>Feature sequence1 95 1312 gene locus_tag LOCUS_00010 95 1312 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289167.1 protein_id gnl|my_center|LOCUS_00010 2978 1509 gene locus_tag LOCUS_00020 2978 1509 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289312.1 protein_id gnl|my_center|LOCUS_00020 3088 3600 gene locus_tag LOCUS_00030 3088 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3668 4090 gene locus_tag LOCUS_00040 3668 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4114 4950 gene locus_tag LOCUS_00050 4114 4950 CDS product HtlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903270.1 protein_id gnl|my_center|LOCUS_00050 5020 6048 gene locus_tag LOCUS_00060 5020 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903271.1 protein_id gnl|my_center|LOCUS_00060 6041 6727 gene locus_tag LOCUS_00070 6041 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6776 7102 gene locus_tag LOCUS_00080 6776 7102 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289371.1 protein_id gnl|my_center|LOCUS_00080 7681 7472 gene locus_tag LOCUS_00090 7681 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8815 7712 gene locus_tag LOCUS_00100 8815 7712 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902258.1 protein_id gnl|my_center|LOCUS_00100 9034 10839 gene locus_tag LOCUS_00110 9034 10839 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_00110 11685 10873 gene locus_tag LOCUS_00120 11685 10873 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 protein_id gnl|my_center|LOCUS_00120 11770 12873 gene locus_tag LOCUS_00130 11770 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13025 13495 gene locus_tag LOCUS_00140 13025 13495 CDS product DUF5802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289390.1 protein_id gnl|my_center|LOCUS_00140 13573 14469 gene locus_tag LOCUS_00150 13573 14469 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289389.1 protein_id gnl|my_center|LOCUS_00150 15686 14457 gene locus_tag LOCUS_00160 15686 14457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15810 16913 gene locus_tag LOCUS_00170 15810 16913 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_00170 16910 17989 gene locus_tag LOCUS_00180 16910 17989 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 protein_id gnl|my_center|LOCUS_00180 18883 18071 gene locus_tag LOCUS_00190 gene nadC 18883 18071 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903380.1 protein_id gnl|my_center|LOCUS_00190 20439 18886 gene locus_tag LOCUS_00200 20439 18886 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903379.1 protein_id gnl|my_center|LOCUS_00200 21577 20453 gene locus_tag LOCUS_00210 gene nadA 21577 20453 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903378.1 protein_id gnl|my_center|LOCUS_00210 23352 21772 gene locus_tag LOCUS_00220 23352 21772 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903377.1 protein_id gnl|my_center|LOCUS_00220 23567 24145 gene locus_tag LOCUS_00230 23567 24145 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403129.1 protein_id gnl|my_center|LOCUS_00230 25153 24209 gene locus_tag LOCUS_00240 25153 24209 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903371.1 protein_id gnl|my_center|LOCUS_00240 26334 25354 gene locus_tag LOCUS_00250 26334 25354 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902144.1 protein_id gnl|my_center|LOCUS_00250 26581 26378 gene locus_tag LOCUS_00260 26581 26378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 26474 27067 gene locus_tag LOCUS_00270 gene rnhA 26474 27067 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902145.1 protein_id gnl|my_center|LOCUS_00270 27057 27692 gene locus_tag LOCUS_00280 27057 27692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902146.1 protein_id gnl|my_center|LOCUS_00280 27785 28318 gene locus_tag LOCUS_00290 27785 28318 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902148.1 protein_id gnl|my_center|LOCUS_00290 28574 28753 gene locus_tag LOCUS_00300 28574 28753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 28859 30220 gene locus_tag LOCUS_00310 28859 30220 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902151.1 protein_id gnl|my_center|LOCUS_00310 30366 30827 gene locus_tag LOCUS_00320 30366 30827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 30824 31285 gene locus_tag LOCUS_00330 30824 31285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 31269 33155 gene locus_tag LOCUS_00340 31269 33155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 33152 34684 gene locus_tag LOCUS_00350 33152 34684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021319.1 protein_id gnl|my_center|LOCUS_00350 34745 36052 gene locus_tag LOCUS_00360 34745 36052 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903314.1 protein_id gnl|my_center|LOCUS_00360 37415 36189 gene locus_tag LOCUS_00370 37415 36189 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903606.1 protein_id gnl|my_center|LOCUS_00370 38249 37479 gene locus_tag LOCUS_00380 38249 37479 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902530.1 protein_id gnl|my_center|LOCUS_00380 38404 39855 gene locus_tag LOCUS_00390 38404 39855 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837937.1 protein_id gnl|my_center|LOCUS_00390 40750 39908 gene locus_tag LOCUS_00400 40750 39908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 40957 40885 gene locus_tag LOCUS_t00010 40957 40885 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 41079 41534 gene locus_tag LOCUS_00410 41079 41534 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289448.1 protein_id gnl|my_center|LOCUS_00410 42514 41585 gene locus_tag LOCUS_00420 42514 41585 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903564.1 protein_id gnl|my_center|LOCUS_00420 43256 42606 gene locus_tag LOCUS_00430 43256 42606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 43994 43302 gene locus_tag LOCUS_00440 gene ribB 43994 43302 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903567.1 protein_id gnl|my_center|LOCUS_00440 44695 43991 gene locus_tag LOCUS_00450 44695 43991 CDS product DUF120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289437.1 protein_id gnl|my_center|LOCUS_00450 44973 45911 gene locus_tag LOCUS_00460 44973 45911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 46960 45953 gene locus_tag LOCUS_00470 gene twy1 46960 45953 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903569.1 protein_id gnl|my_center|LOCUS_00470 47268 47486 gene locus_tag LOCUS_00480 47268 47486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 47684 48052 gene locus_tag LOCUS_00490 47684 48052 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902617.1 protein_id gnl|my_center|LOCUS_00490 48119 50029 gene locus_tag LOCUS_00500 48119 50029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 50617 50060 gene locus_tag LOCUS_00510 50617 50060 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903498.1 protein_id gnl|my_center|LOCUS_00510 50808 52331 gene locus_tag LOCUS_00520 50808 52331 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902613.1 protein_id gnl|my_center|LOCUS_00520 52328 53002 gene locus_tag LOCUS_00530 52328 53002 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902614.1 protein_id gnl|my_center|LOCUS_00530 53086 54234 gene locus_tag LOCUS_00540 53086 54234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 54496 54663 gene locus_tag LOCUS_00550 54496 54663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 54821 55534 gene locus_tag LOCUS_00560 gene psmB 54821 55534 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289244.1 protein_id gnl|my_center|LOCUS_00560 55964 55683 gene locus_tag LOCUS_00570 55964 55683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 56129 56956 gene locus_tag LOCUS_00580 56129 56956 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902621.1 protein_id gnl|my_center|LOCUS_00580 57024 57722 gene locus_tag LOCUS_00590 57024 57722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 58019 57732 gene locus_tag LOCUS_00600 58019 57732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 59184 58069 gene locus_tag LOCUS_00610 59184 58069 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902622.1 protein_id gnl|my_center|LOCUS_00610 61648 59186 gene locus_tag LOCUS_00620 61648 59186 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902623.1 protein_id gnl|my_center|LOCUS_00620 61852 63768 gene locus_tag LOCUS_00630 gene gyrB 61852 63768 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049928262.1 protein_id gnl|my_center|LOCUS_00630 63853 66384 gene locus_tag LOCUS_00640 gene gyrA 63853 66384 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902625.1 protein_id gnl|my_center|LOCUS_00640 66959 66429 gene locus_tag LOCUS_00650 66959 66429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 66922 67608 gene locus_tag LOCUS_00660 66922 67608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 68768 67869 gene locus_tag LOCUS_00670 gene rocF 68768 67869 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808692.1 protein_id gnl|my_center|LOCUS_00670 69753 68836 gene locus_tag LOCUS_00680 69753 68836 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_00680 69872 70405 gene locus_tag LOCUS_00690 69872 70405 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902626.1 protein_id gnl|my_center|LOCUS_00690 70633 71799 gene locus_tag LOCUS_00700 70633 71799 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902627.1 protein_id gnl|my_center|LOCUS_00700 72001 72915 gene locus_tag LOCUS_00710 72001 72915 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403067.1 protein_id gnl|my_center|LOCUS_00710 74813 73116 gene locus_tag LOCUS_00720 gene thsA 74813 73116 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892611.1 protein_id gnl|my_center|LOCUS_00720 75044 76513 gene locus_tag LOCUS_00730 75044 76513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 77135 76530 gene locus_tag LOCUS_00740 77135 76530 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903653.1 protein_id gnl|my_center|LOCUS_00740 77381 77809 gene locus_tag LOCUS_00750 gene lrpA1 77381 77809 CDS product HTH-type transcriptional regulator LrpA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902807.1 protein_id gnl|my_center|LOCUS_00750 78318 78121 gene locus_tag LOCUS_00760 78318 78121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 80161 78650 gene locus_tag LOCUS_00770 gene lcfB 80161 78650 CDS product long-chain-fatty-acid--CoA ligase LcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244686.1 protein_id gnl|my_center|LOCUS_00770 80534 80740 gene locus_tag LOCUS_00780 80534 80740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 82424 80964 gene locus_tag LOCUS_00790 82424 80964 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_00790 83937 82609 gene locus_tag LOCUS_00800 83937 82609 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_00800 85098 84181 gene locus_tag LOCUS_00810 85098 84181 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256055.1 protein_id gnl|my_center|LOCUS_00810 86153 85095 gene locus_tag LOCUS_00820 86153 85095 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_00820 86931 86245 gene locus_tag LOCUS_00830 86931 86245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 87184 87630 gene locus_tag LOCUS_00840 87184 87630 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 protein_id gnl|my_center|LOCUS_00840 87689 88492 gene locus_tag LOCUS_00850 87689 88492 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229423.1 protein_id gnl|my_center|LOCUS_00850 88485 89003 gene locus_tag LOCUS_00860 88485 89003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 89735 89055 gene locus_tag LOCUS_00870 89735 89055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 89882 90460 gene locus_tag LOCUS_00880 89882 90460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 90666 91331 gene locus_tag LOCUS_00890 90666 91331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 95390 91794 gene locus_tag LOCUS_00900 95390 91794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 95874 95533 gene locus_tag LOCUS_00910 95874 95533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 96123 97349 gene locus_tag LOCUS_00920 96123 97349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 97538 98560 gene locus_tag LOCUS_00930 gene ilvA 97538 98560 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583846.1 protein_id gnl|my_center|LOCUS_00930 99275 99667 gene locus_tag LOCUS_00940 99275 99667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 99838 101664 gene locus_tag LOCUS_00950 gene rpoB 99838 101664 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903997.1 protein_id gnl|my_center|LOCUS_00950 101770 102864 gene locus_tag LOCUS_00960 101770 102864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 103017 103688 gene locus_tag LOCUS_00970 103017 103688 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272276.1 protein_id gnl|my_center|LOCUS_00970 103932 104882 gene locus_tag LOCUS_00980 103932 104882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 104879 106570 gene locus_tag LOCUS_00990 104879 106570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 107470 107706 gene locus_tag LOCUS_01000 107470 107706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 108211 108501 gene locus_tag LOCUS_01010 108211 108501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 108494 110101 gene locus_tag LOCUS_01020 108494 110101 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145161935.1 protein_id gnl|my_center|LOCUS_01020 110178 110861 gene locus_tag LOCUS_01030 110178 110861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 110945 112192 gene locus_tag LOCUS_01040 110945 112192 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272198.1 protein_id gnl|my_center|LOCUS_01040 112208 113569 gene locus_tag LOCUS_01050 112208 113569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 113657 114169 gene locus_tag LOCUS_01060 113657 114169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 114153 114923 gene locus_tag LOCUS_01070 114153 114923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01070 116200 115259 gene locus_tag LOCUS_01080 116200 115259 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529747.1 protein_id gnl|my_center|LOCUS_01080 116556 117035 gene locus_tag LOCUS_01090 116556 117035 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902805.1 protein_id gnl|my_center|LOCUS_01090 117089 117625 gene locus_tag LOCUS_01100 117089 117625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 117723 118457 gene locus_tag LOCUS_01110 117723 118457 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903355.1 protein_id gnl|my_center|LOCUS_01110 118621 118827 gene locus_tag LOCUS_01120 118621 118827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 120929 118983 gene locus_tag LOCUS_01130 120929 118983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 120976 121398 gene locus_tag LOCUS_01140 120976 121398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 121529 122041 gene locus_tag LOCUS_01150 121529 122041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 122084 124969 gene locus_tag LOCUS_01160 122084 124969 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902906.1 protein_id gnl|my_center|LOCUS_01160 125522 124998 gene locus_tag LOCUS_01170 125522 124998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 127911 125713 gene locus_tag LOCUS_01180 127911 125713 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903073.1 protein_id gnl|my_center|LOCUS_01180 129360 127951 gene locus_tag LOCUS_01190 129360 127951 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902279.1 protein_id gnl|my_center|LOCUS_01190 129482 129817 gene locus_tag LOCUS_01200 129482 129817 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902280.1 protein_id gnl|my_center|LOCUS_01200 130579 129923 gene locus_tag LOCUS_01210 130579 129923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 132294 130843 gene locus_tag LOCUS_01220 132294 130843 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403933.1 protein_id gnl|my_center|LOCUS_01220 132858 132448 gene locus_tag LOCUS_01230 132858 132448 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876409.1 protein_id gnl|my_center|LOCUS_01230 133432 132869 gene locus_tag LOCUS_01240 133432 132869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 135511 133523 gene locus_tag LOCUS_01250 135511 133523 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902517.1 protein_id gnl|my_center|LOCUS_01250 136848 135508 gene locus_tag LOCUS_01260 136848 135508 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902518.1 protein_id gnl|my_center|LOCUS_01260 140056 137681 gene locus_tag LOCUS_01270 140056 137681 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902519.1 protein_id gnl|my_center|LOCUS_01270 142127 140058 gene locus_tag LOCUS_01280 142127 140058 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902520.1 protein_id gnl|my_center|LOCUS_01280 142614 143030 gene locus_tag LOCUS_01290 142614 143030 CDS product DUF5820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903019.1 protein_id gnl|my_center|LOCUS_01290 144323 143037 gene locus_tag LOCUS_01300 144323 143037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 144403 144852 gene locus_tag LOCUS_01310 144403 144852 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903018.1 protein_id gnl|my_center|LOCUS_01310 145782 144955 gene locus_tag LOCUS_01320 145782 144955 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405419.1 protein_id gnl|my_center|LOCUS_01320 146091 145918 gene locus_tag LOCUS_01330 146091 145918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 147597 146242 gene locus_tag LOCUS_01340 147597 146242 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903110.1 protein_id gnl|my_center|LOCUS_01340 147696 148919 gene locus_tag LOCUS_01350 147696 148919 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903039.1 protein_id gnl|my_center|LOCUS_01350 149187 148930 gene locus_tag LOCUS_01360 149187 148930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903038.1 protein_id gnl|my_center|LOCUS_01360 149981 149256 gene locus_tag LOCUS_01370 149981 149256 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902925.1 protein_id gnl|my_center|LOCUS_01370 153476 150096 gene locus_tag LOCUS_01380 153476 150096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 153985 155244 gene locus_tag LOCUS_01390 gene icd 153985 155244 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903372.1 protein_id gnl|my_center|LOCUS_01390 156687 155962 gene locus_tag LOCUS_01400 156687 155962 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902743.1 protein_id gnl|my_center|LOCUS_01400 157284 156760 gene locus_tag LOCUS_01410 157284 156760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 157381 157833 gene locus_tag LOCUS_01420 157381 157833 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082236.1 protein_id gnl|my_center|LOCUS_01420 157876 158622 gene locus_tag LOCUS_01430 157876 158622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 159234 158875 gene locus_tag LOCUS_01440 159234 158875 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902769.1 protein_id gnl|my_center|LOCUS_01440 160278 159322 gene locus_tag LOCUS_01450 160278 159322 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902523.1 protein_id gnl|my_center|LOCUS_01450 161878 160346 gene locus_tag LOCUS_01460 161878 160346 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902539.1 protein_id gnl|my_center|LOCUS_01460 162146 163243 gene locus_tag LOCUS_01470 162146 163243 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903903.1 protein_id gnl|my_center|LOCUS_01470 163343 163732 gene locus_tag LOCUS_01480 163343 163732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 163939 164406 gene locus_tag LOCUS_01490 163939 164406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 165312 164494 gene locus_tag LOCUS_01500 165312 164494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 166118 165309 gene locus_tag LOCUS_01510 166118 165309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 167026 166115 gene locus_tag LOCUS_01520 167026 166115 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_01520 167232 168377 gene locus_tag LOCUS_01530 167232 168377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 169539 169090 gene locus_tag LOCUS_01540 169539 169090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903315.1 protein_id gnl|my_center|LOCUS_01540 169666 171336 gene locus_tag LOCUS_01550 169666 171336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 172628 171369 gene locus_tag LOCUS_01560 172628 171369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 172711 173028 gene locus_tag LOCUS_01570 172711 173028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 174668 173004 gene locus_tag LOCUS_01580 174668 173004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 175182 174727 gene locus_tag LOCUS_01590 175182 174727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 175415 176068 gene locus_tag LOCUS_01600 175415 176068 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289172.1 protein_id gnl|my_center|LOCUS_01600 176373 177458 gene locus_tag LOCUS_01610 176373 177458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 177487 179103 gene locus_tag LOCUS_01620 177487 179103 CDS product bacterio-opsin activator domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902709.1 protein_id gnl|my_center|LOCUS_01620 179690 179115 gene locus_tag LOCUS_01630 179690 179115 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902509.1 protein_id gnl|my_center|LOCUS_01630 179935 180354 gene locus_tag LOCUS_01640 179935 180354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 180360 180581 gene locus_tag LOCUS_01650 180360 180581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 180726 182573 gene locus_tag LOCUS_01660 180726 182573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 184909 182786 gene locus_tag LOCUS_01670 184909 182786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 187249 185159 gene locus_tag LOCUS_01680 187249 185159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 188225 187374 gene locus_tag LOCUS_01690 188225 187374 CDS product IS5-like element ISH28 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890407.1 protein_id gnl|my_center|LOCUS_01690 188407 188616 gene locus_tag LOCUS_01700 188407 188616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 188993 188784 gene locus_tag LOCUS_01710 188993 188784 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903343.1 protein_id gnl|my_center|LOCUS_01710 189158 189427 gene locus_tag LOCUS_01720 189158 189427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903817.1 protein_id gnl|my_center|LOCUS_01720 189647 190912 gene locus_tag LOCUS_01730 189647 190912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064846.1 protein_id gnl|my_center|LOCUS_01730 191112 192503 gene locus_tag LOCUS_01740 gene truD 191112 192503 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902134.1 protein_id gnl|my_center|LOCUS_01740 192976 192521 gene locus_tag LOCUS_01750 192976 192521 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902004.1 protein_id gnl|my_center|LOCUS_01750 193323 192973 gene locus_tag LOCUS_01760 193323 192973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 193590 194240 gene locus_tag LOCUS_01770 193590 194240 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902133.1 protein_id gnl|my_center|LOCUS_01770 196274 194361 gene locus_tag LOCUS_01780 196274 194361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 196423 198627 gene locus_tag LOCUS_01790 196423 198627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 199644 198835 gene locus_tag LOCUS_01800 199644 198835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 199848 200717 gene locus_tag LOCUS_01810 199848 200717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 200753 201247 gene locus_tag LOCUS_01820 200753 201247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 201277 202092 gene locus_tag LOCUS_01830 201277 202092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 202327 202563 gene locus_tag LOCUS_01840 202327 202563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 202629 202868 gene locus_tag LOCUS_01850 202629 202868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 202865 203137 gene locus_tag LOCUS_01860 202865 203137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 203276 203749 gene locus_tag LOCUS_01870 203276 203749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 203864 204673 gene locus_tag LOCUS_01880 203864 204673 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027790.1 protein_id gnl|my_center|LOCUS_01880 205018 207444 gene locus_tag LOCUS_01890 205018 207444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 207684 209582 gene locus_tag LOCUS_01900 207684 209582 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727588.1 protein_id gnl|my_center|LOCUS_01900 209879 211108 gene locus_tag LOCUS_01910 209879 211108 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 protein_id gnl|my_center|LOCUS_01910 211012 211317 gene locus_tag LOCUS_01920 211012 211317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 211349 212161 gene locus_tag LOCUS_01930 211349 212161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 213157 212225 gene locus_tag LOCUS_01940 213157 212225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 213318 213707 gene locus_tag LOCUS_01950 gene tnpA 213318 213707 CDS product IS200/IS605-like element ISH35 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904062.1 protein_id gnl|my_center|LOCUS_01950 213704 214942 gene locus_tag LOCUS_01960 213704 214942 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289618.1 protein_id gnl|my_center|LOCUS_01960 215299 214994 gene locus_tag LOCUS_01970 215299 214994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 215872 215381 gene locus_tag LOCUS_01980 215872 215381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 217208 215952 gene locus_tag LOCUS_01990 217208 215952 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901978.1 protein_id gnl|my_center|LOCUS_01990 218936 218124 gene locus_tag LOCUS_02000 218936 218124 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904217.1 protein_id gnl|my_center|LOCUS_02000 219712 219077 gene locus_tag LOCUS_02010 219712 219077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 219839 220261 gene locus_tag LOCUS_02020 219839 220261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 221462 220389 gene locus_tag LOCUS_02030 221462 220389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 222330 221848 gene locus_tag LOCUS_02040 222330 221848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904189.1 protein_id gnl|my_center|LOCUS_02040 222921 222334 gene locus_tag LOCUS_02050 222921 222334 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904190.1 protein_id gnl|my_center|LOCUS_02050 226628 223080 gene locus_tag LOCUS_02060 226628 223080 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904032.1 protein_id gnl|my_center|LOCUS_02060 227254 227757 gene locus_tag LOCUS_02070 227254 227757 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176765249.1 protein_id gnl|my_center|LOCUS_02070 228269 227787 gene locus_tag LOCUS_02080 228269 227787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 228806 229717 gene locus_tag LOCUS_02090 228806 229717 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904220.1 protein_id gnl|my_center|LOCUS_02090 230352 229939 gene locus_tag LOCUS_02100 230352 229939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 230603 231553 gene locus_tag LOCUS_02110 230603 231553 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289741.1 protein_id gnl|my_center|LOCUS_02110 231550 232422 gene locus_tag LOCUS_02120 231550 232422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 232710 233636 gene locus_tag LOCUS_02130 232710 233636 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904212.1 protein_id gnl|my_center|LOCUS_02130 234234 235373 gene locus_tag LOCUS_02140 234234 235373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 235521 236186 gene locus_tag LOCUS_02150 235521 236186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 236646 236885 gene locus_tag LOCUS_02160 236646 236885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 237097 238173 gene locus_tag LOCUS_02170 237097 238173 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081422761.1 protein_id gnl|my_center|LOCUS_02170 238405 238833 gene locus_tag LOCUS_02180 238405 238833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 239871 238861 gene locus_tag LOCUS_02190 239871 238861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 240061 240519 gene locus_tag LOCUS_02200 240061 240519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 240507 242240 gene locus_tag LOCUS_02210 240507 242240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 242291 243085 gene locus_tag LOCUS_02220 242291 243085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 243201 244655 gene locus_tag LOCUS_02230 243201 244655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 244667 245692 gene locus_tag LOCUS_02240 244667 245692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 245689 247740 gene locus_tag LOCUS_02250 245689 247740 CDS product VirB4 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289607.1 protein_id gnl|my_center|LOCUS_02250 247733 248911 gene locus_tag LOCUS_02260 247733 248911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 249683 249339 gene locus_tag LOCUS_02270 249683 249339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 249903 249766 gene locus_tag LOCUS_02280 249903 249766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 249958 251193 gene locus_tag LOCUS_02290 249958 251193 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901980.1 protein_id gnl|my_center|LOCUS_02290 251350 251787 gene locus_tag LOCUS_02300 251350 251787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904174.1 protein_id gnl|my_center|LOCUS_02300 251918 252163 gene locus_tag LOCUS_02310 251918 252163 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771148.1 protein_id gnl|my_center|LOCUS_02310 252153 252503 gene locus_tag LOCUS_02320 252153 252503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 253202 252804 gene locus_tag LOCUS_02330 253202 252804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 253938 253303 gene locus_tag LOCUS_02340 253938 253303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 253834 254451 gene locus_tag LOCUS_02350 253834 254451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02350 254409 254603 gene locus_tag LOCUS_02360 254409 254603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02360 254824 256728 gene locus_tag LOCUS_02370 254824 256728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 256777 257430 gene locus_tag LOCUS_02380 256777 257430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 259341 258406 gene locus_tag LOCUS_02390 259341 258406 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_02390 260255 259617 gene locus_tag LOCUS_02400 260255 259617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 263363 261831 gene locus_tag LOCUS_02410 263363 261831 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250770.1 protein_id gnl|my_center|LOCUS_02410 263908 264987 gene locus_tag LOCUS_02420 263908 264987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 266255 265065 gene locus_tag LOCUS_02430 266255 265065 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901986.1 protein_id gnl|my_center|LOCUS_02430 267289 266699 gene locus_tag LOCUS_02440 267289 266699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02440 268903 269274 gene locus_tag LOCUS_02450 268903 269274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 269945 269466 gene locus_tag LOCUS_02460 269945 269466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 271256 270093 gene locus_tag LOCUS_02470 271256 270093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 272533 271256 gene locus_tag LOCUS_02480 272533 271256 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_02480 272666 273805 gene locus_tag LOCUS_02490 272666 273805 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250684.1 protein_id gnl|my_center|LOCUS_02490 274055 274258 gene locus_tag LOCUS_02500 274055 274258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 274255 274863 gene locus_tag LOCUS_02510 274255 274863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 275524 274868 gene locus_tag LOCUS_02520 275524 274868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 276128 277207 gene locus_tag LOCUS_02530 276128 277207 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902703.1 protein_id gnl|my_center|LOCUS_02530 278612 277599 gene locus_tag LOCUS_02540 278612 277599 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902703.1 protein_id gnl|my_center|LOCUS_02540 279974 278826 gene locus_tag LOCUS_02550 279974 278826 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_02550 282159 281047 gene locus_tag LOCUS_02560 282159 281047 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_02560 282462 282854 gene locus_tag LOCUS_02570 gene tnpA 282462 282854 CDS product IS200/IS605-like element ISH1-8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901979.1 protein_id gnl|my_center|LOCUS_02570 282856 284112 gene locus_tag LOCUS_02580 282856 284112 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901980.1 protein_id gnl|my_center|LOCUS_02580 284546 288310 gene locus_tag LOCUS_02590 284546 288310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 290525 288357 gene locus_tag LOCUS_02600 290525 288357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 290658 292214 gene locus_tag LOCUS_02610 290658 292214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 292211 292603 gene locus_tag LOCUS_02620 292211 292603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 292814 292605 gene locus_tag LOCUS_02630 292814 292605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 293308 292940 gene locus_tag LOCUS_02640 293308 292940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 293870 293403 gene locus_tag LOCUS_02650 293870 293403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 294147 293863 gene locus_tag LOCUS_02660 294147 293863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 294304 295278 gene locus_tag LOCUS_02670 294304 295278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 296480 295464 gene locus_tag LOCUS_02680 296480 295464 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419775.1 protein_id gnl|my_center|LOCUS_02680 297564 296473 gene locus_tag LOCUS_02690 297564 296473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 297843 297565 gene locus_tag LOCUS_02700 297843 297565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 298098 299696 gene locus_tag LOCUS_02710 298098 299696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251151.1 protein_id gnl|my_center|LOCUS_02710 299752 300315 gene locus_tag LOCUS_02720 299752 300315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 300471 301028 gene locus_tag LOCUS_02730 300471 301028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904216.1 protein_id gnl|my_center|LOCUS_02730 302385 301117 gene locus_tag LOCUS_02740 302385 301117 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901978.1 protein_id gnl|my_center|LOCUS_02740 302692 302910 gene locus_tag LOCUS_02750 302692 302910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 303657 302965 gene locus_tag LOCUS_02760 303657 302965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776543.1 protein_id gnl|my_center|LOCUS_02760 305473 303740 gene locus_tag LOCUS_02770 305473 303740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 308492 305466 gene locus_tag LOCUS_02780 308492 305466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 308650 308489 gene locus_tag LOCUS_02790 308650 308489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 309924 308647 gene locus_tag LOCUS_02800 309924 308647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 311195 309921 gene locus_tag LOCUS_02810 311195 309921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 311940 311188 gene locus_tag LOCUS_02820 311940 311188 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 protein_id gnl|my_center|LOCUS_02820 315466 312029 gene locus_tag LOCUS_02830 315466 312029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 315629 316840 gene locus_tag LOCUS_02840 315629 316840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 317264 317545 gene locus_tag LOCUS_02850 317264 317545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 317547 317993 gene locus_tag LOCUS_02860 317547 317993 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_02860 318118 319788 gene locus_tag LOCUS_02870 318118 319788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 320040 319816 gene locus_tag LOCUS_02880 320040 319816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 321041 320127 gene locus_tag LOCUS_02890 321041 320127 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228277.1 protein_id gnl|my_center|LOCUS_02890 321168 322682 gene locus_tag LOCUS_02900 321168 322682 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903457.1 protein_id gnl|my_center|LOCUS_02900 322716 323396 gene locus_tag LOCUS_02910 gene rnhB 322716 323396 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903458.1 protein_id gnl|my_center|LOCUS_02910 323462 323641 gene locus_tag LOCUS_02920 323462 323641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 324003 323707 gene locus_tag LOCUS_02930 324003 323707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 324183 325376 gene locus_tag LOCUS_02940 324183 325376 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901948.1 protein_id gnl|my_center|LOCUS_02940 325376 327253 gene locus_tag LOCUS_02950 gene glmS 325376 327253 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901947.1 protein_id gnl|my_center|LOCUS_02950 327451 327972 gene locus_tag LOCUS_02960 327451 327972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 327974 328414 gene locus_tag LOCUS_02970 327974 328414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 328460 329395 gene locus_tag LOCUS_02980 328460 329395 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613588.1 protein_id gnl|my_center|LOCUS_02980 329504 330088 gene locus_tag LOCUS_02990 329504 330088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 330174 331163 gene locus_tag LOCUS_03000 330174 331163 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257986.1 protein_id gnl|my_center|LOCUS_03000 331760 331173 gene locus_tag LOCUS_03010 331760 331173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 331786 332961 gene locus_tag LOCUS_03020 331786 332961 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226810.1 protein_id gnl|my_center|LOCUS_03020 333056 334132 gene locus_tag LOCUS_03030 333056 334132 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257908.1 protein_id gnl|my_center|LOCUS_03030 334129 334641 gene locus_tag LOCUS_03040 334129 334641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 334638 335735 gene locus_tag LOCUS_03050 334638 335735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 335817 337676 gene locus_tag LOCUS_03060 335817 337676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 338656 337742 gene locus_tag LOCUS_03070 gene rfbB 338656 337742 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_03070 338709 339587 gene locus_tag LOCUS_03080 gene rfbD 338709 339587 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_03080 339791 339609 gene locus_tag LOCUS_03090 339791 339609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 340868 339795 gene locus_tag LOCUS_03100 340868 339795 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_03100 341329 340865 gene locus_tag LOCUS_03110 341329 340865 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877830.1 protein_id gnl|my_center|LOCUS_03110 341500 343290 gene locus_tag LOCUS_03120 341500 343290 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928959.1 protein_id gnl|my_center|LOCUS_03120 343730 344590 gene locus_tag LOCUS_03130 343730 344590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 345222 346274 gene locus_tag LOCUS_03140 345222 346274 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926811.1 protein_id gnl|my_center|LOCUS_03140 346274 347026 gene locus_tag LOCUS_03150 346274 347026 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902759.1 protein_id gnl|my_center|LOCUS_03150 347391 347771 gene locus_tag LOCUS_03160 347391 347771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 347768 348880 gene locus_tag LOCUS_03170 347768 348880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 348949 350805 gene locus_tag LOCUS_03180 gene asnB 348949 350805 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_03180 350837 351658 gene locus_tag LOCUS_03190 350837 351658 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 protein_id gnl|my_center|LOCUS_03190 352783 351674 gene locus_tag LOCUS_03200 352783 351674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 352884 354803 gene locus_tag LOCUS_03210 gene asnB 352884 354803 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_03210 354859 356064 gene locus_tag LOCUS_03220 354859 356064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 357379 356105 gene locus_tag LOCUS_03230 357379 356105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 357798 357475 gene locus_tag LOCUS_03240 357798 357475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 358906 357809 gene locus_tag LOCUS_03250 358906 357809 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289085.1 protein_id gnl|my_center|LOCUS_03250 360383 358968 gene locus_tag LOCUS_03260 360383 358968 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901950.1 protein_id gnl|my_center|LOCUS_03260 361639 360542 gene locus_tag LOCUS_03270 361639 360542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 361913 362956 gene locus_tag LOCUS_03280 361913 362956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 364046 363060 gene locus_tag LOCUS_03290 364046 363060 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901996.1 protein_id gnl|my_center|LOCUS_03290 364850 364089 gene locus_tag LOCUS_03300 gene aglF 364850 364089 CDS product UTP--glucose-1-phosphate uridylyltransferase AglF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901983.1 protein_id gnl|my_center|LOCUS_03300 365577 364990 gene locus_tag LOCUS_03310 365577 364990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 365696 365971 gene locus_tag LOCUS_03320 365696 365971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 366065 367135 gene locus_tag LOCUS_03330 366065 367135 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905888.1 protein_id gnl|my_center|LOCUS_03330 367189 367419 gene locus_tag LOCUS_03340 367189 367419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 367897 367442 gene locus_tag LOCUS_03350 367897 367442 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903023.1 protein_id gnl|my_center|LOCUS_03350 368881 367952 gene locus_tag LOCUS_03360 gene draG 368881 367952 CDS product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943427.1 protein_id gnl|my_center|LOCUS_03360 369139 368945 gene locus_tag LOCUS_03370 369139 368945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 369228 369458 gene locus_tag LOCUS_03380 369228 369458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 369535 369945 gene locus_tag LOCUS_03390 369535 369945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 369999 370175 gene locus_tag LOCUS_03400 369999 370175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 370240 370569 gene locus_tag LOCUS_03410 370240 370569 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903863.1 