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975530.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 94491..95072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528236.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(94956..95231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(95241..96146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 tRNA complement(96689..96774) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(96966..97565) product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971828.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene wrbA CDS 97727..98482 product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253617.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 98549..99391 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314363.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 99604..100101 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975542.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene gpt CDS 100742..104548 product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529536.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 104768..104995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 104992..105633 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392204.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(105841..107148) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969201.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(107145..108545) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969200.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 108741..109676 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401748.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene msrP CDS 109676..110320 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969198.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene msrQ CDS complement(110426..110848) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707774.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene rplQ CDS complement(110986..111996) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707773.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(112099..112488) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495225.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 gene rpsK CDS complement(112740..113108) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313984.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene rpsM CDS complement(113343..113921) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328075.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(113918..115258) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536503.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene secY CDS complement(115569..116045) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328073.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene rplO CDS complement(116059..116262) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536508.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene rpmD CDS complement(116276..116845) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536510.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene rpsE CDS complement(116974..117336) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383041.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene rplR CDS complement(117349..117882) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975182.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 gene rplF CDS complement(117925..118323) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975181.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene rpsH CDS complement(118336..118641) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536519.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene rpsN CDS complement(118676..119233) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975179.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 gene rplE CDS complement(119226..119537) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975178.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene rplX CDS complement(119551..119919) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495199.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 gene rplN CDS complement(120170..120406) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975177.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 gene rpsQ CDS complement(120419..120619) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536529.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene rpmC CDS complement(120632..121045) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975175.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene rplP CDS complement(121084..121815) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975174.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 gene rpsC CDS complement(121815..122204) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707758.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene rplV CDS complement(122207..122485) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002964358.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene rpsS CDS complement(122501..123337) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707757.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene rplB CDS complement(123376..123669) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536621.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(123666..124286) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975172.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene rplD CDS complement(124299..124982) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975171.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene rplC CDS complement(125150..125458) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507767.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene rpsJ CDS complement(125613..126788) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969189.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene tuf CDS complement(126855..128954) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707752.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene fusA CDS complement(128987..129457) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507761.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene rpsG CDS complement(129513..129884) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507760.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene rpsL CDS 130445..130744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975168.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(130937..132322) product IS1182-like element ISBma2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205153.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(132414..136625) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328060.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene rpoC CDS complement(136838..140980) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975166.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene rpoB CDS complement(141238..141615) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316437.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene rplL CDS complement(141676..142194) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402238.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene rplJ CDS complement(142536..143240) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328057.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene rplA CDS complement(143237..143668) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316435.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene rplK CDS complement(143869..144399) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707742.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene nusG tRNA complement(144806..144881) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(145253..146428) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969189.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene tuf CDS complement(146652..146936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708407.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 tRNA complement(147096..147169) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(147194..147278) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 147486..148370 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975157.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS complement(148446..149069) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969187.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 149364..150311 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969186.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 tRNA 150366..150441 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(150523..150774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 150907..151680 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401481.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 151736..152218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975151.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(152308..153336) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101777569.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene prfB CDS complement(153539..155992) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969182.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(156251..157492) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401505.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS 158127..161129 product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252195.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(161208..162362) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969178.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS 162637..163395 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533078.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 163555..163995 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328041.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene aroQ CDS 164019..164483 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975143.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 gene accB CDS 164494..165837 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533072.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene accC CDS 165853..166470 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975141.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene aat CDS complement(166526..166966) product DUF2155 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975140.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(167043..167438) product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328036.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(167565..168065) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533058.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(168129..169631) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975137.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene gatB CDS complement(169717..170229) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328030.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(170273..171754) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240741.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 gene gatA CDS complement(171905..172192) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240742.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene gatC CDS complement(172297..173001) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256572.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 173146..173442 product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974886.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 173468..173959 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971538.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene ruvX CDS complement(173899..174231) product DUF6105 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972656.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(174522..176174) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328023.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS 176361..177302 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975127.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 177299..178591 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971533.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 178644..179258 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240750.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene plsY CDS 179273..180424 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969165.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene dprA CDS complement(180356..180610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 180867..183506 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533027.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene topA CDS 183511..185862 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399477.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene rnr CDS complement(185859..186041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 185953..186423 product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252183.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 186456..187079 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975120.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 187093..188277 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537639.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS 188370..188537 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707650.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene rpmG CDS complement(189209..190630) product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537641.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(190647..191018) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537642.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 191161..191460 product DUF3572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328012.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 191577..192890 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969160.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 192999..194303 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975114.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(194333..197830) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969158.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene dnaE CDS complement(198397..199083) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975112.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(199097..200404) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328003.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(200439..201767) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240764.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS complement(202464..202733) product DUF1467 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526683.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(202941..203345) product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975098.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene mce CDS complement(203398..205065) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975097.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(205081..205848) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975096.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(205845..207296) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969150.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene nuoN CDS complement(207306..208817) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531857.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(208817..210814) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531855.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene nuoL CDS complement(210822..211130) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531854.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene nuoK CDS complement(211157..211771) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707629.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(211887..212378) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707628.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 gene nuoI CDS complement(212416..213462) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975090.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene nuoH CDS complement(213483..215561) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975089.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene nuoG CDS complement(215736..217040) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531839.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene nuoF CDS complement(217052..218155) product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971510.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(218172..218414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327988.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(218414..219604) product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531832.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(219655..220260) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327986.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(220278..220859) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975082.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(220850..221215) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707618.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 tRNA complement(221682..221758) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(221804..221880) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 222123..222198 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(222290..222610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000401.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(222854..223645) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974406.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(223654..225048) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391972.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(225045..232364) product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563188.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS 232889..234472 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968671.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 234469..235731 product capsule biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974404.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 235942..236718 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969901.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 236889..237836 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975702.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 238084..239211 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017276276.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(239273..241804) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327248.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene secD CDS complement(241916..242335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(242521..245985) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969143.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(245985..247250) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390983.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 247519..247974 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531815.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(248044..250236) product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969141.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(250503..250778) product DNA-binding protein HupB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312721.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene hupB CDS complement(250983..253406) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327977.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene lon CDS complement(253720..254997) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531807.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene clpX CDS complement(255296..255928) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327975.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene clpP CDS complement(256069..256239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 256199..257458 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971502.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(257468..257812) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327970.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(257947..259230) product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969134.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS complement(259333..259761) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529220.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 259926..260762 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390999.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 261019..261483 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707596.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene rplM CDS 261486..261962 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975055.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene rpsI CDS 262116..263069 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969130.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene speB CDS 263191..264123 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969129.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene argC CDS complement(264154..265230) product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969128.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 265367..265585 product DUF2842 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379956.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 265753..266979 product polysaccharide biosynthesis GNAT family N-acetyltransferase UppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971493.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene uppA CDS complement(266995..269229) product exopolysaccharide transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969123.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 269441..270016 product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327952.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 270022..271209 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391038.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 271263..272831 product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969121.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS 272828..274069 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529257.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 274066..275220 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969120.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS complement(275432..275686) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313814.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(276097..276351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31650 tRNA complement(276455..276531) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(276647..277177) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707548.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(277304..277642) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529278.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(277833..278810) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529280.