protein_id gnl|my_center|LOCUS_03410 370937 371809 gene locus_tag LOCUS_03420 370937 371809 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_03420 371812 373485 gene locus_tag LOCUS_03430 371812 373485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 373478 375160 gene locus_tag LOCUS_03440 373478 375160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 375167 375565 gene locus_tag LOCUS_03450 375167 375565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 375747 377159 gene locus_tag LOCUS_03460 375747 377159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 377284 378036 gene locus_tag LOCUS_03470 377284 378036 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902086.1 protein_id gnl|my_center|LOCUS_03470 378179 379534 gene locus_tag LOCUS_03480 378179 379534 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289493.1 protein_id gnl|my_center|LOCUS_03480 379663 380670 gene locus_tag LOCUS_03490 379663 380670 CDS product PGF-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903207.1 protein_id gnl|my_center|LOCUS_03490 380667 381059 gene locus_tag LOCUS_03500 380667 381059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 381101 382021 gene locus_tag LOCUS_03510 381101 382021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 382385 383362 gene locus_tag LOCUS_03520 382385 383362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903193.1 protein_id gnl|my_center|LOCUS_03520 383809 383396 gene locus_tag LOCUS_03530 383809 383396 CDS product DUF5830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903194.1 protein_id gnl|my_center|LOCUS_03530 383957 385513 gene locus_tag LOCUS_03540 383957 385513 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742208.1 protein_id gnl|my_center|LOCUS_03540 385513 385827 gene locus_tag LOCUS_03550 385513 385827 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_03550 385827 386144 gene locus_tag LOCUS_03560 385827 386144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 386389 387048 gene locus_tag LOCUS_03570 386389 387048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 387296 389797 gene locus_tag LOCUS_03580 387296 389797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 390018 390674 gene locus_tag LOCUS_03590 390018 390674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 391277 390930 gene locus_tag LOCUS_03600 391277 390930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 391251 391496 gene locus_tag LOCUS_03610 391251 391496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 394847 391695 gene locus_tag LOCUS_03620 394847 391695 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903197.1 protein_id gnl|my_center|LOCUS_03620 395141 395437 gene locus_tag LOCUS_03630 395141 395437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 395491 396168 gene locus_tag LOCUS_03640 gene phoU 395491 396168 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892486.1 protein_id gnl|my_center|LOCUS_03640 396950 396270 gene locus_tag LOCUS_03650 396950 396270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 397096 397725 gene locus_tag LOCUS_03660 397096 397725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 397893 398180 gene locus_tag LOCUS_03670 397893 398180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 398290 398769 gene locus_tag LOCUS_03680 398290 398769 CDS product DUF5799 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902746.1 protein_id gnl|my_center|LOCUS_03680 399779 398799 gene locus_tag LOCUS_03690 gene leuB 399779 398799 CDS product bifunctional 3-isopropylmalate/3-methylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870225.1 protein_id gnl|my_center|LOCUS_03690 399888 400637 gene locus_tag LOCUS_03700 399888 400637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 401297 400671 gene locus_tag LOCUS_03710 gene leuD 401297 400671 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404878.1 protein_id gnl|my_center|LOCUS_03710 402715 401294 gene locus_tag LOCUS_03720 gene leuC 402715 401294 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404876.1 protein_id gnl|my_center|LOCUS_03720 403034 402717 gene locus_tag LOCUS_03730 403034 402717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 404108 403041 gene locus_tag LOCUS_03740 gene ilvC 404108 403041 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392863.1 protein_id gnl|my_center|LOCUS_03740 405007 404105 gene locus_tag LOCUS_03750 405007 404105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 406785 405004 gene locus_tag LOCUS_03760 406785 405004 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_03760 408288 407224 gene locus_tag LOCUS_03770 408288 407224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 408838 409293 gene locus_tag LOCUS_03780 408838 409293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 409376 409696 gene locus_tag LOCUS_03790 409376 409696 CDS product DUF5779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902748.1 protein_id gnl|my_center|LOCUS_03790 410752 409784 gene locus_tag LOCUS_03800 410752 409784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 411371 410832 gene locus_tag LOCUS_03810 411371 410832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 412107 411415 gene locus_tag LOCUS_03820 412107 411415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 412241 412927 gene locus_tag LOCUS_03830 412241 412927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902751.1 protein_id gnl|my_center|LOCUS_03830 412997 413458 gene locus_tag LOCUS_03840 412997 413458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903839.1 protein_id gnl|my_center|LOCUS_03840 413676 413467 gene locus_tag LOCUS_03850 413676 413467 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240443.1 protein_id gnl|my_center|LOCUS_03850 414078 413752 gene locus_tag LOCUS_03860 414078 413752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 414197 415600 gene locus_tag LOCUS_03870 414197 415600 CDS product phosphopentomutase/phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902636.1 protein_id gnl|my_center|LOCUS_03870 416267 416980 gene locus_tag LOCUS_03880 416267 416980 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902630.1 protein_id gnl|my_center|LOCUS_03880 417113 418180 gene locus_tag LOCUS_03890 417113 418180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 418538 418230 gene locus_tag LOCUS_03900 418538 418230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 419551 418661 gene locus_tag LOCUS_03910 419551 418661 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902245.1 protein_id gnl|my_center|LOCUS_03910 419920 420393 gene locus_tag LOCUS_03920 419920 420393 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902246.1 protein_id gnl|my_center|LOCUS_03920 420831 420406 gene locus_tag LOCUS_03930 420831 420406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 420951 421823 gene locus_tag LOCUS_03940 420951 421823 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902247.1 protein_id gnl|my_center|LOCUS_03940 422274 421825 gene locus_tag LOCUS_03950 422274 421825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 423022 422279 gene locus_tag LOCUS_03960 423022 422279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 423565 423110 gene locus_tag LOCUS_03970 423565 423110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 424409 423636 gene locus_tag LOCUS_03980 424409 423636 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289189.1 protein_id gnl|my_center|LOCUS_03980 424544 425719 gene locus_tag LOCUS_03990 424544 425719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 425778 426122 gene locus_tag LOCUS_04000 425778 426122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 426430 426152 gene locus_tag LOCUS_04010 426430 426152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 428521 426839 gene locus_tag LOCUS_04020 428521 426839 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986975.1 protein_id gnl|my_center|LOCUS_04020 429603 428536 gene locus_tag LOCUS_04030 429603 428536 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870578.1 protein_id gnl|my_center|LOCUS_04030 430393 429638 gene locus_tag LOCUS_04040 430393 429638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 432003 430444 gene locus_tag LOCUS_04050 432003 430444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 433028 432000 gene locus_tag LOCUS_04060 433028 432000 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062389568.1 protein_id gnl|my_center|LOCUS_04060 433180 433989 gene locus_tag LOCUS_04070 433180 433989 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088738.1 protein_id gnl|my_center|LOCUS_04070 433986 434798 gene locus_tag LOCUS_04080 433986 434798 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289160.1 protein_id gnl|my_center|LOCUS_04080 436005 434809 gene locus_tag LOCUS_04090 436005 434809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 437685 436372 gene locus_tag LOCUS_04100 437685 436372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 437828 438130 gene locus_tag LOCUS_04110 437828 438130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 439114 438152 gene locus_tag LOCUS_04120 439114 438152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 439816 439202 gene locus_tag LOCUS_04130 gene trpG 439816 439202 CDS product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903199.1 protein_id gnl|my_center|LOCUS_04130 441531 439813 gene locus_tag LOCUS_04140 gene trpE 441531 439813 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903200.1 protein_id gnl|my_center|LOCUS_04140 442208 441528 gene locus_tag LOCUS_04150 442208 441528 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903201.1 protein_id gnl|my_center|LOCUS_04150 443208 442210 gene locus_tag LOCUS_04160 gene trpD 443208 442210 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903202.1 protein_id gnl|my_center|LOCUS_04160 444983 443364 gene locus_tag LOCUS_04170 444983 443364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 446914 445148 gene locus_tag LOCUS_04180 446914 445148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 447193 447268 gene locus_tag LOCUS_t00020 447193 447268 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 447453 447683 gene locus_tag LOCUS_04190 447453 447683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 447683 448126 gene locus_tag LOCUS_04200 447683 448126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 448123 448473 gene locus_tag LOCUS_04210 448123 448473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 448463 448819 gene locus_tag LOCUS_04220 448463 448819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 448819 449334 gene locus_tag LOCUS_04230 448819 449334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 449335 450612 gene locus_tag LOCUS_04240 449335 450612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 450738 452477 gene locus_tag LOCUS_04250 450738 452477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 452858 453241 gene locus_tag LOCUS_04260 452858 453241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 453410 453276 gene locus_tag LOCUS_04270 453410 453276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 453625 453407 gene locus_tag LOCUS_04280 453625 453407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 456144 453622 gene locus_tag LOCUS_04290 456144 453622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 456160 456393 gene locus_tag LOCUS_04300 456160 456393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 456412 456684 gene locus_tag LOCUS_04310 456412 456684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 457030 456773 gene locus_tag LOCUS_04320 457030 456773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 457541 457086 gene locus_tag LOCUS_04330 457541 457086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 458929 457538 gene locus_tag LOCUS_04340 458929 457538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 459783 458932 gene locus_tag LOCUS_04350 459783 458932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 461828 459780 gene locus_tag LOCUS_04360 461828 459780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 462721 461825 gene locus_tag LOCUS_04370 462721 461825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 463448 462714 gene locus_tag LOCUS_04380 463448 462714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 463956 463663 gene locus_tag LOCUS_04390 463956 463663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 464535 463984 gene locus_tag LOCUS_04400 464535 463984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 464920 464528 gene locus_tag LOCUS_04410 464920 464528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 465469 464996 gene locus_tag LOCUS_04420 465469 464996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 467041 465473 gene locus_tag LOCUS_04430 467041 465473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 467220 467038 gene locus_tag LOCUS_04440 467220 467038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 467449 467760 gene locus_tag LOCUS_04450 467449 467760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 468014 468457 gene locus_tag LOCUS_04460 468014 468457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 469484 468606 gene locus_tag LOCUS_04470 469484 468606 CDS product IS5-like element ISH28 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890407.1 protein_id gnl|my_center|LOCUS_04470 470151 469543 gene locus_tag LOCUS_04480 470151 469543 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890465.1 protein_id gnl|my_center|LOCUS_04480 470351 470833 gene locus_tag LOCUS_04490 470351 470833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 472044 470836 gene locus_tag LOCUS_04500 472044 470836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 472293 472045 gene locus_tag LOCUS_04510 472293 472045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 473036 472767 gene locus_tag LOCUS_04520 473036 472767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 473050 474057 gene locus_tag LOCUS_04530 473050 474057 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289552.1 protein_id gnl|my_center|LOCUS_04530 474100 474957 gene locus_tag LOCUS_04540 474100 474957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059055354.1 protein_id gnl|my_center|LOCUS_04540 475727 476227 gene locus_tag LOCUS_04550 475727 476227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 476266 476841 gene locus_tag LOCUS_04560 476266 476841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 477246 477109 gene locus_tag LOCUS_04570 477246 477109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 477577 477392 gene locus_tag LOCUS_04580 477577 477392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 478001 477798 gene locus_tag LOCUS_04590 478001 477798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 478126 477998 gene locus_tag LOCUS_04600 478126 477998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 478389 478123 gene locus_tag LOCUS_04610 478389 478123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 478924 478523 gene locus_tag LOCUS_04620 478924 478523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 479183 479440 gene locus_tag LOCUS_04630 479183 479440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 479437 480363 gene locus_tag LOCUS_04640 479437 480363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 480641 480372 gene locus_tag LOCUS_04650 480641 480372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 481134 480694 gene locus_tag LOCUS_04660 481134 480694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 481330 481557 gene locus_tag LOCUS_04670 481330 481557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 481670 482338 gene locus_tag LOCUS_04680 481670 482338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 482335 482922 gene locus_tag LOCUS_04690 482335 482922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 482919 483953 gene locus_tag LOCUS_04700 482919 483953 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902703.1 protein_id gnl|my_center|LOCUS_04700 484727 485869 gene locus_tag LOCUS_04710 484727 485869 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903212.1 protein_id gnl|my_center|LOCUS_04710 487353 486625 gene locus_tag LOCUS_04720 gene radB 487353 486625 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903214.1 protein_id gnl|my_center|LOCUS_04720 488890 487436 gene locus_tag LOCUS_04730 488890 487436 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_04730 489464 489024 gene locus_tag LOCUS_04740 489464 489024 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903884.1 protein_id gnl|my_center|LOCUS_04740 489579 490112 gene locus_tag LOCUS_04750 489579 490112 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902023.1 protein_id gnl|my_center|LOCUS_04750 490519 490277 gene locus_tag LOCUS_04760 490519 490277 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903468.1 protein_id gnl|my_center|LOCUS_04760 490670 491221 gene locus_tag LOCUS_04770 490670 491221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 491330 493150 gene locus_tag LOCUS_04780 gene infB 491330 493150 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903469.1 protein_id gnl|my_center|LOCUS_04780 493789 493439 gene locus_tag LOCUS_04790 493789 493439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 493995 493810 gene locus_tag LOCUS_04800 493995 493810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 494964 494179 gene locus_tag LOCUS_04810 494964 494179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 495114 495407 gene locus_tag LOCUS_04820 495114 495407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 495814 495425 gene locus_tag LOCUS_04830 495814 495425 CDS product DUF5811 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903470.1 protein_id gnl|my_center|LOCUS_04830 496344 495829 gene locus_tag LOCUS_04840 496344 495829 CDS product pyruvoyl-dependent arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903471.1 protein_id gnl|my_center|LOCUS_04840 498376 496484 gene locus_tag LOCUS_04850 498376 496484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 498986 498588 gene locus_tag LOCUS_04860 498986 498588 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902168.1 protein_id gnl|my_center|LOCUS_04860 500001 499216 gene locus_tag LOCUS_04870 500001 499216 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902169.1 protein_id gnl|my_center|LOCUS_04870 500597 501031 gene locus_tag LOCUS_04880 500597 501031 CDS product NOB1 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289414.1 protein_id gnl|my_center|LOCUS_04880 503356 501107 gene locus_tag LOCUS_04890 503356 501107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 504582 503464 gene locus_tag LOCUS_04900 504582 503464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 505595 504843 gene locus_tag LOCUS_04910 505595 504843 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902216.1 protein_id gnl|my_center|LOCUS_04910 506988 505678 gene locus_tag LOCUS_04920 506988 505678 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903465.1 protein_id gnl|my_center|LOCUS_04920 507092 508234 gene locus_tag LOCUS_04930 507092 508234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 508760 508299 gene locus_tag LOCUS_04940 508760 508299 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903479.1 protein_id gnl|my_center|LOCUS_04940 509928 508843 gene locus_tag LOCUS_04950 509928 508843 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902103.1 protein_id gnl|my_center|LOCUS_04950 510068 510895 gene locus_tag LOCUS_04960 510068 510895 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902223.1 protein_id gnl|my_center|LOCUS_04960 512540 511458 gene locus_tag LOCUS_04970 512540 511458 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903425.1 protein_id gnl|my_center|LOCUS_04970 512940 512623 gene locus_tag LOCUS_04980 512940 512623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 513339 515282 gene locus_tag LOCUS_04990 513339 515282 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227739.1 protein_id gnl|my_center|LOCUS_04990 517017 515515 gene locus_tag LOCUS_05000 gene gpmI 517017 515515 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903383.1 protein_id gnl|my_center|LOCUS_05000 517522 517905 gene locus_tag LOCUS_05010 517522 517905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 517912 518574 gene locus_tag LOCUS_05020 517912 518574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 519208 518576 gene locus_tag LOCUS_05030 519208 518576 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902159.1 protein_id gnl|my_center|LOCUS_05030 519355 520797 gene locus_tag LOCUS_05040 519355 520797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 520876 522126 gene locus_tag LOCUS_05050 520876 522126 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223940.1 protein_id gnl|my_center|LOCUS_05050 523010 522483 gene locus_tag LOCUS_05060 523010 522483 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419208.1 protein_id gnl|my_center|LOCUS_05060 525435 523072 gene locus_tag LOCUS_05070 525435 523072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 525858 525553 gene locus_tag LOCUS_05080 525858 525553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 526551 525949 gene locus_tag LOCUS_05090 526551 525949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 526663 527733 gene locus_tag LOCUS_05100 526663 527733 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903604.1 protein_id gnl|my_center|LOCUS_05100 528572 527835 gene locus_tag LOCUS_05110 528572 527835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 529923 528718 gene locus_tag LOCUS_05120 529923 528718 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902360.1 protein_id gnl|my_center|LOCUS_05120 530036 531322 gene locus_tag LOCUS_05130 530036 531322 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289176.1 protein_id gnl|my_center|LOCUS_05130 532077 531352 gene locus_tag LOCUS_05140 532077 531352 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892488.1 protein_id gnl|my_center|LOCUS_05140 532390 532124 gene locus_tag LOCUS_05150 532390 532124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289181.1 protein_id gnl|my_center|LOCUS_05150 533879 532440 gene locus_tag LOCUS_05160 533879 532440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 533967 534317 gene locus_tag LOCUS_05170 533967 534317 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289179.1 protein_id gnl|my_center|LOCUS_05170 534317 534496 gene locus_tag LOCUS_05180 534317 534496 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902367.1 protein_id gnl|my_center|LOCUS_05180 535627 534560 gene locus_tag LOCUS_05190 535627 534560 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902406.1 protein_id gnl|my_center|LOCUS_05190 538807 536300 gene locus_tag LOCUS_05200 538807 536300 CDS product DUF2298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902370.1 protein_id gnl|my_center|LOCUS_05200 538950 539660 gene locus_tag LOCUS_05210 538950 539660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 539706 540491 gene locus_tag LOCUS_05220 539706 540491 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903518.1 protein_id gnl|my_center|LOCUS_05220 540635 540979 gene locus_tag LOCUS_05230 540635 540979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 541075 541150 gene locus_tag LOCUS_t00030 541075 541150 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 542277 541708 gene locus_tag LOCUS_05240 gene hpt 542277 541708 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902373.1 protein_id gnl|my_center|LOCUS_05240 542839 542327 gene locus_tag LOCUS_05250 542839 542327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 543410 542895 gene locus_tag LOCUS_05260 543410 542895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 543491 546043 gene locus_tag LOCUS_05270 543491 546043 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024445.1 protein_id gnl|my_center|LOCUS_05270 546040 546510 gene locus_tag LOCUS_05280 546040 546510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 546623 547069 gene locus_tag LOCUS_05290 546623 547069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 547069 548910 gene locus_tag LOCUS_05300 547069 548910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 548907 549530 gene locus_tag LOCUS_05310 548907 549530 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024441.1 protein_id gnl|my_center|LOCUS_05310 549520 549807 gene locus_tag LOCUS_05320 549520 549807 CDS product Na(+)/H(+) antiporter subunit F1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228814.1 protein_id gnl|my_center|LOCUS_05320 549810 550271 gene locus_tag LOCUS_05330 549810 550271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 551081 550302 gene locus_tag LOCUS_05340 551081 550302 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809706.1 protein_id gnl|my_center|LOCUS_05340 551478 551128 gene locus_tag LOCUS_05350 551478 551128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 552778 551609 gene locus_tag LOCUS_05360 gene coaBC 552778 551609 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902383.1 protein_id gnl|my_center|LOCUS_05360 552877 553101 gene locus_tag LOCUS_05370 552877 553101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 553963 553133 gene locus_tag LOCUS_05380 553963 553133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 554046 554579 gene locus_tag LOCUS_05390 554046 554579 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289184.1 protein_id gnl|my_center|LOCUS_05390 554646 554942 gene locus_tag LOCUS_05400 554646 554942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903776.1 protein_id gnl|my_center|LOCUS_05400 555566 555000 gene locus_tag LOCUS_05410 555566 555000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 556465 555686 gene locus_tag LOCUS_05420 556465 555686 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157849919.1 protein_id gnl|my_center|LOCUS_05420 557071 556628 gene locus_tag LOCUS_05430 557071 556628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902388.1 protein_id gnl|my_center|LOCUS_05430 557218 558519 gene locus_tag LOCUS_05440 557218 558519 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902386.1 protein_id gnl|my_center|LOCUS_05440 558617 559678 gene locus_tag LOCUS_05450 558617 559678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 560094 559825 gene locus_tag LOCUS_05460 560094 559825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 560483 560103 gene locus_tag LOCUS_05470 560483 560103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 561433 560636 gene locus_tag LOCUS_05480 561433 560636 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902391.1 protein_id gnl|my_center|LOCUS_05480 562235 561441 gene locus_tag LOCUS_05490 562235 561441 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902392.1 protein_id gnl|my_center|LOCUS_05490 563169 562327 gene locus_tag LOCUS_05500 563169 562327 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902393.1 protein_id gnl|my_center|LOCUS_05500 563555 563169 gene locus_tag LOCUS_05510 563555 563169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902394.1 protein_id gnl|my_center|LOCUS_05510 564117 563557 gene locus_tag LOCUS_05520 564117 563557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 565114 564260 gene locus_tag LOCUS_05530 565114 564260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902396.1 protein_id gnl|my_center|LOCUS_05530 565242 565883 gene locus_tag LOCUS_05540 565242 565883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 565975 566478 gene locus_tag LOCUS_05550 565975 566478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902397.1 protein_id gnl|my_center|LOCUS_05550 567252 566569 gene locus_tag LOCUS_05560 gene nth 567252 566569 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902399.1 protein_id gnl|my_center|LOCUS_05560 567360 567926 gene locus_tag LOCUS_05570 567360 567926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 569251 568109 gene locus_tag LOCUS_05580 569251 568109 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902541.1 protein_id gnl|my_center|LOCUS_05580 569810 569346 gene locus_tag LOCUS_05590 569810 569346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 570081 570449 gene locus_tag LOCUS_05600 570081 570449 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289522.1 protein_id gnl|my_center|LOCUS_05600 570446 570991 gene locus_tag LOCUS_05610 570446 570991 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903885.1 protein_id gnl|my_center|LOCUS_05610 572519 571932 gene locus_tag LOCUS_05620 572519 571932 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903910.1 protein_id gnl|my_center|LOCUS_05620 573514 572606 gene locus_tag LOCUS_05630 573514 572606 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903908.1 protein_id gnl|my_center|LOCUS_05630 573643 575133 gene locus_tag LOCUS_05640 573643 575133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 575412 575143 gene locus_tag LOCUS_05650 575412 575143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 576424 575507 gene locus_tag LOCUS_05660 576424 575507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 580055 576564 gene locus_tag LOCUS_05670 580055 576564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 580214 582307 gene locus_tag LOCUS_05680 gene ligA 580214 582307 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403650.1 protein_id gnl|my_center|LOCUS_05680 583038 582751 gene locus_tag LOCUS_05690 583038 582751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136360936.1 protein_id gnl|my_center|LOCUS_05690 583192 583971 gene locus_tag LOCUS_05700 583192 583971 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903861.1 protein_id gnl|my_center|LOCUS_05700 584004 584162 gene locus_tag LOCUS_05710 584004 584162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 584453 584175 gene locus_tag LOCUS_05720 584453 584175 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903691.1 protein_id gnl|my_center|LOCUS_05720 585561 584788 gene locus_tag LOCUS_05730 gene larB 585561 584788 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020480.1 protein_id gnl|my_center|LOCUS_05730 585770 585937 gene locus_tag LOCUS_05740 585770 585937 CDS product DUF1931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903690.1 protein_id gnl|my_center|LOCUS_05740 586743 586012 gene locus_tag LOCUS_05750 gene rpiA 586743 586012 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903689.1 protein_id gnl|my_center|LOCUS_05750 586849 587049 gene locus_tag LOCUS_05760 586849 587049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 587113 588423 gene locus_tag LOCUS_05770 gene glmM 587113 588423 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877198.1 protein_id gnl|my_center|LOCUS_05770 588775 589470 gene locus_tag LOCUS_05780 588775 589470 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_05780 589627 590937 gene locus_tag LOCUS_05790 589627 590937 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860380.1 protein_id gnl|my_center|LOCUS_05790 591037 593109 gene locus_tag LOCUS_05800 gene uvrB 591037 593109 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903784.1 protein_id gnl|my_center|LOCUS_05800 595358 593115 gene locus_tag LOCUS_05810 595358 593115 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902645.1 protein_id gnl|my_center|LOCUS_05810 595572 596009 gene locus_tag LOCUS_05820 595572 596009 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903814.1 protein_id gnl|my_center|LOCUS_05820 597055 596216 gene locus_tag LOCUS_05830 597055 596216 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485719.1 protein_id gnl|my_center|LOCUS_05830 597225 597944 gene locus_tag LOCUS_05840 597225 597944 CDS product DUF5806 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903887.1 protein_id gnl|my_center|LOCUS_05840 598652 598017 gene locus_tag LOCUS_05850 598652 598017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 600005 598707 gene locus_tag LOCUS_05860 600005 598707 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903894.1 protein_id gnl|my_center|LOCUS_05860 600066 600740 gene locus_tag LOCUS_05870 600066 600740 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289535.1 protein_id gnl|my_center|LOCUS_05870 601194 600727 gene locus_tag LOCUS_05880 601194 600727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 601796 601191 gene locus_tag LOCUS_05890 601796 601191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 603192 601888 gene locus_tag LOCUS_05900 gene aspS 603192 601888 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_05900 604268 604906 gene locus_tag LOCUS_05910 604268 604906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 605025 605744 gene locus_tag LOCUS_05920 605025 605744 CDS product putative phosphoglycerol geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902143.1 protein_id gnl|my_center|LOCUS_05920 605877 606512 gene locus_tag LOCUS_05930 605877 606512 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902596.1 protein_id gnl|my_center|LOCUS_05930 609068 606567 gene locus_tag LOCUS_05940 609068 606567 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902213.1 protein_id gnl|my_center|LOCUS_05940 609686 609342 gene locus_tag LOCUS_05950 609686 609342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 610035 609628 gene locus_tag LOCUS_05960 610035 609628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 610414 610130 gene locus_tag LOCUS_05970 610414 610130 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289126.1 protein_id gnl|my_center|LOCUS_05970 610552 610418 gene locus_tag LOCUS_05980 610552 610418 CDS product DNA-directed RNA polymerase subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902130.1 protein_id gnl|my_center|LOCUS_05980 610828 610556 gene locus_tag LOCUS_05990 610828 610556 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289127.1 protein_id gnl|my_center|LOCUS_05990 611347 612531 gene locus_tag LOCUS_06000 611347 612531 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902524.1 protein_id gnl|my_center|LOCUS_06000 612642 613031 gene locus_tag LOCUS_06010 gene fer2 612642 613031 CDS product ferredoxin Fer2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903707.1 protein_id gnl|my_center|LOCUS_06010 613475 614728 gene locus_tag LOCUS_06020 613475 614728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 614805 615347 gene locus_tag LOCUS_06030 614805 615347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289420.1 protein_id gnl|my_center|LOCUS_06030 616169 615369 gene locus_tag LOCUS_06040 616169 615369 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447223.1 protein_id gnl|my_center|LOCUS_06040 616789 618171 gene locus_tag LOCUS_06050 gene serS 616789 618171 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903523.1 protein_id gnl|my_center|LOCUS_06050 620218 618542 gene locus_tag LOCUS_06060 620218 618542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 620712 620335 gene locus_tag LOCUS_06070 620712 620335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 620997 621890 gene locus_tag LOCUS_06080 620997 621890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 622823 622155 gene locus_tag LOCUS_06090 622823 622155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 622862 623809 gene locus_tag LOCUS_06100 622862 623809 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403067.1 protein_id gnl|my_center|LOCUS_06100 624634 623960 gene locus_tag LOCUS_06110 624634 623960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 624913 625872 gene locus_tag LOCUS_06120 624913 625872 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647271.1 protein_id gnl|my_center|LOCUS_06120 625908 627407 gene locus_tag LOCUS_06130 625908 627407 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_06130 629025 627565 gene locus_tag LOCUS_06140 629025 627565 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_06140 629385 629041 gene locus_tag LOCUS_06150 629385 629041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 630950 629481 gene locus_tag LOCUS_06160 630950 629481 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897237.1 protein_id gnl|my_center|LOCUS_06160 631018 631743 gene locus_tag LOCUS_06170 631018 631743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 632203 633585 gene locus_tag LOCUS_06180 632203 633585 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_06180 634905 633868 gene locus_tag LOCUS_06190 634905 633868 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902224.1 protein_id gnl|my_center|LOCUS_06190 636212 635112 gene locus_tag LOCUS_06200 gene gntC 636212 635112 CDS product guanitoxin biosynthesis PLP-dependent (S)-gamma-hydroxy-L-arginine cyclodehydratase GntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061335.1 protein_id gnl|my_center|LOCUS_06200 636347 636631 gene locus_tag LOCUS_06210 636347 636631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 636632 637504 gene locus_tag LOCUS_06220 636632 637504 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940064.1 protein_id gnl|my_center|LOCUS_06220 637512 637775 gene locus_tag LOCUS_06230 637512 637775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 637775 638320 gene locus_tag LOCUS_06240 637775 638320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 638835 638314 gene locus_tag LOCUS_06250 638835 638314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 639137 638838 gene locus_tag LOCUS_06260 639137 638838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 639326 639847 gene locus_tag LOCUS_06270 639326 639847 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902226.1 protein_id gnl|my_center|LOCUS_06270 639911 641284 gene locus_tag LOCUS_06280 639911 641284 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892484.1 protein_id gnl|my_center|LOCUS_06280 641495 642712 gene locus_tag LOCUS_06290 gene ftsZ 641495 642712 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902232.1 protein_id gnl|my_center|LOCUS_06290 642830 643003 gene locus_tag LOCUS_06300 642830 643003 CDS product protein translocase SEC61 complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902231.1 protein_id gnl|my_center|LOCUS_06300 643008 643445 gene locus_tag LOCUS_06310 643008 643445 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902230.1 protein_id gnl|my_center|LOCUS_06310 643705 644178 gene locus_tag LOCUS_06320 643705 644178 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869023.1 protein_id gnl|my_center|LOCUS_06320 645191 644175 gene locus_tag LOCUS_06330 645191 644175 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289630.1 protein_id gnl|my_center|LOCUS_06330 645556 647049 gene locus_tag LOCUS_06340 645556 647049 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404786.1 protein_id gnl|my_center|LOCUS_06340 647039 649444 gene locus_tag LOCUS_06350 647039 649444 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404785.1 protein_id gnl|my_center|LOCUS_06350 649518 650297 gene locus_tag LOCUS_06360 649518 650297 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892483.1 protein_id gnl|my_center|LOCUS_06360 650886 650299 gene locus_tag LOCUS_06370 650886 650299 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289144.1 protein_id gnl|my_center|LOCUS_06370 650987 651253 gene locus_tag LOCUS_06380 650987 651253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 652956 651325 gene locus_tag LOCUS_06390 652956 651325 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_06390 655155 653047 gene locus_tag LOCUS_06400 655155 653047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06400 655058 655282 gene locus_tag LOCUS_06410 655058 655282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 655309 656520 gene locus_tag LOCUS_06420 655309 656520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 656763 656524 gene locus_tag LOCUS_06430 656763 656524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 657115 656924 gene locus_tag LOCUS_06440 657115 656924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 657300 657115 gene locus_tag LOCUS_06450 657300 657115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 657508 658128 gene locus_tag LOCUS_06460 657508 658128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 658224 658700 gene locus_tag LOCUS_06470 658224 658700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 659969 658701 gene locus_tag LOCUS_06480 659969 658701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 660760 660149 gene locus_tag LOCUS_06490 gene hisB 660760 660149 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903709.1 protein_id gnl|my_center|LOCUS_06490 661054 664248 gene locus_tag LOCUS_06500 661054 664248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 665324 664602 gene locus_tag LOCUS_06510 gene hisA 665324 664602 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903708.1 protein_id gnl|my_center|LOCUS_06510 666556 665378 gene locus_tag LOCUS_06520 666556 665378 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486733.1 protein_id gnl|my_center|LOCUS_06520 667072 666710 gene locus_tag LOCUS_06530 667072 666710 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903524.1 protein_id gnl|my_center|LOCUS_06530 667168 667239 gene locus_tag LOCUS_t00040 667168 667239 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 668659 667574 gene locus_tag LOCUS_06540 668659 667574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 669802 668825 gene locus_tag LOCUS_06550 669802 668825 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289749.1 protein_id gnl|my_center|LOCUS_06550 669855 670172 gene locus_tag LOCUS_06560 669855 670172 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903375.1 protein_id gnl|my_center|LOCUS_06560 671519 670182 gene locus_tag LOCUS_06570 671519 670182 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903554.1 protein_id gnl|my_center|LOCUS_06570 671732 672706 gene locus_tag LOCUS_06580 671732 672706 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289434.1 protein_id gnl|my_center|LOCUS_06580 673137 672799 gene locus_tag LOCUS_06590 673137 672799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 673918 673382 gene locus_tag LOCUS_06600 673918 673382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 673910 674527 gene locus_tag LOCUS_06610 673910 674527 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903263.1 protein_id gnl|my_center|LOCUS_06610 674855 676396 gene locus_tag LOCUS_06620 674855 676396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 677973 676486 gene locus_tag LOCUS_06630 gene secY 677973 676486 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903257.1 protein_id gnl|my_center|LOCUS_06630 678489 677977 gene locus_tag LOCUS_06640 678489 677977 CDS product uL15m family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903256.1 protein_id gnl|my_center|LOCUS_06640 678950 678486 gene locus_tag LOCUS_06650 678950 678486 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117363797.1 protein_id gnl|my_center|LOCUS_06650 679597 678950 gene locus_tag LOCUS_06660 679597 678950 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903254.1 protein_id gnl|my_center|LOCUS_06660 680154 679594 gene locus_tag LOCUS_06670 680154 679594 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903253.1 protein_id gnl|my_center|LOCUS_06670 680612 680154 gene locus_tag LOCUS_06680 680612 680154 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903252.1 protein_id gnl|my_center|LOCUS_06680 681424 680609 gene locus_tag LOCUS_06690 681424 680609 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903251.1 protein_id gnl|my_center|LOCUS_06690 681963 681424 gene locus_tag LOCUS_06700 681963 681424 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903250.1 protein_id gnl|my_center|LOCUS_06700 682358 681966 gene locus_tag LOCUS_06710 682358 681966 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903249.1 protein_id gnl|my_center|LOCUS_06710 682549 682358 gene locus_tag LOCUS_06720 682549 682358 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903248.1 protein_id gnl|my_center|LOCUS_06720 683076 682546 gene locus_tag LOCUS_06730 683076 682546 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903247.1 protein_id gnl|my_center|LOCUS_06730 683899 683069 gene locus_tag LOCUS_06740 683899 683069 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903246.1 protein_id gnl|my_center|LOCUS_06740 684270 683896 gene locus_tag LOCUS_06750 gene rplX 684270 683896 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903245.1 protein_id gnl|my_center|LOCUS_06750 684665 684267 gene locus_tag LOCUS_06760 684665 684267 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903244.1 protein_id gnl|my_center|LOCUS_06760 684991 684665 gene locus_tag LOCUS_06770 684991 684665 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903243.1 protein_id gnl|my_center|LOCUS_06770 685353 684982 gene locus_tag LOCUS_06780 685353 684982 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903242.1 protein_id gnl|my_center|LOCUS_06780 685559 685356 gene locus_tag LOCUS_06790 gene rpmC 685559 685356 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903241.1 protein_id gnl|my_center|LOCUS_06790 686557 685556 gene locus_tag LOCUS_06800 686557 685556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 687021 686557 gene locus_tag LOCUS_06810 687021 686557 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903239.1 protein_id gnl|my_center|LOCUS_06810 687453 687025 gene locus_tag LOCUS_06820 687453 687025 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903238.1 protein_id gnl|my_center|LOCUS_06820 688187 687450 gene locus_tag LOCUS_06830 688187 687450 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903237.1 protein_id gnl|my_center|LOCUS_06830 688445 688188 gene locus_tag LOCUS_06840 688445 688188 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903236.1 protein_id gnl|my_center|LOCUS_06840 689188 688442 gene locus_tag LOCUS_06850 gene rpl4p 689188 688442 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903235.1 protein_id gnl|my_center|LOCUS_06850 690166 689192 gene locus_tag LOCUS_06860 690166 689192 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903234.1 protein_id gnl|my_center|LOCUS_06860 691276 690329 gene locus_tag LOCUS_06870 691276 690329 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903233.1 protein_id gnl|my_center|LOCUS_06870 692084 692773 gene locus_tag LOCUS_06880 692084 692773 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903895.1 protein_id gnl|my_center|LOCUS_06880 692962 693114 gene locus_tag LOCUS_06890 692962 693114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 693203 694303 gene locus_tag LOCUS_06900 693203 694303 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_06900 694608 694536 gene locus_tag LOCUS_t00050 694608 694536 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 696507 694660 gene locus_tag LOCUS_06910 696507 694660 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903944.1 protein_id gnl|my_center|LOCUS_06910 697233 696547 gene locus_tag LOCUS_06920 697233 696547 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 protein_id gnl|my_center|LOCUS_06920 697558 697289 gene locus_tag LOCUS_06930 697558 697289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 699158 697698 gene locus_tag LOCUS_06940 699158 697698 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_06940 699573 699262 gene locus_tag LOCUS_06950 699573 699262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 700561 699566 gene locus_tag LOCUS_06960 700561 699566 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902500.1 protein_id gnl|my_center|LOCUS_06960 700672 701634 gene locus_tag LOCUS_06970 700672 701634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 701698 703551 gene locus_tag LOCUS_06980 701698 703551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 703733 704935 gene locus_tag LOCUS_06990 703733 704935 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903512.1 protein_id gnl|my_center|LOCUS_06990 704937 705332 gene locus_tag LOCUS_07000 704937 705332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903511.1 protein_id gnl|my_center|LOCUS_07000 705394 705969 gene locus_tag LOCUS_07010 705394 705969 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903510.1 protein_id gnl|my_center|LOCUS_07010 705970 706167 gene locus_tag LOCUS_07020 705970 706167 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903509.1 protein_id gnl|my_center|LOCUS_07020 706167 706784 gene locus_tag LOCUS_07030 706167 706784 CDS product DUF359 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289421.1 protein_id gnl|my_center|LOCUS_07030 707426 706836 gene locus_tag LOCUS_07040 707426 706836 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289247.1 protein_id gnl|my_center|LOCUS_07040 707563 707910 gene locus_tag LOCUS_07050 707563 707910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 709048 708524 gene locus_tag LOCUS_07060 709048 708524 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902177.1 protein_id gnl|my_center|LOCUS_07060 709294 711402 gene locus_tag LOCUS_07070 gene lonB 709294 711402 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902178.1 protein_id gnl|my_center|LOCUS_07070 711404 712222 gene locus_tag LOCUS_07080 711404 712222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 712820 712236 gene locus_tag LOCUS_07090 712820 712236 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289136.1 protein_id gnl|my_center|LOCUS_07090 713962 712847 gene locus_tag LOCUS_07100 713962 712847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 714934 714056 gene locus_tag LOCUS_07110 714934 714056 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227690.1 protein_id gnl|my_center|LOCUS_07110 715668 714931 gene locus_tag LOCUS_07120 715668 714931 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060828.1 protein_id gnl|my_center|LOCUS_07120 716754 715687 gene locus_tag LOCUS_07130 716754 715687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 716765 717523 gene locus_tag LOCUS_07140 716765 717523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 717738 719120 gene locus_tag LOCUS_07150 717738 719120 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289423.1 protein_id gnl|my_center|LOCUS_07150 722353 719153 gene locus_tag LOCUS_07160 722353 719153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 722595 723047 gene locus_tag LOCUS_07170 722595 723047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 723117 723938 gene locus_tag LOCUS_07180 723117 723938 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903514.1 protein_id gnl|my_center|LOCUS_07180 724122 725183 gene locus_tag LOCUS_07190 724122 725183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 725183 726358 gene locus_tag LOCUS_07200 725183 726358 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902524.1 protein_id gnl|my_center|LOCUS_07200 726450 727736 gene locus_tag LOCUS_07210 726450 727736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 727762 728583 gene locus_tag LOCUS_07220 727762 728583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 729394 728630 gene locus_tag LOCUS_07230 729394 728630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 731365 729449 gene locus_tag LOCUS_07240 731365 729449 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405008.1 protein_id gnl|my_center|LOCUS_07240 731542 732075 gene locus_tag LOCUS_07250 731542 732075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 732082 732342 gene locus_tag LOCUS_07260 732082 732342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 734737 732512 gene locus_tag LOCUS_07270 734737 732512 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903216.1 protein_id gnl|my_center|LOCUS_07270 735863 734877 gene locus_tag LOCUS_07280 735863 734877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 736260 735865 gene locus_tag LOCUS_07290 736260 735865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903322.1 protein_id gnl|my_center|LOCUS_07290 736466 736257 gene locus_tag LOCUS_07300 736466 736257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 736402 736638 gene locus_tag LOCUS_07310 736402 736638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 736785 738362 gene locus_tag LOCUS_07320 gene thsA 736785 738362 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892611.1 protein_id gnl|my_center|LOCUS_07320 739397 739618 gene locus_tag LOCUS_07330 739397 739618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 739721 740068 gene locus_tag LOCUS_07340 739721 740068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289430.1 protein_id gnl|my_center|LOCUS_07340 740072 740416 gene locus_tag LOCUS_07350 740072 740416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 741517 740459 gene locus_tag LOCUS_07360 741517 740459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 742513 741671 gene locus_tag LOCUS_07370 742513 741671 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 protein_id gnl|my_center|LOCUS_07370 742720 743130 gene locus_tag LOCUS_07380 742720 743130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 744303 743179 gene locus_tag LOCUS_07390 gene carA 744303 743179 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903326.1 protein_id gnl|my_center|LOCUS_07390 744377 744859 gene locus_tag LOCUS_07400 744377 744859 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903327.1 protein_id gnl|my_center|LOCUS_07400 745632 744946 gene locus_tag LOCUS_07410 745632 744946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 745970 746563 gene locus_tag LOCUS_07420 745970 746563 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289385.1 protein_id gnl|my_center|LOCUS_07420 746642 747640 gene locus_tag LOCUS_07430 746642 747640 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903845.1 protein_id gnl|my_center|LOCUS_07430 747637 747933 gene locus_tag LOCUS_07440 747637 747933 CDS product DUF424 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903846.1 protein_id gnl|my_center|LOCUS_07440 747985 749967 gene locus_tag LOCUS_07450 747985 749967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 750034 751146 gene locus_tag LOCUS_07460 750034 751146 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 protein_id gnl|my_center|LOCUS_07460 752156 751641 gene locus_tag LOCUS_07470 752156 751641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 752950 752204 gene locus_tag LOCUS_07480 gene cbiZ 752950 752204 CDS product adenosylcobinamide amidohydrolase CbiZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903156.1 protein_id gnl|my_center|LOCUS_07480 753962 752943 gene locus_tag LOCUS_07490 gene cobD 753962 752943 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903155.1 protein_id gnl|my_center|LOCUS_07490 754642 753959 gene locus_tag LOCUS_07500 754642 753959 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535909.1 protein_id gnl|my_center|LOCUS_07500 755562 754741 gene locus_tag LOCUS_07510 gene cobS 755562 754741 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289358.1 protein_id gnl|my_center|LOCUS_07510 756584 755562 gene locus_tag LOCUS_07520 756584 755562 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903152.1 protein_id gnl|my_center|LOCUS_07520 757249 756581 gene locus_tag LOCUS_07530 757249 756581 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892512.1 protein_id gnl|my_center|LOCUS_07530 758007 757333 gene locus_tag LOCUS_07540 758007 757333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 758630 758073 gene locus_tag LOCUS_07550 758630 758073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 758849 758934 gene locus_tag LOCUS_t00060 758849 758934 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 759075 759365 gene locus_tag LOCUS_07560 759075 759365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 759717 759394 gene locus_tag LOCUS_07570 759717 759394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 760046 759714 gene locus_tag LOCUS_07580 760046 759714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 760916 760122 gene locus_tag LOCUS_07590 760916 760122 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_07590 761043 761585 gene locus_tag LOCUS_07600 761043 761585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 762041 761763 gene locus_tag LOCUS_07610 762041 761763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 762103 762579 gene locus_tag LOCUS_07620 762103 762579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 763258 762596 gene locus_tag LOCUS_07630 gene npdG 763258 762596 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903948.1 protein_id gnl|my_center|LOCUS_07630 763589 763371 gene locus_tag LOCUS_07640 763589 763371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 764588 763698 gene locus_tag LOCUS_07650 764588 763698 CDS product TIGR01548 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903949.1 protein_id gnl|my_center|LOCUS_07650 765043 764585 gene locus_tag LOCUS_07660 765043 764585 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903950.1 protein_id gnl|my_center|LOCUS_07660 765224 765745 gene locus_tag LOCUS_07670 765224 765745 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903951.1 protein_id gnl|my_center|LOCUS_07670 766392 765868 gene locus_tag LOCUS_07680 766392 765868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 767246 766467 gene locus_tag LOCUS_07690 767246 766467 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_07690 767361 767726 gene locus_tag LOCUS_07700 767361 767726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 767810 768151 gene locus_tag LOCUS_07710 767810 768151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 768508 768170 gene locus_tag LOCUS_07720 gene hisE 768508 768170 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903939.1 protein_id gnl|my_center|LOCUS_07720 769052 768498 gene locus_tag LOCUS_07730 769052 768498 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903940.1 protein_id gnl|my_center|LOCUS_07730 769784 769137 gene locus_tag LOCUS_07740 gene pdxT 769784 769137 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903941.1 protein_id gnl|my_center|LOCUS_07740 770018 770257 gene locus_tag LOCUS_07750 770018 770257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 770501 772228 gene locus_tag LOCUS_07760 770501 772228 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902165.1 protein_id gnl|my_center|LOCUS_07760 772366 774186 gene locus_tag LOCUS_07770 772366 774186 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902190.1 protein_id gnl|my_center|LOCUS_07770 774518 775483 gene locus_tag LOCUS_07780 774518 775483 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_07780 775754 776800 gene locus_tag LOCUS_07790 775754 776800 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903126.1 protein_id gnl|my_center|LOCUS_07790 776859 777563 gene locus_tag LOCUS_07800 776859 777563 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289139.1 protein_id gnl|my_center|LOCUS_07800 777647 778123 gene locus_tag LOCUS_07810 777647 778123 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289138.1 protein_id gnl|my_center|LOCUS_07810 778250 778675 gene locus_tag LOCUS_07820 778250 778675 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904081.1 protein_id gnl|my_center|LOCUS_07820 779927 778749 gene locus_tag LOCUS_07830 779927 778749 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902185.1 protein_id gnl|my_center|LOCUS_07830 780305 781426 gene locus_tag LOCUS_07840 780305 781426 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902659.1 protein_id gnl|my_center|LOCUS_07840 781507 782535 gene locus_tag LOCUS_07850 781507 782535 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902422.1 protein_id gnl|my_center|LOCUS_07850 782928 782590 gene locus_tag LOCUS_07860 gene pth2 782928 782590 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902135.1 protein_id gnl|my_center|LOCUS_07860 785073 782983 gene locus_tag LOCUS_07870 785073 782983 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065864.1 protein_id gnl|my_center|LOCUS_07870 787208 785070 gene locus_tag LOCUS_07880 787208 785070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 787515 788102 gene locus_tag LOCUS_07890 gene dcd 787515 788102 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902137.1 protein_id gnl|my_center|LOCUS_07890 788168 789112 gene locus_tag LOCUS_07900 788168 789112 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902138.1 protein_id gnl|my_center|LOCUS_07900 789109 789807 gene locus_tag LOCUS_07910 789109 789807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 790790 789828 gene locus_tag LOCUS_07920 790790 789828 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903946.1 protein_id gnl|my_center|LOCUS_07920 791216 790941 gene locus_tag LOCUS_07930 791216 790941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 792024 791275 gene locus_tag LOCUS_07940 792024 791275 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902141.1 protein_id gnl|my_center|LOCUS_07940 792332 792643 gene locus_tag LOCUS_07950 792332 792643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 792667 796263 gene locus_tag LOCUS_07960 gene smc 792667 796263 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902208.1 protein_id gnl|my_center|LOCUS_07960 796276 797331 gene locus_tag LOCUS_07970 796276 797331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 797401 797673 gene locus_tag LOCUS_07980 797401 797673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 798596 797679 gene locus_tag LOCUS_07990 798596 797679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 799523 798660 gene locus_tag LOCUS_08000 gene mtnP 799523 798660 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_08000 800690 799677 gene locus_tag LOCUS_08010 800690 799677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 801911 800820 gene locus_tag LOCUS_08020 801911 800820 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902155.1 protein_id gnl|my_center|LOCUS_08020 802734 801961 gene locus_tag LOCUS_08030 802734 801961 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902222.1 protein_id gnl|my_center|LOCUS_08030 802842 804782 gene locus_tag LOCUS_08040 802842 804782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 805715 804807 gene locus_tag LOCUS_08050 805715 804807 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902221.1 protein_id gnl|my_center|LOCUS_08050 805865 807064 gene locus_tag LOCUS_08060 805865 807064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 807514 807101 gene locus_tag LOCUS_08070 807514 807101 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903834.1 protein_id gnl|my_center|LOCUS_08070 808128 807511 gene locus_tag LOCUS_08080 808128 807511 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903833.1 protein_id gnl|my_center|LOCUS_08080 809468 808677 gene locus_tag LOCUS_08090 809468 808677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 810632 809997 gene locus_tag LOCUS_08100 810632 809997 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_08100 811298 810639 gene locus_tag LOCUS_08110 811298 810639 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902018.1 protein_id gnl|my_center|LOCUS_08110 812708 811419 gene locus_tag LOCUS_08120 812708 811419 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947133.1 protein_id gnl|my_center|LOCUS_08120 812911 814890 gene locus_tag LOCUS_08130 812911 814890 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903922.1 protein_id gnl|my_center|LOCUS_08130 815874 815044 gene locus_tag LOCUS_08140 815874 815044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 816262 816747 gene locus_tag LOCUS_08150 gene rimI 816262 816747 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289526.1 protein_id gnl|my_center|LOCUS_08150 816803 817351 gene locus_tag LOCUS_08160 816803 817351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 817382 817843 gene locus_tag LOCUS_08170 817382 817843 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887547.1 protein_id gnl|my_center|LOCUS_08170 817919 818308 gene locus_tag LOCUS_08180 817919 818308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 818944 818309 gene locus_tag LOCUS_08190 818944 818309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903785.1 protein_id gnl|my_center|LOCUS_08190 819036 820322 gene locus_tag LOCUS_08200 819036 820322 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890416.1 protein_id gnl|my_center|LOCUS_08200 820324 820764 gene locus_tag LOCUS_08210 820324 820764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903493.1 protein_id gnl|my_center|LOCUS_08210 821342 820767 gene locus_tag LOCUS_08220 821342 820767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 821931 821500 gene locus_tag LOCUS_08230 821931 821500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 823022 822012 gene locus_tag LOCUS_08240 823022 822012 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903937.1 protein_id gnl|my_center|LOCUS_08240 823696 823319 gene locus_tag LOCUS_08250 823696 823319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 825736 824012 gene locus_tag LOCUS_08260 825736 824012 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031712.1 protein_id gnl|my_center|LOCUS_08260 825783 826757 gene locus_tag LOCUS_08270 825783 826757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 828060 826804 gene locus_tag LOCUS_08280 828060 826804 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289074.1 protein_id gnl|my_center|LOCUS_08280 828220 829752 gene locus_tag LOCUS_08290 828220 829752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 830142 832025 gene locus_tag LOCUS_08300 830142 832025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 832296 832889 gene locus_tag LOCUS_08310 gene purO 832296 832889 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903769.1 protein_id gnl|my_center|LOCUS_08310 833232 833969 gene locus_tag LOCUS_08320 833232 833969 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903770.1 protein_id gnl|my_center|LOCUS_08320 834017 835258 gene locus_tag LOCUS_08330 834017 835258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 836476 835292 gene locus_tag LOCUS_08340 836476 835292 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903772.1 protein_id gnl|my_center|LOCUS_08340 837875 836649 gene locus_tag LOCUS_08350 837875 836649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 838091 840760 gene locus_tag LOCUS_08360 gene valS 838091 840760 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060895.1 protein_id gnl|my_center|LOCUS_08360 840784 841458 gene locus_tag LOCUS_08370 840784 841458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 844515 841525 gene locus_tag LOCUS_08380 844515 841525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 844733 845956 gene locus_tag LOCUS_08390 844733 845956 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903549.1 protein_id gnl|my_center|LOCUS_08390 846274 845978 gene locus_tag LOCUS_08400 846274 845978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 846393 847349 gene locus_tag LOCUS_08410 846393 847349 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903551.1 protein_id gnl|my_center|LOCUS_08410 847629 848705 gene locus_tag LOCUS_08420 847629 848705 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903552.1 protein_id gnl|my_center|LOCUS_08420 850438 849146 gene locus_tag LOCUS_08430 850438 849146 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903810.1 protein_id gnl|my_center|LOCUS_08430 851723 850626 gene locus_tag LOCUS_08440 851723 850626 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903593.1 protein_id gnl|my_center|LOCUS_08440 852488 851778 gene locus_tag LOCUS_08450 852488 851778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 852747 852607 gene locus_tag LOCUS_08460 852747 852607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 852998 852747 gene locus_tag LOCUS_08470 852998 852747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 853155 854222 gene locus_tag LOCUS_08480 853155 854222 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289444.1 protein_id gnl|my_center|LOCUS_08480 854517 854969 gene locus_tag LOCUS_08490 854517 854969 CDS product DUF5788 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289143.1 protein_id gnl|my_center|LOCUS_08490 855892 855050 gene locus_tag LOCUS_08500 855892 855050 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113110.1 protein_id gnl|my_center|LOCUS_08500 855982 857733 gene locus_tag LOCUS_08510 855982 857733 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876189.1 protein_id gnl|my_center|LOCUS_08510 858643 857777 gene locus_tag LOCUS_08520 858643 857777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 859637 858672 gene locus_tag LOCUS_08530 859637 858672 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023086.1 protein_id gnl|my_center|LOCUS_08530 860637 859750 gene locus_tag LOCUS_08540 860637 859750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 861350 860634 gene locus_tag LOCUS_08550 861350 860634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 863895 861469 gene locus_tag LOCUS_08560 863895 861469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 865700 863895 gene locus_tag LOCUS_08570 865700 863895 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023084.1 protein_id gnl|my_center|LOCUS_08570 866514 865774 gene locus_tag LOCUS_08580 866514 865774 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026122.1 protein_id gnl|my_center|LOCUS_08580 871359 866803 gene locus_tag LOCUS_08590 gene gltB 871359 866803 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421590.1 protein_id gnl|my_center|LOCUS_08590 872105 871557 gene locus_tag LOCUS_08600 872105 871557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 874456 872213 gene locus_tag LOCUS_08610 874456 872213 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289484.1 protein_id gnl|my_center|LOCUS_08610 874733 875347 gene locus_tag LOCUS_08620 874733 875347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289482.1 protein_id gnl|my_center|LOCUS_08620 875411 876130 gene locus_tag LOCUS_08630 875411 876130 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902136.1 protein_id gnl|my_center|LOCUS_08630 876768 876223 gene locus_tag LOCUS_08640 876768 876223 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903731.1 protein_id gnl|my_center|LOCUS_08640 877568 876768 gene locus_tag LOCUS_08650 877568 876768 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903731.1 protein_id gnl|my_center|LOCUS_08650 878137 877568 gene locus_tag LOCUS_08660 878137 877568 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903731.1 protein_id gnl|my_center|LOCUS_08660 878715 878215 gene locus_tag LOCUS_08670 878715 878215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 879153 878851 gene locus_tag LOCUS_08680 879153 878851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 879891 879460 gene locus_tag LOCUS_08690 879891 879460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 880846 879950 gene locus_tag LOCUS_08700 880846 879950 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902142.1 protein_id gnl|my_center|LOCUS_08700 881056 882609 gene locus_tag LOCUS_08710 881056 882609 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_08710 883540 882650 gene locus_tag LOCUS_08720 883540 882650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 883691 884341 gene locus_tag LOCUS_08730 883691 884341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 884391 884464 gene locus_tag LOCUS_t00070 884391 884464 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 885247 884726 gene locus_tag LOCUS_08740 885247 884726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 885474 885244 gene locus_tag LOCUS_08750 885474 885244 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289406.1 protein_id gnl|my_center|LOCUS_08750 887296 886139 gene locus_tag LOCUS_08760 887296 886139 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289530.1 protein_id gnl|my_center|LOCUS_08760 887605 887982 gene locus_tag LOCUS_08770 887605 887982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 887979 889442 gene locus_tag LOCUS_08780 887979 889442 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903965.1 protein_id gnl|my_center|LOCUS_08780 891043 889508 gene locus_tag LOCUS_08790 891043 889508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 892525 891068 gene locus_tag LOCUS_08800 892525 891068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 893595 892591 gene locus_tag LOCUS_08810 893595 892591 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903967.1 protein_id gnl|my_center|LOCUS_08810 893904 893731 gene locus_tag LOCUS_08820 893904 893731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 894415 895179 gene locus_tag LOCUS_08830 894415 895179 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903969.1 protein_id gnl|my_center|LOCUS_08830 895158 895823 gene locus_tag LOCUS_08840 895158 895823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 896457 895870 gene locus_tag LOCUS_08850 896457 895870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903971.1 protein_id gnl|my_center|LOCUS_08850 896576 899605 gene locus_tag LOCUS_08860 gene uvrA 896576 899605 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903972.1 protein_id gnl|my_center|LOCUS_08860 902309 899739 gene locus_tag LOCUS_08870 902309 899739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 903787 902327 gene locus_tag LOCUS_08880 903787 902327 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256148.1 protein_id gnl|my_center|LOCUS_08880 903918 904958 gene locus_tag LOCUS_08890 903918 904958 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825317.1 protein_id gnl|my_center|LOCUS_08890 905119 906201 gene locus_tag LOCUS_08900 905119 906201 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289531.1 protein_id gnl|my_center|LOCUS_08900 910011 906292 gene locus_tag LOCUS_08910 910011 906292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 911440 910211 gene locus_tag LOCUS_08920 911440 910211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 911954 911583 gene locus_tag LOCUS_08930 911954 911583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 912078 912389 gene locus_tag LOCUS_08940 912078 912389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903983.1 protein_id gnl|my_center|LOCUS_08940 912447 913805 gene locus_tag LOCUS_08950 912447 913805 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903984.1 protein_id gnl|my_center|LOCUS_08950 914450 914223 gene locus_tag LOCUS_08960 914450 914223 CDS product H/ACA ribonucleoprotein complex subunit GAR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902991.1 protein_id gnl|my_center|LOCUS_08960 914757 914479 gene locus_tag LOCUS_08970 gene srp19 914757 914479 CDS product signal recognition particle subunit SRP19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902992.1 protein_id gnl|my_center|LOCUS_08970 914982 917234 gene locus_tag LOCUS_08980 914982 917234 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903183.1 protein_id gnl|my_center|LOCUS_08980 918253 917336 gene locus_tag LOCUS_08990 918253 917336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 919440 918250 gene locus_tag LOCUS_09000 919440 918250 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903900.1 protein_id gnl|my_center|LOCUS_09000 920074 919493 gene locus_tag LOCUS_09010 920074 919493 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902791.1 protein_id gnl|my_center|LOCUS_09010 920914 920090 gene locus_tag LOCUS_09020 920914 920090 CDS product YqcI/YcgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902790.1 protein_id gnl|my_center|LOCUS_09020 921491 920940 gene locus_tag LOCUS_09030 921491 920940 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088276.1 protein_id gnl|my_center|LOCUS_09030 921929 921546 gene locus_tag LOCUS_09040 921929 921546 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289124.1 protein_id gnl|my_center|LOCUS_09040 922128 923576 gene locus_tag LOCUS_09050 922128 923576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 923765 923583 gene locus_tag LOCUS_09060 923765 923583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 925281 923824 gene locus_tag LOCUS_09070 gene hemA 925281 923824 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903296.1 protein_id gnl|my_center|LOCUS_09070 925952 925278 gene locus_tag LOCUS_09080 925952 925278 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903297.1 protein_id gnl|my_center|LOCUS_09080 927059 925953 gene locus_tag LOCUS_09090 927059 925953 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903298.1 protein_id gnl|my_center|LOCUS_09090 927519 927103 gene locus_tag LOCUS_09100 927519 927103 CDS product DUF5778 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903299.1 protein_id gnl|my_center|LOCUS_09100 927935 927741 gene locus_tag LOCUS_09110 927935 927741 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_09110 928066 928992 gene locus_tag LOCUS_09120 gene uppS 928066 928992 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903300.1 protein_id gnl|my_center|LOCUS_09120 929856 929008 gene locus_tag LOCUS_09130 929856 929008 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902391.1 protein_id gnl|my_center|LOCUS_09130 930031 930687 gene locus_tag LOCUS_09140 930031 930687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 930716 931183 gene locus_tag LOCUS_09150 930716 931183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 931333 931629 gene locus_tag LOCUS_09160 931333 931629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 931710 931991 gene locus_tag LOCUS_09170 931710 931991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 932955 932314 gene locus_tag LOCUS_09180 932955 932314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 933914 933102 gene locus_tag LOCUS_09190 gene speB 933914 933102 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903289.1 protein_id gnl|my_center|LOCUS_09190 934324 933950 gene locus_tag LOCUS_09200 934324 933950 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903290.1 protein_id gnl|my_center|LOCUS_09200 935242 934445 gene locus_tag LOCUS_09210 935242 934445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 935975 935361 gene locus_tag LOCUS_09220 935975 935361 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229674.1 protein_id gnl|my_center|LOCUS_09220 936453 936016 gene locus_tag LOCUS_09230 936453 936016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 936562 938172 gene locus_tag LOCUS_09240 gene crtI 936562 938172 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903230.1 protein_id gnl|my_center|LOCUS_09240 938175 939071 gene locus_tag LOCUS_09250 938175 939071 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903229.1 protein_id gnl|my_center|LOCUS_09250 941246 939777 gene locus_tag LOCUS_09260 941246 939777 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289363.1 protein_id gnl|my_center|LOCUS_09260 941597 942415 gene locus_tag LOCUS_09270 941597 942415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 942420 943145 gene locus_tag LOCUS_09280 942420 943145 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 protein_id gnl|my_center|LOCUS_09280 943142 943906 gene locus_tag LOCUS_09290 943142 943906 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_09290 943903 944895 gene locus_tag LOCUS_09300 943903 944895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 944953 945765 gene locus_tag LOCUS_09310 944953 945765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 945762 946298 gene locus_tag LOCUS_09320 945762 946298 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903178.1 protein_id gnl|my_center|LOCUS_09320 946858 946325 gene locus_tag LOCUS_09330 946858 946325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903179.1 protein_id gnl|my_center|LOCUS_09330 947676 946933 gene locus_tag LOCUS_09340 947676 946933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 947883 948515 gene locus_tag LOCUS_09350 gene serB 947883 948515 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136360913.1 protein_id gnl|my_center|LOCUS_09350 948598 948870 gene locus_tag LOCUS_09360 948598 948870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 948912 949427 gene locus_tag LOCUS_09370 948912 949427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 950666 949440 gene locus_tag LOCUS_09380 gene metX 950666 949440 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289504.1 protein_id gnl|my_center|LOCUS_09380 952020 950668 gene locus_tag LOCUS_09390 952020 950668 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903810.1 protein_id gnl|my_center|LOCUS_09390 955465 952274 gene locus_tag LOCUS_09400 gene carB 955465 952274 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903325.1 protein_id gnl|my_center|LOCUS_09400 957601 955547 gene locus_tag LOCUS_09410 957601 955547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 957925 957692 gene locus_tag LOCUS_09420 957925 957692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 958313 958651 gene locus_tag LOCUS_09430 958313 958651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 959251 958718 gene locus_tag LOCUS_09440 959251 958718 CDS product DUF5815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903323.1 protein_id gnl|my_center|LOCUS_09440 960992 959415 gene locus_tag LOCUS_09450 960992 959415 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876362.1 protein_id gnl|my_center|LOCUS_09450 961712 961170 gene locus_tag LOCUS_09460 961712 961170 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230151.1 protein_id gnl|my_center|LOCUS_09460 963215 961884 gene locus_tag LOCUS_09470 963215 961884 CDS product Hvo_1808 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903899.1 protein_id gnl|my_center|LOCUS_09470 964861 963212 gene locus_tag LOCUS_09480 964861 963212 CDS product Hvo_1808 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903899.1 protein_id gnl|my_center|LOCUS_09480 967028 965241 gene locus_tag LOCUS_09490 967028 965241 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289512.1 protein_id gnl|my_center|LOCUS_09490 967332 968468 gene locus_tag LOCUS_09500 967332 968468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 968793 968542 gene locus_tag LOCUS_09510 968793 968542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289513.1 protein_id gnl|my_center|LOCUS_09510 968909 971275 gene locus_tag LOCUS_09520 968909 971275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 971647 971441 gene locus_tag LOCUS_09530 971647 971441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 971933 972943 gene locus_tag LOCUS_09540 971933 972943 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903859.1 protein_id gnl|my_center|LOCUS_09540 972943 973668 gene locus_tag LOCUS_09550 972943 973668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903860.1 protein_id gnl|my_center|LOCUS_09550 973871 973701 gene locus_tag LOCUS_09560 973871 973701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 974051 975058 gene locus_tag LOCUS_09570 974051 975058 CDS product DUF5784 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289319.1 protein_id gnl|my_center|LOCUS_09570 975639 975193 gene locus_tag LOCUS_09580 975639 975193 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205992.1 protein_id gnl|my_center|LOCUS_09580 976763 975708 gene locus_tag LOCUS_09590 976763 975708 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110591.1 protein_id gnl|my_center|LOCUS_09590 978072 976921 gene locus_tag LOCUS_09600 978072 976921 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289424.1 protein_id gnl|my_center|LOCUS_09600 981337 978182 gene locus_tag LOCUS_09610 981337 978182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 981522 982853 gene locus_tag LOCUS_09620 gene trkA 981522 982853 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404994.1 protein_id gnl|my_center|LOCUS_09620 982989 984605 gene locus_tag LOCUS_09630 982989 984605 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404995.1 protein_id gnl|my_center|LOCUS_09630 986614 984947 gene locus_tag LOCUS_09640 986614 984947 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903259.1 protein_id gnl|my_center|LOCUS_09640 987353 986616 gene locus_tag LOCUS_09650 987353 986616 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902085.1 protein_id gnl|my_center|LOCUS_09650 987520 988263 gene locus_tag LOCUS_09660 987520 988263 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902932.1 protein_id gnl|my_center|LOCUS_09660 990692 988398 gene locus_tag LOCUS_09670 990692 988398 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892477.1 protein_id gnl|my_center|LOCUS_09670 991161 990685 gene locus_tag LOCUS_09680 991161 990685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 991412 992092 gene locus_tag LOCUS_09690 991412 992092 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902929.1 protein_id gnl|my_center|LOCUS_09690 992089 992439 gene locus_tag LOCUS_09700 992089 992439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 992541 994097 gene locus_tag LOCUS_09710 992541 994097 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902931.1 protein_id gnl|my_center|LOCUS_09710 994094 994297 gene locus_tag LOCUS_09720 994094 994297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902930.1 protein_id gnl|my_center|LOCUS_09720 995808 994357 gene locus_tag LOCUS_09730 995808 994357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 996057 996665 gene locus_tag LOCUS_09740 996057 996665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 996818 997402 gene locus_tag LOCUS_09750 996818 997402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 997670 999835 gene locus_tag LOCUS_09760 997670 999835 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140493.1 protein_id gnl|my_center|LOCUS_09760 999838 1001895 gene locus_tag LOCUS_09770 999838 1001895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1001992 1003866 gene locus_tag LOCUS_09780 1001992 1003866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1003940 1004016 gene locus_tag LOCUS_t00080 1003940 1004016 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1004767 1004219 gene locus_tag LOCUS_09790 1004767 1004219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1006295 1005279 gene locus_tag LOCUS_09800 1006295 1005279 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902703.1 protein_id gnl|my_center|LOCUS_09800 1006974 1006564 gene locus_tag LOCUS_09810 1006974 1006564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1007261 1006971 gene locus_tag LOCUS_09820 1007261 1006971 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904211.1 protein_id gnl|my_center|LOCUS_09820 1007789 1008706 gene locus_tag LOCUS_09830 1007789 1008706 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903490.1 protein_id gnl|my_center|LOCUS_09830 1009795 1008755 gene locus_tag LOCUS_09840 1009795 1008755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1010064 1010276 gene locus_tag LOCUS_09850 1010064 1010276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1010408 1010635 gene locus_tag LOCUS_09860 1010408 1010635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1010704 1011006 gene locus_tag LOCUS_09870 1010704 1011006 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904115.1 protein_id gnl|my_center|LOCUS_09870 1013006 1011150 gene locus_tag LOCUS_09880 1013006 1011150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1013962 1013258 gene locus_tag LOCUS_09890 1013962 1013258 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902495.1 protein_id gnl|my_center|LOCUS_09890 1014017 1014946 gene locus_tag LOCUS_09900 1014017 1014946 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903522.1 protein_id gnl|my_center|LOCUS_09900 1015005 1015460 gene locus_tag LOCUS_09910 1015005 