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(278807..279865) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529283.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene plsX CDS complement(279982..280536) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971447.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(280682..281236) product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312818.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 281386..281853 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975021.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(281954..284089) product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252216.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(284253..285485) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971445.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(285531..286016) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707539.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene nusB CDS complement(286013..286474) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975017.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene ribH CDS complement(286590..287744) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531843.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(287854..288471) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975015.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(288456..289586) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391078.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene ribD CDS complement(289587..290066) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529310.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene nrdR CDS complement(290136..291434) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037431185.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 291685..292902 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972738.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 gene chrA CDS complement(292972..294303) product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975012.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(294560..295069) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529316.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(295200..295598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 295799..296815 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391123.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 gene hemB CDS 296884..297351 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327890.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 297446..298198 product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969108.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 298240..299154 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240838.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(299269..301521) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971438.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene parC CDS 301730..302926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391097.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 303052..304464 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 304475..305479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(305502..305828) product DUF1236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254769.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(305909..307699) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971433.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 gene aspS CDS 307958..309103 product ceramide glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153438907.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 309172..310416 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391126.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 310503..311885 product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530218.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 312039..313190 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969099.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene rnd CDS complement(313349..314527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(314612..315211) product DUF922 domain-containing Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392406.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(315219..316640) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529361.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene ppx CDS complement(316750..318963) product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156528573.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(319100..319795) product DnaA regulatory inactivator HdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327870.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene hdaA CDS complement(319827..320963) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969095.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 321175..322248 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969094.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 gene purM CDS 322245..322931 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974989.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene purN CDS complement(322909..323517) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971421.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(323546..325660) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526666.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 325749..326609 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391113.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 326656..327390 product ribonuclease T(2) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391115.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 327456..328046 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391116.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(328107..328742) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327858.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS 329104..329868 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974981.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS 329865..331907 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240869.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene uvrC CDS complement(331874..332074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 332167..332751 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312874.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene pgsA CDS 332753..333007 product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327854.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene moaD CDS 333009..333500 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240872.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(333584..334006) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974973.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene ndk CDS 334285..335346 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992266.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 335405..337303 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252245.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 337397..338323 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391146.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(338363..338812) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974965.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(338820..340313) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240884.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 340575..341759 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531650.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene lptF CDS 341756..342838 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391153.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene lptG CDS 342838..345171 product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252250.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 345346..346248 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327836.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 346300..347331 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327835.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 gene pdxA CDS 347331..348158 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969072.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene rsmA CDS complement(348224..348889) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971396.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene gmk CDS complement(348894..349781) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969071.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(349979..351151) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969070.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene mltG CDS complement(351332..352594) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391159.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene fabF CDS complement(352709..352999) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531676.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(353229..353966) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974944.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene fabG CDS complement(353994..354962) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974943.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 gene fabD CDS 355141..356184 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327827.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(356253..356603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 357067..357522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 357547..357795 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531693.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene rpsR CDS 358007..358981 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327825.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 359003..359590 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531697.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene rplI CDS 359769..361055 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532522.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(361140..361760) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974921.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 361920..363860 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974922.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 364009..365937 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391163.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 366079..366780 product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969055.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 366809..367663 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974925.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene pssA CDS 367907..368362 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969062.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 368443..370017 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969063.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 370022..371059 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969064.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(371106..371846) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240909.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(371859..373367) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314558.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene purF CDS complement(373610..374212) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379721.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(374423..375826) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971380.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene radA CDS complement(375894..377063) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969059.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene alr CDS 377166..377762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(377784..379283) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974934.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(379486..380424) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391171.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene rarD CDS complement(380564..382180) product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391172.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene cimA CDS complement(382272..383231) product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969052.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene pip CDS complement(383228..383713) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969049.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(383710..385143) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532561.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene cysS CDS 385545..385733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS complement(385764..386552) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971366.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 386613..387047 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974911.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 387050..387457 product TIGR02301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327799.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS 387488..387817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969047.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 387834..388604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391177.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 388746..389594 product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971363.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 389591..390226 product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974907.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 390229..390762 product tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379686.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 390759..391733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240927.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(391749..392261) product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129937.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(392347..393252) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391199.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene nadC CDS complement(393361..394959) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391192.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(395122..396201) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974901.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene nadA CDS complement(396366..397583) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969038.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 397790..398782 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968502.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene corA CDS complement(398786..399631) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974899.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS complement(399716..402493) product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974897.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(402593..403342) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014529139.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 gene recO CDS 403553..404287 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526652.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(404315..406627) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391213.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS 406854..407903 product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968871.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 407890..410253 product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968870.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(410269..411213) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240946.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene era CDS complement(411218..411937) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971346.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 gene rnc CDS complement(411934..412704) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527287.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene lepB CDS complement(412777..413175) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971345.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene acpS CDS complement(413172..413741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(413924..414076) product DUF3563 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064506643.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS complement(414246..416468) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527294.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(416574..416981) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527295.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene rpoZ CDS 416907..417197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS 417284..417859 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311253.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 418055..418366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(418418..418897) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969015.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene smpB CDS complement(418900..419784) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391228.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene dapA CDS 420078..422141 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526651.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 422201..423073 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050983961.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(423187..424197) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969013.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 424190..424480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(424660..425007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257548.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(425065..426513) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112356.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 426653..427210 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813206.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 427490..429487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(429499..430236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(430703..432190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(432264..436208) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388260.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(436532..437653) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974700.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene dinB CDS complement(437663..438331) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532730.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(438406..438819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 438706..439254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 439169..440692 product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257431.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 440689..443976 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967470.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS 444301..444972 product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086135.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 445013..445333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS 445598..445813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS 446001..446381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(446398..446697) product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538229.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 447154..447426 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036743091.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 sequence32 source 1..278276 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 155..2767 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968330.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 gene hrpB CDS 2808..4112 product ActS/PrrB/RegB family redox-sensitive histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067479.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 4242..4784 product ActR/PrrA/RegA family redox response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970626.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(4919..5449) product MmcB family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067477.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS 5783..6448 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531973.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(6529..8694) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968325.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(8863..10869) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398133.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS complement(11012..11941) product DUF1402 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067472.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS complement(12138..13445) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330426.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene hslU CDS complement(13561..14127) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709882.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 gene hslV CDS 14304..14897 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390535.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 gene hisB CDS 14916..15392 product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531987.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS 15394..16035 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968319.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 gene hisH CDS 16037..16780 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330420.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 gene hisA CDS 16887..17663 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970619.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene hisF CDS 17675..17998 product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531991.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS 18011..19003 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067462.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene coaA CDS complement(19037..19663) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330416.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(19666..20100) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970617.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 gene arfB CDS complement(20218..21828) product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067458.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 22145..22861 product two-component system response regulator ChvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067457.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene chvI CDS 22970..24763 product two-component system sensor histidine kinase ChvG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210431003.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 gene chvG CDS 24760..25218 product serine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909982.