1015460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1015608 1016138 gene locus_tag LOCUS_09920 1015608 1016138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1016705 1017046 gene locus_tag LOCUS_09930 1016705 1017046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903405.1 protein_id gnl|my_center|LOCUS_09930 1017199 1017284 gene locus_tag LOCUS_t00090 1017199 1017284 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1017526 1019445 gene locus_tag LOCUS_09940 1017526 1019445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1019527 1020174 gene locus_tag LOCUS_09950 1019527 1020174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1021932 1020241 gene locus_tag LOCUS_09960 1021932 1020241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1022610 1021984 gene locus_tag LOCUS_09970 1022610 1021984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1024402 1022906 gene locus_tag LOCUS_09980 gene gatB 1024402 1022906 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902210.1 protein_id gnl|my_center|LOCUS_09980 1025080 1024493 gene locus_tag LOCUS_09990 1025080 1024493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903725.1 protein_id gnl|my_center|LOCUS_09990 1025235 1025864 gene locus_tag LOCUS_10000 1025235 1025864 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_10000 1027157 1026036 gene locus_tag LOCUS_10010 1027157 1026036 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902330.1 protein_id gnl|my_center|LOCUS_10010 1028045 1028578 gene locus_tag LOCUS_10020 1028045 1028578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 1028603 1029364 gene locus_tag LOCUS_10030 1028603 1029364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1029393 1029731 gene locus_tag LOCUS_10040 1029393 1029731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1029803 1030039 gene locus_tag LOCUS_10050 1029803 1030039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1030196 1030041 gene locus_tag LOCUS_10060 1030196 1030041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1030213 1030593 gene locus_tag LOCUS_10070 1030213 1030593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1030618 1032084 gene locus_tag LOCUS_10080 gene proS 1030618 1032084 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902251.1 protein_id gnl|my_center|LOCUS_10080 1033990 1032290 gene locus_tag LOCUS_10090 gene aor 1033990 1032290 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 protein_id gnl|my_center|LOCUS_10090 1036012 1034102 gene locus_tag LOCUS_10100 1036012 1034102 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289426.1 protein_id gnl|my_center|LOCUS_10100 1036995 1036072 gene locus_tag LOCUS_10110 1036995 1036072 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903522.1 protein_id gnl|my_center|LOCUS_10110 1039556 1037631 gene locus_tag LOCUS_10120 gene thrS 1039556 1037631 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289388.1 protein_id gnl|my_center|LOCUS_10120 1040689 1039652 gene locus_tag LOCUS_10130 1040689 1039652 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171355.1 protein_id gnl|my_center|LOCUS_10130 1041293 1040763 gene locus_tag LOCUS_10140 1041293 1040763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1041292 1043178 gene locus_tag LOCUS_10150 1041292 1043178 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877065.1 protein_id gnl|my_center|LOCUS_10150 1043771 1043289 gene locus_tag LOCUS_10160 1043771 1043289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1045567 1043906 gene locus_tag LOCUS_10170 1045567 1043906 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902970.1 protein_id gnl|my_center|LOCUS_10170 1046115 1045651 gene locus_tag LOCUS_10180 1046115 1045651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1046996 1047574 gene locus_tag LOCUS_10190 1046996 1047574 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903263.1 protein_id gnl|my_center|LOCUS_10190 1047576 1048556 gene locus_tag LOCUS_10200 1047576 1048556 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289369.1 protein_id gnl|my_center|LOCUS_10200 1049606 1048587 gene locus_tag LOCUS_10210 1049606 1048587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1050657 1049755 gene locus_tag LOCUS_10220 1050657 1049755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1050754 1050824 gene locus_tag LOCUS_t00100 1050754 1050824 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1052255 1051521 gene locus_tag LOCUS_10230 1052255 1051521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1053714 1052866 gene locus_tag LOCUS_10240 1053714 1052866 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045008.1 protein_id gnl|my_center|LOCUS_10240 1054767 1054126 gene locus_tag LOCUS_10250 1054767 1054126 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093220.1 protein_id gnl|my_center|LOCUS_10250 1055546 1054995 gene locus_tag LOCUS_10260 1055546 1054995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1056139 1055588 gene locus_tag LOCUS_10270 1056139 1055588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1056038 1056403 gene locus_tag LOCUS_10280 1056038 1056403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1056647 1056817 gene locus_tag LOCUS_10290 1056647 1056817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1057592 1056867 gene locus_tag LOCUS_10300 1057592 1056867 CDS product IS6-like element ISH29 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289758.1 protein_id gnl|my_center|LOCUS_10300 1057683 1058024 gene locus_tag LOCUS_10310 1057683 1058024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1060319 1058052 gene locus_tag LOCUS_10320 1060319 1058052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1060522 1061583 gene locus_tag LOCUS_10330 1060522 1061583 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403481.1 protein_id gnl|my_center|LOCUS_10330 1061867 1063288 gene locus_tag LOCUS_10340 1061867 1063288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1063447 1063614 gene locus_tag LOCUS_10350 1063447 1063614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1064099 1063683 gene locus_tag LOCUS_10360 1064099 1063683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1066604 1064238 gene locus_tag LOCUS_10370 1066604 1064238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1067380 1066637 gene locus_tag LOCUS_10380 1067380 1066637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1067957 1067394 gene locus_tag LOCUS_10390 1067957 1067394 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902509.1 protein_id gnl|my_center|LOCUS_10390 1068094 1068726 gene locus_tag LOCUS_10400 1068094 1068726 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728128.1 protein_id gnl|my_center|LOCUS_10400 1069042 1068970 gene locus_tag LOCUS_t00110 1069042 1068970 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1069372 1069836 gene locus_tag LOCUS_10410 1069372 1069836 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902552.1 protein_id gnl|my_center|LOCUS_10410 1069853 1071070 gene locus_tag LOCUS_10420 1069853 1071070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902551.1 protein_id gnl|my_center|LOCUS_10420 1071067 1071417 gene locus_tag LOCUS_10430 1071067 1071417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1071414 1072049 gene locus_tag LOCUS_10440 1071414 1072049 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902549.1 protein_id gnl|my_center|LOCUS_10440 1072501 1072088 gene locus_tag LOCUS_10450 1072501 1072088 CDS product plastocyanin/azurin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902548.1 protein_id gnl|my_center|LOCUS_10450 1072628 1073905 gene locus_tag LOCUS_10460 1072628 1073905 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902792.1 protein_id gnl|my_center|LOCUS_10460 1075423 1073993 gene locus_tag LOCUS_10470 gene glmM 1075423 1073993 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903637.1 protein_id gnl|my_center|LOCUS_10470 1075561 1076421 gene locus_tag LOCUS_10480 1075561 1076421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903635.1 protein_id gnl|my_center|LOCUS_10480 1076718 1077566 gene locus_tag LOCUS_10490 1076718 1077566 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903634.1 protein_id gnl|my_center|LOCUS_10490 1077655 1078563 gene locus_tag LOCUS_10500 gene pdxS 1077655 1078563 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903311.1 protein_id gnl|my_center|LOCUS_10500 1078835 1079077 gene locus_tag LOCUS_10510 1078835 1079077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1079800 1079372 gene locus_tag LOCUS_10520 1079800 1079372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1080092 1082059 gene locus_tag LOCUS_10530 1080092 1082059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1083327 1082335 gene locus_tag LOCUS_10540 1083327 1082335 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_10540 1083436 1085202 gene locus_tag LOCUS_10550 gene ilvD 1083436 1085202 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839606.1 protein_id gnl|my_center|LOCUS_10550 1085473 1085282 gene locus_tag LOCUS_10560 1085473 1085282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1087643 1085595 gene locus_tag LOCUS_10570 1087643 1085595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1087909 1088175 gene locus_tag LOCUS_10580 1087909 1088175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1088748 1088413 gene locus_tag LOCUS_10590 1088748 1088413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1089346 1090986 gene locus_tag LOCUS_10600 1089346 1090986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1092090 1091029 gene locus_tag LOCUS_10610 1092090 1091029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1092541 1092083 gene locus_tag LOCUS_10620 1092541 1092083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1093804 1092563 gene locus_tag LOCUS_10630 1093804 1092563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1095235 1093874 gene locus_tag LOCUS_10640 1095235 1093874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1095906 1095274 gene locus_tag LOCUS_10650 1095906 1095274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1096789 1095968 gene locus_tag LOCUS_10660 1096789 1095968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1098827 1096797 gene locus_tag LOCUS_10670 1098827 1096797 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361678.1 protein_id gnl|my_center|LOCUS_10670 1101283 1098824 gene locus_tag LOCUS_10680 1101283 1098824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1102730 1101516 gene locus_tag LOCUS_10690 1102730 1101516 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_10690 1103275 1102727 gene locus_tag LOCUS_10700 1103275 1102727 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879119.1 protein_id gnl|my_center|LOCUS_10700 1105235 1103619 gene locus_tag LOCUS_10710 1105235 1103619 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892520.1 protein_id gnl|my_center|LOCUS_10710 1105893 1105294 gene locus_tag LOCUS_10720 1105893 1105294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903464.1 protein_id gnl|my_center|LOCUS_10720 1107063 1105942 gene locus_tag LOCUS_10730 1107063 1105942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1107254 1108273 gene locus_tag LOCUS_10740 1107254 1108273 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289411.1 protein_id gnl|my_center|LOCUS_10740 1109287 1108301 gene locus_tag LOCUS_10750 1109287 1108301 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903430.1 protein_id gnl|my_center|LOCUS_10750 1109437 1110033 gene locus_tag LOCUS_10760 1109437 1110033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1110011 1110226 gene locus_tag LOCUS_10770 1110011 1110226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1110276 1110527 gene locus_tag LOCUS_10780 gene purS 1110276 1110527 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903429.1 protein_id gnl|my_center|LOCUS_10780 1110580 1111257 gene locus_tag LOCUS_10790 gene purQ 1110580 1111257 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903428.1 protein_id gnl|my_center|LOCUS_10790 1112596 1111334 gene locus_tag LOCUS_10800 1112596 1111334 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289393.1 protein_id gnl|my_center|LOCUS_10800 1112706 1114007 gene locus_tag LOCUS_10810 1112706 1114007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1114004 1115242 gene locus_tag LOCUS_10820 1114004 1115242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1116012 1115323 gene locus_tag LOCUS_10830 1116012 1115323 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266245.1 protein_id gnl|my_center|LOCUS_10830 1116233 1117126 gene locus_tag LOCUS_10840 gene secF 1116233 1117126 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903462.1 protein_id gnl|my_center|LOCUS_10840 1117123 1118718 gene locus_tag LOCUS_10850 1117123 1118718 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903461.1 protein_id gnl|my_center|LOCUS_10850 1118806 1119543 gene locus_tag LOCUS_10860 1118806 1119543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892529.1 protein_id gnl|my_center|LOCUS_10860 1119603 1120013 gene locus_tag LOCUS_10870 1119603 1120013 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113301.1 protein_id gnl|my_center|LOCUS_10870 1120824 1120048 gene locus_tag LOCUS_10880 1120824 1120048 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902515.1 protein_id gnl|my_center|LOCUS_10880 1121113 1121043 gene locus_tag LOCUS_t00120 1121113 1121043 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1121370 1122197 gene locus_tag LOCUS_10890 1121370 1122197 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903494.1 protein_id gnl|my_center|LOCUS_10890 1122277 1122573 gene locus_tag LOCUS_10900 1122277 1122573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1122655 1123278 gene locus_tag LOCUS_10910 1122655 1123278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1123344 1124108 gene locus_tag LOCUS_10920 1123344 1124108 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937657.1 protein_id gnl|my_center|LOCUS_10920 1124463 1124200 gene locus_tag LOCUS_10930 1124463 1124200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903401.1 protein_id gnl|my_center|LOCUS_10930 1124850 1124554 gene locus_tag LOCUS_10940 1124850 1124554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1125244 1124924 gene locus_tag LOCUS_10950 1125244 1124924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 protein_id gnl|my_center|LOCUS_10950 1125170 1125394 gene locus_tag LOCUS_10960 1125170 1125394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1125654 1125484 gene locus_tag LOCUS_10970 1125654 1125484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1128238 1125716 gene locus_tag LOCUS_10980 1128238 1125716 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903632.1 protein_id gnl|my_center|LOCUS_10980 1128967 1128239 gene locus_tag LOCUS_10990 1128967 1128239 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070807659.1 protein_id gnl|my_center|LOCUS_10990 1129295 1129101 gene locus_tag LOCUS_11000 1129295 1129101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1129403 1130221 gene locus_tag LOCUS_11010 1129403 1130221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1130229 1130801 gene locus_tag LOCUS_11020 1130229 1130801 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892532.1 protein_id gnl|my_center|LOCUS_11020 1130801 1132573 gene locus_tag LOCUS_11030 1130801 1132573 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 protein_id gnl|my_center|LOCUS_11030 1132685 1132867 gene locus_tag LOCUS_11040 1132685 1132867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1132975 1133298 gene locus_tag LOCUS_11050 1132975 1133298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1133581 1134279 gene locus_tag LOCUS_11060 1133581 1134279 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289405.1 protein_id gnl|my_center|LOCUS_11060 1134282 1134512 gene locus_tag LOCUS_11070 1134282 1134512 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903411.1 protein_id gnl|my_center|LOCUS_11070 1134595 1135968 gene locus_tag LOCUS_11080 1134595 1135968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1136017 1136898 gene locus_tag LOCUS_11090 1136017 1136898 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903603.1 protein_id gnl|my_center|LOCUS_11090 1137882 1136947 gene locus_tag LOCUS_11100 1137882 1136947 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903490.1 protein_id gnl|my_center|LOCUS_11100 1138093 1139157 gene locus_tag LOCUS_11110 1138093 1139157 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_11110 1139670 1140992 gene locus_tag LOCUS_11120 1139670 1140992 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353378.1 protein_id gnl|my_center|LOCUS_11120 1142126 1141041 gene locus_tag LOCUS_11130 gene mfnA 1142126 1141041 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902198.1 protein_id gnl|my_center|LOCUS_11130 1143076 1142273 gene locus_tag LOCUS_11140 1143076 1142273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1145485 1143179 gene locus_tag LOCUS_11150 gene ppsA 1145485 1143179 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902200.1 protein_id gnl|my_center|LOCUS_11150 1145942 1145784 gene locus_tag LOCUS_11160 1145942 1145784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1146336 1145950 gene locus_tag LOCUS_11170 1146336 1145950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1147780 1146329 gene locus_tag LOCUS_11180 1147780 1146329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1148763 1147777 gene locus_tag LOCUS_11190 1148763 1147777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1150876 1149074 gene locus_tag LOCUS_11200 1150876 1149074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1152614 1150974 gene locus_tag LOCUS_11210 1152614 1150974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1153654 1152707 gene locus_tag LOCUS_11220 1153654 1152707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1153982 1154524 gene locus_tag LOCUS_11230 1153982 1154524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1155210 1154551 gene locus_tag LOCUS_11240 1155210 1154551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1155359 1156537 gene locus_tag LOCUS_11250 1155359 1156537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1156601 1156777 gene locus_tag LOCUS_11260 1156601 1156777 CDS product DUF5786 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289220.1 protein_id gnl|my_center|LOCUS_11260 1157168 1158277 gene locus_tag LOCUS_11270 1157168 1158277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1159792 1158347 gene locus_tag LOCUS_11280 1159792 1158347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1160908 1159991 gene locus_tag LOCUS_11290 1160908 1159991 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902202.1 protein_id gnl|my_center|LOCUS_11290 1160979 1161254 gene locus_tag LOCUS_11300 1160979 1161254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1161738 1162565 gene locus_tag LOCUS_11310 1161738 1162565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1164215 1162557 gene locus_tag LOCUS_11320 1164215 1162557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1165005 1164271 gene locus_tag LOCUS_11330 1165005 1164271 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361490.1 protein_id gnl|my_center|LOCUS_11330 1165106 1165888 gene locus_tag LOCUS_11340 1165106 1165888 CDS product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903310.1 protein_id gnl|my_center|LOCUS_11340 1166819 1165899 gene locus_tag LOCUS_11350 1166819 1165899 CDS product DUF6293 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892517.1 protein_id gnl|my_center|LOCUS_11350 1166927 1167076 gene locus_tag LOCUS_11360 1166927 1167076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1167445 1167098 gene locus_tag LOCUS_11370 1167445 1167098 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316382.1 protein_id gnl|my_center|LOCUS_11370 1167685 1169160 gene locus_tag LOCUS_11380 1167685 1169160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1169643 1169137 gene locus_tag LOCUS_11390 1169643 1169137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1170983 1169640 gene locus_tag LOCUS_11400 1170983 1169640 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289378.1 protein_id gnl|my_center|LOCUS_11400 1173719 1171152 gene locus_tag LOCUS_11410 1173719 1171152 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838171.1 protein_id gnl|my_center|LOCUS_11410 1173832 1174515 gene locus_tag LOCUS_11420 1173832 1174515 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289377.1 protein_id gnl|my_center|LOCUS_11420 1174621 1174947 gene locus_tag LOCUS_11430 1174621 1174947 CDS product DUF5783 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289487.1 protein_id gnl|my_center|LOCUS_11430 1175785 1174967 gene locus_tag LOCUS_11440 1175785 1174967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1176768 1175782 gene locus_tag LOCUS_11450 1176768 1175782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_11450 1176937 1178454 gene locus_tag LOCUS_11460 1176937 1178454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1178573 1178743 gene locus_tag LOCUS_11470 1178573 1178743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1179761 1178850 gene locus_tag LOCUS_11480 1179761 1178850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903896.1 protein_id gnl|my_center|LOCUS_11480 1179871 1180224 gene locus_tag LOCUS_11490 1179871 1180224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1180648 1180238 gene locus_tag LOCUS_11500 1180648 1180238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1181011 1180691 gene locus_tag LOCUS_11510 1181011 1180691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1181141 1181311 gene locus_tag LOCUS_11520 1181141 1181311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1183375 1181357 gene locus_tag LOCUS_11530 1183375 1181357 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289450.1 protein_id gnl|my_center|LOCUS_11530 1183952 1183566 gene locus_tag LOCUS_11540 1183952 1183566 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289449.1 protein_id gnl|my_center|LOCUS_11540 1184119 1184619 gene locus_tag LOCUS_11550 1184119 1184619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1184739 1185230 gene locus_tag LOCUS_11560 1184739 1185230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1185327 1187084 gene locus_tag LOCUS_11570 gene argS 1185327 1187084 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_11570 1188209 1187106 gene locus_tag LOCUS_11580 1188209 1187106 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902333.1 protein_id gnl|my_center|LOCUS_11580 1188359 1188856 gene locus_tag LOCUS_11590 1188359 1188856 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902263.1 protein_id gnl|my_center|LOCUS_11590 1189094 1188912 gene locus_tag LOCUS_11600 1189094 1188912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1189209 1189799 gene locus_tag LOCUS_11610 1189209 1189799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902265.1 protein_id gnl|my_center|LOCUS_11610 1189861 1190022 gene locus_tag LOCUS_11620 1189861 1190022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1191232 1190060 gene locus_tag LOCUS_11630 1191232 1190060 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064319.1 protein_id gnl|my_center|LOCUS_11630 1192457 1191276 gene locus_tag LOCUS_11640 1192457 1191276 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064397.1 protein_id gnl|my_center|LOCUS_11640 1193233 1192454 gene locus_tag LOCUS_11650 1193233 1192454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901944.1 protein_id gnl|my_center|LOCUS_11650 1195080 1193239 gene locus_tag LOCUS_11660 1195080 1193239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1195234 1196682 gene locus_tag LOCUS_11670 1195234 1196682 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_11670 1197775 1196708 gene locus_tag LOCUS_11680 1197775 1196708 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902254.1 protein_id gnl|my_center|LOCUS_11680 1200350 1198500 gene locus_tag LOCUS_11690 1200350 1198500 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119621.1 protein_id gnl|my_center|LOCUS_11690 1200793 1200452 gene locus_tag LOCUS_11700 1200793 1200452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1201097 1201240 gene locus_tag LOCUS_11710 1201097 1201240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1201316 1201984 gene locus_tag LOCUS_11720 1201316 1201984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1203948 1202848 gene locus_tag LOCUS_11730 1203948 1202848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1205104 1204046 gene locus_tag LOCUS_11740 1205104 1204046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1206404 1205274 gene locus_tag LOCUS_11750 1206404 1205274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1207886 1206624 gene locus_tag LOCUS_11760 1207886 1206624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1209302 1208037 gene locus_tag LOCUS_11770 1209302 1208037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1210727 1209501 gene locus_tag LOCUS_11780 1210727 1209501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1211178 1212665 gene locus_tag LOCUS_11790 1211178 1212665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1212727 1213608 gene locus_tag LOCUS_11800 1212727 1213608 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089183.1 protein_id gnl|my_center|LOCUS_11800 1213608 1214855 gene locus_tag LOCUS_11810 1213608 1214855 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089184.1 protein_id gnl|my_center|LOCUS_11810 1214858 1215658 gene locus_tag LOCUS_11820 1214858 1215658 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879470.1 protein_id gnl|my_center|LOCUS_11820 1215655 1216413 gene locus_tag LOCUS_11830 1215655 1216413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11830 1216633 1217991 gene locus_tag LOCUS_11840 1216633 1217991 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902096.1 protein_id gnl|my_center|LOCUS_11840 1218053 1219003 gene locus_tag LOCUS_11850 1218053 1219003 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_11850 1219051 1219884 gene locus_tag LOCUS_11860 1219051 1219884 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 protein_id gnl|my_center|LOCUS_11860 1219886 1220215 gene locus_tag LOCUS_11870 1219886 1220215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1220402 1220325 gene locus_tag LOCUS_t00130 1220402 1220325 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1221688 1220495 gene locus_tag LOCUS_11880 1221688 1220495 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877710.1 protein_id gnl|my_center|LOCUS_11880 1222036 1221920 gene locus_tag LOCUS_r00010 1222036 1221920 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1225047 1222164 gene locus_tag LOCUS_r00020 1225047 1222164 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1225333 1225262 gene locus_tag LOCUS_t00140 1225333 1225262 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1226894 1225430 gene locus_tag LOCUS_r00030 1226894 1225430 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1227419 1227150 gene locus_tag LOCUS_11890 1227419 1227150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1227903 1227595 gene locus_tag LOCUS_11900 1227903 1227595 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903872.1 protein_id gnl|my_center|LOCUS_11900 1228215 1228412 gene locus_tag LOCUS_11910 1228215 1228412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1228476 1229537 gene locus_tag LOCUS_11920 1228476 1229537 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903871.1 protein_id gnl|my_center|LOCUS_11920 1229619 1230377 gene locus_tag LOCUS_11930 gene azf 1229619 1230377 CDS product NAD-dependent glucose-6-phosphate dehydrogenase Azf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289099.1 protein_id gnl|my_center|LOCUS_11930 1230799 1231800 gene locus_tag LOCUS_11940 1230799 1231800 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903695.1 protein_id gnl|my_center|LOCUS_11940 1232491 1231868 gene locus_tag LOCUS_11950 1232491 1231868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1232682 1234010 gene locus_tag LOCUS_11960 gene thrC 1232682 1234010 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903816.1 protein_id gnl|my_center|LOCUS_11960 1234133 1234522 gene locus_tag LOCUS_11970 1234133 1234522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1234610 1234888 gene locus_tag LOCUS_11980 1234610 1234888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1237396 1234958 gene locus_tag LOCUS_11990 1237396 1234958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1240152 1237459 gene locus_tag LOCUS_12000 1240152 1237459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1240301 1241305 gene locus_tag LOCUS_12010 1240301 1241305 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387830.1 protein_id gnl|my_center|LOCUS_12010 1241298 1242152 gene locus_tag LOCUS_12020 1241298 1242152 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 protein_id gnl|my_center|LOCUS_12020 1243616 1242195 gene locus_tag LOCUS_12030 gene lpdA 1243616 1242195 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903648.1 protein_id gnl|my_center|LOCUS_12030 1244696 1244463 gene locus_tag LOCUS_12040 1244696 1244463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1245142 1244771 gene locus_tag LOCUS_12050 1245142 1244771 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902485.1 protein_id gnl|my_center|LOCUS_12050 1245314 1246339 gene locus_tag LOCUS_12060 1245314 1246339 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903678.1 protein_id gnl|my_center|LOCUS_12060 1246415 1247821 gene locus_tag LOCUS_12070 gene cofH 1246415 1247821 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903422.1 protein_id gnl|my_center|LOCUS_12070 1248988 1247864 gene locus_tag LOCUS_12080 gene cofG 1248988 1247864 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892527.1 protein_id gnl|my_center|LOCUS_12080 1250139 1249447 gene locus_tag LOCUS_12090 gene cofC 1250139 1249447 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903420.1 protein_id gnl|my_center|LOCUS_12090 1251339 1250167 gene locus_tag LOCUS_12100 1251339 1250167 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289408.1 protein_id gnl|my_center|LOCUS_12100 1252471 1251467 gene locus_tag LOCUS_12110 1252471 1251467 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892525.1 protein_id gnl|my_center|LOCUS_12110 1252930 1252550 gene locus_tag LOCUS_12120 1252930 1252550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1253571 1253002 gene locus_tag LOCUS_12130 1253571 1253002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1253682 1254284 gene locus_tag LOCUS_12140 gene tmk 1253682 1254284 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903416.1 protein_id gnl|my_center|LOCUS_12140 1254355 1254714 gene locus_tag LOCUS_12150 1254355 1254714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1254871 1255491 gene locus_tag LOCUS_12160 1254871 1255491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1257483 1255630 gene locus_tag LOCUS_12170 1257483 1255630 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903960.1 protein_id gnl|my_center|LOCUS_12170 1257951 1257628 gene locus_tag LOCUS_12180 1257951 1257628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1257950 1259164 gene locus_tag LOCUS_12190 gene argE 1257950 1259164 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247175.1 protein_id gnl|my_center|LOCUS_12190 1259236 1260792 gene locus_tag LOCUS_12200 1259236 1260792 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903957.1 protein_id gnl|my_center|LOCUS_12200 1261710 1260823 gene locus_tag LOCUS_12210 1261710 1260823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1263569 1261947 gene locus_tag LOCUS_12220 1263569 1261947 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903461.1 protein_id gnl|my_center|LOCUS_12220 1264196 1263624 gene locus_tag LOCUS_12230 1264196 1263624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12230 1264694 1264296 gene locus_tag LOCUS_12240 1264694 1264296 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230341.1 protein_id gnl|my_center|LOCUS_12240 1264794 1265798 gene locus_tag LOCUS_12250 1264794 1265798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1266544 1265822 gene locus_tag LOCUS_12260 1266544 1265822 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903981.1 protein_id gnl|my_center|LOCUS_12260 1266700 1267053 gene locus_tag LOCUS_12270 gene sepF 1266700 1267053 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903980.1 protein_id gnl|my_center|LOCUS_12270 1268169 1267165 gene locus_tag LOCUS_12280 1268169 1267165 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289230.1 protein_id gnl|my_center|LOCUS_12280 1268690 1268235 gene locus_tag LOCUS_12290 1268690 1268235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1269827 1268694 gene locus_tag LOCUS_12300 1269827 1268694 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922354.1 protein_id gnl|my_center|LOCUS_12300 1271284 1269824 gene locus_tag LOCUS_12310 1271284 1269824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1271409 1272194 gene locus_tag LOCUS_12320 1271409 1272194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1272184 1272921 gene locus_tag LOCUS_12330 1272184 1272921 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902159.1 protein_id gnl|my_center|LOCUS_12330 1275130 1272935 gene locus_tag LOCUS_12340 1275130 1272935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1275332 1276477 gene locus_tag LOCUS_12350 1275332 1276477 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903850.1 protein_id gnl|my_center|LOCUS_12350 1276464 1277525 gene locus_tag LOCUS_12360 1276464 1277525 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903851.1 protein_id gnl|my_center|LOCUS_12360 1277700 1279856 gene locus_tag LOCUS_12370 gene katG 1277700 1279856 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904144.1 protein_id gnl|my_center|LOCUS_12370 1280729 1279896 gene locus_tag LOCUS_12380 1280729 1279896 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903562.1 protein_id gnl|my_center|LOCUS_12380 1280986 1281531 gene locus_tag LOCUS_12390 1280986 1281531 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289436.1 protein_id gnl|my_center|LOCUS_12390 1282042 1283193 gene locus_tag LOCUS_12400 gene hemC 1282042 1283193 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903738.1 protein_id gnl|my_center|LOCUS_12400 1283190 1283993 gene locus_tag LOCUS_12410 gene cobA 1283190 1283993 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903739.1 protein_id gnl|my_center|LOCUS_12410 1284076 1284807 gene locus_tag LOCUS_12420 1284076 1284807 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903740.1 protein_id gnl|my_center|LOCUS_12420 1285467 1285111 gene locus_tag LOCUS_12430 1285467 1285111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1285980 1285543 gene locus_tag LOCUS_12440 1285980 1285543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1287517 1286045 gene locus_tag LOCUS_12450 1287517 1286045 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903705.1 protein_id gnl|my_center|LOCUS_12450 1289030 1287543 gene locus_tag LOCUS_12460 1289030 1287543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1289775 1289395 gene locus_tag LOCUS_12470 1289775 1289395 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903744.1 protein_id gnl|my_center|LOCUS_12470 1290378 1290028 gene locus_tag LOCUS_12480 1290378 1290028 CDS product DUF5783 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289487.1 protein_id gnl|my_center|LOCUS_12480 1291368 1290433 gene locus_tag LOCUS_12490 1291368 1290433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1292430 1291450 gene locus_tag LOCUS_12500 1292430 1291450 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_12500 1293784 1292531 gene locus_tag LOCUS_12510 1293784 1292531 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903607.1 protein_id gnl|my_center|LOCUS_12510 1293945 1294850 gene locus_tag LOCUS_12520 1293945 1294850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1297027 1295576 gene locus_tag LOCUS_12530 1297027 1295576 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_12530 1298883 1297123 gene locus_tag LOCUS_12540 1298883 1297123 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289455.1 protein_id gnl|my_center|LOCUS_12540 1299133 1298957 gene locus_tag LOCUS_12550 1299133 1298957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1299531 1299196 gene locus_tag LOCUS_12560 1299531 1299196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1300146 1303019 gene locus_tag LOCUS_12570 1300146 1303019 CDS product bacterio-opsin activator domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289108.1 protein_id gnl|my_center|LOCUS_12570 1303383 1304687 gene locus_tag LOCUS_12580 gene gdhB 1303383 1304687 CDS product glutamate dehydrogenase GdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902074.1 protein_id gnl|my_center|LOCUS_12580 1305946 1304711 gene locus_tag LOCUS_12590 1305946 1304711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1306568 1306182 gene locus_tag LOCUS_12600 1306568 1306182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1306757 1307083 gene locus_tag LOCUS_12610 1306757 1307083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1307198 1307911 gene locus_tag LOCUS_12620 1307198 1307911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1308256 1307924 gene locus_tag LOCUS_12630 1308256 1307924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1309000 1308326 gene locus_tag LOCUS_12640 1309000 1308326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1309830 1309012 gene locus_tag LOCUS_12650 1309830 1309012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1310696 1309830 gene locus_tag LOCUS_12660 1310696 1309830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967624.1 protein_id gnl|my_center|LOCUS_12660 1312651 1310693 gene locus_tag LOCUS_12670 1312651 1310693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1313144 1312725 gene locus_tag LOCUS_12680 1313144 1312725 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902485.1 protein_id gnl|my_center|LOCUS_12680 1313404 1313856 gene locus_tag LOCUS_12690 1313404 1313856 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903180.1 protein_id gnl|my_center|LOCUS_12690 1314805 1313885 gene locus_tag LOCUS_12700 1314805 1313885 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902500.1 protein_id gnl|my_center|LOCUS_12700 1315682 1314963 gene locus_tag LOCUS_12710 1315682 1314963 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049924277.1 protein_id gnl|my_center|LOCUS_12710 1316662 1315679 gene locus_tag LOCUS_12720 1316662 1315679 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405445.1 protein_id gnl|my_center|LOCUS_12720 1316696 1317700 gene locus_tag LOCUS_12730 1316696 1317700 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 protein_id gnl|my_center|LOCUS_12730 1318050 1317790 gene locus_tag LOCUS_12740 1318050 1317790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903482.1 protein_id gnl|my_center|LOCUS_12740 1320356 1318581 gene locus_tag LOCUS_12750 1320356 1318581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1322074 1321190 gene locus_tag LOCUS_12760 gene nucS 1322074 1321190 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250849.1 protein_id gnl|my_center|LOCUS_12760 1322778 1322125 gene locus_tag LOCUS_12770 1322778 1322125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1323652 1322873 gene locus_tag LOCUS_12780 1323652 1322873 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_12780 1323862 1324533 gene locus_tag LOCUS_12790 1323862 1324533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1324579 1325445 gene locus_tag LOCUS_12800 1324579 1325445 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903351.1 protein_id gnl|my_center|LOCUS_12800 1326782 1325463 gene locus_tag LOCUS_12810 1326782 1325463 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222034.1 protein_id gnl|my_center|LOCUS_12810 1328037 1326829 gene locus_tag LOCUS_12820 1328037 1326829 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373777.1 protein_id gnl|my_center|LOCUS_12820 1328164 1328349 gene locus_tag LOCUS_12830 1328164 1328349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1328407 1328631 gene locus_tag LOCUS_12840 1328407 1328631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1328785 1330785 gene locus_tag LOCUS_12850 1328785 1330785 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903687.1 protein_id gnl|my_center|LOCUS_12850 1332276 1330822 gene locus_tag LOCUS_12860 1332276 1330822 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_12860 1333947 1332346 gene locus_tag LOCUS_12870 1333947 1332346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1334198 1335583 gene locus_tag LOCUS_12880 1334198 1335583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1335869 1335621 gene locus_tag LOCUS_12890 1335869 1335621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1337191 1335941 gene locus_tag LOCUS_12900 1337191 1335941 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902524.1 protein_id gnl|my_center|LOCUS_12900 1338074 1337268 gene locus_tag LOCUS_12910 1338074 1337268 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903396.1 protein_id gnl|my_center|LOCUS_12910 1339813 1338167 gene locus_tag LOCUS_12920 1339813 1338167 CDS product DUF255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289401.1 protein_id gnl|my_center|LOCUS_12920 1340008 1341336 gene locus_tag LOCUS_12930 1340008 1341336 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904150.1 protein_id gnl|my_center|LOCUS_12930 1341504 1342502 gene locus_tag LOCUS_12940 1341504 1342502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902219.1 protein_id gnl|my_center|LOCUS_12940 1343050 1342568 gene locus_tag LOCUS_12950 1343050 1342568 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978170.1 protein_id gnl|my_center|LOCUS_12950 1343234 1343854 gene locus_tag LOCUS_12960 1343234 1343854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1344908 1343856 gene locus_tag LOCUS_12970 1344908 1343856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1345947 1344979 gene locus_tag LOCUS_12980 1345947 1344979 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289364.1 protein_id gnl|my_center|LOCUS_12980 1346225 1347268 gene locus_tag LOCUS_12990 1346225 1347268 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902857.1 protein_id gnl|my_center|LOCUS_12990 1347274 1348290 gene locus_tag LOCUS_13000 1347274 1348290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1348324 1348563 gene locus_tag LOCUS_13010 1348324 1348563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1349647 1348565 gene locus_tag LOCUS_13020 1349647 1348565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1350682 1349732 gene locus_tag LOCUS_13030 gene pyrF 1350682 1349732 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903220.1 protein_id gnl|my_center|LOCUS_13030 1350758 1351423 gene locus_tag LOCUS_13040 1350758 1351423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1351547 1352203 gene locus_tag LOCUS_13050 1351547 1352203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903184.1 protein_id gnl|my_center|LOCUS_13050 1352312 1352638 gene locus_tag LOCUS_13060 1352312 1352638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1353792 1352809 gene locus_tag LOCUS_13070 1353792 1352809 CDS product R2-like ligand-binding oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230220.1 protein_id gnl|my_center|LOCUS_13070 1354018 1354668 gene locus_tag LOCUS_13080 1354018 1354668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1354735 1355508 gene locus_tag LOCUS_13090 gene legD1 1354735 1355508 CDS product Dot/Icm type IV secretion system effector LegD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948394.1 protein_id gnl|my_center|LOCUS_13090 1355514 1355606 gene locus_tag LOCUS_t00150 1355514 1355606 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1356016 1356690 gene locus_tag LOCUS_13100 1356016 1356690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1357076 1356870 gene locus_tag LOCUS_13110 1357076 1356870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1358433 1357177 gene locus_tag LOCUS_13120 1358433 1357177 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289069.1 protein_id gnl|my_center|LOCUS_13120 1358557 1358486 gene locus_tag LOCUS_t00160 1358557 1358486 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1359391 1358654 gene locus_tag LOCUS_13130 1359391 1358654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289417.1 protein_id gnl|my_center|LOCUS_13130 1359452 1360204 gene locus_tag LOCUS_13140 1359452 1360204 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903495.1 protein_id gnl|my_center|LOCUS_13140 1360705 1360313 gene locus_tag LOCUS_13150 1360705 1360313 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289078.1 protein_id gnl|my_center|LOCUS_13150 1360999 1360715 gene locus_tag LOCUS_13160 1360999 1360715 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901977.1 protein_id gnl|my_center|LOCUS_13160 1363165 1361069 gene locus_tag LOCUS_13170 gene metG 1363165 1361069 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902197.1 protein_id gnl|my_center|LOCUS_13170 1363897 1363244 gene locus_tag LOCUS_13180 1363897 1363244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1365045 1363981 gene locus_tag LOCUS_13190 1365045 1363981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1365844 1365074 gene locus_tag LOCUS_13200 1365844 1365074 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902203.1 protein_id gnl|my_center|LOCUS_13200 1366711 1367709 gene locus_tag LOCUS_13210 gene hemB 1366711 1367709 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903732.1 protein_id gnl|my_center|LOCUS_13210 1368058 1369476 gene locus_tag LOCUS_13220 1368058 1369476 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405103.1 protein_id gnl|my_center|LOCUS_13220 1369469 1369834 gene locus_tag LOCUS_13230 1369469 1369834 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_13230 1369838 1370317 gene locus_tag LOCUS_13240 1369838 1370317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1370829 1372571 gene locus_tag LOCUS_13250 1370829 1372571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1373284 1374624 gene locus_tag LOCUS_13260 1373284 1374624 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903735.1 protein_id gnl|my_center|LOCUS_13260 1374632 1374889 gene locus_tag LOCUS_13270 1374632 1374889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1375189 1374920 gene locus_tag LOCUS_13280 1375189 1374920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1375488 1375231 gene locus_tag LOCUS_13290 1375488 1375231 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903557.1 protein_id gnl|my_center|LOCUS_13290 1376623 1375565 gene locus_tag LOCUS_13300 1376623 1375565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1376760 1377749 gene locus_tag LOCUS_13310 1376760 1377749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1378016 1378459 gene locus_tag LOCUS_13320 1378016 1378459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1378456 1380807 gene locus_tag LOCUS_13330 1378456 1380807 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902898.1 protein_id gnl|my_center|LOCUS_13330 1380880 1381527 gene locus_tag LOCUS_13340 1380880 1381527 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903261.1 protein_id gnl|my_center|LOCUS_13340 1381606 1382007 gene locus_tag LOCUS_13350 1381606 1382007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1382158 1382697 gene locus_tag LOCUS_13360 1382158 1382697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1383446 1382733 gene locus_tag LOCUS_13370 1383446 1382733 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903348.1 protein_id gnl|my_center|LOCUS_13370 1384469 1383489 gene locus_tag LOCUS_13380 1384469 1383489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1385490 1384594 gene locus_tag LOCUS_13390 1385490 1384594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1385478 1385798 gene locus_tag LOCUS_13400 1385478 1385798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1385795 1387660 gene locus_tag LOCUS_13410 gene arcS 1385795 1387660 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903438.1 protein_id gnl|my_center|LOCUS_13410 1387734 1388132 gene locus_tag LOCUS_13420 1387734 1388132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1388550 1388341 gene locus_tag LOCUS_13430 1388550 1388341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1389985 1388663 gene locus_tag LOCUS_13440 1389985 1388663 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901978.1 protein_id gnl|my_center|LOCUS_13440 1390261 1391202 gene locus_tag LOCUS_13450 1390261 1391202 CDS product EMC3/TMCO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903262.1 protein_id gnl|my_center|LOCUS_13450 1391973 1391251 gene locus_tag LOCUS_13460 1391973 1391251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1392643 1392041 gene locus_tag LOCUS_13470 1392643 1392041 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903441.1 protein_id gnl|my_center|LOCUS_13470 1393044 1392712 gene locus_tag LOCUS_13480 1393044 1392712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1393175 1394041 gene locus_tag LOCUS_13490 1393175 1394041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1395595 1394045 gene locus_tag LOCUS_13500 1395595 1394045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1397262 1395592 gene locus_tag LOCUS_13510 1397262 1395592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1397882 1397259 gene locus_tag LOCUS_13520 1397882 1397259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1398465 1397884 gene locus_tag LOCUS_13530 1398465 1397884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1400860 1399007 gene locus_tag LOCUS_13540 1400860 1399007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1401046 1400973 gene locus_tag LOCUS_t00170 1401046 1400973 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1401688 1401101 gene locus_tag LOCUS_13550 gene trmY 1401688 1401101 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903455.1 protein_id gnl|my_center|LOCUS_13550 1401797 1404286 gene locus_tag LOCUS_13560 1401797 1404286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901946.1 protein_id gnl|my_center|LOCUS_13560 1405566 1404265 gene locus_tag LOCUS_13570 gene aglM 1405566 1404265 CDS product UDP-glucose 6-dehydrogenase AglM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901982.1 protein_id gnl|my_center|LOCUS_13570 1406282 1405848 gene locus_tag LOCUS_13580 1406282 1405848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1406166 1406444 gene locus_tag LOCUS_13590 1406166 1406444 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289392.1 protein_id gnl|my_center|LOCUS_13590 1407449 1406529 gene locus_tag LOCUS_13600 1407449 1406529 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289391.1 protein_id gnl|my_center|LOCUS_13600 1408707 1407454 gene locus_tag LOCUS_13610 gene gatD 1408707 1407454 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903349.1 protein_id gnl|my_center|LOCUS_13610 1408823 1409323 gene locus_tag LOCUS_13620 1408823 1409323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1409320 1411530 gene locus_tag LOCUS_13630 1409320 1411530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1411628 1412026 gene locus_tag LOCUS_13640 1411628 1412026 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903878.1 protein_id gnl|my_center|LOCUS_13640 1412039 1412473 gene locus_tag LOCUS_13650 1412039 1412473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902511.1 protein_id gnl|my_center|LOCUS_13650 1412470 1412955 gene locus_tag LOCUS_13660 1412470 1412955 CDS product DUF5807 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289520.1 protein_id gnl|my_center|LOCUS_13660 1413179 1413601 gene locus_tag LOCUS_13670 1413179 1413601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1413881 1416127 gene locus_tag LOCUS_13680 1413881 1416127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1417099 1416110 gene locus_tag LOCUS_13690 1417099 1416110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1417449 1417096 gene locus_tag LOCUS_13700 1417449 1417096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1417924 1417538 gene locus_tag LOCUS_13710 1417924 1417538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1418109 1419194 gene locus_tag LOCUS_13720 1418109 1419194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903882.1 protein_id gnl|my_center|LOCUS_13720 1419712 1419278 gene locus_tag LOCUS_13730 1419712 1419278 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289748.1 protein_id gnl|my_center|LOCUS_13730 1420014 1419712 gene locus_tag LOCUS_13740 1420014 1419712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1420098 1420790 gene locus_tag LOCUS_13750 1420098 1420790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1421573 1421067 gene locus_tag LOCUS_13760 1421573 1421067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1422237 1423754 gene locus_tag LOCUS_13770 gene tgtA 1422237 1423754 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903439.1 protein_id gnl|my_center|LOCUS_13770 1424211 1423774 gene locus_tag LOCUS_13780 1424211 1423774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1424843 1424208 gene locus_tag LOCUS_13790 1424843 1424208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1425364 1424897 gene locus_tag LOCUS_13800 gene cheY 1425364 1424897 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902692.1 protein_id gnl|my_center|LOCUS_13800 1425457 1425810 gene locus_tag LOCUS_13810 1425457 1425810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1425850 1426110 gene locus_tag LOCUS_13820 1425850 1426110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1426115 1426444 gene locus_tag LOCUS_13830 1426115 1426444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1426587 1427312 gene locus_tag LOCUS_13840 1426587 1427312 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262887.1 protein_id gnl|my_center|LOCUS_13840 1428132 1427314 gene locus_tag LOCUS_13850 1428132 1427314 CDS product DUF6159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958069.1 protein_id gnl|my_center|LOCUS_13850 1429532 1428240 gene locus_tag LOCUS_13860 1429532 1428240 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903876.1 protein_id gnl|my_center|LOCUS_13860 1429906 1429592 gene locus_tag LOCUS_13870 1429906 1429592 CDS product CPCC family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877836.1 protein_id gnl|my_center|LOCUS_13870 1430053 1430523 gene locus_tag LOCUS_13880 1430053 1430523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1430828 1430529 gene locus_tag LOCUS_13890 1430828 1430529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1431349 1430894 gene locus_tag LOCUS_13900 1431349 1430894 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289521.1 protein_id gnl|my_center|LOCUS_13900 1431482 1432345 gene locus_tag LOCUS_13910 1431482 1432345 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088005.1 protein_id gnl|my_center|LOCUS_13910 1432963 1432361 gene locus_tag LOCUS_13920 1432963 1432361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1433202 1432960 gene locus_tag LOCUS_13930 1433202 1432960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1433295 1434281 gene locus_tag LOCUS_13940 1433295 1434281 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904083.1 protein_id gnl|my_center|LOCUS_13940 1434339 1435022 gene locus_tag LOCUS_13950 1434339 1435022 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892481.1 protein_id gnl|my_center|LOCUS_13950 1435413 1435093 gene locus_tag LOCUS_13960 1435413 1435093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1436323 1435406 gene locus_tag LOCUS_13970 gene guaA 1436323 1435406 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903336.1 protein_id gnl|my_center|LOCUS_13970 1437990 1436323 gene locus_tag LOCUS_13980 1437990 1436323 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903337.1 protein_id gnl|my_center|LOCUS_13980 1438194 1438595 gene locus_tag LOCUS_13990 gene msrB 1438194 1438595 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903021.1 protein_id gnl|my_center|LOCUS_13990 1439685 1438627 gene locus_tag LOCUS_14000 1439685 1438627 CDS product Brp/Blh family beta-carotene 15,15'-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289439.1 protein_id gnl|my_center|LOCUS_14000 1440494 1439676 gene locus_tag LOCUS_14010 gene crtY 1440494 1439676 CDS product lycopene beta-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289440.1 protein_id gnl|my_center|LOCUS_14010 1441367 1440606 gene locus_tag LOCUS_14020 1441367 1440606 CDS product bacteriorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903069.1 protein_id gnl|my_center|LOCUS_14020 1441588 1442466 gene locus_tag LOCUS_14030 gene moeB 1441588 1442466 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902012.1 protein_id gnl|my_center|LOCUS_14030 1442970 1442542 gene locus_tag LOCUS_14040 1442970 1442542 CDS product desampylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903329.1 protein_id gnl|my_center|LOCUS_14040 1443887 1442970 gene locus_tag LOCUS_14050 1443887 1442970 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123518.1 protein_id gnl|my_center|LOCUS_14050 1443937 1444545 gene locus_tag LOCUS_14060 1443937 1444545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1444772 1445413 gene locus_tag LOCUS_14070 1444772 1445413 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902596.1 protein_id gnl|my_center|LOCUS_14070 1446945 1445431 gene locus_tag LOCUS_14080 1446945 1445431 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218083104.1 protein_id gnl|my_center|LOCUS_14080 1446954 1447793 gene locus_tag LOCUS_14090 1446954 1447793 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902346.1 protein_id gnl|my_center|LOCUS_14090 1448213 1447887 gene locus_tag LOCUS_14100 1448213 1447887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 1448575 1449594 gene locus_tag LOCUS_14110 1448575 1449594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1449581 1451938 gene locus_tag LOCUS_14120 1449581 1451938 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903005.1 protein_id gnl|my_center|LOCUS_14120 1452095 1453156 gene locus_tag LOCUS_14130 1452095 1453156 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876835.1 protein_id gnl|my_center|LOCUS_14130 1454072 1453164 gene locus_tag LOCUS_14140 1454072 1453164 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903787.1 protein_id gnl|my_center|LOCUS_14140 1454349 1455218 gene locus_tag LOCUS_14150 1454349 1455218 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289496.1 protein_id gnl|my_center|LOCUS_14150 1455685 1457214 gene locus_tag LOCUS_14160 1455685 1457214 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_14160 1457211 1458239 gene locus_tag LOCUS_14170 1457211 1458239 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902103.1 protein_id gnl|my_center|LOCUS_14170 1458287 1458628 gene locus_tag LOCUS_14180 1458287 1458628 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289111.1 protein_id gnl|my_center|LOCUS_14180 1458693 1459448 gene locus_tag LOCUS_14190 1458693 1459448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1460492 1459464 gene locus_tag LOCUS_14200 1460492 1459464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1461182 1460562 gene locus_tag LOCUS_14210 1461182 1460562 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361074.1 protein_id gnl|my_center|LOCUS_14210 1461324 1462388 gene locus_tag LOCUS_14220 gene dcyD 1461324 1462388 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365903.1 protein_id gnl|my_center|LOCUS_14220 1462461 1462757 gene locus_tag LOCUS_14230 1462461 1462757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1462936 1463853 gene locus_tag LOCUS_14240 1462936 1463853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1463854 1465284 gene locus_tag LOCUS_14250 1463854 1465284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990833.1 protein_id gnl|my_center|LOCUS_14250 1465345 1466760 gene locus_tag LOCUS_14260 gene thiD 1465345 1466760 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903947.1 protein_id gnl|my_center|LOCUS_14260 1467830 1466826 gene locus_tag LOCUS_14270 1467830 1466826 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903696.1 protein_id gnl|my_center|LOCUS_14270 1468007 1468153 gene locus_tag LOCUS_14280 1468007 1468153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1469617 1468295 gene locus_tag LOCUS_14290 1469617 1468295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1469758 1470864 gene locus_tag LOCUS_14300 1469758 1470864 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902643.1 protein_id gnl|my_center|LOCUS_14300 1470952 1472019 gene locus_tag LOCUS_14310 1470952 1472019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1472045 1472371 gene locus_tag LOCUS_14320 1472045 1472371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1472364 1472888 gene locus_tag LOCUS_14330 1472364 1472888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1473222 1472938 gene locus_tag LOCUS_14340 1473222 1472938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1473178 1474092 gene locus_tag LOCUS_14350 1473178 1474092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1474184 1475248 gene locus_tag LOCUS_14360 1474184 1475248 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902643.1 protein_id gnl|my_center|LOCUS_14360 1475289 1476599 gene locus_tag LOCUS_14370 1475289 1476599 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902557.1 protein_id gnl|my_center|LOCUS_14370 1476841 1476680 gene locus_tag LOCUS_14380 1476841 1476680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1476928 1477467 gene locus_tag LOCUS_14390 1476928 1477467 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930802.1 protein_id gnl|my_center|LOCUS_14390 1477470 1478678 gene locus_tag LOCUS_14400 1477470 1478678 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031626.1 protein_id gnl|my_center|LOCUS_14400 1478727 1479212 gene locus_tag LOCUS_14410 1478727 1479212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1479906 1479214 gene locus_tag LOCUS_14420 1479906 1479214 CDS product dolichol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289491.1 protein_id gnl|my_center|LOCUS_14420 1481704 1479911 gene locus_tag LOCUS_14430 gene glyS 1481704 1479911 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903756.1 protein_id gnl|my_center|LOCUS_14430 1482560 1481697 gene locus_tag LOCUS_14440 1482560 1481697 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903755.1 protein_id gnl|my_center|LOCUS_14440 1482866 1483483 gene locus_tag LOCUS_14450 1482866 1483483 CDS product protein sorting system archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289470.1 protein_id gnl|my_center|LOCUS_14450 1484752 1484093 gene locus_tag LOCUS_14460 1484752 1484093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1485609 1484866 gene locus_tag LOCUS_14470 1485609 1484866 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903677.1 protein_id gnl|my_center|LOCUS_14470 1486902 1485718 gene locus_tag LOCUS_14480 1486902 1485718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1487351 1486905 gene locus_tag LOCUS_14490 1487351 1486905 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188466.1 protein_id gnl|my_center|LOCUS_14490 1489648 1487348 gene locus_tag LOCUS_14500 1489648 1487348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1491585 1489747 gene locus_tag LOCUS_14510 1491585 1489747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1491757 1492506 gene locus_tag LOCUS_14520 1491757 1492506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1492591 1494996 gene locus_tag LOCUS_14530 1492591 1494996 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902063.1 protein_id gnl|my_center|LOCUS_14530 1495289 1496107 gene locus_tag LOCUS_14540 1495289 1496107 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903682.1 protein_id gnl|my_center|LOCUS_14540 1496299 1496117 gene locus_tag LOCUS_14550 1496299 1496117 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903684.1 protein_id gnl|my_center|LOCUS_14550 1498898 1496541 gene locus_tag LOCUS_14560 gene tatC 1498898 1496541 CDS product Sec-independent protein translocase TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903685.1 protein_id gnl|my_center|LOCUS_14560 1499766 1499365 gene locus_tag LOCUS_14570 1499766 1499365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1499807 1501327 gene locus_tag LOCUS_14580 1499807 1501327 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903869.1 protein_id gnl|my_center|LOCUS_14580 1501327 1503102 gene locus_tag LOCUS_14590 gene pheT 1501327 1503102 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903870.1 protein_id gnl|my_center|LOCUS_14590 1503610 1503203 gene locus_tag LOCUS_14600 1503610 1503203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 1504336 1503773 gene locus_tag LOCUS_14610 1504336 1503773 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_14610 1504474 1505784 gene locus_tag LOCUS_14620 1504474 1505784 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289469.1 protein_id gnl|my_center|LOCUS_14620 1505915 1506640 gene locus_tag LOCUS_14630 1505915 1506640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1507971 1506943 gene locus_tag LOCUS_14640 1507971 1506943 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903663.1 protein_id gnl|my_center|LOCUS_14640 1508126 1509115 gene locus_tag LOCUS_14650 1508126 1509115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1509112 1509822 gene locus_tag LOCUS_14660 1509112 1509822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1509929 1510210 gene locus_tag LOCUS_14670 1509929 1510210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903776.1 protein_id gnl|my_center|LOCUS_14670 1511083 1510280 gene locus_tag LOCUS_14680 1511083 1510280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903794.1 protein_id gnl|my_center|LOCUS_14680 1511481 1511897 gene locus_tag LOCUS_14690 1511481 1511897 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_14690 1513512 1511947 gene locus_tag LOCUS_14700 1513512 1511947 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903796.1 protein_id gnl|my_center|LOCUS_14700 1513641 1513859 gene locus_tag LOCUS_14710 1513641 1513859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1514739 1513810 gene locus_tag LOCUS_14720 1514739 1513810 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903797.1 protein_id gnl|my_center|LOCUS_14720 1515256 1514840 gene locus_tag LOCUS_14730 1515256 1514840 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289500.1 protein_id gnl|my_center|LOCUS_14730 1515890 1515261 gene locus_tag LOCUS_14740 1515890 1515261 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289501.1 protein_id gnl|my_center|LOCUS_14740 1517104 1519020 gene locus_tag LOCUS_14750 1517104 1519020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1519902 1519102 gene locus_tag LOCUS_14760 1519902 1519102 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903805.1 protein_id gnl|my_center|LOCUS_14760 1520889 1519942 gene locus_tag LOCUS_14770 1520889 1519942 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903805.1 protein_id gnl|my_center|LOCUS_14770 1520990 1522753 gene locus_tag LOCUS_14780 1520990 1522753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1524079 1523159 gene locus_tag LOCUS_14790 1524079 1523159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1525069 1524629 gene locus_tag LOCUS_14800 1525069 1524629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1525217 1526959 gene locus_tag LOCUS_14810 1525217 1526959 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903778.1 protein_id gnl|my_center|LOCUS_14810 1527026 1528285 gene locus_tag LOCUS_14820 1527026 1528285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1528341 1529150 gene locus_tag LOCUS_14830 gene pheA 1528341 1529150 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903649.1 protein_id gnl|my_center|LOCUS_14830 1529592 1530209 gene locus_tag LOCUS_14840 1529592 1530209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1530326 1531027 gene locus_tag LOCUS_14850 1530326 1531027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1534009 1531457 gene locus_tag LOCUS_14860 1534009 1531457 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903758.1 protein_id gnl|my_center|LOCUS_14860 1534214 1534435 gene locus_tag LOCUS_14870 1534214 1534435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1535096 1534509 gene locus_tag LOCUS_14880 1535096 1534509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1535820 1536596 gene locus_tag LOCUS_14890 1535820 1536596 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903932.1 protein_id gnl|my_center|LOCUS_14890 1536675 1537694 gene locus_tag LOCUS_14900 gene mer 1536675 1537694 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_14900 1537945 1537727 gene locus_tag LOCUS_14910 1537945 1537727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1538048 1538392 gene locus_tag LOCUS_14920 1538048 1538392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1538597 1539562 gene locus_tag LOCUS_14930 1538597 1539562 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_14930 1539564 1540637 gene locus_tag LOCUS_14940 1539564 1540637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1540634 1542919 gene locus_tag LOCUS_14950 1540634 1542919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1543028 1543321 gene locus_tag LOCUS_14960 gene yciH 1543028 1543321 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903930.1 protein_id gnl|my_center|LOCUS_14960 1544027 1543362 gene locus_tag LOCUS_14970 1544027 1543362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1544125 1545534 gene locus_tag LOCUS_14980 1544125 1545534 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_14980 1545572 1545892 gene locus_tag LOCUS_14990 1545572 1545892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1546287 1545913 gene locus_tag LOCUS_15000 1546287 1545913 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903929.1 protein_id gnl|my_center|LOCUS_15000 1546451 1547848 gene locus_tag LOCUS_15010 1546451 1547848 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_15010 1548721 1547915 gene locus_tag LOCUS_15020 1548721 1547915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1549638 1548718 gene locus_tag LOCUS_15030 1549638 1548718 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_15030 1549797 1550657 gene locus_tag LOCUS_15040 1549797 1550657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1551284 1550691 gene locus_tag LOCUS_15050 1551284 1550691 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903927.1 protein_id gnl|my_center|LOCUS_15050 1551793 1551281 gene locus_tag LOCUS_15060 1551793 1551281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1552362 1551790 gene locus_tag LOCUS_15070 1552362 1551790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1552763 1552485 gene locus_tag LOCUS_15080 1552763 1552485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1553800 1552766 gene locus_tag LOCUS_15090 1553800 1552766 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890413.1 protein_id gnl|my_center|LOCUS_15090 1555226 1553793 gene locus_tag LOCUS_15100 1555226 1553793 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890412.1 protein_id gnl|my_center|LOCUS_15100 1555453 1557276 gene locus_tag LOCUS_15110 gene ctaD 1555453 1557276 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902450.1 protein_id gnl|my_center|LOCUS_15110 1558897 1557458 gene locus_tag LOCUS_15120 1558897 1557458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1559389 1558970 gene locus_tag LOCUS_15130 1559389 1558970 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355850.1 protein_id gnl|my_center|LOCUS_15130 1559563 1560456 gene locus_tag LOCUS_15140 1559563 1560456 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061282.1 protein_id gnl|my_center|LOCUS_15140 1560876 1560583 gene locus_tag LOCUS_15150 1560876 1560583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1561544 1560873 gene locus_tag LOCUS_15160 1561544 1560873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1561507 1561845 gene locus_tag LOCUS_15170 1561507 1561845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1562054 1563217 gene locus_tag LOCUS_15180 1562054 1563217 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_15180 1563225 1564373 gene locus_tag LOCUS_15190 1563225 1564373 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289424.1 protein_id gnl|my_center|LOCUS_15190 1564926 1564450 gene locus_tag LOCUS_15200 1564926 1564450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1566618 1565029 gene locus_tag LOCUS_15210 1566618 1565029 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902970.1 protein_id gnl|my_center|LOCUS_15210 1568358 1566661 gene locus_tag LOCUS_15220 1568358 1566661 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_15220 1570825 1568480 gene locus_tag LOCUS_15230 1570825 1568480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1571935 1570847 gene locus_tag LOCUS_15240 1571935 1570847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1572373 1572681 gene locus_tag LOCUS_15250 1572373 1572681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1573646 1574863 gene locus_tag LOCUS_15260 1573646 1574863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1575073 1575396 gene locus_tag LOCUS_15270 1575073 1575396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1575868 1576179 gene locus_tag LOCUS_15280 1575868 1576179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1576172 1576570 gene locus_tag LOCUS_15290 1576172 1576570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128906461.1 protein_id gnl|my_center|LOCUS_15290 1576661 1577281 gene locus_tag LOCUS_15300 1576661 1577281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1577354 1578307 gene locus_tag LOCUS_15310 1577354 1578307 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904212.1 protein_id gnl|my_center|LOCUS_15310 1578917 1579393 gene locus_tag LOCUS_15320 1578917 1579393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1582887 1579405 gene locus_tag LOCUS_15330 1582887 1579405 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904032.1 protein_id gnl|my_center|LOCUS_15330 1583886 1583086 gene locus_tag LOCUS_15340 1583886 1583086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1583964 1584305 gene locus_tag LOCUS_15350 1583964 1584305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1585678 1584314 gene locus_tag LOCUS_15360 1585678 1584314 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289743.1 protein_id gnl|my_center|LOCUS_15360 1585773 1586411 gene locus_tag LOCUS_15370 1585773 1586411 CDS product IS6-like element ISH29 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289758.1 protein_id gnl|my_center|LOCUS_15370 1586540 1587082 gene locus_tag LOCUS_15380 1586540 1587082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1587088 1587603 gene locus_tag LOCUS_15390 1587088 1587603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1587760 1588623 gene locus_tag LOCUS_15400 1587760 1588623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1589261 1588794 gene locus_tag LOCUS_15410 1589261 1588794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1589566 1589886 gene locus_tag LOCUS_15420 1589566 1589886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1591198 1589888 gene locus_tag LOCUS_15430 1591198 1589888 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724359.1 protein_id gnl|my_center|LOCUS_15430 1591323 1592714 gene locus_tag LOCUS_15440 1591323 1592714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1593162 1592728 gene locus_tag LOCUS_15450 1593162 1592728 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904240.1 protein_id gnl|my_center|LOCUS_15450 1593338 1593568 gene locus_tag LOCUS_15460 1593338 1593568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1594045 1593584 gene locus_tag LOCUS_15470 1594045 1593584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1594345 1594770 gene locus_tag LOCUS_15480 1594345 1594770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1595130 1596143 gene locus_tag LOCUS_15490 1595130 1596143 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289724.1 protein_id gnl|my_center|LOCUS_15490 1596478 1596756 gene locus_tag LOCUS_15500 1596478 1596756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1598239 1599663 gene locus_tag LOCUS_15510 1598239 1599663 CDS product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904188.1 protein_id gnl|my_center|LOCUS_15510 1599660 1599941 gene locus_tag LOCUS_15520 1599660 1599941 CDS product DUF3006 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904187.1 protein_id gnl|my_center|LOCUS_15520 1601001 1601255 gene locus_tag LOCUS_15530 1601001 1601255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1601266 1603080 gene locus_tag LOCUS_15540 1601266 1603080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890505.1 protein_id gnl|my_center|LOCUS_15540 1603080 1603892 gene locus_tag LOCUS_15550 1603080 1603892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1603901 1605019 gene locus_tag LOCUS_15560 1603901 1605019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1605028 1606143 gene locus_tag LOCUS_15570 1605028 1606143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904034.1 protein_id gnl|my_center|LOCUS_15570 1606136 1608280 gene locus_tag LOCUS_15580 1606136 1608280 CDS product VirB4 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289607.1 protein_id gnl|my_center|LOCUS_15580 1608322 1608807 gene locus_tag LOCUS_15590 1608322 1608807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1608834 1610102 gene locus_tag LOCUS_15600 1608834 1610102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1610435 1611622 gene locus_tag LOCUS_15610 1610435 1611622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1611749 1612036 gene locus_tag LOCUS_15620 1611749 1612036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1612138 1613145 gene locus_tag LOCUS_15630 1612138 1613145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1613299 1614117 gene locus_tag LOCUS_15640 1613299 1614117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1614898 1614167 gene locus_tag LOCUS_15650 1614898 1614167 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890736.1 protein_id gnl|my_center|LOCUS_15650 1615166 1617070 gene locus_tag LOCUS_15660 1615166 1617070 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902249.1 protein_id gnl|my_center|LOCUS_15660 1617564 1617121 gene locus_tag LOCUS_15670 1617564 1617121 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903106.1 protein_id gnl|my_center|LOCUS_15670 1620148 1617710 gene locus_tag LOCUS_15680 1620148 1617710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1617835 1617912 gene locus_tag LOCUS_t00180 1617835 1617912 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1622849 1620243 gene locus_tag LOCUS_15690 1622849 1620243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1623014 1625914 gene locus_tag LOCUS_15700 gene mutS 1623014 1625914 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902083.1 protein_id gnl|my_center|LOCUS_15700 1626295 1625927 gene locus_tag LOCUS_15710 1626295 1625927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1626567 1626292 gene locus_tag LOCUS_15720 1626567 1626292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1626871 1627464 gene locus_tag LOCUS_15730 1626871 1627464 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902507.1 protein_id gnl|my_center|LOCUS_15730 1628150 1627497 gene locus_tag LOCUS_15740 1628150 1627497 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404988.1 protein_id gnl|my_center|LOCUS_15740 1629639 1628173 gene locus_tag LOCUS_15750 1629639 1628173 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904092.1 protein_id gnl|my_center|LOCUS_15750 1629862 1630881 gene locus_tag LOCUS_15760 1629862 1630881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1630949 1631632 gene locus_tag LOCUS_15770 1630949 1631632 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289497.1 protein_id gnl|my_center|LOCUS_15770 1631676 1632131 gene locus_tag LOCUS_15780 1631676 1632131 CDS product DUF2391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903792.1 protein_id gnl|my_center|LOCUS_15780 1632431 1633639 gene locus_tag LOCUS_15790 gene ilvA 1632431 1633639 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903546.1 protein_id gnl|my_center|LOCUS_15790 1633886 1634920 gene locus_tag LOCUS_15800 gene radA 1633886 1634920 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289511.1 protein_id gnl|my_center|LOCUS_15800 1636015 1634960 gene locus_tag LOCUS_15810 gene endA 1636015 1634960 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903640.1 protein_id gnl|my_center|LOCUS_15810 1636885 1636097 gene locus_tag LOCUS_15820 1636885 1636097 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903641.1 protein_id gnl|my_center|LOCUS_15820 1638975 1637362 gene locus_tag LOCUS_15830 1638975 1637362 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903639.1 protein_id gnl|my_center|LOCUS_15830 1640712 1639129 gene locus_tag LOCUS_15840 gene serA 1640712 1639129 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903813.1 protein_id gnl|my_center|LOCUS_15840 1641585 1640833 gene locus_tag LOCUS_15850 1641585 1640833 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967667.1 protein_id gnl|my_center|LOCUS_15850 1641759 1643636 gene locus_tag LOCUS_15860 1641759 1643636 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903956.1 protein_id gnl|my_center|LOCUS_15860 1643733 1646120 gene locus_tag LOCUS_15870 1643733 1646120 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903642.1 protein_id gnl|my_center|LOCUS_15870 1646257 1647075 gene locus_tag LOCUS_15880 1646257 1647075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1647190 1647771 gene locus_tag LOCUS_15890 1647190 1647771 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903728.1 protein_id gnl|my_center|LOCUS_15890 1647793 1648491 gene locus_tag LOCUS_15900 1647793 1648491 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903729.1 protein_id gnl|my_center|LOCUS_15900 1648547 1649284 gene locus_tag LOCUS_15910 1648547 1649284 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289483.1 protein_id gnl|my_center|LOCUS_15910 1649350 1651446 gene locus_tag LOCUS_15920 1649350 1651446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 1652958 1651702 gene locus_tag LOCUS_15930 1652958 1651702 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_15930 1654014 1653052 gene locus_tag LOCUS_15940 1654014 1653052 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289328.1 protein_id gnl|my_center|LOCUS_15940 1654782 1654078 gene locus_tag LOCUS_15950 1654782 1654078 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532996.1 protein_id gnl|my_center|LOCUS_15950 1655624 1654779 gene locus_tag LOCUS_15960 1655624 1654779 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532995.1 protein_id gnl|my_center|LOCUS_15960 1656751 1655621 gene locus_tag LOCUS_15970 1656751 1655621 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083027.1 protein_id gnl|my_center|LOCUS_15970 1657694 1656753 gene locus_tag LOCUS_15980 gene urtB 1657694 1656753 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215689.1 protein_id gnl|my_center|LOCUS_15980 1658989 1657691 gene locus_tag LOCUS_15990 gene urtA 1658989 1657691 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_15990 1660158 1659439 gene locus_tag LOCUS_16000 1660158 1659439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1660355 1660804 gene locus_tag LOCUS_16010 1660355 1660804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1660801 1662507 gene locus_tag LOCUS_16020 gene ureC 1660801 1662507 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267497.1 protein_id gnl|my_center|LOCUS_16020 1662504 1662866 gene locus_tag LOCUS_16030 1662504 1662866 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058500.1 protein_id gnl|my_center|LOCUS_16030 1662863 1663486 gene locus_tag LOCUS_16040 gene ureG 1662863 1663486 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103989.1 protein_id gnl|my_center|LOCUS_16040 1663486 1664478 gene locus_tag LOCUS_16050 1663486 1664478 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815718.1 protein_id gnl|my_center|LOCUS_16050 1664478 1665083 gene locus_tag LOCUS_16060 1664478 1665083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1665080 1665775 gene locus_tag LOCUS_16070 1665080 1665775 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164256.1 protein_id gnl|my_center|LOCUS_16070 1665887 1668133 gene locus_tag LOCUS_16080 1665887 1668133 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903183.1 protein_id gnl|my_center|LOCUS_16080 1670184 1668178 gene locus_tag LOCUS_16090 1670184 1668178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1670789 1670403 gene locus_tag LOCUS_16100 1670789 1670403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1670894 1672837 gene locus_tag LOCUS_16110 1670894 1672837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1673813 1672983 gene locus_tag LOCUS_16120 1673813 1672983 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892776.1 protein_id gnl|my_center|LOCUS_16120 1674025 1675518 gene locus_tag LOCUS_16130 gene fadD5 1674025 1675518 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726688.1 protein_id gnl|my_center|LOCUS_16130 1676175 1675552 gene locus_tag LOCUS_16140 1676175 1675552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1677797 1676256 gene locus_tag LOCUS_16150 1677797 1676256 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903449.1 protein_id gnl|my_center|LOCUS_16150 1679149 1677794 gene locus_tag LOCUS_16160 gene glpB 1679149 1677794 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903448.1 protein_id gnl|my_center|LOCUS_16160 1680843 1679167 gene locus_tag LOCUS_16170 gene glpA 1680843 1679167 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903447.1 protein_id gnl|my_center|LOCUS_16170 1681080 1682633 gene locus_tag LOCUS_16180 gene glpK 1681080 1682633 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903446.1 protein_id gnl|my_center|LOCUS_16180 1683350 1682643 gene locus_tag LOCUS_16190 1683350 1682643 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903683.1 protein_id gnl|my_center|LOCUS_16190 1683686 1684588 gene locus_tag LOCUS_16200 1683686 1684588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1686277 1684730 gene locus_tag LOCUS_16210 1686277 1684730 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224018.1 protein_id gnl|my_center|LOCUS_16210 1686675 1686274 gene locus_tag LOCUS_16220 1686675 1686274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1687148 1686675 gene locus_tag LOCUS_16230 1687148 1686675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1687192 1688328 gene locus_tag LOCUS_16240 1687192 1688328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1688330 1688770 gene locus_tag LOCUS_16250 1688330 1688770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1689717 1688806 gene locus_tag LOCUS_16260 1689717 1688806 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403067.1 protein_id