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS 25370..25771 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067454.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS 25789..26061 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844956.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 26193..27593 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330407.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 gene ahcY CDS 27807..30347 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968312.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 30352..31851 product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968311.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS 31937..32671 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067449.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 32674..35850 product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968309.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 gene addB CDS 35843..39397 product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968308.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 gene addA CDS 39513..39833 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311093.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene trxA CDS complement(39892..41235) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968306.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(41253..42158) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536448.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 gene accD CDS complement(42198..43037) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242331.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene trpA CDS complement(43039..44259) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536446.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 gene trpB CDS complement(44256..44930) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330397.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 45060..45257 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566084.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(45291..46052) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968304.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(46228..46662) product DUF2852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067439.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(46791..48080) product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536442.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene phaZ CDS complement(48272..49243) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390501.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS complement(49288..50841) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067433.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS complement(50921..51910) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968299.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(52085..52531) product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061563.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(52559..53572) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968298.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS 53687..54565 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330385.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(54589..55386) product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251843.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene hpaI CDS complement(55454..56908) product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067427.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 gene gabD CDS 57094..57687 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398204.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(58003..60438) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390482.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene gyrB CDS complement(60573..60953) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531717.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(60950..61519) product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242350.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(61506..62624) product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398216.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(62639..63343) product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067421.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS 63506..63961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS 64084..64572 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330375.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene secB CDS complement(64684..65388) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398703.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene dnaQ CDS complement(65388..65978) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067417.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 gene coaE CDS complement(65975..66835) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968287.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(66828..67427) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508611.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(67454..68266) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067414.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS 68752..69714 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398694.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene hemE CDS 69711..70253 product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311068.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 gene hemJ CDS 70494..71759 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970587.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene rho CDS 71895..73226 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970586.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 gene mnmE CDS 73293..75182 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972598.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 gene mnmG CDS 75179..75814 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970584.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene rsmG CDS 75830..76624 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330364.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS 76649..77539 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330363.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(77656..78696) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310932.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene holA CDS complement(78704..79228) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398682.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene lptE CDS complement(79215..81890) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970579.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene leuS CDS 82037..82696 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970578.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS complement(82890..83588) product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531751.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 83826..85778 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067399.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 gene acs CDS 85935..87407 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS 87404..88246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973986.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS complement(88266..89246) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS complement(89243..90082) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529656.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(90082..91158) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529657.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS complement(91199..91990) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816321.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(92014..92907) product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095821.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene mak CDS complement(92996..93724) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530726.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS complement(94185..95318) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530260.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(95507..96391) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530264.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 96818..98233 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066912.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS 98354..99232 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972367.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS 99232..100068 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404217.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS 100072..100296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS 100322..101365 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975043.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 101377..102441 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976185.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 gene ugpC CDS 102469..103194 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434102.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS 103483..104892 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393760.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene leuC CDS 105092..106477 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097587317.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(106617..108227) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970573.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene purH CDS complement(108340..110022) product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242378.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(110149..111549) product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970575.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(111546..112508) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876568.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 gene htpX CDS 112645..112842 product DUF1674 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876566.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS complement(112945..117714) product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970571.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 118018..118893 product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563606.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene pdxY CDS 118987..119628 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242643.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(119810..120589) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970568.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 120540..120716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(120796..121830) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531790.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(122109..122810) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992354.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(122925..124037) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067383.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene leuB CDS complement(124241..124846) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242478.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene leuD CDS complement(125004..125246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067235.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS 125352..126263 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970474.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS 126260..126466 product DUF1737 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393782.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS complement(126630..127064) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310993.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS complement(127360..127704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 127682..128167 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531268.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene bfr CDS complement(128284..128826) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330099.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(128836..130032) product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970468.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(130115..131452) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067224.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS complement(131442..132887) product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067223.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS complement(133013..133594) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972484.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene thpR CDS complement(133682..134326) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067280.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 134325..135095 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330154.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS 135092..137644 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252344.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 137800..138543 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508710.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 138724..139491 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014529968.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS 139613..140818 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535755.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 140966..142219 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067340.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene ispG CDS complement(142300..143355) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390315.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene hisC CDS complement(143360..144277) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970531.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 144413..145159 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067328.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene mtgA CDS 145367..145552 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067326.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 gene rpmF CDS 145716..146120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529226.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(146135..146716) product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065997962.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 gene phaR CDS 146986..148167 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067324.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS 148253..148978 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709750.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS 149034..149342 product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709729.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS 149433..149822 product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970500.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS 150155..150658 product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529690.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS 150901..152139 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970499.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene rlmN CDS 152233..153186 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529687.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 153307..154188 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970498.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 154185..154979 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529683.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS complement(154986..155627) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252343.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS 155801..157024 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330161.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS complement(157098..158315) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393947.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(158312..158917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS 158979..159620 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508644.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS 159775..159939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS complement(160056..161153) product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061326.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS 161542..163602 product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970561.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS 163800..165626 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330113.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene typA CDS 165830..166336 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330114.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 166495..167028 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310823.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene ppa CDS complement(167033..167314) product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242528.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(167356..167649) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531184.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(167865..168581) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970397.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(168584..169072) product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330119.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(169103..170716) product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330120.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(170730..171956) product COG4223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310857.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(172033..172779) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970393.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(172782..173711) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972466.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 gene hemC CDS 173785..174879 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393860.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 gene tsaD CDS 174876..175862 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330125.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS 175883..176176 product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067173.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 176182..176613 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972462.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS 176620..177267 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508815.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(177283..177741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 178042..178434 product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330061.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 gene sdhC CDS 178448..178828 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531168.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene sdhD CDS 178836..180677 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067167.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene sdhA CDS 180696..181475 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531162.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 181621..182142 product protease inhibitor Inh/omp19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037456298.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 182179..183375 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310852.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 gene zapE CDS 183537..184499 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393726.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene mdh CDS 184527..185723 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530260.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene sucC CDS 185726..186628 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530262.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene sucD CDS 186774..189770 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970380.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS 189878..191101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35020 note possible pseudo, internal stop codon, frameshifted CDS 191248..191709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS 191829..192581 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393736.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS 192606..194012 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970376.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 gene lpdA CDS 194150..194698 product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330046.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS complement(194676..195908) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393706.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(195932..196867) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162145490.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS 197077..199293 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067138.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS 199363..199746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530294.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS 199979..200539 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330038.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS 200539..202068 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530298.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene atpA CDS 202187..203068 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389782.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS 203095..204621 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067133.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene atpD CDS 204738..205151 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242660.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 205348..206775 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655408.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS complement(206788..207420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS complement(207615..208457) product DUF6030 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067129.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 208615..209394 product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066727.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(209417..210847) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329335.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS complement(210995..211756) product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878846.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 gene cobM CDS complement(211825..213072) product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526984.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 213065..213835 product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531081.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(213799..214563) product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394055.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS complement(214560..215291) product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528814.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(215288..215920) product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067032.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS complement(215917..217173) product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243256.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 gene cobG CDS complement(217236..218018) product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528807.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 gene cobF CDS complement(218150..218905) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327554.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS 218855..219040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS 219077..220273 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392692.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS complement(220340..221623) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972400.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(221759..222652) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330312.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS 222824..224221 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242408.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 224233..225648 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970546.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS 225671..227194 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242406.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 227201..228433 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330316.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS complement(228694..229794) product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970366.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 229873..230343 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242567.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS complement(230405..230821) product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394735.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(230818..231675) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394733.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(231691..231948) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173827777.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 gene grxC CDS complement(231986..232603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS 232853..233722 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066732.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS complement(233740..233907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS complement(233950..234267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329520.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(234364..234786) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709175.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 gene mutT CDS complement(234783..235541) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394699.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS complement(235581..236825) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240078.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 gene argJ CDS complement(236914..237813) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066738.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS 238049..240739 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533499.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 gene secA CDS 240909..242303 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533497.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS 242300..243574 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329526.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(243589..245247) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329527.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS complement(245309..246004) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969985.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS 246137..247486 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969984.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS 247486..248793 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066638.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS complement(248845..249729) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243246.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 gene purU CDS complement(250058..251368) product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086758.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS complement(251505..252731) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975201.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS complement(252822..253871) product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971173.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS complement(253882..254748) product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537156.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene cysW CDS complement(254738..255601) product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530875.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 gene cysT CDS complement(255606..256631) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310267.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS complement(257016..257558) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242502.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS complement(257777..258046) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709652.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 gene rpmA CDS complement(258074..258445) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067213.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene rplU CDS complement(258458..260473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35680 tRNA 258764..258853 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS complement(260470..260859) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051076796.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS complement(260880..261194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 261655..263802 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538222.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 263795..265639 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476430.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS complement(266199..266420) product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS complement(266423..267550) product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS complement(267547..268545) product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368416.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene trbG CDS complement(268542..269231) product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 gene trbF CDS complement(269228..270613) product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368414.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene trbL CDS complement(270616..270882) product putative entry exclusion protein TrbK-alt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368413.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene trbK-alt CDS complement(270896..271672) product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 gene trbJ CDS complement(271669..274161) product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene trbE CDS complement(274172..274453) product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368410.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS complement(274453..274785) product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388565.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS complement(274782..275765) product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 gene trbB CDS 276228..276752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS complement(276770..277237) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538234.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 misc_feature complement(277248..>278276) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368406.1:conjugal transfer protein TraG locus_tag LOCUS_35860 sequence33 source 1..190160 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 442..1131 product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 gene trbF CDS 1128..2129 product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368416.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 gene trbG CDS 2126..3262 product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS 3265..3486 product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS 3622..3939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS 3936..4289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 4286..4684 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051076796.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 4681..6339 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286106.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 tRNA complement(6310..6386) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 7113..7733 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036411.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 7726..8820 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026970.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS 8817..9800 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388682.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS complement(9874..10239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS complement(10428..11420) product DUF4424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967721.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS complement(11591..12403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS complement(12682..13563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972623.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS complement(13560..13838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS complement(13839..15455) product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225537.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS 15733..16086 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(16147..16845) product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973824.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(16842..17276) product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973823.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(17303..19807) product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973822.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 gene napA CDS complement(19782..20069) product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327937.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(20062..20601) product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973820.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 gene napF CDS complement(20573..20764) product periplasmic nitrate reductase, NapE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967656.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 gene napE CDS complement(21027..21941) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327933.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(22075..23217) product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327932.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 gene nirK CDS 23431..24645 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327931.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS 24791..26143 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967669.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 gene hemN CDS complement(26211..28109) product nitric oxide reductase activation protein NorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973799.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS complement(28117..28929) product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327924.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS complement(28994..30340) product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327923.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(30365..30817) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707559.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS complement(30950..31225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS complement(31233..31790) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391050.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS 31892..32047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003504656.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS 32059..32520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS complement(32530..33465) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080854800.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS complement(33589..34566) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970977.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS complement(34557..35066) product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327916.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS 35175..36686 product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434506.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS 36683..37306 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967676.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS complement(37287..38684) product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528935.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS complement(38694..39107) product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066973.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(39104..40252) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970249.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(40335..40559) product aa3-type cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066975.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(40789..41541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329825.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(41720..44029) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329826.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 44482..45261 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970251.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS complement(45291..45698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(45783..46748) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329828.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS complement(46774..47802) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389389.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS complement(47852..48400) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528917.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS 48505..49296 product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970254.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 49416..50528 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243306.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS 50528..51517 product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970256.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS complement(51621..51920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS 52169..53341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS complement(53424..54017) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970258.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS complement(54103..55236) product ornithine/lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970259.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 gene odc2 CDS 55316..55564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS 55781..56686 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389413.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 56786..57415 product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394164.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 57409..58386 product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970261.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS complement(58390..58629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973903.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS complement(58626..59318) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329843.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS complement(59427..60119) product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329844.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS complement(60237..60875) product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066994.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS 61027..61512 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970265.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 61567..62508 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153436966.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS complement(62526..63518) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972890.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(63628..65040) product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191255.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 gene otsA CDS complement(65281..66027) product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096047.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 gene otsB CDS complement(66172..66714) product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329815.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS complement(66707..69700) product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329816.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS complement(69697..70053) product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709402.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(70101..71354) product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003522141.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS 71690..71917 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313768.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 gene rpsU CDS 72058..72945 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844854.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS complement(73010..74641) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339545.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS complement(74707..75435) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565148.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(75461..76714) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140281.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS complement(76711..77532) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339543.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(77600..78646) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723135.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS 78927..79946 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339542.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(80103..80348) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976084.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 gene rpsU CDS complement(80923..81102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS complement(81205..83040) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972891.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 83418..84929 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398036.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 gene glpD CDS 84968..86041 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970354.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS 86051..87121 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242578.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS 87124..87990 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067118.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS 88001..88819 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970356.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 88819..89238 product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067120.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS 89312..91033 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530325.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS complement(91092..91424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS complement(91421..91942) product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532429.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS complement(92025..92717) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532428.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS complement(92836..93129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS complement(93126..93593) product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812026.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS complement(93590..94375) product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329369.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS complement(94392..94601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS complement(94598..95476) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329370.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene ccoP CDS complement(95480..95650) product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329371.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS complement(95660..96388) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970725.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 gene ccoO CDS complement(96391..98055) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394259.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene ccoN CDS complement(98073..98606) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 gene nsrR CDS 98668..99276 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 gene can CDS 99551..101365 product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 101376..103106 product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470366.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 gene cysI CDS complement(103196..103510) product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968075.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS complement(103533..104546) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968074.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS complement(104705..105655) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097615290.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS 105962..106906 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389119.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 106984..108483 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389118.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS 108473..109438 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389117.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS 109473..111239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(111267..112223) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389120.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(112345..113049) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121399.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(113178..113507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS 113725..114744 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391989.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS 114814..115137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS 115642..116025 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536742.