gnl|my_center|LOCUS_16260 1690543 1689887 gene locus_tag LOCUS_16270 1690543 1689887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1690676 1692391 gene locus_tag LOCUS_16280 1690676 1692391 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902435.1 protein_id gnl|my_center|LOCUS_16280 1692394 1692699 gene locus_tag LOCUS_16290 1692394 1692699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903983.1 protein_id gnl|my_center|LOCUS_16290 1692814 1693437 gene locus_tag LOCUS_16300 1692814 1693437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1693662 1695116 gene locus_tag LOCUS_16310 1693662 1695116 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_16310 1695212 1695676 gene locus_tag LOCUS_16320 1695212 1695676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1698693 1695940 gene locus_tag LOCUS_16330 gene mutS 1698693 1695940 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902076.1 protein_id gnl|my_center|LOCUS_16330 1698890 1699303 gene locus_tag LOCUS_16340 gene trxA 1698890 1699303 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890427.1 protein_id gnl|my_center|LOCUS_16340 1699379 1700110 gene locus_tag LOCUS_16350 1699379 1700110 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902216.1 protein_id gnl|my_center|LOCUS_16350 1700389 1700129 gene locus_tag LOCUS_16360 1700389 1700129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1700783 1700469 gene locus_tag LOCUS_16370 1700783 1700469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1702067 1700934 gene locus_tag LOCUS_16380 1702067 1700934 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902856.1 protein_id gnl|my_center|LOCUS_16380 1702165 1702827 gene locus_tag LOCUS_16390 1702165 1702827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1703199 1702858 gene locus_tag LOCUS_16400 1703199 1702858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1703447 1703196 gene locus_tag LOCUS_16410 1703447 1703196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1703784 1704305 gene locus_tag LOCUS_16420 1703784 1704305 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903885.1 protein_id gnl|my_center|LOCUS_16420 1705555 1704356 gene locus_tag LOCUS_16430 1705555 1704356 CDS product TIGR04347 family pseudo-SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902854.1 protein_id gnl|my_center|LOCUS_16430 1705863 1705552 gene locus_tag LOCUS_16440 1705863 1705552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 1707168 1706002 gene locus_tag LOCUS_16450 gene mthRnl 1707168 1706002 CDS product ATP-dependent RNA/DNA ligase MthRnl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060995.1 protein_id gnl|my_center|LOCUS_16450 1707304 1707978 gene locus_tag LOCUS_16460 1707304 1707978 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879429.1 protein_id gnl|my_center|LOCUS_16460 1709208 1708042 gene locus_tag LOCUS_16470 gene trpB 1709208 1708042 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064422.1 protein_id gnl|my_center|LOCUS_16470 1709598 1710302 gene locus_tag LOCUS_16480 1709598 1710302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1710437 1710742 gene locus_tag LOCUS_16490 1710437 1710742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1710815 1711177 gene locus_tag LOCUS_16500 1710815 1711177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1711272 1711691 gene locus_tag LOCUS_16510 1711272 1711691 CDS product deoxycytidine triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838163.1 protein_id gnl|my_center|LOCUS_16510 1711737 1713068 gene locus_tag LOCUS_16520 1711737 1713068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1713195 1713986 gene locus_tag LOCUS_16530 1713195 1713986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1713989 1714963 gene locus_tag LOCUS_16540 1713989 1714963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1714965 1715885 gene locus_tag LOCUS_16550 1714965 1715885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1717985 1715910 gene locus_tag LOCUS_16560 1717985 1715910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1718010 1720370 gene locus_tag LOCUS_16570 1718010 1720370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1720652 1721605 gene locus_tag LOCUS_16580 gene kdgK1 1720652 1721605 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902071.1 protein_id gnl|my_center|LOCUS_16580 1721841 1723154 gene locus_tag LOCUS_16590 1721841 1723154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 1723311 1723790 gene locus_tag LOCUS_16600 1723311 1723790 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903982.1 protein_id gnl|my_center|LOCUS_16600 1724181 1723906 gene locus_tag LOCUS_16610 1724181 1723906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1724337 1725065 gene locus_tag LOCUS_16620 1724337 1725065 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903867.1 protein_id gnl|my_center|LOCUS_16620 1725153 1725806 gene locus_tag LOCUS_16630 1725153 1725806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1726136 1727020 gene locus_tag LOCUS_16640 1726136 1727020 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902091.1 protein_id gnl|my_center|LOCUS_16640 1727116 1727355 gene locus_tag LOCUS_16650 1727116 1727355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1727535 1728929 gene locus_tag LOCUS_16660 1727535 1728929 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_16660 1729643 1728984 gene locus_tag LOCUS_16670 1729643 1728984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1730424 1729738 gene locus_tag LOCUS_16680 1730424 1729738 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902596.1 protein_id gnl|my_center|LOCUS_16680 1730562 1731353 gene locus_tag LOCUS_16690 1730562 1731353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1731460 1733505 gene locus_tag LOCUS_16700 1731460 1733505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1734814 1733630 gene locus_tag LOCUS_16710 1734814 1733630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1735281 1734835 gene locus_tag LOCUS_16720 1735281 1734835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1735873 1735799 gene locus_tag LOCUS_t00190 1735873 1735799 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1736104 1736646 gene locus_tag LOCUS_16730 1736104 1736646 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289117.1 protein_id gnl|my_center|LOCUS_16730 1737005 1737181 gene locus_tag LOCUS_16740 1737005 1737181 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902100.1 protein_id gnl|my_center|LOCUS_16740 1737185 1738360 gene locus_tag LOCUS_16750 gene ftsZ 1737185 1738360 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289116.1 protein_id gnl|my_center|LOCUS_16750 1738525 1739208 gene locus_tag LOCUS_16760 1738525 1739208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902481.1 protein_id gnl|my_center|LOCUS_16760 1740435 1739380 gene locus_tag LOCUS_16770 1740435 1739380 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902098.1 protein_id gnl|my_center|LOCUS_16770 1741533 1741237 gene locus_tag LOCUS_16780 1741533 1741237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1741808 1741536 gene locus_tag LOCUS_16790 1741808 1741536 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_16790 1742800 1741904 gene locus_tag LOCUS_16800 1742800 1741904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1743598 1742966 gene locus_tag LOCUS_16810 1743598 1742966 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903176.1 protein_id gnl|my_center|LOCUS_16810 1744409 1743615 gene locus_tag LOCUS_16820 1744409 1743615 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289114.1 protein_id gnl|my_center|LOCUS_16820 1744739 1744533 gene locus_tag LOCUS_16830 1744739 1744533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1745093 1745758 gene locus_tag LOCUS_16840 1745093 1745758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902206.1 protein_id gnl|my_center|LOCUS_16840 1745777 1747951 gene locus_tag LOCUS_16850 1745777 1747951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903117.1 protein_id gnl|my_center|LOCUS_16850 1748096 1747953 gene locus_tag LOCUS_16860 1748096 1747953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1748289 1749053 gene locus_tag LOCUS_16870 1748289 1749053 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878199.1 protein_id gnl|my_center|LOCUS_16870 1749437 1749195 gene locus_tag LOCUS_16880 1749437 1749195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1750584 1749694 gene locus_tag LOCUS_16890 1750584 1749694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1751996 1750761 gene locus_tag LOCUS_16900 1751996 1750761 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289074.1 protein_id gnl|my_center|LOCUS_16900 1752977 1753891 gene locus_tag LOCUS_16910 1752977 1753891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1754769 1754161 gene locus_tag LOCUS_16920 1754769 1754161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1755009 1755695 gene locus_tag LOCUS_16930 1755009 1755695 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259454.1 protein_id gnl|my_center|LOCUS_16930 1756085 1755774 gene locus_tag LOCUS_16940 1756085 1755774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1756017 1756223 gene locus_tag LOCUS_16950 1756017 1756223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1758693 1756306 gene locus_tag LOCUS_16960 1758693 1756306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1759550 1758690 gene locus_tag LOCUS_16970 1759550 1758690 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903387.1 protein_id gnl|my_center|LOCUS_16970 1759820 1760710 gene locus_tag LOCUS_16980 1759820 1760710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1761005 1761949 gene locus_tag LOCUS_16990 1761005 1761949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_16990 1761946 1762779 gene locus_tag LOCUS_17000 1761946 1762779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1763138 1763452 gene locus_tag LOCUS_17010 1763138 1763452 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904114.1 protein_id gnl|my_center|LOCUS_17010 1764645 1763770 gene locus_tag LOCUS_17020 1764645 1763770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1765449 1764646 gene locus_tag LOCUS_17030 1765449 1764646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1766413 1765517 gene locus_tag LOCUS_17040 1766413 1765517 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060859.1 protein_id gnl|my_center|LOCUS_17040 1767100 1766420 gene locus_tag LOCUS_17050 1767100 1766420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1767260 1767658 gene locus_tag LOCUS_17060 1767260 1767658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1767673 1768569 gene locus_tag LOCUS_17070 1767673 1768569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1772654 1769007 gene locus_tag LOCUS_17080 1772654 1769007 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904032.1 protein_id gnl|my_center|LOCUS_17080 1771023 1770927 gene locus_tag LOCUS_t00200 1771023 1770927 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1773767 1773979 gene locus_tag LOCUS_17090 1773767 1773979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1774726 1774505 gene locus_tag LOCUS_17100 1774726 1774505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1774921 1775988 gene locus_tag LOCUS_17110 1774921 1775988 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_17110 1779484 1776806 gene locus_tag LOCUS_17120 1779484 1776806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1780276 1779491 gene locus_tag LOCUS_17130 gene cas5b 1780276 1779491 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082347.1 protein_id gnl|my_center|LOCUS_17130 1781345 1780308 gene locus_tag LOCUS_17140 gene cas7b 1781345 1780308 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_17140 1783474 1781351 gene locus_tag LOCUS_17150 1783474 1781351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1784265 1783471 gene locus_tag LOCUS_17160 1784265 1783471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 1784414 1784980 gene locus_tag LOCUS_17170 gene cas4 1784414 1784980 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545751.1 protein_id gnl|my_center|LOCUS_17170 1784983 1785984 gene locus_tag LOCUS_17180 gene cas1b 1784983 1785984 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545291.1 protein_id gnl|my_center|LOCUS_17180 1785985 1786245 gene locus_tag LOCUS_17190 1785985 1786245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1786352 1793136 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccagacgcacctttgaggggttgaagc 1793330 1794163 gene locus_tag LOCUS_17200 1793330 1794163 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902092.1 protein_id gnl|my_center|LOCUS_17200 1794273 1795175 gene locus_tag LOCUS_17210 1794273 1795175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1795175 1795882 gene locus_tag LOCUS_17220 1795175 1795882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902481.1 protein_id gnl|my_center|LOCUS_17220 1797413 1795902 gene locus_tag LOCUS_17230 1797413 1795902 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902970.1 protein_id gnl|my_center|LOCUS_17230 1798343 1797540 gene locus_tag LOCUS_17240 1798343 1797540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1798533 1799618 gene locus_tag LOCUS_17250 1798533 1799618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1800389 1799703 gene locus_tag LOCUS_17260 1800389 1799703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289115.1 protein_id gnl|my_center|LOCUS_17260 1800951 1800454 gene locus_tag LOCUS_17270 1800951 1800454 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099189.1 protein_id gnl|my_center|LOCUS_17270 1801053 1801538 gene locus_tag LOCUS_17280 1801053 1801538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1801838 1802344 gene locus_tag LOCUS_17290 1801838 1802344 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289104.1 protein_id gnl|my_center|LOCUS_17290 1802337 1803029 gene locus_tag LOCUS_17300 1802337 1803029 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892603.1 protein_id gnl|my_center|LOCUS_17300 1803573 1803358 gene locus_tag LOCUS_17310 1803573 1803358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1805037 1804030 gene locus_tag LOCUS_17320 1805037 1804030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1806218 1805034 gene locus_tag LOCUS_17330 1806218 1805034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1807039 1806215 gene locus_tag LOCUS_17340 1807039 1806215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1808592 1807246 gene locus_tag LOCUS_17350 1808592 1807246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1810013 1808715 gene locus_tag LOCUS_17360 1810013 1808715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 1811915 1810191 gene locus_tag LOCUS_17370 1811915 1810191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1813059 1812010 gene locus_tag LOCUS_17380 1813059 1812010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1813391 1813948 gene locus_tag LOCUS_17390 1813391 1813948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1814102 1814758 gene locus_tag LOCUS_17400 1814102 1814758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005553844.1 protein_id gnl|my_center|LOCUS_17400 1814833 1815114 gene locus_tag LOCUS_17410 1814833 1815114 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902560.1 protein_id gnl|my_center|LOCUS_17410 1816018 1815182 gene locus_tag LOCUS_17420 1816018 1815182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 1816201 1817391 gene locus_tag LOCUS_17430 1816201 1817391 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978098.1 protein_id gnl|my_center|LOCUS_17430 1817893 1818342 gene locus_tag LOCUS_17440 1817893 1818342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 1818577 1818894 gene locus_tag LOCUS_17450 1818577 1818894 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903507.1 protein_id gnl|my_center|LOCUS_17450 1818899 1819030 gene locus_tag LOCUS_17460 1818899 1819030 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903506.1 protein_id gnl|my_center|LOCUS_17460 1819141 1820793 gene locus_tag LOCUS_17470 1819141 1820793 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903505.1 protein_id gnl|my_center|LOCUS_17470 1821076 1821348 gene locus_tag LOCUS_17480 1821076 1821348 CDS product DUF5808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903504.1 protein_id gnl|my_center|LOCUS_17480 1821603 1822130 gene locus_tag LOCUS_17490 1821603 1822130 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289427.1 protein_id gnl|my_center|LOCUS_17490 1823178 1822138 gene locus_tag LOCUS_17500 1823178 1822138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 1823271 1824713 gene locus_tag LOCUS_17510 1823271 1824713 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903692.1 protein_id gnl|my_center|LOCUS_17510 1825225 1824758 gene locus_tag LOCUS_17520 1825225 1824758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1825739 1825230 gene locus_tag LOCUS_17530 1825739 1825230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1826035 1825835 gene locus_tag LOCUS_17540 1826035 1825835 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289475.1 protein_id gnl|my_center|LOCUS_17540 1826199 1827359 gene locus_tag LOCUS_17550 gene citZ 1826199 1827359 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903548.1 protein_id gnl|my_center|LOCUS_17550 1827532 1828185 gene locus_tag LOCUS_17560 1827532 1828185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1828241 1828651 gene locus_tag LOCUS_17570 1828241 1828651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1829335 1828709 gene locus_tag LOCUS_17580 1829335 1828709 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903563.1 protein_id gnl|my_center|LOCUS_17580 1830178 1829435 gene locus_tag LOCUS_17590 gene fabG 1830178 1829435 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_17590 1831768 1830284 gene locus_tag LOCUS_17600 1831768 1830284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1832312 1831770 gene locus_tag LOCUS_17610 1832312 1831770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 1832804 1832463 gene locus_tag LOCUS_17620 1832804 1832463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1832941 1833579 gene locus_tag LOCUS_17630 1832941 1833579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1834466 1833588 gene locus_tag LOCUS_17640 1834466 1833588 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812528.1 protein_id gnl|my_center|LOCUS_17640 1835195 1834653 gene locus_tag LOCUS_17650 gene cgi121 1835195 1834653 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903768.1 protein_id gnl|my_center|LOCUS_17650 1837486 1835195 gene locus_tag LOCUS_17660 1837486 1835195 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903767.1 protein_id gnl|my_center|LOCUS_17660 1837630 1839024 gene locus_tag LOCUS_17670 1837630 1839024 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903655.1 protein_id gnl|my_center|LOCUS_17670 1840608 1839052 gene locus_tag LOCUS_17680 1840608 1839052 CDS product single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902049.1 protein_id gnl|my_center|LOCUS_17680 1841268 1840672 gene locus_tag LOCUS_17690 1841268 1840672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902481.1 protein_id gnl|my_center|LOCUS_17690 1841470 1841542 gene locus_tag LOCUS_t00210 1841470 1841542 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1841676 1842347 gene locus_tag LOCUS_17700 1841676 1842347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902048.1 protein_id gnl|my_center|LOCUS_17700 1842941 1842432 gene locus_tag LOCUS_17710 1842941 1842432 CDS product YfcE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228757.1 protein_id gnl|my_center|LOCUS_17710 1843396 1843160 gene locus_tag LOCUS_17720 1843396 1843160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1843544 1844911 gene locus_tag LOCUS_17730 1843544 1844911 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289743.1 protein_id gnl|my_center|LOCUS_17730 1844973 1846364 gene locus_tag LOCUS_17740 1844973 1846364 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838397.1 protein_id gnl|my_center|LOCUS_17740 1846907 1846365 gene locus_tag LOCUS_17750 1846907 1846365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 1847004 1847189 gene locus_tag LOCUS_17760 1847004 1847189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1847345 1849966 gene locus_tag LOCUS_17770 1847345 1849966 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902482.1 protein_id gnl|my_center|LOCUS_17770 1850595 1850083 gene locus_tag LOCUS_17780 1850595 1850083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1851280 1850588 gene locus_tag LOCUS_17790 1851280 1850588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 1851738 1851493 gene locus_tag LOCUS_17800 1851738 1851493 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771148.1 protein_id gnl|my_center|LOCUS_17800 1852015 1852341 gene locus_tag LOCUS_17810 1852015 1852341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 1852499 1852951 gene locus_tag LOCUS_17820 1852499 1852951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1853172 1853672 gene locus_tag LOCUS_17830 1853172 1853672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1854877 1853780 gene locus_tag LOCUS_17840 1854877 1853780 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902112.1 protein_id gnl|my_center|LOCUS_17840 1855353 1854880 gene locus_tag LOCUS_17850 1855353 1854880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 1855798 1855346 gene locus_tag LOCUS_17860 1855798 1855346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 1856245 1857615 gene locus_tag LOCUS_17870 1856245 1857615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 1859190 1858192 gene locus_tag LOCUS_17880 1859190 1858192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 1859989 1859183 gene locus_tag LOCUS_17890 1859989 1859183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1860570 1860079 gene locus_tag LOCUS_17900 1860570 1860079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1861703 1860567 gene locus_tag LOCUS_17910 1861703 1860567 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135535622.1 protein_id gnl|my_center|LOCUS_17910 1861970 1861734 gene locus_tag LOCUS_17920 1861970 1861734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1862295 1862552 gene locus_tag LOCUS_17930 1862295 1862552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903452.1 protein_id gnl|my_center|LOCUS_17930 1862865 1866293 gene locus_tag LOCUS_17940 1862865 1866293 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890482.1 protein_id gnl|my_center|LOCUS_17940 1867585 1866290 gene locus_tag LOCUS_17950 1867585 1866290 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_17950 1869688 1867631 gene locus_tag LOCUS_17960 1869688 1867631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1870071 1870862 gene locus_tag LOCUS_17970 1870071 1870862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1873823 1870890 gene locus_tag LOCUS_17980 1873823 1870890 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890482.1 protein_id gnl|my_center|LOCUS_17980 1873937 1874818 gene locus_tag LOCUS_17990 1873937 1874818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1874901 1875947 gene locus_tag LOCUS_18000 1874901 1875947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1876363 1876055 gene locus_tag LOCUS_18010 1876363 1876055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18010 1876889 1876356 gene locus_tag LOCUS_18020 1876889 1876356 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890481.1 protein_id gnl|my_center|LOCUS_18020 1881223 1876946 gene locus_tag LOCUS_18030 1881223 1876946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 1881327 1884077 gene locus_tag LOCUS_18040 1881327 1884077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1884081 1887902 gene locus_tag LOCUS_18050 1884081 1887902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1887909 1889870 gene locus_tag LOCUS_18060 1887909 1889870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1889917 1890852 gene locus_tag LOCUS_18070 1889917 1890852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1892330 1891077 gene locus_tag LOCUS_18080 1892330 1891077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 1892452 1893453 gene locus_tag LOCUS_18090 1892452 1893453 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289552.1 protein_id gnl|my_center|LOCUS_18090 1893591 1894274 gene locus_tag LOCUS_18100 1893591 1894274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 1894261 1894536 gene locus_tag LOCUS_18110 1894261 1894536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1894536 1896668 gene locus_tag LOCUS_18120 1894536 1896668 CDS product type B DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904193.1 protein_id gnl|my_center|LOCUS_18120 1897200 1898156 gene locus_tag LOCUS_18130 1897200 1898156 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249806.1 protein_id gnl|my_center|LOCUS_18130 1899858 1898218 gene locus_tag LOCUS_18140 1899858 1898218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 1900276 1900046 gene locus_tag LOCUS_18150 1900276 1900046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1900375 1900761 gene locus_tag LOCUS_18160 1900375 1900761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1901902 1900805 gene locus_tag LOCUS_18170 1901902 1900805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1902252 1901995 gene locus_tag LOCUS_18180 1902252 1901995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1902595 1902975 gene locus_tag LOCUS_18190 1902595 1902975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1904855 1903041 gene locus_tag LOCUS_18200 1904855 1903041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1906260 1905205 gene locus_tag LOCUS_18210 1906260 1905205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1906509 1907222 gene locus_tag LOCUS_18220 1906509 1907222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1907554 1908828 gene locus_tag LOCUS_18230 1907554 1908828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1910079 1909030 gene locus_tag LOCUS_18240 1910079 1909030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1910239 1910865 gene locus_tag LOCUS_18250 1910239 1910865 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090561.1 protein_id gnl|my_center|LOCUS_18250 1911230 1910889 gene locus_tag LOCUS_18260 1911230 1910889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1912753 1911566 gene locus_tag LOCUS_18270 1912753 1911566 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229643.1 protein_id gnl|my_center|LOCUS_18270 1912958 1913593 gene locus_tag LOCUS_18280 1912958 1913593 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902402.1 protein_id gnl|my_center|LOCUS_18280 1913746 1914687 gene locus_tag LOCUS_18290 1913746 1914687 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840054.1 protein_id gnl|my_center|LOCUS_18290 1914748 1915170 gene locus_tag LOCUS_18300 1914748 1915170 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902412.1 protein_id gnl|my_center|LOCUS_18300 1916598 1915336 gene locus_tag LOCUS_18310 1916598 1915336 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123282.1 protein_id gnl|my_center|LOCUS_18310 1917422 1916739 gene locus_tag LOCUS_18320 1917422 1916739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1917592 1918107 gene locus_tag LOCUS_18330 1917592 1918107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 1918998 1918237 gene locus_tag LOCUS_18340 1918998 1918237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1919362 1919021 gene locus_tag LOCUS_18350 1919362 1919021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 1919938 1919585 gene locus_tag LOCUS_18360 1919938 1919585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1920315 1919995 gene locus_tag LOCUS_18370 1920315 1919995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 1920402 1920614 gene locus_tag LOCUS_18380 1920402 1920614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 1920563 1921096 gene locus_tag LOCUS_18390 1920563 1921096 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902409.1 protein_id gnl|my_center|LOCUS_18390 1921733 1921143 gene locus_tag LOCUS_18400 1921733 1921143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1923269 1921866 gene locus_tag LOCUS_18410 1923269 1921866 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_18410 1923870 1923376 gene locus_tag LOCUS_18420 1923870 1923376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 1924891 1923785 gene locus_tag LOCUS_18430 1924891 1923785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 1926069 1924906 gene locus_tag LOCUS_18440 1926069 1924906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1926538 1926092 gene locus_tag LOCUS_18450 1926538 1926092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18450 1927584 1926850 gene locus_tag LOCUS_18460 1927584 1926850 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892625.1 protein_id gnl|my_center|LOCUS_18460 1927673 1928968 gene locus_tag LOCUS_18470 1927673 1928968 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890424.1 protein_id gnl|my_center|LOCUS_18470 1929631 1929023 gene locus_tag LOCUS_18480 1929631 1929023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1930323 1929676 gene locus_tag LOCUS_18490 1930323 1929676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1930663 1931514 gene locus_tag LOCUS_18500 gene surE 1930663 1931514 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902899.1 protein_id gnl|my_center|LOCUS_18500 1931851 1932930 gene locus_tag LOCUS_18510 1931851 1932930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1932955 1934097 gene locus_tag LOCUS_18520 1932955 1934097 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903082.1 protein_id gnl|my_center|LOCUS_18520 1934438 1934854 gene locus_tag LOCUS_18530 1934438 1934854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1934859 1936130 gene locus_tag LOCUS_18540 1934859 1936130 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405030.1 protein_id gnl|my_center|LOCUS_18540 1936229 1937161 gene locus_tag LOCUS_18550 1936229 1937161 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902500.1 protein_id gnl|my_center|LOCUS_18550 1937289 1937678 gene locus_tag LOCUS_18560 1937289 1937678 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903020.1 protein_id gnl|my_center|LOCUS_18560 1938526 1937798 gene locus_tag LOCUS_18570 1938526 1937798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 1938614 1939288 gene locus_tag LOCUS_18580 1938614 1939288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1939403 1941796 gene locus_tag LOCUS_18590 1939403 1941796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1943006 1942104 gene locus_tag LOCUS_18600 1943006 1942104 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296694.1 protein_id gnl|my_center|LOCUS_18600 1943064 1943360 gene locus_tag LOCUS_18610 1943064 1943360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 1945076 1943556 gene locus_tag LOCUS_18620 1945076 1943556 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902539.1 protein_id gnl|my_center|LOCUS_18620 1945222 1945968 gene locus_tag LOCUS_18630 1945222 1945968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 1946823 1945996 gene locus_tag LOCUS_18640 1946823 1945996 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903562.1 protein_id gnl|my_center|LOCUS_18640 1946995 1948272 gene locus_tag LOCUS_18650 1946995 1948272 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_18650 1948279 1949220 gene locus_tag LOCUS_18660 1948279 1949220 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532983.1 protein_id gnl|my_center|LOCUS_18660 1949222 1950400 gene locus_tag LOCUS_18670 1949222 1950400 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391162.1 protein_id gnl|my_center|LOCUS_18670 1950393 1951268 gene locus_tag LOCUS_18680 1950393 1951268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_18680 1951271 1952089 gene locus_tag LOCUS_18690 1951271 1952089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_18690 1952086 1953021 gene locus_tag LOCUS_18700 1952086 1953021 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814724.1 protein_id gnl|my_center|LOCUS_18700 1955354 1953183 gene locus_tag LOCUS_18710 1955354 1953183 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902898.1 protein_id gnl|my_center|LOCUS_18710 1955758 1955351 gene locus_tag LOCUS_18720 1955758 1955351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 1955957 1956427 gene locus_tag LOCUS_18730 1955957 1956427 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902895.1 protein_id gnl|my_center|LOCUS_18730 1957493 1956540 gene locus_tag LOCUS_18740 1957493 1956540 CDS product R2-like ligand-binding oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259170.1 protein_id gnl|my_center|LOCUS_18740 1957634 1958644 gene locus_tag LOCUS_18750 1957634 1958644 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_18750 1959878 1958778 gene locus_tag LOCUS_18760 1959878 1958778 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135662722.1 protein_id gnl|my_center|LOCUS_18760 1961417 1959924 gene locus_tag LOCUS_18770 1961417 1959924 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903741.1 protein_id gnl|my_center|LOCUS_18770 1961506 1961769 gene locus_tag LOCUS_18780 1961506 1961769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1961821 1962981 gene locus_tag LOCUS_18790 1961821 1962981 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903905.1 protein_id gnl|my_center|LOCUS_18790 1962978 1963886 gene locus_tag LOCUS_18800 1962978 1963886 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903715.1 protein_id gnl|my_center|LOCUS_18800 1964049 1965143 gene locus_tag LOCUS_18810 1964049 1965143 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903905.1 protein_id gnl|my_center|LOCUS_18810 1965145 1965621 gene locus_tag LOCUS_18820 1965145 1965621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1965618 1965851 gene locus_tag LOCUS_18830 1965618 1965851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1966473 1966048 gene locus_tag LOCUS_18840 1966473 1966048 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902585.1 protein_id gnl|my_center|LOCUS_18840 1966782 1967921 gene locus_tag LOCUS_18850 1966782 1967921 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903906.1 protein_id gnl|my_center|LOCUS_18850 1967921 1968787 gene locus_tag LOCUS_18860 1967921 1968787 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903907.1 protein_id gnl|my_center|LOCUS_18860 1969708 1968887 gene locus_tag LOCUS_18870 1969708 1968887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902139.1 protein_id gnl|my_center|LOCUS_18870 1971795 1969840 gene locus_tag LOCUS_18880 1971795 1969840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902041.1 protein_id gnl|my_center|LOCUS_18880 1972390 1971941 gene locus_tag LOCUS_18890 1972390 1971941 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320322.1 protein_id gnl|my_center|LOCUS_18890 1973176 1972442 gene locus_tag LOCUS_18900 1973176 1972442 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903274.1 protein_id gnl|my_center|LOCUS_18900 1973276 1974424 gene locus_tag LOCUS_18910 1973276 1974424 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225693.1 protein_id gnl|my_center|LOCUS_18910 1974483 1974890 gene locus_tag LOCUS_18920 1974483 1974890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 1975077 1977620 gene locus_tag LOCUS_18930 gene ppk1 1975077 1977620 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921077.1 protein_id gnl|my_center|LOCUS_18930 1977681 1978757 gene locus_tag LOCUS_18940 1977681 1978757 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389711.1 protein_id gnl|my_center|LOCUS_18940 1980905 1979613 gene locus_tag LOCUS_18950 1980905 1979613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 1980789 1981847 gene locus_tag LOCUS_18960 1980789 1981847 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903831.1 protein_id gnl|my_center|LOCUS_18960 1982031 1983125 gene locus_tag LOCUS_18970 1982031 1983125 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902094.1 protein_id gnl|my_center|LOCUS_18970 1983860 1984306 gene locus_tag LOCUS_18980 gene bcp 1983860 1984306 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_18980 1984353 1984796 gene locus_tag LOCUS_18990 1984353 1984796 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023176053.1 protein_id gnl|my_center|LOCUS_18990 1985342 1984866 gene locus_tag LOCUS_19000 1985342 1984866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 1986764 1985376 gene locus_tag LOCUS_19010 1986764 1985376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 1986939 1987469 gene locus_tag LOCUS_19020 1986939 1987469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 1988965 1987637 gene locus_tag LOCUS_19030 1988965 1987637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 1989178 1992027 gene locus_tag LOCUS_19040 gene leuS 1989178 1992027 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061305.1 protein_id gnl|my_center|LOCUS_19040 1992259 1994127 gene locus_tag LOCUS_19050 1992259 1994127 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289426.1 protein_id gnl|my_center|LOCUS_19050 1995614 1994247 gene locus_tag LOCUS_19060 1995614 1994247 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_19060 1996683 1995688 gene locus_tag LOCUS_19070 1996683 1995688 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289464.1 protein_id gnl|my_center|LOCUS_19070 1996810 1997745 gene locus_tag LOCUS_19080 1996810 1997745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135825349.1 protein_id gnl|my_center|LOCUS_19080 1998519 1997899 gene locus_tag LOCUS_19090 gene engB 1998519 1997899 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903933.1 protein_id gnl|my_center|LOCUS_19090 1998650 1999135 gene locus_tag LOCUS_19100 1998650 1999135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 1999619 1999137 gene locus_tag LOCUS_19110 1999619 1999137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2000410 1999718 gene locus_tag LOCUS_19120 2000410 1999718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 2000473 2001849 gene locus_tag LOCUS_19130 2000473 2001849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2002450 2001872 gene locus_tag LOCUS_19140 2002450 2001872 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903898.1 protein_id gnl|my_center|LOCUS_19140 2002560 2002811 gene locus_tag LOCUS_19150 2002560 2002811 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903766.1 protein_id gnl|my_center|LOCUS_19150 2004703 2002874 gene locus_tag LOCUS_19160 2004703 2002874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2005812 2004898 gene locus_tag LOCUS_19170 gene mdh 2005812 2004898 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903765.1 protein_id gnl|my_center|LOCUS_19170 2007030 2005909 gene locus_tag LOCUS_19180 2007030 2005909 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903688.1 protein_id gnl|my_center|LOCUS_19180 2007186 2008439 gene locus_tag LOCUS_19190 2007186 2008439 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289074.1 protein_id gnl|my_center|LOCUS_19190 2008581 2009180 gene locus_tag LOCUS_19200 2008581 2009180 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903909.1 protein_id gnl|my_center|LOCUS_19200 2009234 2010070 gene locus_tag LOCUS_19210 2009234 2010070 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289293.1 protein_id gnl|my_center|LOCUS_19210 2010191 2010724 gene locus_tag LOCUS_19220 2010191 2010724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2011261 2010734 gene locus_tag LOCUS_19230 2011261 2010734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2011477 2012640 gene locus_tag LOCUS_19240 2011477 2012640 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_19240 2013058 2012657 gene locus_tag LOCUS_19250 2013058 2012657 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903865.1 protein_id gnl|my_center|LOCUS_19250 2013627 2013127 gene locus_tag LOCUS_19260 2013627 2013127 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289517.1 protein_id gnl|my_center|LOCUS_19260 2014243 2013704 gene locus_tag LOCUS_19270 2014243 2013704 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143383.1 protein_id gnl|my_center|LOCUS_19270 2014343 2015719 gene locus_tag LOCUS_19280 2014343 2015719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2017362 2015758 gene locus_tag LOCUS_19290 2017362 2015758 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289152.1 protein_id gnl|my_center|LOCUS_19290 2017914 2017522 gene locus_tag LOCUS_19300 2017914 2017522 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903979.1 protein_id gnl|my_center|LOCUS_19300 2019039 2018041 gene locus_tag LOCUS_19310 2019039 2018041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 2019197 2019523 gene locus_tag LOCUS_19320 2019197 2019523 CDS product DUF6432 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903977.1 protein_id gnl|my_center|LOCUS_19320 2019916 2021010 gene locus_tag LOCUS_19330 2019916 2021010 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903976.1 protein_id gnl|my_center|LOCUS_19330 2022810 2022986 gene locus_tag LOCUS_19340 2022810 2022986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 2024034 2023027 gene locus_tag LOCUS_19350 2024034 2023027 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_19350 2024286 2024591 gene locus_tag LOCUS_19360 2024286 2024591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 2024839 2025213 gene locus_tag LOCUS_19370 2024839 2025213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 2026185 2025286 gene locus_tag LOCUS_19380 gene yegS 2026185 2025286 CDS product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477542.1 protein_id gnl|my_center|LOCUS_19380 2027348 2026263 gene locus_tag LOCUS_19390 2027348 2026263 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036621.1 protein_id gnl|my_center|LOCUS_19390 2028147 2027437 gene locus_tag LOCUS_19400 2028147 2027437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2028245 2028682 gene locus_tag LOCUS_19410 2028245 2028682 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404838.1 protein_id gnl|my_center|LOCUS_19410 2029055 2031208 gene locus_tag LOCUS_19420 2029055 2031208 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267434.1 protein_id gnl|my_center|LOCUS_19420 2031205 2032536 gene locus_tag LOCUS_19430 gene narK 2031205 2032536 CDS product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898992.1 protein_id gnl|my_center|LOCUS_19430 2032536 2032751 gene locus_tag LOCUS_19440 2032536 2032751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2032748 2033533 gene locus_tag LOCUS_19450 2032748 2033533 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902576.1 protein_id gnl|my_center|LOCUS_19450 2033533 2035302 gene locus_tag LOCUS_19460 2033533 2035302 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_19460 2035468 2036700 gene locus_tag LOCUS_19470 2035468 2036700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2036716 2036883 gene locus_tag LOCUS_19480 2036716 2036883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2037622 2036903 gene locus_tag LOCUS_19490 2037622 2036903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2038009 2037827 gene locus_tag LOCUS_19500 2038009 2037827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2039019 2038114 gene locus_tag LOCUS_19510 2039019 2038114 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902089.1 protein_id gnl|my_center|LOCUS_19510 2039721 2039152 gene locus_tag LOCUS_19520 2039721 2039152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2040108 2041118 gene locus_tag