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS complement(116134..116301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 116442..118715 product regulatory protein NosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967621.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 118740..120653 product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967622.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 gene nosZ CDS 120778..122088 product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967623.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS 122085..122999 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967624.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS 122996..123826 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083150.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 123823..124362 product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967626.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 124383..125387 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967627.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS 125471..126163 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391034.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS 126263..126706 product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399366.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 126737..127966 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970958.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS complement(127978..128514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS 129102..129767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 129950..130660 product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722382.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS 130657..131673 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045229668.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 131676..132482 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(132534..133448) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967104.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS complement(133466..134416) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967105.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS complement(134413..135360) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967106.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS complement(135357..136811) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493299.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS complement(136981..137997) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970202.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS 138268..139515 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970203.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS 139512..140237 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967110.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS complement(140345..141157) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085602.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS complement(141172..141945) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066563356.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS complement(141956..142774) product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS complement(142771..143886) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089439.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS complement(143924..145258) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967935.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS complement(145268..146323) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140266.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 146500..147231 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244084.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 147573..148586 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141728.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS 148583..150097 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114470298.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS 150097..151053 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521577.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS 151097..152077 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223730.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS 152178..153938 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS 153940..156027 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491196.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(156071..156643) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532242.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS 156861..157640 product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206670.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS complement(157713..158165) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391497.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 gene cueR CDS 158478..160985 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450289.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS complement(161086..161961) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482132.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 162150..164369 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974567.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS complement(164346..165083) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537652.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(165134..166165) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974571.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(166167..167147) product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974570.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS complement(167144..167947) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926652.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS complement(167944..168879) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015613.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS 168969..169967 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066664.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(170233..170790) product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529619.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS complement(170787..171638) product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384111.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS complement(171643..172386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS complement(172412..174094) product SbmA/BacA-like family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384110.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS complement(174167..176488) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537673.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS 176860..178611 product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836187.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS complement(178714..180882) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966626.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS complement(180924..181310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS complement(181427..182110) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707254.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(182103..182636) product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089811.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 gene hutX CDS complement(182666..184024) product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175593.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 gene hutW CDS 184659..187538 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224745.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS 187564..188691 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224744.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS complement(189227..189709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS complement(189684..189911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37710 sequence34 source 1..177665 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1604..2014 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067629.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS 2011..2985 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398721.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 gene nudC CDS complement(2990..3226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS complement(3301..4152) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533422.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS complement(4167..4922) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968437.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 5045..5914 product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241721.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS complement(5986..6930) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067623.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS 7388..12841 product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391582.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS 12853..14937 product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600459.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 gene pbpC CDS complement(14962..16116) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172901056.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS 16448..18109 product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538124.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 gene cydD CDS 18106..19869 product amino acid ABC transporter ATP-binding/permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973555.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS 19860..21443 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973556.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS 21449..22603 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973557.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 gene cydB CDS 22698..22841 product cytochrome bd-I oxidase subunit CydX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313811.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 gene cydX CDS complement(22901..23365) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332654.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS 23493..24626 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332653.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene alr CDS 24607..25914 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168297224.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS 26003..26380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37900 note possible pseudo, frameshifted CDS 26377..26763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37910 note possible pseudo, frameshifted CDS complement(26782..28524) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047161.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(28528..30045) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143698.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS complement(30297..31220) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254790.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS 31326..32441 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494136.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS complement(32465..33112) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531468.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS 33208..34059 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082145856.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 34104..35354 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844963.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 gene metB CDS complement(35397..35954) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972312.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS 36035..37027 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061907.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene galE CDS complement(37040..37339) product chorismate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968657.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS complement(37320..37502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS complement(37604..38773) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378411.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS complement(38775..39593) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391951.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS complement(39590..40321) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391953.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS complement(40391..41173) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968662.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS complement(41200..41973) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327243.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS 42185..43063 product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS 43099..43722 product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974388.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS 43753..44943 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241432.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS 44940..46547 product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968665.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(46604..47035) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974377.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 gene mscL CDS complement(47165..47590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974374.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS 47695..48042 product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391961.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS 48039..49127 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968651.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS 49261..49491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS 49616..49750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS complement(49747..51105) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026613309.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS complement(51102..51608) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327229.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS complement(51611..51877) product DUF6460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974369.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS 52111..53019 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327227.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(53052..53504) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313306.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS complement(53532..54044) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530125.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS 54157..56688 product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530127.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS 56688..57413 product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252590.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 gene pdeM CDS complement(57480..57821) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968462.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 gene rnk CDS complement(58249..59046) product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968644.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS complement(59043..59936) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530135.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS complement(60293..64030) product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391934.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(64203..64517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS 64484..66280 product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391933.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS 66366..67574 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530141.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 67588..69795 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968640.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS complement(69832..70887) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971982.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS complement(70888..71334) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566213.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS complement(71331..72827) product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316406.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(72956..73633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38370 note possible pseudo, internal stop codon CDS complement(73637..73885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38380 note possible pseudo, internal stop codon CDS 74110..74775 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970929.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(74788..75588) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086017673.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS 75759..77729 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992212.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS complement(77782..78471) product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687047.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(78477..78680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS complement(79222..79812) product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780921.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 gene grxB CDS complement(79946..80740) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082773.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS complement(80751..80906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS 81011..81907 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388220.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 tRNA complement(82095..82168) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(82246..83358) product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530160.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS 83555..84739 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241461.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS 84862..85254 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530166.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 gene apaG CDS complement(85381..86379) product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974341.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS complement(86565..87476) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970889.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene argF CDS complement(87549..88742) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974339.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS 89167..89694 product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530176.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS complement(89867..90550) product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706736.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene phoB CDS complement(90565..91290) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378325.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene phoU CDS complement(91337..92152) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706734.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene pstB CDS complement(92166..93494) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970885.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene pstA CDS complement(93491..94975) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970884.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene pstC CDS complement(95089..96123) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968633.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS complement(96313..97605) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968632.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene phoR CDS 97765..98646 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974330.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 gene ppk2 CDS complement(98650..99714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974329.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS 100101..101069 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974328.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 tRNA 101184..101259 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(101371..102558) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532277.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS 102851..104563 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968608.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS 104663..106288 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252578.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 gene pgi CDS complement(106410..107339) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310651.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS complement(107406..108104) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968605.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS complement(108263..108691) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974312.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS complement(108859..109893) product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391825.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS complement(110057..111313) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240214.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS complement(111451..112182) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401907.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS complement(112209..113198) product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397815.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 gene yjfF CDS complement(113195..114250) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242089.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS complement(114247..115794) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397820.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS complement(115902..116864) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975870.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS 117200..118894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS 118891..119904 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969657.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS complement(119977..120873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS complement(121100..121795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS complement(121934..122989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS complement(123069..123860) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS complement(123870..124673) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061494.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 gene cysQ CDS complement(124675..126576) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503688.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 gene cysN CDS complement(126576..127475) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532711.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 gene cysD CDS complement(128001..128942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS 129468..129905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS 129902..131185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 131208..131732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS 131729..131959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS 131956..133362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS 133646..134188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 134181..134747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS 134751..137159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS complement(137166..137495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS complement(138207..138530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(138527..138874) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS complement(139480..140034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS complement(140122..140874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS complement(140871..141209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS 141421..142017 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074921927.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS 142543..143064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS 143391..143708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS 143857..144201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS 144198..145775 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286106.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS 145858..147063 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973356.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS 147329..147514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS 147615..147929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS 147926..148846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 148843..150324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS 150321..150800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS 150882..151574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS complement(151987..152907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS complement(152959..153399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS complement(153390..153629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS 153753..154121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39170 tRNA complement(154565..154641) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(154772..156193) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968584.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS complement(156443..158344) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968581.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS 158824..159216 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391814.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 gene rnpA CDS 159216..161015 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174839374.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 gene yidC CDS 161173..161826 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252558.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 gene yihA CDS complement(161845..162549) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327108.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS 162730..163617 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974289.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 gene argB CDS complement(163633..164535) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327102.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 164634..165329 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327101.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 165469..166176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS complement(166235..167137) product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974284.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS 167306..168166 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391809.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 gene dapD CDS 168172..168576 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391807.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS 168655..169848 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391801.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 gene dapE CDS 169835..170434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527641.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS complement(170488..171231) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391799.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 gene truA CDS complement(171231..172175) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974269.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 gene fmt CDS complement(172222..172746) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974268.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 gene def CDS 172981..174183 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391792.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS 174227..175126 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970844.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 sequence35 source 1..176271 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(28..1683) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209489743.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS complement(1703..1894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS 2196..2495 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068504438.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS 2499..3002 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002730154.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS 3202..3948 product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368621.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 4269..5624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS 5621..7462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS 7459..9624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS 9621..10061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS 10278..11204 product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394832.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS complement(11221..11649) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS 11766..12161 product mercuric transport protein MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294663.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS 12183..12479 product mercury resistance system periplasmic binding protein MerP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735441.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 gene merP CDS 12481..12729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS 12876..15029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS 15014..16423 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163428.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS 16701..16883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS 16880..17251 product DUF2958 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368622.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS 17251..18045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS 18137..20254 product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368623.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS 20353..20829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974883.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS 20901..21227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS 21227..21520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368624.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS 21956..22120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368625.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS 22296..22664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS 22795..23352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368626.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS 23422..23838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368627.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS 23831..24475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368628.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS 24636..28985 product strawberry notch family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368629.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS 28985..30028 product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368630.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS 30366..31301 product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082895.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS 31463..31879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037275398.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS 32584..32985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 33472..33846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 34300..34548 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970293.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS 34647..34922 product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084140443.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS 35276..35806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS 35947..36228 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036743091.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS 36248..37423 product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490269.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS 37420..38073 product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 gene parA CDS 38070..38813 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188032.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS 38810..39064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368642.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS 39061..39546 product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082880.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS 39543..40085 product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368397.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS 40153..40488 product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082878.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS 40491..41255 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368399.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS 41484..43253 product VirD2 family relaxase/mobilization nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057741414.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS 43279..45264 product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018269525.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS 45269..45694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974253.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS 45767..46048 product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970463.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS 46045..47361 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS 47343..47807 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173513765.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS 48205..49203 product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 gene trbB CDS 49200..49529 product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388565.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS 49529..49810 product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368410.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS 49821..52331 product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 gene trbE CDS 52328..53110 product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 gene trbJ CDS 53128..53415 product putative entry exclusion protein TrbK-alt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368413.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 gene trbK-alt CDS 53418..54773 product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368414.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 gene trbL CDS 54770..55459 product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 gene trbF CDS 55456..56484 product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368416.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 gene trbG CDS 56481..57608 product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS 57611..57850 product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS complement(57843..58460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS complement(58869..59288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS complement(59632..60120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS complement(60134..60622) product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197050165.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS complement(60673..63078) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS complement(63177..64148) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036459.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS complement(64206..65714) product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028720319.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS complement(65789..66181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS 66264..66725 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339163.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS complement(66816..67040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS complement(67043..67558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS complement(67579..68493) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613682.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS complement(68609..68872) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889331.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS complement(68927..71377) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931165.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS 71648..71842 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383180.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS 71857..72261 product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974606.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS complement(72278..72541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS 72726..73001 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083527.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS 73020..73784 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967150.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS 73797..74294 product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167528164.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS 74635..75102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS complement(75526..75738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS 76082..76414 product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327826.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS 76454..76939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS 77556..77975 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085868.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 gene arsC CDS 77972..78697 product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969023.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 gene arsH CDS 78717..80021 product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113751.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS 81554..82030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS 82027..82575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS 82572..83120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS complement(83107..84411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS 84754..84951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS complement(84919..85131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS 85555..86847 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972753.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS 86969..87808 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972754.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS 87819..88715 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972755.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS 88728..89846 product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972756.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 CDS 89874..90797 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257308.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS 90863..91873 product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977362.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS complement(92027..93310) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086030.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS complement(93313..94068) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206437.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS 94569..94814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS 95290..95448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS complement(95568..95873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40440 CDS 96035..96985 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331304.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS 97258..98355 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327741.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS 98369..99298 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529592.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS 99325..100233 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327085.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS complement(100179..100562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS 100536..100745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS 100862..101161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS complement(101224..101580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS 101710..102438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS 102626..102790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS complement(103346..106768) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033458904.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 CDS 107089..107832 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039245.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS 107832..108533 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086814.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS 108556..110469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS 110512..111750 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813762.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS 111883..112593 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929797.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS 112611..112745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS 112759..114477 product aconitase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114962.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS complement(114602..114853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS 114992..116041 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809579.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS 116049..116831 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS 116836..117654 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895300.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS 117671..118642 product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038953.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS complement(118603..118842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS 118741..119520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS 119531..120277 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412971.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS complement(120304..121218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS complement(121664..122383) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244148.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS 122584..123417 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401376.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS 123492..124259 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401373.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS 124270..124938 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401371.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS 124949..125614 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401368.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS 125624..126502 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401366.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 gene dapA CDS 126535..127767 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401363.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS 127790..129259 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401360.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS 129244..130287 product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401358.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS 130284..131036 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401354.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS 131041..131793 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401353.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS complement(132264..133049) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067339.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS complement(133099..134049) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067338.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS complement(134071..135540) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067337.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS complement(135620..136576) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067336.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS complement(136576..137385) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310901.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS 137592..138566 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067334.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS 138691..139623 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067333.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS 139653..141140 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067332.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS 141155..141943 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067331.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS 142242..142865 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314017.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 gene ribB CDS 143198..144205 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969276.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS 144422..145513 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528694.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS 145576..146535 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527033.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS 146548..148050 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967750.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS 148053..148997 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967749.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS 149036..149800 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970020.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS 149894..150664 product galactitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972809.