LOCUS_19530 2040108 2041118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2041306 2042433 gene locus_tag LOCUS_19540 2041306 2042433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 2042498 2043865 gene locus_tag LOCUS_19550 2042498 2043865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2044453 2043839 gene locus_tag LOCUS_19560 2044453 2043839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2044563 2045129 gene locus_tag LOCUS_19570 2044563 2045129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005553844.1 protein_id gnl|my_center|LOCUS_19570 2046117 2045137 gene locus_tag LOCUS_19580 2046117 2045137 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_19580 2047632 2046733 gene locus_tag LOCUS_19590 2047632 2046733 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 protein_id gnl|my_center|LOCUS_19590 2047733 2049031 gene locus_tag LOCUS_19600 gene kynU 2047733 2049031 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276298.1 protein_id gnl|my_center|LOCUS_19600 2049129 2050298 gene locus_tag LOCUS_19610 2049129 2050298 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902466.1 protein_id gnl|my_center|LOCUS_19610 2050295 2050687 gene locus_tag LOCUS_19620 2050295 2050687 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902465.1 protein_id gnl|my_center|LOCUS_19620 2051104 2051490 gene locus_tag LOCUS_19630 2051104 2051490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2051561 2052508 gene locus_tag LOCUS_19640 2051561 2052508 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_19640 2052922 2052536 gene locus_tag LOCUS_19650 2052922 2052536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2053007 2053477 gene locus_tag LOCUS_19660 2053007 2053477 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289517.1 protein_id gnl|my_center|LOCUS_19660 2053867 2054049 gene locus_tag LOCUS_19670 2053867 2054049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2054336 2055718 gene locus_tag LOCUS_19680 gene purB 2054336 2055718 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289153.1 protein_id gnl|my_center|LOCUS_19680 2055878 2056576 gene locus_tag LOCUS_19690 2055878 2056576 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814431.1 protein_id gnl|my_center|LOCUS_19690 2057639 2056590 gene locus_tag LOCUS_19700 2057639 2056590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2058634 2058026 gene locus_tag LOCUS_19710 2058634 2058026 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_19710 2058715 2059890 gene locus_tag LOCUS_19720 2058715 2059890 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903481.1 protein_id gnl|my_center|LOCUS_19720 2060205 2059912 gene locus_tag LOCUS_19730 2060205 2059912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2061107 2060322 gene locus_tag LOCUS_19740 2061107 2060322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 2061558 2061187 gene locus_tag LOCUS_19750 2061558 2061187 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903217.1 protein_id gnl|my_center|LOCUS_19750 2061717 2062067 gene locus_tag LOCUS_19760 2061717 2062067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903618.1 protein_id gnl|my_center|LOCUS_19760 2062064 2062936 gene locus_tag LOCUS_19770 2062064 2062936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 2063455 2063042 gene locus_tag LOCUS_19780 2063455 2063042 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902968.1 protein_id gnl|my_center|LOCUS_19780 2063498 2064181 gene locus_tag LOCUS_19790 2063498 2064181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2064178 2064474 gene locus_tag LOCUS_19800 2064178 2064474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2065407 2064478 gene locus_tag LOCUS_19810 2065407 2064478 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903620.1 protein_id gnl|my_center|LOCUS_19810 2065577 2066071 gene locus_tag LOCUS_19820 2065577 2066071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903621.1 protein_id gnl|my_center|LOCUS_19820 2066103 2067317 gene locus_tag LOCUS_19830 2066103 2067317 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_19830 2070168 2067373 gene locus_tag LOCUS_19840 2070168 2067373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2071120 2070329 gene locus_tag LOCUS_19850 2071120 2070329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2073496 2071253 gene locus_tag LOCUS_19860 2073496 2071253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2074055 2073603 gene locus_tag LOCUS_19870 2074055 2073603 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903622.1 protein_id gnl|my_center|LOCUS_19870 2074320 2074075 gene locus_tag LOCUS_19880 2074320 2074075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 2074430 2075350 gene locus_tag LOCUS_19890 2074430 2075350 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029384.1 protein_id gnl|my_center|LOCUS_19890 2075347 2076138 gene locus_tag LOCUS_19900 2075347 2076138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2076694 2076167 gene locus_tag LOCUS_19910 2076694 2076167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903226.1 protein_id gnl|my_center|LOCUS_19910 2077632 2076694 gene locus_tag LOCUS_19920 gene mch 2077632 2076694 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903231.1 protein_id gnl|my_center|LOCUS_19920 2077718 2078695 gene locus_tag LOCUS_19930 2077718 2078695 CDS product DUF5787 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892531.1 protein_id gnl|my_center|LOCUS_19930 2078739 2080139 gene locus_tag LOCUS_19940 2078739 2080139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2080637 2081137 gene locus_tag LOCUS_19950 gene pyrE 2080637 2081137 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903560.1 protein_id gnl|my_center|LOCUS_19950 2081288 2082748 gene locus_tag LOCUS_19960 2081288 2082748 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903558.1 protein_id gnl|my_center|LOCUS_19960 2082798 2083112 gene locus_tag LOCUS_19970 2082798 2083112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2083277 2084272 gene locus_tag LOCUS_19980 2083277 2084272 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_19980 2084272 2085057 gene locus_tag LOCUS_19990 2084272 2085057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 2085131 2087395 gene locus_tag LOCUS_20000 2085131 2087395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 2087758 2089686 gene locus_tag LOCUS_20010 2087758 2089686 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133412129.1 protein_id gnl|my_center|LOCUS_20010 2089690 2092149 gene locus_tag LOCUS_20020 2089690 2092149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 2092146 2092949 gene locus_tag LOCUS_20030 2092146 2092949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2094919 2093111 gene locus_tag LOCUS_20040 2094919 2093111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 2096307 2094916 gene locus_tag LOCUS_20050 2096307 2094916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2096563 2097339 gene locus_tag LOCUS_20060 2096563 2097339 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_20060 2097502 2099043 gene locus_tag LOCUS_20070 2097502 2099043 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_20070 2099204 2099683 gene locus_tag LOCUS_20080 2099204 2099683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2100235 2099696 gene locus_tag LOCUS_20090 2100235 2099696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902158.1 protein_id gnl|my_center|LOCUS_20090 2101335 2100232 gene locus_tag LOCUS_20100 2101335 2100232 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902157.1 protein_id gnl|my_center|LOCUS_20100 2102395 2101820 gene locus_tag LOCUS_20110 2102395 2101820 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903704.1 protein_id gnl|my_center|LOCUS_20110 2103207 2102542 gene locus_tag LOCUS_20120 2103207 2102542 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903842.1 protein_id gnl|my_center|LOCUS_20120 2103484 2103209 gene locus_tag LOCUS_20130 2103484 2103209 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903843.1 protein_id gnl|my_center|LOCUS_20130 2103637 2103485 gene locus_tag LOCUS_20140 2103637 2103485 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903844.1 protein_id gnl|my_center|LOCUS_20140 2105340 2103760 gene locus_tag LOCUS_20150 2105340 2103760 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281991.1 protein_id gnl|my_center|LOCUS_20150 2105870 2105463 gene locus_tag LOCUS_20160 2105870 2105463 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903088.1 protein_id gnl|my_center|LOCUS_20160 2106617 2105982 gene locus_tag LOCUS_20170 2106617 2105982 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903087.1 protein_id gnl|my_center|LOCUS_20170 2107163 2106702 gene locus_tag LOCUS_20180 2107163 2106702 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903086.1 protein_id gnl|my_center|LOCUS_20180 2107372 2107223 gene locus_tag LOCUS_20190 2107372 2107223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2108065 2107484 gene locus_tag LOCUS_20200 2108065 2107484 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903885.1 protein_id gnl|my_center|LOCUS_20200 2109532 2108159 gene locus_tag LOCUS_20210 2109532 2108159 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 protein_id gnl|my_center|LOCUS_20210 2109871 2110296 gene locus_tag LOCUS_20220 2109871 2110296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2111307 2110369 gene locus_tag LOCUS_20230 2111307 2110369 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122374.1 protein_id gnl|my_center|LOCUS_20230 2111418 2111939 gene locus_tag LOCUS_20240 2111418 2111939 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230481.1 protein_id gnl|my_center|LOCUS_20240 2112152 2111985 gene locus_tag LOCUS_20250 2112152 2111985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 2112693 2112256 gene locus_tag LOCUS_20260 2112693 2112256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 2112640 2112870 gene locus_tag LOCUS_20270 2112640 2112870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 2113163 2113957 gene locus_tag LOCUS_20280 2113163 2113957 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902475.1 protein_id gnl|my_center|LOCUS_20280 2114619 2115257 gene locus_tag LOCUS_20290 2114619 2115257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904053.1 protein_id gnl|my_center|LOCUS_20290 2115359 2117311 gene locus_tag LOCUS_20300 2115359 2117311 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135662706.1 protein_id gnl|my_center|LOCUS_20300 2118070 2118870 gene locus_tag LOCUS_20310 2118070 2118870 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223802.1 protein_id gnl|my_center|LOCUS_20310 2118968 2120308 gene locus_tag LOCUS_20320 2118968 2120308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2120650 2122038 gene locus_tag LOCUS_20330 2120650 2122038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2122052 2122921 gene locus_tag LOCUS_20340 2122052 2122921 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089183.1 protein_id gnl|my_center|LOCUS_20340 2122914 2124062 gene locus_tag LOCUS_20350 2122914 2124062 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274355.1 protein_id gnl|my_center|LOCUS_20350 2124124 2124849 gene locus_tag LOCUS_20360 2124124 2124849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 2124937 2125449 gene locus_tag LOCUS_20370 2124937 2125449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2125636 2127801 gene locus_tag LOCUS_20380 2125636 2127801 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650637.1 protein_id gnl|my_center|LOCUS_20380 2127798 2130086 gene locus_tag LOCUS_20390 2127798 2130086 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285084.1 protein_id gnl|my_center|LOCUS_20390 2130096 2130617 gene locus_tag LOCUS_20400 2130096 2130617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2130721 2133012 gene locus_tag LOCUS_20410 2130721 2133012 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285084.1 protein_id gnl|my_center|LOCUS_20410 2133097 2134716 gene locus_tag LOCUS_20420 2133097 2134716 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726846.1 protein_id gnl|my_center|LOCUS_20420 2134860 2136446 gene locus_tag LOCUS_20430 2134860 2136446 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 protein_id gnl|my_center|LOCUS_20430 2136613 2137032 gene locus_tag LOCUS_20440 2136613 2137032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 2137372 2139306 gene locus_tag LOCUS_20450 2137372 2139306 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421608.1 protein_id gnl|my_center|LOCUS_20450 2139306 2139725 gene locus_tag LOCUS_20460 2139306 2139725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2139722 2141851 gene locus_tag LOCUS_20470 2139722 2141851 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969353.1 protein_id gnl|my_center|LOCUS_20470 2141895 2144234 gene locus_tag LOCUS_20480 2141895 2144234 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285084.1 protein_id gnl|my_center|LOCUS_20480 2144318 2145205 gene locus_tag LOCUS_20490 2144318 2145205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 2146292 2145243 gene locus_tag LOCUS_20500 2146292 2145243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2146429 2147649 gene locus_tag LOCUS_20510 2146429 2147649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2148244 2147861 gene locus_tag LOCUS_20520 2148244 2147861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 2150834 2148300 gene locus_tag LOCUS_20530 2150834 2148300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2150919 2151887 gene locus_tag LOCUS_20540 2150919 2151887 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_20540 2152390 2151884 gene locus_tag LOCUS_20550 2152390 2151884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2154330 2152387 gene locus_tag LOCUS_20560 2154330 2152387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 2155061 2154327 gene locus_tag LOCUS_20570 2155061 2154327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 2155409 2155978 gene locus_tag LOCUS_20580 2155409 2155978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2156184 2157413 gene locus_tag LOCUS_20590 2156184 2157413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2157794 2157450 gene locus_tag LOCUS_20600 2157794 2157450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 2158478 2158056 gene locus_tag LOCUS_20610 2158478 2158056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2158890 2158678 gene locus_tag LOCUS_20620 2158890 2158678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2160287 2159073 gene locus_tag LOCUS_20630 2160287 2159073 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903212.1 protein_id gnl|my_center|LOCUS_20630 2160787 2161470 gene locus_tag LOCUS_20640 2160787 2161470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2161594 2162052 gene locus_tag LOCUS_20650 2161594 2162052 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904153.1 protein_id gnl|my_center|LOCUS_20650 2162178 2162864 gene locus_tag LOCUS_20660 2162178 2162864 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_20660 2163195 2164340 gene locus_tag LOCUS_20670 2163195 2164340 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091867.1 protein_id gnl|my_center|LOCUS_20670 2168559 2164393 gene locus_tag LOCUS_20680 2168559 2164393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 2168788 2169252 gene locus_tag LOCUS_20690 2168788 2169252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2169258 2169560 gene locus_tag LOCUS_20700 2169258 2169560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903983.1 protein_id gnl|my_center|LOCUS_20700 2169627 2170424 gene locus_tag LOCUS_20710 2169627 2170424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2171099 2170452 gene locus_tag LOCUS_20720 2171099 2170452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2172066 2171152 gene locus_tag LOCUS_20730 2172066 2171152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 2172206 2172742 gene locus_tag LOCUS_20740 2172206 2172742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2172786 2174009 gene locus_tag LOCUS_20750 2172786 2174009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 2175578 2174016 gene locus_tag LOCUS_20760 2175578 2174016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2176384 2175641 gene locus_tag LOCUS_20770 2176384 2175641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 2176500 2178050 gene locus_tag LOCUS_20780 2176500 2178050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2178164 2179744 gene locus_tag LOCUS_20790 2178164 2179744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 2179886 2182333 gene locus_tag LOCUS_20800 2179886 2182333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2183555 2182350 gene locus_tag LOCUS_20810 2183555 2182350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2184460 2183540 gene locus_tag LOCUS_20820 2184460 2183540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2185219 2184578 gene locus_tag LOCUS_20830 2185219 2184578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2185770 2185318 gene locus_tag LOCUS_20840 2185770 2185318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2186333 2185767 gene locus_tag LOCUS_20850 2186333 2185767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 2186446 2187345 gene locus_tag LOCUS_20860 2186446 2187345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2189372 2187360 gene locus_tag LOCUS_20870 2189372 2187360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2189768 2190529 gene locus_tag LOCUS_20880 2189768 2190529 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 protein_id gnl|my_center|LOCUS_20880 2191188 2190550 gene locus_tag LOCUS_20890 2191188 2190550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2191340 2191519 gene locus_tag LOCUS_20900 2191340 2191519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2191663 2193036 gene locus_tag LOCUS_20910 2191663 2193036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 2193404 2193099 gene locus_tag LOCUS_20920 2193404 2193099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 2193781 2193401 gene locus_tag LOCUS_20930 2193781 2193401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2194218 2194646 gene locus_tag LOCUS_20940 2194218 2194646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2194665 2194913 gene locus_tag LOCUS_20950 2194665 2194913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2194995 2196089 gene locus_tag LOCUS_20960 2194995 2196089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2196154 2196576 gene locus_tag LOCUS_20970 2196154 2196576 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808355.1 protein_id gnl|my_center|LOCUS_20970 2197598 2196870 gene locus_tag LOCUS_20980 2197598 2196870 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178283.1 protein_id gnl|my_center|LOCUS_20980 2197827 2198276 gene locus_tag LOCUS_20990 2197827 2198276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2199093 2198329 gene locus_tag LOCUS_21000 2199093 2198329 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902328.1 protein_id gnl|my_center|LOCUS_21000 2199355 2199098 gene locus_tag LOCUS_21010 2199355 2199098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2199412 2200659 gene locus_tag LOCUS_21020 2199412 2200659 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_21020 2200995 2202413 gene locus_tag LOCUS_21030 2200995 2202413 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480153.1 protein_id gnl|my_center|LOCUS_21030 2202787 2204223 gene locus_tag LOCUS_21040 2202787 2204223 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404986.1 protein_id gnl|my_center|LOCUS_21040 2204224 2204994 gene locus_tag LOCUS_21050 2204224 2204994 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404987.1 protein_id gnl|my_center|LOCUS_21050 2205118 2207691 gene locus_tag LOCUS_21060 2205118 2207691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2208023 2208412 gene locus_tag LOCUS_21070 2208023 2208412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2209559 2208690 gene locus_tag LOCUS_21080 2209559 2208690 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404481.1 protein_id gnl|my_center|LOCUS_21080 2210983 2209649 gene locus_tag LOCUS_21090 2210983 2209649 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903721.1 protein_id gnl|my_center|LOCUS_21090 2211243 2212049 gene locus_tag LOCUS_21100 2211243 2212049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2212958 2212101 gene locus_tag LOCUS_21110 2212958 2212101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 2213110 2214480 gene locus_tag LOCUS_21120 2213110 2214480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 2217128 2214732 gene locus_tag LOCUS_21130 2217128 2214732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 2218344 2217163 gene locus_tag LOCUS_21140 2218344 2217163 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901949.1 protein_id gnl|my_center|LOCUS_21140 2218578 2219435 gene locus_tag LOCUS_21150 2218578 2219435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2219432 2220025 gene locus_tag LOCUS_21160 2219432 2220025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2220022 2221293 gene locus_tag LOCUS_21170 2220022 2221293 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902121.1 protein_id gnl|my_center|LOCUS_21170 2221290 2221964 gene locus_tag LOCUS_21180 2221290 2221964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2222869 2222246 gene locus_tag LOCUS_21190 2222869 2222246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2223906 2222938 gene locus_tag LOCUS_21200 2223906 2222938 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_21200 2224384 2225550 gene locus_tag LOCUS_21210 2224384 2225550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2226039 2227556 gene locus_tag LOCUS_21220 gene dnaK 2226039 2227556 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902322.1 protein_id gnl|my_center|LOCUS_21220 2227549 2228604 gene locus_tag LOCUS_21230 2227549 2228604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 2229760 2228876 gene locus_tag LOCUS_21240 2229760 2228876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2230075 2231700 gene locus_tag LOCUS_21250 2230075 2231700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2232094 2231828 gene locus_tag LOCUS_21260 2232094 2231828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2233854 2232148 gene locus_tag LOCUS_21270 2233854 2232148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2235740 2233854 gene locus_tag LOCUS_21280 2235740 2233854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2235814 2236083 gene locus_tag LOCUS_21290 2235814 2236083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 2236680 2236773 gene locus_tag LOCUS_t00220 2236680 2236773 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2236840 2237325 gene locus_tag LOCUS_21300 2236840 2237325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2237925 2237566 gene locus_tag LOCUS_21310 2237925 2237566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2238358 2238032 gene locus_tag LOCUS_21320 2238358 2238032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2239252 2238974 gene locus_tag LOCUS_21330 2239252 2238974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2239221 2240597 gene locus_tag LOCUS_21340 2239221 2240597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 2241026 2240640 gene locus_tag LOCUS_21350 2241026 2240640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 2242757 2241084 gene locus_tag LOCUS_21360 2242757 2241084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2244280 2242916 gene locus_tag LOCUS_21370 2244280 2242916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2244444 2245736 gene locus_tag LOCUS_21380 2244444 2245736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2245906 2247747 gene locus_tag LOCUS_21390 2245906 2247747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2247751 2248524 gene locus_tag LOCUS_21400 2247751 2248524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 2248970 2248569 gene locus_tag LOCUS_21410 2248970 2248569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2249352 2249146 gene locus_tag LOCUS_21420 2249352 2249146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 2249637 2251427 gene locus_tag LOCUS_21430 2249637 2251427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 2251716 2252033 gene locus_tag LOCUS_21440 2251716 2252033 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_21440 2254143 2252503 gene locus_tag LOCUS_21450 2254143 2252503 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005575582.1 protein_id gnl|my_center|LOCUS_21450 2254450 2255322 gene locus_tag LOCUS_21460 2254450 2255322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2255312 2255779 gene locus_tag LOCUS_21470 2255312 2255779 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_21470 2255776 2256849 gene locus_tag LOCUS_21480 2255776 2256849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2256954 2258888 gene locus_tag LOCUS_21490 2256954 2258888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 2259084 2260322 gene locus_tag LOCUS_21500 2259084 2260322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2260530 2260312 gene locus_tag LOCUS_21510 2260530 2260312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 2260960 2261115 gene locus_tag LOCUS_21520 2260960 2261115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2262399 2261323 gene locus_tag LOCUS_21530 2262399 2261323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008164722.1 protein_id gnl|my_center|LOCUS_21530 2262743 2264854 gene locus_tag LOCUS_21540 2262743 2264854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 2264975 2266303 gene locus_tag LOCUS_21550 2264975 2266303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 2266377 2266571 gene locus_tag LOCUS_21560 2266377 2266571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2267694 2267080 gene locus_tag LOCUS_21570 2267694 2267080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2268660 2267695 gene locus_tag LOCUS_21580 2268660 2267695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2269027 2270130 gene locus_tag LOCUS_21590 2269027 2270130 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_21590 2270123 2271109 gene locus_tag LOCUS_21600 2270123 2271109 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141858.1 protein_id gnl|my_center|LOCUS_21600 2271482 2272063 gene locus_tag LOCUS_21610 2271482 2272063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2272060 2273385 gene locus_tag LOCUS_21620 2272060 2273385 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940434.1 protein_id gnl|my_center|LOCUS_21620 2273418 2274494 gene locus_tag LOCUS_21630 2273418 2274494 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 protein_id gnl|my_center|LOCUS_21630 2274487 2275761 gene locus_tag LOCUS_21640 2274487 2275761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2276061 2277074 gene locus_tag LOCUS_21650 2276061 2277074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2277284 2277904 gene locus_tag LOCUS_21660 2277284 2277904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2277927 2278418 gene locus_tag LOCUS_21670 2277927 2278418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 2278855 2280669 gene locus_tag LOCUS_21680 gene glmS 2278855 2280669 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901947.1 protein_id gnl|my_center|LOCUS_21680 2281063 2282424 gene locus_tag LOCUS_21690 2281063 2282424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 2282576 2283061 gene locus_tag LOCUS_21700 2282576 2283061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 2283298 2284434 gene locus_tag LOCUS_21710 2283298 2284434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2284827 2284552 gene locus_tag LOCUS_21720 2284827 2284552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2285210 2284824 gene locus_tag LOCUS_21730 2285210 2284824 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892503.1 protein_id gnl|my_center|LOCUS_21730 2285860 2285315 gene locus_tag LOCUS_21740 2285860 2285315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2286681 2285857 gene locus_tag LOCUS_21750 2286681 2285857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2287247 2287447 gene locus_tag LOCUS_21760 2287247 2287447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2287561 2288253 gene locus_tag LOCUS_21770 2287561 2288253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2288309 2290177 gene locus_tag LOCUS_21780 2288309 2290177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2290171 2290776 gene locus_tag LOCUS_21790 2290171 2290776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 2290817 2291782 gene locus_tag LOCUS_21800 2290817 2291782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 2291945 2294320 gene locus_tag LOCUS_21810 2291945 2294320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2294560 2294793 gene locus_tag LOCUS_21820 2294560 2294793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 2294790 2295266 gene locus_tag LOCUS_21830 2294790 2295266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 2295271 2296578 gene locus_tag LOCUS_21840 2295271 2296578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2296629 2297015 gene locus_tag LOCUS_21850 2296629 2297015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2298052 2297048 gene locus_tag LOCUS_21860 2298052 2297048 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902051.1 protein_id gnl|my_center|LOCUS_21860 2298507 2298052 gene locus_tag LOCUS_21870 2298507 2298052 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902050.1 protein_id gnl|my_center|LOCUS_21870 2298645 2299031 gene locus_tag LOCUS_21880 2298645 2299031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 2299126 2300673 gene locus_tag LOCUS_21890 gene dhaS 2299126 2300673 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080288.1 protein_id gnl|my_center|LOCUS_21890 2301727 2300744 gene locus_tag LOCUS_21900 2301727 2300744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2301884 2302507 gene locus_tag LOCUS_21910 2301884 2302507 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289529.1 protein_id gnl|my_center|LOCUS_21910 2302826 2302617 gene locus_tag LOCUS_21920 2302826 2302617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2303081 2303275 gene locus_tag LOCUS_21930 2303081 2303275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2303545 2304003 gene locus_tag LOCUS_21940 2303545 2304003 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186182.1 protein_id gnl|my_center|LOCUS_21940 2304000 2304272 gene locus_tag LOCUS_21950 2304000 2304272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 2304616 2304281 gene locus_tag LOCUS_21960 2304616 2304281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 2305653 2304667 gene locus_tag LOCUS_21970 gene corA 2305653 2304667 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081315.1 protein_id gnl|my_center|LOCUS_21970 2305901 2305653 gene locus_tag LOCUS_21980 2305901 2305653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 2306723 2305965 gene locus_tag LOCUS_21990 2306723 2305965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2308292 2306793 gene locus_tag LOCUS_22000 gene cysS 2308292 2306793 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902789.1 protein_id gnl|my_center|LOCUS_22000 2308846 2308361 gene locus_tag LOCUS_22010 2308846 2308361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 2310492 2309611 gene locus_tag LOCUS_22020 2310492 2309611 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903273.1 protein_id gnl|my_center|LOCUS_22020 2311312 2310626 gene locus_tag LOCUS_22030 2311312 2310626 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903275.1 protein_id gnl|my_center|LOCUS_22030 2311905 2312804 gene locus_tag LOCUS_22040 gene dapA 2311905 2312804 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_22040 2312801 2313559 gene locus_tag LOCUS_22050 gene dapB 2312801 2313559 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921379.1 protein_id gnl|my_center|LOCUS_22050 2313566 2314399 gene locus_tag LOCUS_22060 2313566 2314399 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_22060 2314748 2316064 gene locus_tag LOCUS_22070 gene lysA 2314748 2316064 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_22070 2316145 2317110 gene locus_tag LOCUS_22080 gene dapF 2316145 2317110 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878250.1 protein_id gnl|my_center|LOCUS_22080 2317115 2318221 gene locus_tag LOCUS_22090 2317115 2318221 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_22090 2318939 2318412 gene locus_tag LOCUS_22100 2318939 2318412 CDS product DUF5813 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903410.1 protein_id gnl|my_center|LOCUS_22100 2319016 2320239 gene locus_tag LOCUS_22110 2319016 2320239 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902193.1 protein_id gnl|my_center|LOCUS_22110 2320871 2320251 gene locus_tag LOCUS_22120 2320871 2320251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 2322080 2320872 gene locus_tag LOCUS_22130 2322080 2320872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2322200 2322823 gene locus_tag LOCUS_22140 2322200 2322823 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902192.1 protein_id gnl|my_center|LOCUS_22140 2323138 2322878 gene locus_tag LOCUS_22150 2323138 2322878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902191.1 protein_id gnl|my_center|LOCUS_22150 2324791 2323625 gene locus_tag LOCUS_22160 2324791 2323625 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903472.1 protein_id gnl|my_center|LOCUS_22160 2326771 2324978 gene locus_tag LOCUS_22170 gene pepF 2326771 2324978 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289415.1 protein_id gnl|my_center|LOCUS_22170 2327820 2326825 gene locus_tag LOCUS_22180 2327820 2326825 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902294.1 protein_id gnl|my_center|LOCUS_22180 2328374 2329456 gene locus_tag LOCUS_22190 2328374 2329456 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903858.1 protein_id gnl|my_center|LOCUS_22190 2329453 2330496 gene locus_tag LOCUS_22200 gene pstC 2329453 2330496 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903857.1 protein_id gnl|my_center|LOCUS_22200 2330493 2332115 gene locus_tag LOCUS_22210 gene pstA 2330493 2332115 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903856.1 protein_id gnl|my_center|LOCUS_22210 2332112 2333050 gene locus_tag LOCUS_22220 gene pstB 2332112 2333050 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903855.1 protein_id gnl|my_center|LOCUS_22220 2333052 2333720 gene locus_tag LOCUS_22230 gene phoU 2333052 2333720 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892486.1 protein_id gnl|my_center|LOCUS_22230 2334371 2334961 gene locus_tag LOCUS_22240 2334371 2334961 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902087.1 protein_id gnl|my_center|LOCUS_22240 2335112 2335519 gene locus_tag LOCUS_22250 2335112 2335519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2335516 2335944 gene locus_tag LOCUS_22260 2335516 2335944 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890456.1 protein_id gnl|my_center|LOCUS_22260 2336174 2337493 gene locus_tag LOCUS_22270 2336174 2337493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2337974 2337567 gene locus_tag LOCUS_22280 2337974 2337567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 2340955 2338154 gene locus_tag LOCUS_22290 gene alaS 2340955 2338154 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903698.1 protein_id gnl|my_center|LOCUS_22290 2343442 2341199 gene locus_tag LOCUS_22300 2343442 2341199 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903824.1 protein_id gnl|my_center|LOCUS_22300 2344765 2343509 gene locus_tag LOCUS_22310 2344765 2343509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 2344960 2345628 gene locus_tag LOCUS_22320 2344960 2345628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 2346654 2345707 gene locus_tag LOCUS_22330 2346654 2345707 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838058.1 protein_id gnl|my_center|LOCUS_22330 2346739 2347272 gene locus_tag LOCUS_22340 2346739 2347272 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289508.1 protein_id gnl|my_center|LOCUS_22340 2348462 2347449 gene locus_tag LOCUS_22350 2348462 2347449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2348598 2348732 gene locus_tag LOCUS_22360 2348598 2348732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 2349674 2348763 gene locus_tag LOCUS_22370 2349674 2348763 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189188.1 protein_id gnl|my_center|LOCUS_22370 2350065 2349766 gene locus_tag LOCUS_22380 2350065 2349766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2350567 2350151 gene locus_tag LOCUS_22390 2350567 2350151 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903848.1 protein_id gnl|my_center|LOCUS_22390 2350677 2351120 gene locus_tag LOCUS_22400 2350677 2351120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2351659 2351219 gene locus_tag LOCUS_22410 2351659 2351219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 2353941 2352091 gene locus_tag LOCUS_22420 2353941 2352091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2356906 2353934 gene locus_tag LOCUS_22430 2356906 2353934 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903996.1 protein_id gnl|my_center|LOCUS_22430 2358754 2356928 gene locus_tag LOCUS_22440 gene rpoB 2358754 2356928 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903997.1 protein_id gnl|my_center|LOCUS_22440 2360399 2358828 gene locus_tag LOCUS_22450 2360399 2358828 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755883.1 protein_id gnl|my_center|LOCUS_22450 2360623 2360396 gene locus_tag LOCUS_22460 2360623 2360396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 2360992 2361065 gene locus_tag LOCUS_t00230 2360992 2361065 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2361147 2361560 gene locus_tag LOCUS_22470 2361147 2361560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2361735 2362310 gene locus_tag LOCUS_22480 2361735 2362310 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289247.1 protein_id gnl|my_center|LOCUS_22480 2363342 2362323 gene locus_tag LOCUS_22490 2363342 2362323 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877605.1 protein_id gnl|my_center|LOCUS_22490 2364187 2363339 gene locus_tag LOCUS_22500 2364187 2363339 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_22500 2364583 2364236 gene locus_tag LOCUS_22510 2364583 2364236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 2364990 2364580 gene locus_tag LOCUS_22520 2364990 2364580 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903409.1 protein_id gnl|my_center|LOCUS_22520 2364989 2365522 gene locus_tag LOCUS_22530 2364989 2365522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 2365777 2367030 gene locus_tag LOCUS_22540 gene hmgA 2365777 2367030 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903374.1 protein_id gnl|my_center|LOCUS_22540 2367909 2367445 gene locus_tag LOCUS_22550 2367909 2367445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2368433 2367906 gene locus_tag LOCUS_22560 2368433 2367906 CDS product DUF5817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903373.1 protein_id gnl|my_center|LOCUS_22560 2370355 2368553 gene locus_tag LOCUS_22570 2370355 2368553 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289455.1 protein_id gnl|my_center|LOCUS_22570 2370935 2370402 gene locus_tag LOCUS_22580 2370935 2370402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2372368 2370932 gene locus_tag LOCUS_22590 2372368 2370932 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902121.1 protein_id gnl|my_center|LOCUS_22590 2373038 2372361 gene locus_tag LOCUS_22600 2373038 2372361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 2374078 2373035 gene locus_tag LOCUS_22610 2374078 2373035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2374793 2374149 gene locus_tag LOCUS_22620 2374793 2374149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903725.1 protein_id gnl|my_center|LOCUS_22620 2374909 2375523 gene locus_tag LOCUS_22630 2374909 2375523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902733.1 protein_id gnl|my_center|LOCUS_22630 2375594 2376508 gene locus_tag LOCUS_22640 2375594 2376508 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895799.1 protein_id gnl|my_center|LOCUS_22640 2376878 2376549 gene locus_tag LOCUS_22650 2376878 2376549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2377400 2377056 gene locus_tag LOCUS_22660 2377400 2377056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 2377917 2377519 gene locus_tag LOCUS_22670 2377917 2377519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 2378595 2377960 gene locus_tag LOCUS_22680 2378595 2377960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 2379118 2378666 gene locus_tag LOCUS_22690 2379118 2378666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2379453 2380859 gene locus_tag LOCUS_22700 gene cca 2379453 2380859 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902052.1 protein_id gnl|my_center|LOCUS_22700 2381498 2382457 gene locus_tag LOCUS_22710 2381498 2382457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2382454 2383014 gene locus_tag LOCUS_22720 gene thpR 2382454 2383014 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066123.1 protein_id gnl|my_center|LOCUS_22720 2383078 2383944 gene locus_tag LOCUS_22730 2383078 2383944 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902664.1 protein_id gnl|my_center|LOCUS_22730 2384245 2384012 gene locus_tag LOCUS_22740 2384245 2384012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 2385092 2384301 gene locus_tag LOCUS_22750 2385092 2384301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2386180 2385686 gene locus_tag LOCUS_22760 2386180 2385686 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289507.1 protein_id gnl|my_center|LOCUS_22760 2386586 2386320 gene locus_tag LOCUS_22770 2386586 2386320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 2386781 2386599 gene locus_tag LOCUS_22780 2386781 2386599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 2386815 2387675 gene locus_tag LOCUS_22790 2386815 2387675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2387729 2388268 gene locus_tag LOCUS_22800 gene hjc 2387729 2388268 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903673.1 protein_id gnl|my_center|LOCUS_22800 2388265 2388984 gene locus_tag LOCUS_22810 2388265 2388984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 2390631 2388997 gene locus_tag LOCUS_22820 2390631 2388997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2391177 2390698 gene locus_tag LOCUS_22830 2391177 2390698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 2391326 2391814 gene locus_tag LOCUS_22840 2391326 2391814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2393868 2392486 gene locus_tag LOCUS_22850 2393868 2392486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2394781 2393948 gene locus_tag LOCUS_22860 2394781 2393948 CDS product DUF5781 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903991.1 protein_id gnl|my_center|LOCUS_22860 2394935 2395906 gene locus_tag LOCUS_22870 2394935 2395906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 2396066 2398252 gene locus_tag LOCUS_22880 2396066 2398252 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903990.1 protein_id gnl|my_center|LOCUS_22880 2398885 2398436 gene locus_tag LOCUS_22890 2398885 2398436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 2399876 2398977 gene locus_tag LOCUS_22900 2399876 2398977 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943338.1 protein_id gnl|my_center|LOCUS_22900 