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS 150928..151899 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257467.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS 151896..153164 product D-tagatose-bisphosphate aldolase, class II, non-catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972812.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS complement(153231..154016) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393072.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS complement(154013..155041) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968074.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS 155359..156369 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970573.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS 156666..157667 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013332.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS 157848..158795 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311331.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS 158821..159774 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976172.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS 159771..160613 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193469.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS complement(160698..161990) product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550878.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS complement(162016..162480) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 CDS complement(162496..163263) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228477.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS complement(163286..163939) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385744.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS complement(163944..164606) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723203.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS complement(164666..165487) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967260.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS 165661..166449 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975583.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS 166510..167454 product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530436.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS complement(167505..168419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41170 CDS complement(168460..169215) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066671.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS complement(169193..169690) product 2,4'-dihydroxyacetophenone dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066672.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS complement(169746..170453) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484679.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS 170730..171509 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067189.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS 171578..172246 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527987.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS 172281..173054 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137994.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS 173086..174258 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391942.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS 174770..176194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41250 sequence36 source 1..172032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..912 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_184144746.1:electron transfer flavoprotein-ubiquinone oxidoreductase locus_tag LOCUS_41260 CDS complement(1406..2728) product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976222.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS complement(3004..3900) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976224.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 gene purU CDS complement(3922..4800) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976225.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 gene folD CDS complement(4948..6225) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976226.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS 6362..7300 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976227.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS 7594..8625 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976228.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS 8695..9906 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976229.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS 9903..11033 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976230.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS 11030..11821 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976231.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS complement(11847..12857) product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704302.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS complement(12951..13436) product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392232.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS complement(13451..14869) product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975644.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 gene puuE CDS 15032..15400 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975645.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 gene uraH CDS 15404..16885 product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528241.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 gene xdhA CDS 16889..19246 product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528240.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 gene xdhB CDS 19304..20143 product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391572.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 gene xdhC CDS complement(20189..21133) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975651.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS 21271..22512 product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061555.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS 22509..23837 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242239.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 gene guaD CDS complement(23822..24655) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976206.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS 24855..26639 product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969935.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 gene gcl CDS 26660..27475 product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976204.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 gene hyi CDS 27481..28365 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969937.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 CDS complement(28311..28532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS 28522..29790 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244121.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS complement(29919..30578) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331493.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 CDS complement(30845..31456) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974304.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 CDS 31694..32560 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203387.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS complement(32582..35026) product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972413.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 CDS complement(35037..36005) product DUF1839 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196302.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS complement(36008..36922) product amino acid--[acyl-carrier-protein] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080728814.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS complement(36927..38099) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972410.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS complement(38096..38350) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003504852.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 CDS 38744..40726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41600 CDS 40737..41972 product polysaccharide biosynthesis protein GumE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275331.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS complement(41985..43022) product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035286.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 CDS complement(43066..44262) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037589.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS complement(44490..47441) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398238.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 gene polA CDS 47925..48296 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398241.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS 48374..49765 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968407.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS 49892..50839 product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531919.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS 50940..51374 product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969615.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS 51544..53763 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241759.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS 54035..55954 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241760.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 gene dnaK CDS 56215..57339 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309945.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 gene dnaJ CDS complement(57426..58046) product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968472.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS complement(58162..58974) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330712.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS 59183..59746 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909774.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 gene infC CDS 59968..60177 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493355.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 gene rpmI CDS 60209..60610 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710091.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 gene rplT CDS 60700..61572 product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970767.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS 61565..62650 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435478.1 transl_table 11 codon_start 1 locus_tag LOCUS_41780 gene pheS CDS 62672..65098 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968474.1 transl_table 11 codon_start 1 locus_tag LOCUS_41790 gene pheT CDS complement(65191..66141) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397288.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS 66307..67293 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435452.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS complement(67299..68321) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS 68404..70230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS 70296..71876 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968483.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 gene xseA CDS complement(71890..72684) product pyrroline-5-carboxylate reductase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384670.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS complement(72675..73928) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397312.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS complement(74011..74484) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241641.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 gene ybaK CDS complement(74497..74841) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067705.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS complement(74889..76058) product tyrosine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968491.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 gene tatA CDS 76233..77087 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969139.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS complement(77059..78516) product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972356.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS 78712..79272 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243584.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS complement(79434..80726) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527246.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS complement(80955..81413) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532225.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS complement(81744..82487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41950 tRNA complement(82830..82914) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(82993..84420) product polysaccharide biosynthesis phosphomannomutase UppO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972275.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 gene uppO CDS 84550..84936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS complement(84976..85275) product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067663.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS 85441..85890 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067664.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS complement(85905..86297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS 86581..87345 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525643.1 transl_table 11 codon_start 1 locus_tag LOCUS_42010 CDS complement(87359..88411) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391836.1 transl_table 11 codon_start 1 locus_tag LOCUS_42020 gene pyrC CDS 88539..89267 product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530344.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS 89511..90257 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533645.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 CDS complement(90304..92136) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970755.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 gene lepA CDS complement(92195..93448) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241670.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS 93647..94672 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398799.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS 94734..95669 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974609.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS 95750..96412 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435511.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS complement(96442..97263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 CDS 97395..98378 product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968471.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 CDS complement(98403..99077) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529016.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS 99249..100373 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234781892.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 gene recF CDS 100370..101146 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970639.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS complement(101193..102197) product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968405.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS 102382..102921 product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014529993.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 CDS complement(102967..104001) product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390685.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS complement(104083..104652) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968469.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 gene efp CDS 104817..105881 product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330707.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 gene epmA CDS 105878..106927 product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968467.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS complement(106991..108973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42210 CDS 108857..109102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS 109187..109912 product sulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533444.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 CDS complement(109902..110669) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255051.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 gene nth CDS 110692..111192 product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398290.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS 111285..112157 product bifunctional helix-turn-helix domain-containing protein/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067575.1 transl_table 11 codon_start 1 locus_tag LOCUS_42260 CDS complement(112281..112916) product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531941.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 CDS complement(112939..113742) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398299.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 gene dapB CDS complement(113778..115571) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398302.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS complement(115689..116714) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067571.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS complement(116772..117152) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067570.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS complement(117290..118354) product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968392.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 gene mepA CDS 118580..120397 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531957.1 transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS 120582..121658 product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330521.1 transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS 121658..122797 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067566.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS 122794..124434 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968391.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS 124444..125403 product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968390.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 CDS complement(125412..126266) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968389.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 CDS complement(126276..126623) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014766585.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 CDS complement(126687..128081) product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067561.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 CDS 128213..129022 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067560.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 CDS complement(129092..130075) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968386.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS complement(130088..131098) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968385.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS complement(131118..132596) product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398328.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS complement(132641..133924) product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398331.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS complement(133989..134705) product CpaD family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311311.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS complement(134718..136265) product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968381.1 transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS complement(136278..137087) product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968380.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 gene cpaB CDS complement(137262..137774) product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255090.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 CDS complement(137867..138055) product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209602232.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 CDS 138380..138793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS 138909..139520 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398349.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 CDS 139520..140101 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255094.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 CDS 140208..141437 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968375.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 CDS 141543..142172 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173511417.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 gene upp CDS 142295..142831 product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309957.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS complement(142821..144149) product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968373.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 gene deoA CDS complement(144319..145122) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398371.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 CDS complement(145119..145511) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970669.1 transl_table 11 codon_start 1 locus_tag LOCUS_42590 CDS complement(145513..146493) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255101.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS complement(146490..147623) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968370.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 CDS complement(147620..149155) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968369.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS 149315..149536 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970665.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 CDS complement(149599..150591) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067618.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS complement(150821..151471) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330579.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 gene msrA CDS complement(151509..151829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330580.1 transl_table 11 codon_start 1 locus_tag LOCUS_42660 tRNA 152058..152147 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 152742..155000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS complement(155054..155443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42680 CDS complement(155440..155976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS complement(156778..159273) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280508.1 transl_table 11 codon_start 1 locus_tag LOCUS_42700 CDS complement(159650..160663) product class 1 integron integrase IntI1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845048.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 gene intI1 CDS 160821..161600 product ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206317.1 transl_table 11 codon_start 1 locus_tag LOCUS_42720 gene aadA1 CDS 161764..162111 product quaternary ammonium compound efflux SMR transporter QacE delta 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679427.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS 162105..162944 product sulfonamide-resistant dihydropteroate synthase Sul1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259031.1 transl_table 11 codon_start 1 locus_tag LOCUS_42740 gene sul1 CDS 163072..163572 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886834.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS complement(163555..163932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42760 CDS 164274..165407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS complement(165404..167044) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963679.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS complement(167041..167232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS 167630..168160 product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946710.1 transl_table 11 codon_start 1 locus_tag LOCUS_42800 CDS 168359..168574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42810 CDS 168621..169139 product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538228.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS 169377..169925 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 CDS complement(169939..170241) product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538229.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 CDS 170143..170367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS 170687..170956 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036743091.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 sequence37 source 1..163602 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 88..633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS 662..985 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067631.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS 1075..1680 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533410.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 gene recR CDS 1788..2939 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067634.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS complement(2993..4621) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982187.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS 4853..5464 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534362.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 gene rimP CDS 5594..7195 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241711.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 gene nusA CDS 7212..7868 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067638.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS 7970..10570 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968445.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 gene infB CDS 10643..11053 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330664.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 gene rbfA CDS 11066..12001 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067641.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 gene truB CDS 12115..13863 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202402528.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS 14066..14335 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067643.1 transl_table 11 codon_start 1 locus_tag LOCUS_42990 gene rpsO CDS 14645..16789 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398735.1 transl_table 11 codon_start 1 locus_tag LOCUS_43000 gene pnp CDS 16870..17886 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067645.1 transl_table 11 codon_start 1 locus_tag LOCUS_43010 CDS 17979..18206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43020 CDS complement(18319..19125) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067646.1 transl_table 11 codon_start 1 locus_tag LOCUS_43030 gene fabI CDS complement(19131..20354) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534376.1 transl_table 11 codon_start 1 locus_tag LOCUS_43040 gene fabB CDS complement(20408..20923) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309974.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 gene fabA CDS 21239..21661 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037377824.1 transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS complement(21666..22301) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330674.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 CDS 22439..22912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972625.1 transl_table 11 codon_start 1 locus_tag LOCUS_43080 CDS complement(23009..23803) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330675.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 tRNA complement(23939..24014) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(24158..24550) product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534381.1 transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS 24828..26183 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968452.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 gene aroA CDS 26180..26812 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973565.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 gene cmk CDS 26929..28635 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067656.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 gene rpsA CDS complement(28713..30209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS 30544..31926 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038543.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 CDS 32030..32371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534402.1 transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS complement(32385..33620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973568.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 CDS complement(33701..34339) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398756.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS 34456..34770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS 34958..35998 product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968456.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 CDS complement(36056..36310) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014761069.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 CDS complement(36427..37716) product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327306.1 transl_table 11 codon_start 1 locus_tag LOCUS_43220 gene rhaI CDS complement(37729..39822) product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327307.1 transl_table 11 codon_start 1 locus_tag LOCUS_43230 CDS 40022..40834 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378547.1 transl_table 11 codon_start 1 locus_tag LOCUS_43240 CDS 40870..41859 product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004436001.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 gene rhaS CDS 42037..43539 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968715.1 transl_table 11 codon_start 1 locus_tag LOCUS_43260 CDS 43536..44522 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241393.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 CDS 44515..45549 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968717.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 CDS 45560..45874 product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529957.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 gene rhaM CDS complement(45959..46111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS 46485..48056 product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392008.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS 48104..48403 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974443.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 CDS 48400..48765 product chemotaxis response regulator CheY1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493773.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 gene cheY1 CDS 48782..51061 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392010.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 CDS 51064..51528 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529946.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 CDS 51525..52433 product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529944.1 transl_table 11 codon_start 1 locus_tag LOCUS_43360 gene cheR CDS 52430..53488 product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970952.1 transl_table 11 codon_start 1 locus_tag LOCUS_43370 gene cheB CDS 53488..53877 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706841.1 transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS 53874..54428 product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392015.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 gene cheD CDS 54512..54904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392016.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS 55179..56864 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968722.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 gene fliF CDS 57413..58156 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968723.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 CDS 58156..58911 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392020.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 CDS complement(58972..59418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968724.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS complement(59423..60502) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968725.1 transl_table 11 codon_start 1 locus_tag LOCUS_43450 gene flhB CDS complement(60618..61655) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327328.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 gene fliG CDS complement(61794..62393) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311129.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 gene fliN CDS complement(62456..63400) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968727.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS complement(63404..64279) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378598.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 gene motA CDS 64463..65242 product DUF1217 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327332.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 CDS 65244..65969 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968729.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 gene flgF CDS 65976..67388 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968730.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 gene fliI CDS 67393..67950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529906.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 CDS 68124..68504 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529904.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 gene flgB CDS 68508..68927 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529902.1 transl_table 11 codon_start 1 locus_tag LOCUS_43550 gene flgC CDS 68924..69250 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974467.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 CDS 69260..70042 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974468.1 transl_table 11 codon_start 1 locus_tag LOCUS_43570 gene flgG CDS 70129..70599 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445553.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 gene flgA CDS 70596..71711 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529892.1 transl_table 11 codon_start 1 locus_tag LOCUS_43590 CDS 71708..72250 product MotE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327341.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 CDS 72247..72957 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529888.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 gene flgH CDS 72992..73483 product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241361.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS 73480..74217 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241360.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 gene fliP CDS complement(74316..76238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS 76559..77449 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706867.1 transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS 77607..78683 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970970.1 transl_table 11 codon_start 1 locus_tag LOCUS_43660 CDS 78994..79956 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974478.1 transl_table 11 codon_start 1 locus_tag LOCUS_43670 CDS 80275..80922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968740.1 transl_table 11 codon_start 1 locus_tag LOCUS_43680 CDS 80919..82109 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974481.1 transl_table 11 codon_start 1 locus_tag LOCUS_43690 CDS 82114..83418 product chemotaxis protein MotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974482.1 transl_table 11 codon_start 1 locus_tag LOCUS_43700 gene motC CDS 83415..84800 product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395300.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS 84742..85302 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577480.1 transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS 85584..86258 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395294.1 transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS 86358..87629 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974486.1 transl_table 11 codon_start 1 locus_tag LOCUS_43740 CDS 87673..89118 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968747.1 transl_table 11 codon_start 1 locus_tag LOCUS_43750 gene flgK CDS 89122..90177 product flagellar hook-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241348.1 transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS 90215..90568 product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529863.1 transl_table 11 codon_start 1 locus_tag LOCUS_43770 gene flaF CDS 90565..91011 product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706881.1 transl_table 11 codon_start 1 locus_tag LOCUS_43780 gene flbT CDS 91005..91415 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974491.1 transl_table 11 codon_start 1 locus_tag LOCUS_43790 gene flgD CDS 91422..91688 product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529857.1 transl_table 11 codon_start 1 locus_tag LOCUS_43800 CDS 91805..93892 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974492.1 transl_table 11 codon_start 1 locus_tag LOCUS_43810 gene flhA CDS 93889..94641 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974493.1 transl_table 11 codon_start 1 locus_tag LOCUS_43820 gene fliR CDS 94649..95041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529852.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS 95194..95796 product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974495.1 transl_table 11 codon_start 1 locus_tag LOCUS_43840 CDS 95812..96180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970991.1 transl_table 11 codon_start 1 locus_tag LOCUS_43850 CDS 96177..96689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395279.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 CDS complement(96721..97515) product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530227.1 transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS complement(97961..98134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS 98066..98893 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968754.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 gene folD CDS 99246..100586 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241336.1 transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS 100701..101711 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529835.1 transl_table 11 codon_start 1 locus_tag LOCUS_43910 CDS 101713..102861 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327372.1 transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS complement(102916..104736) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327377.1 transl_table 11 codon_start 1 locus_tag LOCUS_43930 gene edd CDS complement(104873..105571) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527053.1 transl_table 11 codon_start 1 locus_tag LOCUS_43940 gene pgl CDS complement(105581..107053) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327380.1 transl_table 11 codon_start 1 locus_tag LOCUS_43950 gene zwf CDS complement(107150..108433) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327381.1 transl_table 11 codon_start 1 locus_tag LOCUS_43960 CDS complement(108642..110003) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327382.1 transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS 110250..111431 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971006.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 CDS complement(111531..111770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706908.1 transl_table 11 codon_start 1 locus_tag LOCUS_43990 CDS complement(111814..113103) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527089.1 transl_table 11 codon_start 1 locus_tag LOCUS_44000 gene aceA CDS 113344..114759 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395254.1 transl_table 11 codon_start 1 locus_tag LOCUS_44010 CDS 114941..116035 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530248.1 transl_table 11 codon_start 1 locus_tag LOCUS_44020 CDS 116116..117258 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527095.1 transl_table 11 codon_start 1 locus_tag LOCUS_44030 CDS 117263..118174 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395250.1 transl_table 11 codon_start 1 locus_tag LOCUS_44040 CDS 118179..119000 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527099.1 transl_table 11 codon_start 1 locus_tag LOCUS_44050 CDS complement(119013..120842) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974522.1 transl_table 11 codon_start 1 locus_tag LOCUS_44060 CDS 121023..122975 product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968769.1 transl_table 11 codon_start 1 locus_tag LOCUS_44070 CDS complement(123002..124693) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327398.1 transl_table 11 codon_start 1 locus_tag LOCUS_44080 CDS complement(124837..128295) product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395241.1 transl_table 11 codon_start 1 locus_tag LOCUS_44090 CDS 128540..128989 product phasin PhaP1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527110.1 transl_table 11 codon_start 1 locus_tag LOCUS_44100 gene phaP1 tRNA 129139..129215 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS 129799..130620 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530271.1 transl_table 11 codon_start 1 locus_tag LOCUS_44110 CDS 130683..131984 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626135.1 transl_table 11 codon_start 1 locus_tag LOCUS_44120 CDS 132067..132984 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389016.1 transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS 132987..135260 product propanediol/glycerol family dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878616.1 transl_table 11 codon_start 1 locus_tag LOCUS_44140 CDS 135257..135679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44150 CDS 135694..136791 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972908.1 transl_table 11 codon_start 1 locus_tag LOCUS_44160 gene ugpC CDS 136788..137579 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528936.1 transl_table 11 codon_start 1 locus_tag LOCUS_44170 CDS 137616..138764 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140266.1 transl_table 11 codon_start 1 locus_tag LOCUS_44180 CDS 138771..140078 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967935.1 transl_table 11 codon_start 1 locus_tag LOCUS_44190 CDS 140188..140844 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114140.1 transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS 141343..142971 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808649.1 transl_table 11 codon_start 1 locus_tag LOCUS_44210 CDS 142985..143179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44220 CDS 143298..144902 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808651.1 transl_table 11 codon_start 1 locus_tag LOCUS_44230 gene ggt CDS 145043..146152 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010022659.1 transl_table 11 codon_start 1 locus_tag LOCUS_44240 CDS complement(146277..146978) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967141.1 transl_table 11 codon_start 1 locus_tag LOCUS_44250 CDS complement(147354..148235) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974530.1 transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS 148340..149836 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310049.1 transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS 149979..151070 product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395239.1 transl_table 11 codon_start 1 locus_tag LOCUS_44280 CDS 151060..152136 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968777.1 transl_table 11 codon_start 1 locus_tag LOCUS_44290 CDS complement(152198..153244) product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968778.1 transl_table 11 codon_start 1 locus_tag LOCUS_44300 CDS 153456..153953 product iron-responsive transcriptional regulator RirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527122.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 gene rirA CDS complement(154086..154808) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314645.1 transl_table 11 codon_start 1 locus_tag LOCUS_44320 CDS 155195..156790 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974536.1 transl_table 11 codon_start 1 locus_tag LOCUS_44330 CDS 156881..157885 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527127.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 CDS 157895..158785 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378916.1 transl_table 11 codon_start 1 locus_tag LOCUS_44350 CDS 158785..159639 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527131.1 transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS 159636..160493 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527132.1 transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS 160556..160900 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527133.1 transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS complement(160976..161773) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395198.1 transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS 161918..162118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44400 CDS complement(162298..162558) product glycine zipper domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378934.1 transl_table 11 codon_start 1 locus_tag LOCUS_44410 CDS complement(162590..162745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44420 CDS 162927..163133 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974103.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 CDS 163202..163366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44440