2400162 2399938 gene locus_tag LOCUS_22910 2400162 2399938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 2400650 2401180 gene locus_tag LOCUS_22920 2400650 2401180 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361009.1 protein_id gnl|my_center|LOCUS_22920 2401177 2402127 gene locus_tag LOCUS_22930 2401177 2402127 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903987.1 protein_id gnl|my_center|LOCUS_22930 2402516 2403781 gene locus_tag LOCUS_22940 gene tuf 2402516 2403781 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903986.1 protein_id gnl|my_center|LOCUS_22940 2403783 2404091 gene locus_tag LOCUS_22950 gene rpsJ 2403783 2404091 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903985.1 protein_id gnl|my_center|LOCUS_22950 2404443 2404682 gene locus_tag LOCUS_22960 2404443 2404682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 2404731 2404802 gene locus_tag LOCUS_t00240 2404731 2404802 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2404958 2405281 gene locus_tag LOCUS_22970 2404958 2405281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 2406149 2405487 gene locus_tag LOCUS_22980 gene fer 2406149 2405487 CDS product ferredoxin Fer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903573.1 protein_id gnl|my_center|LOCUS_22980 2406284 2406997 gene locus_tag LOCUS_22990 2406284 2406997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 2407082 2407804 gene locus_tag LOCUS_23000 2407082 2407804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902751.1 protein_id gnl|my_center|LOCUS_23000 2407923 2408954 gene locus_tag LOCUS_23010 2407923 2408954 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289355.1 protein_id gnl|my_center|LOCUS_23010 2408954 2410252 gene locus_tag LOCUS_23020 2408954 2410252 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289356.1 protein_id gnl|my_center|LOCUS_23020 2410256 2411938 gene locus_tag LOCUS_23030 2410256 2411938 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903150.1 protein_id gnl|my_center|LOCUS_23030 2411997 2412242 gene locus_tag LOCUS_23040 2411997 2412242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2412385 2412248 gene locus_tag LOCUS_23050 2412385 2412248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2412685 2413134 gene locus_tag LOCUS_23060 2412685 2413134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2413945 2413421 gene locus_tag LOCUS_23070 2413945 2413421 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289184.1 protein_id gnl|my_center|LOCUS_23070 2414093 2414557 gene locus_tag LOCUS_23080 2414093 2414557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2415751 2414570 gene locus_tag LOCUS_23090 2415751 2414570 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064319.1 protein_id gnl|my_center|LOCUS_23090 2416514 2415741 gene locus_tag LOCUS_23100 2416514 2415741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901944.1 protein_id gnl|my_center|LOCUS_23100 2418154 2416511 gene locus_tag LOCUS_23110 2418154 2416511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2419292 2418288 gene locus_tag LOCUS_23120 2419292 2418288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 2419468 2419971 gene locus_tag LOCUS_23130 2419468 2419971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2419973 2421940 gene locus_tag LOCUS_23140 gene nosZ 2419973 2421940 CDS product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098686.1 protein_id gnl|my_center|LOCUS_23140 2421959 2422840 gene locus_tag LOCUS_23150 2421959 2422840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 2422847 2424232 gene locus_tag LOCUS_23160 2422847 2424232 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935040.1 protein_id gnl|my_center|LOCUS_23160 2424225 2425193 gene locus_tag LOCUS_23170 2424225 2425193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2425190 2426161 gene locus_tag LOCUS_23180 2425190 2426161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2426169 2427236 gene locus_tag LOCUS_23190 2426169 2427236 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902253.1 protein_id gnl|my_center|LOCUS_23190 2428274 2427681 gene locus_tag LOCUS_23200 2428274 2427681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 2429491 2428451 gene locus_tag LOCUS_23210 2429491 2428451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2429713 2431014 gene locus_tag LOCUS_23220 2429713 2431014 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485071.1 protein_id gnl|my_center|LOCUS_23220 2431075 2432217 gene locus_tag LOCUS_23230 2431075 2432217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 2432295 2433176 gene locus_tag LOCUS_23240 2432295 2433176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 2433173 2434378 gene locus_tag LOCUS_23250 2433173 2434378 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904113.1 protein_id gnl|my_center|LOCUS_23250 2434834 2434403 gene locus_tag LOCUS_23260 2434834 2434403 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_23260 2435021 2436211 gene locus_tag LOCUS_23270 2435021 2436211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2437383 2436283 gene locus_tag LOCUS_23280 2437383 2436283 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403699.1 protein_id gnl|my_center|LOCUS_23280 2437644 2437570 gene locus_tag LOCUS_t00250 2437644 2437570 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2438521 2437715 gene locus_tag LOCUS_23290 2438521 2437715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 2439181 2438576 gene locus_tag LOCUS_23300 2439181 2438576 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_23300 2439239 2439703 gene locus_tag LOCUS_23310 2439239 2439703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 2440132 2441367 gene locus_tag LOCUS_23320 2440132 2441367 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903821.1 protein_id gnl|my_center|LOCUS_23320 2441372 2442889 gene locus_tag LOCUS_23330 gene argH 2441372 2442889 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903820.1 protein_id gnl|my_center|LOCUS_23330 2443115 2443279 gene locus_tag LOCUS_23340 gene lysW 2443115 2443279 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249234.1 protein_id gnl|my_center|LOCUS_23340 2443433 2444302 gene locus_tag LOCUS_23350 gene lysX 2443433 2444302 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_23350 2444299 2445336 gene locus_tag LOCUS_23360 gene argC 2444299 2445336 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229001.1 protein_id gnl|my_center|LOCUS_23360 2445527 2446384 gene locus_tag LOCUS_23370 2445527 2446384 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229000.1 protein_id gnl|my_center|LOCUS_23370 2446446 2447573 gene locus_tag LOCUS_23380 2446446 2447573 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228893.1 protein_id gnl|my_center|LOCUS_23380 2447570 2448682 gene locus_tag LOCUS_23390 2447570 2448682 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257089.1 protein_id gnl|my_center|LOCUS_23390 2448675 2449589 gene locus_tag LOCUS_23400 gene argF 2448675 2449589 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_23400 2449642 2449899 gene locus_tag LOCUS_23410 2449642 2449899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 2450842 2449919 gene locus_tag LOCUS_23420 gene thiL 2450842 2449919 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903480.1 protein_id gnl|my_center|LOCUS_23420 2451545 2451970 gene locus_tag LOCUS_23430 2451545 2451970 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903746.1 protein_id gnl|my_center|LOCUS_23430 2452090 2455689 gene locus_tag LOCUS_23440 2452090 2455689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 2456128 2457147 gene locus_tag LOCUS_23450 2456128 2457147 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_23450 2457144 2458091 gene locus_tag LOCUS_23460 2457144 2458091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 2458264 2459094 gene locus_tag LOCUS_23470 2458264 2459094 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289100.1 protein_id gnl|my_center|LOCUS_23470 2460919 2459324 gene locus_tag LOCUS_23480 2460919 2459324 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903647.1 protein_id gnl|my_center|LOCUS_23480 2461935 2460922 gene locus_tag LOCUS_23490 2461935 2460922 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289463.1 protein_id gnl|my_center|LOCUS_23490 2463035 2461932 gene locus_tag LOCUS_23500 gene pdhA 2463035 2461932 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_23500 2464194 2463262 gene locus_tag LOCUS_23510 gene lipA 2464194 2463262 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903644.1 protein_id gnl|my_center|LOCUS_23510 2464818 2464246 gene locus_tag LOCUS_23520 2464818 2464246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2465817 2465206 gene locus_tag LOCUS_23530 2465817 2465206 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903992.1 protein_id gnl|my_center|LOCUS_23530 2466245 2465817 gene locus_tag LOCUS_23540 2466245 2465817 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903993.1 protein_id gnl|my_center|LOCUS_23540 2467292 2466384 gene locus_tag LOCUS_23550 2467292 2466384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2467908 2467483 gene locus_tag LOCUS_23560 2467908 2467483 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903994.1 protein_id gnl|my_center|LOCUS_23560 2468056 2469297 gene locus_tag LOCUS_23570 2468056 2469297 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903847.1 protein_id gnl|my_center|LOCUS_23570 2469361 2469436 gene locus_tag LOCUS_t00260 2469361 2469436 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2469716 2470054 gene locus_tag LOCUS_23580 2469716 2470054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 2470476 2470063 gene locus_tag LOCUS_23590 gene cdd 2470476 2470063 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902631.1 protein_id gnl|my_center|LOCUS_23590 2470722 2471213 gene locus_tag LOCUS_23600 2470722 2471213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 2471277 2472671 gene locus_tag LOCUS_23610 2471277 2472671 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903838.1 protein_id gnl|my_center|LOCUS_23610 2473976 2472684 gene locus_tag LOCUS_23620 2473976 2472684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 2474067 2474561 gene locus_tag LOCUS_23630 2474067 2474561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 2474665 2475060 gene locus_tag LOCUS_23640 2474665 2475060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2475663 2475070 gene locus_tag LOCUS_23650 gene msrA 2475663 2475070 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902851.1 protein_id gnl|my_center|LOCUS_23650 2476562 2477899 gene locus_tag LOCUS_23660 2476562 2477899 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903671.1 protein_id gnl|my_center|LOCUS_23660 2478063 2479610 gene locus_tag LOCUS_23670 2478063 2479610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 2479726 2481003 gene locus_tag LOCUS_23680 2479726 2481003 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903672.1 protein_id gnl|my_center|LOCUS_23680 2481843 2481016 gene locus_tag LOCUS_23690 2481843 2481016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2481842 2482294 gene locus_tag LOCUS_23700 2481842 2482294 CDS product DUF5790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902043.1 protein_id gnl|my_center|LOCUS_23700 2482474 2483283 gene locus_tag LOCUS_23710 2482474 2483283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 2484048 2483299 gene locus_tag LOCUS_23720 2484048 2483299 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_23720 2484144 2484605 gene locus_tag LOCUS_23730 2484144 2484605 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903086.1 protein_id gnl|my_center|LOCUS_23730 2486578 2484641 gene locus_tag LOCUS_23740 2486578 2484641 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902041.1 protein_id gnl|my_center|LOCUS_23740 2487298 2486684 gene locus_tag LOCUS_23750 2487298 2486684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 2487502 2487574 gene locus_tag LOCUS_t00270 2487502 2487574 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2487901 2488398 gene locus_tag LOCUS_23760 2487901 2488398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2488706 2488779 gene locus_tag LOCUS_t00280 2488706 2488779 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2489061 2489951 gene locus_tag LOCUS_23770 2489061 2489951 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902500.1 protein_id gnl|my_center|LOCUS_23770 2490784 2490035 gene locus_tag LOCUS_23780 2490784 2490035 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_23780 2491396 2490878 gene locus_tag LOCUS_23790 2491396 2490878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903670.1 protein_id gnl|my_center|LOCUS_23790 2491685 2491879 gene locus_tag LOCUS_23800 2491685 2491879 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_23800 2492832 2491978 gene locus_tag LOCUS_23810 2492832 2491978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2494094 2492895 gene locus_tag LOCUS_23820 2494094 2492895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2494938 2494201 gene locus_tag LOCUS_23830 2494938 2494201 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021949.1 protein_id gnl|my_center|LOCUS_23830 2495070 2495534 gene locus_tag LOCUS_23840 2495070 2495534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2496886 2495549 gene locus_tag LOCUS_23850 2496886 2495549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2497883 2496936 gene locus_tag LOCUS_23860 gene surE 2497883 2496936 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902899.1 protein_id gnl|my_center|LOCUS_23860 2498280 2497963 gene locus_tag LOCUS_23870 2498280 2497963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 2498499 2499083 gene locus_tag LOCUS_23880 2498499 2499083 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903837.1 protein_id gnl|my_center|LOCUS_23880 2499084 2499644 gene locus_tag LOCUS_23890 2499084 2499644 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903836.1 protein_id gnl|my_center|LOCUS_23890 2499901 2499737 gene locus_tag LOCUS_23900 2499901 2499737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2500188 2500006 gene locus_tag LOCUS_23910 2500188 2500006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 2500355 2503345 gene locus_tag LOCUS_23920 2500355 2503345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 2503342 2504019 gene locus_tag LOCUS_23930 2503342 2504019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2504016 2505614 gene locus_tag LOCUS_23940 2504016 2505614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 2505617 2507158 gene locus_tag LOCUS_23950 2505617 2507158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 2507696 2507160 gene locus_tag LOCUS_23960 2507696 2507160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 2507961 2509610 gene locus_tag LOCUS_23970 2507961 2509610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2510694 2509612 gene locus_tag LOCUS_23980 2510694 2509612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 2510853 2511146 gene locus_tag LOCUS_23990 2510853 2511146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2511399 2511169 gene locus_tag LOCUS_24000 2511399 2511169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2511770 2512045 gene locus_tag LOCUS_24010 2511770 2512045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2513352 2512312 gene locus_tag LOCUS_24020 2513352 2512312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289510.1 protein_id gnl|my_center|LOCUS_24020 2513786 2514208 gene locus_tag LOCUS_24030 2513786 2514208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 2514299 2514679 gene locus_tag LOCUS_24040 2514299 2514679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 2514780 2515673 gene locus_tag LOCUS_24050 2514780 2515673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 2515723 2516076 gene locus_tag LOCUS_24060 2515723 2516076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 2517070 2516117 gene locus_tag LOCUS_24070 2517070 2516117 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_24070 2517218 2517661 gene locus_tag LOCUS_24080 2517218 2517661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 2517663 2518598 gene locus_tag LOCUS_24090 2517663 2518598 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902989.1 protein_id gnl|my_center|LOCUS_24090 2520555 2519374 gene locus_tag LOCUS_24100 2520555 2519374 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902332.1 protein_id gnl|my_center|LOCUS_24100 2520645 2521307 gene locus_tag LOCUS_24110 2520645 2521307 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903223.1 protein_id gnl|my_center|LOCUS_24110 2521695 2521324 gene locus_tag LOCUS_24120 2521695 2521324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 2523683 2521902 gene locus_tag LOCUS_24130 2523683 2521902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903388.1 protein_id gnl|my_center|LOCUS_24130 2524479 2523676 gene locus_tag LOCUS_24140 2524479 2523676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903387.1 protein_id gnl|my_center|LOCUS_24140 2524587 2525162 gene locus_tag LOCUS_24150 2524587 2525162 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289218.1 protein_id gnl|my_center|LOCUS_24150 2525957 2525385 gene locus_tag LOCUS_24160 2525957 2525385 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289404.1 protein_id gnl|my_center|LOCUS_24160 2526708 2526025 gene locus_tag LOCUS_24170 2526708 2526025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 2527480 2526770 gene locus_tag LOCUS_24180 2527480 2526770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2528636 2527557 gene locus_tag LOCUS_24190 2528636 2527557 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903403.1 protein_id gnl|my_center|LOCUS_24190 2529980 2528730 gene locus_tag LOCUS_24200 2529980 2528730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2531118 2530117 gene locus_tag LOCUS_24210 2531118 2530117 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405157.1 protein_id gnl|my_center|LOCUS_24210 2531211 2532269 gene locus_tag LOCUS_24220 2531211 2532269 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903402.1 protein_id gnl|my_center|LOCUS_24220 2532551 2532393 gene locus_tag LOCUS_24230 2532551 2532393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 2532832 2534691 gene locus_tag LOCUS_24240 2532832 2534691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2534893 2535972 gene locus_tag LOCUS_24250 2534893 2535972 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903753.1 protein_id gnl|my_center|LOCUS_24250 2535972 2537468 gene locus_tag LOCUS_24260 2535972 2537468 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903752.1 protein_id gnl|my_center|LOCUS_24260 2537465 2538589 gene locus_tag LOCUS_24270 2537465 2538589 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903751.1 protein_id gnl|my_center|LOCUS_24270 2538586 2540217 gene locus_tag LOCUS_24280 2538586 2540217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 2541240 2540428 gene locus_tag LOCUS_24290 2541240 2540428 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903934.1 protein_id gnl|my_center|LOCUS_24290 2542670 2541285 gene locus_tag LOCUS_24300 2542670 2541285 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289527.1 protein_id gnl|my_center|LOCUS_24300 2542766 2543662 gene locus_tag LOCUS_24310 gene hisG 2542766 2543662 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903669.1 protein_id gnl|my_center|LOCUS_24310 2543714 2545255 gene locus_tag LOCUS_24320 2543714 2545255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 2547203 2545512 gene locus_tag LOCUS_24330 2547203 2545512 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902435.1 protein_id gnl|my_center|LOCUS_24330 2547317 2548123 gene locus_tag LOCUS_24340 2547317 2548123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2548147 2548803 gene locus_tag LOCUS_24350 2548147 2548803 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259011.1 protein_id gnl|my_center|LOCUS_24350 2548915 2549319 gene locus_tag LOCUS_24360 2548915 2549319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 2549396 2550016 gene locus_tag LOCUS_24370 2549396 2550016 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902402.1 protein_id gnl|my_center|LOCUS_24370 2550646 2550026 gene locus_tag LOCUS_24380 2550646 2550026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903785.1 protein_id gnl|my_center|LOCUS_24380 2550807 2551238 gene locus_tag LOCUS_24390 2550807 2551238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 2551309 2552175 gene locus_tag LOCUS_24400 gene htpX 2551309 2552175 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_24400 2552374 2553573 gene locus_tag LOCUS_24410 2552374 2553573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2553573 2554220 gene locus_tag LOCUS_24420 2553573 2554220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2554248 2554883 gene locus_tag LOCUS_24430 2554248 2554883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022099.1 protein_id gnl|my_center|LOCUS_24430 2554943 2556346 gene locus_tag LOCUS_24440 2554943 2556346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 2556390 2557424 gene locus_tag LOCUS_24450 gene priL 2556390 2557424 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903675.1 protein_id gnl|my_center|LOCUS_24450 2557891 2558145 gene locus_tag LOCUS_24460 2557891 2558145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 2558412 2558224 gene locus_tag LOCUS_24470 2558412 2558224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2558850 2559398 gene locus_tag LOCUS_24480 2558850 2559398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2559595 2559416 gene locus_tag LOCUS_24490 2559595 2559416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 2560761 2559658 gene locus_tag LOCUS_24500 2560761 2559658 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902123.1 protein_id gnl|my_center|LOCUS_24500 2560956 2561912 gene locus_tag LOCUS_24510 gene larE 2560956 2561912 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896918.1 protein_id gnl|my_center|LOCUS_24510 2561980 2563065 gene locus_tag LOCUS_24520 2561980 2563065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 2563062 2563880 gene locus_tag LOCUS_24530 2563062 2563880 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023323.1 protein_id gnl|my_center|LOCUS_24530 2563945 2564523 gene locus_tag LOCUS_24540 2563945 2564523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289498.1 protein_id gnl|my_center|LOCUS_24540 2564834 2564565 gene locus_tag LOCUS_24550 gene trxA 2564834 2564565 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903943.1 protein_id gnl|my_center|LOCUS_24550 2564965 2565126 gene locus_tag LOCUS_24560 2564965 2565126 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903942.1 protein_id gnl|my_center|LOCUS_24560 2565588 2565313 gene locus_tag LOCUS_24570 2565588 2565313 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903955.1 protein_id gnl|my_center|LOCUS_24570 2565793 2566113 gene locus_tag LOCUS_24580 2565793 2566113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903954.1 protein_id gnl|my_center|LOCUS_24580 2566113 2567966 gene locus_tag LOCUS_24590 2566113 2567966 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903953.1 protein_id gnl|my_center|LOCUS_24590 2569141 2567990 gene locus_tag LOCUS_24600 2569141 2567990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2569259 2570284 gene locus_tag LOCUS_24610 2569259 2570284 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902020.1 protein_id gnl|my_center|LOCUS_24610 2570440 2570805 gene locus_tag LOCUS_24620 2570440 2570805 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902021.1 protein_id gnl|my_center|LOCUS_24620 2571767 2570886 gene locus_tag LOCUS_24630 2571767 2570886 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902022.1 protein_id gnl|my_center|LOCUS_24630 2572086 2571913 gene locus_tag LOCUS_24640 2572086 2571913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2572233 2572463 gene locus_tag LOCUS_24650 2572233 2572463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 2573868 2572531 gene locus_tag LOCUS_24660 2573868 2572531 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877762.1 protein_id gnl|my_center|LOCUS_24660 2576561 2573991 gene locus_tag LOCUS_24670 gene folP 2576561 2573991 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902259.1 protein_id gnl|my_center|LOCUS_24670 2576885 2576574 gene locus_tag LOCUS_24680 2576885 2576574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2578899 2577235 gene locus_tag LOCUS_24690 gene thsB 2578899 2577235 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361694.1 protein_id gnl|my_center|LOCUS_24690 2579513 2579124 gene locus_tag LOCUS_24700 2579513 2579124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 2579720 2579639 gene locus_tag LOCUS_t00290 2579720 2579639 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2579996 2579748 gene locus_tag LOCUS_24710 2579996 2579748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 2580376 2579993 gene locus_tag LOCUS_24720 2580376 2579993 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903545.1 protein_id gnl|my_center|LOCUS_24720 2582032 2581025 gene locus_tag LOCUS_24730 2582032 2581025 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289100.1 protein_id gnl|my_center|LOCUS_24730 2583790 2582153 gene locus_tag LOCUS_24740 2583790 2582153 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903224.1 protein_id gnl|my_center|LOCUS_24740 2584278 2583898 gene locus_tag LOCUS_24750 2584278 2583898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 2584455 2585444 gene locus_tag LOCUS_24760 2584455 2585444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 2585921 2585487 gene locus_tag LOCUS_24770 2585921 2585487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 2586534 2585983 gene locus_tag LOCUS_24780 2586534 2585983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2586739 2588034 gene locus_tag LOCUS_24790 gene hisS 2586739 2588034 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_24790 2589218 2588091 gene locus_tag LOCUS_24800 2589218 2588091 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289085.1 protein_id gnl|my_center|LOCUS_24800 2590491 2589256 gene locus_tag LOCUS_24810 2590491 2589256 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878110.1 protein_id gnl|my_center|LOCUS_24810 2590727 2591794 gene locus_tag LOCUS_24820 gene prpB 2590727 2591794 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763428.1 protein_id gnl|my_center|LOCUS_24820 2591896 2593383 gene locus_tag LOCUS_24830 2591896 2593383 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903474.1 protein_id gnl|my_center|LOCUS_24830 2594298 2593417 gene locus_tag LOCUS_24840 gene truA 2594298 2593417 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903475.1 protein_id gnl|my_center|LOCUS_24840 2594359 2595120 gene locus_tag LOCUS_24850 gene aglF 2594359 2595120 CDS product UTP--glucose-1-phosphate uridylyltransferase AglF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902754.1 protein_id gnl|my_center|LOCUS_24850 2595187 2595939 gene locus_tag LOCUS_24860 2595187 2595939 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902016.1 protein_id gnl|my_center|LOCUS_24860 2596810 2597142 gene locus_tag LOCUS_24870 2596810 2597142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 2597129 2599393 gene locus_tag LOCUS_24880 2597129 2599393 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903584.1 protein_id gnl|my_center|LOCUS_24880 2599689 2599943 gene locus_tag LOCUS_24890 2599689 2599943 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289441.1 protein_id gnl|my_center|LOCUS_24890 2599965 2600549 gene locus_tag LOCUS_24900 2599965 2600549 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903582.1 protein_id gnl|my_center|LOCUS_24900 2600546 2601604 gene locus_tag LOCUS_24910 2600546 2601604 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903581.1 protein_id gnl|my_center|LOCUS_24910 2601601 2601921 gene locus_tag LOCUS_24920 2601601 2601921 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903580.1 protein_id gnl|my_center|LOCUS_24920 2601925 2603694 gene locus_tag LOCUS_24930 2601925 2603694 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903579.1 protein_id gnl|my_center|LOCUS_24930 2603697 2605118 gene locus_tag LOCUS_24940 2603697 2605118 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903578.1 protein_id gnl|my_center|LOCUS_24940 2605268 2606713 gene locus_tag LOCUS_24950 2605268 2606713 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_24950 2606776 2607417 gene locus_tag LOCUS_24960 2606776 2607417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 2607473 2608168 gene locus_tag LOCUS_24970 2607473 2608168 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903575.1 protein_id gnl|my_center|LOCUS_24970 2608231 2608641 gene locus_tag LOCUS_24980 2608231 2608641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 2610154 2608802 gene locus_tag LOCUS_24990 gene glnA 2610154 2608802 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060929.1 protein_id gnl|my_center|LOCUS_24990 2610405 2610860 gene locus_tag LOCUS_25000 gene lrp 2610405 2610860 CDS product HTH-type transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903541.1 protein_id gnl|my_center|LOCUS_25000 2611964 2611029 gene locus_tag LOCUS_25010 2611964 2611029 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289431.1 protein_id gnl|my_center|LOCUS_25010 2613237 2611969 gene locus_tag LOCUS_25020 2613237 2611969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 2614205 2613345 gene locus_tag LOCUS_25030 2614205 2613345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2615477 2614278 gene locus_tag LOCUS_25040 2615477 2614278 CDS product tRNA (guanine(26)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903537.1 protein_id gnl|my_center|LOCUS_25040 2616189 2616713 gene locus_tag LOCUS_25050 2616189 2616713 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903920.1 protein_id gnl|my_center|LOCUS_25050 2616943 2619306 gene locus_tag LOCUS_25060 2616943 2619306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2619579 2621195 gene locus_tag LOCUS_25070 2619579 2621195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 2622531 2621221 gene locus_tag LOCUS_25080 2622531 2621221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 2623729 2622599 gene locus_tag LOCUS_25090 2623729 2622599 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892524.1 protein_id gnl|my_center|LOCUS_25090 2623964 2625034 gene locus_tag LOCUS_25100 2623964 2625034 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289477.1 protein_id gnl|my_center|LOCUS_25100 2625113 2625535 gene locus_tag LOCUS_25110 gene hisI 2625113 2625535 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903699.1 protein_id gnl|my_center|LOCUS_25110 2625535 2626707 gene locus_tag LOCUS_25120 2625535 2626707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903638.1 protein_id gnl|my_center|LOCUS_25120 2627222 2626704 gene locus_tag LOCUS_25130 2627222 2626704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 2628363 2627290 gene locus_tag LOCUS_25140 2628363 2627290 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 protein_id gnl|my_center|LOCUS_25140 2628470 2628874 gene locus_tag LOCUS_25150 2628470 2628874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 2629004 2629714 gene locus_tag LOCUS_25160 2629004 2629714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2630847 2629723 gene locus_tag LOCUS_25170 gene rtcA 2630847 2629723 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289214.1 protein_id gnl|my_center|LOCUS_25170 2630874 2631584 gene locus_tag LOCUS_25180 2630874 2631584 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903333.1 protein_id gnl|my_center|LOCUS_25180 2632453 2631599 gene locus_tag LOCUS_25190 2632453 2631599 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903592.1 protein_id gnl|my_center|LOCUS_25190 2632630 2632953 gene locus_tag LOCUS_25200 2632630 2632953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 2634068 2633100 gene locus_tag LOCUS_25210 2634068 2633100 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903590.1 protein_id gnl|my_center|LOCUS_25210 2634859 2634065 gene locus_tag LOCUS_25220 2634859 2634065 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903589.1 protein_id gnl|my_center|LOCUS_25220 2636246 2635005 gene locus_tag LOCUS_25230 2636246 2635005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 2636425 2637822 gene locus_tag LOCUS_25240 2636425 2637822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 2638104 2637901 gene locus_tag LOCUS_25250 2638104 2637901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2638048 2638350 gene locus_tag LOCUS_25260 2638048 2638350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 2639160 2638468 gene locus_tag LOCUS_25270 2639160 2638468 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289442.1 protein_id gnl|my_center|LOCUS_25270 2639274 2639894 gene locus_tag LOCUS_25280 2639274 2639894 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903340.1 protein_id gnl|my_center|LOCUS_25280 2640147 2640497 gene locus_tag LOCUS_25290 2640147 2640497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 2640671 2641339 gene locus_tag LOCUS_25300 gene rdgB 2640671 2641339 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903503.1 protein_id gnl|my_center|LOCUS_25300 2643143 2641374 gene locus_tag LOCUS_25310 2643143 2641374 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903485.1 protein_id gnl|my_center|LOCUS_25310 2645074 2643209 gene locus_tag LOCUS_25320 2645074 2643209 CDS product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902126.1 protein_id gnl|my_center|LOCUS_25320 2645732 2645178 gene locus_tag LOCUS_25330 2645732 2645178 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902125.1 protein_id gnl|my_center|LOCUS_25330 2646270 2645836 gene locus_tag LOCUS_25340 2646270 2645836 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337321.1 protein_id gnl|my_center|LOCUS_25340 2646840 2646319 gene locus_tag LOCUS_25350 2646840 2646319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 2649491 2647302 gene locus_tag LOCUS_25360 gene purL 2649491 2647302 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902605.1 protein_id gnl|my_center|LOCUS_25360 2649640 2650668 gene locus_tag LOCUS_25370 2649640 2650668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 2650717 2651454 gene locus_tag LOCUS_25380 2650717 2651454 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_25380 2651454 2652605 gene locus_tag LOCUS_25390 2651454 2652605 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902607.1 protein_id gnl|my_center|LOCUS_25390 2652935 2656528 gene locus_tag LOCUS_25400 2652935 2656528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2656693 2657550 gene locus_tag LOCUS_25410 2656693 2657550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 2657621 2657899 gene locus_tag LOCUS_25420 2657621 2657899 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903295.1 protein_id gnl|my_center|LOCUS_25420 2657901 2658302 gene locus_tag LOCUS_25430 2657901 2658302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 2658407 2659078 gene locus_tag LOCUS_25440 2658407 2659078 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903294.1 protein_id gnl|my_center|LOCUS_25440 2659283 2659062 gene locus_tag LOCUS_25450 2659283 2659062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 2659754 2659494 gene locus_tag LOCUS_25460 2659754 2659494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2660658 2659843 gene locus_tag LOCUS_25470 2660658 2659843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 2660747 2661022 gene locus_tag LOCUS_25480 2660747 2661022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2661953 2661024 gene locus_tag LOCUS_25490 2661953 2661024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25490 2663011 2661950 gene locus_tag LOCUS_25500 gene btuC 2663011 2661950 CDS product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902994.1 protein_id gnl|my_center|LOCUS_25500 2663073 2664248 gene locus_tag LOCUS_25510 2663073 2664248 CDS product PGF-CTERM-anchored ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902993.1 protein_id gnl|my_center|LOCUS_25510 2664656 2665372 gene locus_tag LOCUS_25520 2664656 2665372 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289362.1 protein_id gnl|my_center|LOCUS_25520 2665543 2666784 gene locus_tag LOCUS_25530 2665543 2666784 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289074.1 protein_id gnl|my_center|LOCUS_25530 2668201 2666861 gene locus_tag LOCUS_25540 gene hmgB 2668201 2666861 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_25540 2670147 2668270 gene locus_tag LOCUS_25550 2670147 2668270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 2677855 2670260 gene locus_tag LOCUS_25560 2677855 2670260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 2680079 2677995 gene locus_tag LOCUS_25570 2680079 2677995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 2680767 2680189 gene locus_tag LOCUS_25580 2680767 2680189 CDS product DUF2150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903173.1 protein_id gnl|my_center|LOCUS_25580 2681782 2680940 gene locus_tag LOCUS_25590 2681782 2680940 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903172.1 protein_id gnl|my_center|LOCUS_25590 2682994 2681981 gene locus_tag LOCUS_25600 2682994 2681981 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404555.1 protein_id gnl|my_center|LOCUS_25600 2683052 2683921 gene locus_tag LOCUS_25610 2683052 2683921 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903288.1 protein_id gnl|my_center|LOCUS_25610 2684007 2684864 gene locus_tag LOCUS_25620 gene cruF 2684007 2684864 CDS product bisanhydrobacterioruberin hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903228.1 protein_id gnl|my_center|LOCUS_25620 2685377 2684916 gene locus_tag LOCUS_25630 2685377 2684916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 2686414 2685467 gene locus_tag LOCUS_25640 2686414 2685467 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903227.1 protein_id gnl|my_center|LOCUS_25640 2688032 2686713 gene locus_tag LOCUS_25650 gene purD 2688032 2686713 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772775.1 protein_id gnl|my_center|LOCUS_25650 2688114 2688926 gene locus_tag LOCUS_25660 2688114 2688926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2690087 2689002 gene locus_tag LOCUS_25670 2690087 2689002 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267697.1 protein_id gnl|my_center|LOCUS_25670 2690254 2691486 gene locus_tag LOCUS_25680 2690254 2691486 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_25680 2691541 2692314 gene locus_tag LOCUS_25690 gene cobB 2691541 2692314 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240270.1 protein_id gnl|my_center|LOCUS_25690 2692860 2692336 gene locus_tag LOCUS_25700 2692860 2692336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2692944 2693375 gene locus_tag LOCUS_25710 2692944 2693375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 2693741 2693406 gene locus_tag LOCUS_25720 2693741 2693406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 2694296 2693787 gene locus_tag LOCUS_25730 2694296 2693787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2694995 2694351 gene locus_tag LOCUS_25740 2694995 2694351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 2695209 2696267 gene locus_tag LOCUS_25750 2695209 2696267 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902990.1 protein_id gnl|my_center|LOCUS_25750 2696388 2696645 gene locus_tag LOCUS_25760 2696388 2696645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 2697750 2696746 gene locus_tag LOCUS_25770 2697750 2696746 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902989.1 protein_id gnl|my_center|LOCUS_25770 2698195 2697965 gene locus_tag LOCUS_25780 2698195 2697965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 2698523 2699824 gene locus_tag LOCUS_25790 2698523 2699824 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403144.1 protein_id gnl|my_center|LOCUS_25790 2701093 2699936 gene locus_tag LOCUS_25800 2701093 2699936 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890416.1 protein_id gnl|my_center|LOCUS_25800 2701225 2702028 gene locus_tag LOCUS_25810 2701225 2702028 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289315.1 protein_id gnl|my_center|LOCUS_25810 2703127 2702060 gene locus_tag LOCUS_25820 2703127 2702060 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902643.1 protein_id gnl|my_center|LOCUS_25820 2703572 2703129 gene locus_tag LOCUS_25830 2703572 2703129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2703799 2705166 gene locus_tag LOCUS_25840 2703799 2705166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2705166 2705633 gene locus_tag LOCUS_25850 2705166 2705633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2707575 2705677 gene locus_tag LOCUS_25860 2707575 2705677 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902014.1 protein_id gnl|my_center|LOCUS_25860 2708509 2707715 gene locus_tag LOCUS_25870 2708509 2707715 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902183.1 protein_id gnl|my_center|LOCUS_25870 2709549 2708704 gene locus_tag LOCUS_25880 gene trpA 2709549 2708704 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902182.1 protein_id gnl|my_center|LOCUS_25880 2710865 2709546 gene locus_tag LOCUS_25890 gene trpB 2710865 2709546 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902181.1 protein_id gnl|my_center|LOCUS_25890 2711650 2710862 gene locus_tag LOCUS_25900 gene trpC 2711650 2710862 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902180.1 protein_id gnl|my_center|LOCUS_25900 2711910 2712986 gene locus_tag LOCUS_25910 2711910 2712986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 2712986 2714785 gene locus_tag LOCUS_25920 2712986 2714785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2715274 2714999 gene locus_tag LOCUS_25930 2715274 2714999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 2715161 2716171 gene locus_tag LOCUS_25940 2715161 2716171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 2716171 2718009 gene locus_tag LOCUS_25950 2716171 2718009 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_25950 2718550 2718296 gene locus_tag LOCUS_25960 2718550 2718296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903482.1 protein_id gnl|my_center|LOCUS_25960 2719788 2718853 gene locus_tag LOCUS_25970 2719788 2718853 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289090.1 protein_id gnl|my_center|LOCUS_25970 2719787 2720482 gene locus_tag LOCUS_25980 gene pyrH 2719787 2720482 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903483.1 protein_id gnl|my_center|LOCUS_25980 2720479 2722230 gene locus_tag LOCUS_25990 gene lysS 2720479 2722230 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903484.1 protein_id gnl|my_center|LOCUS_25990 2723079 2722258 gene locus_tag LOCUS_26000 2723079 2722258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 2724523 2723279 gene locus_tag LOCUS_26010 2724523 2723279 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151112700.1 protein_id gnl|my_center|LOCUS_26010 2724655 2726166 gene locus_tag LOCUS_26020 2724655 2726166 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902592.1 protein_id gnl|my_center|LOCUS_26020 2726257 2727231 gene locus_tag LOCUS_26030 gene artA 2726257 2727231 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904000.1 protein_id gnl|my_center|LOCUS_26030 2727329 2728384 gene locus_tag LOCUS_26040 gene artA 2727329 2728384 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904000.1 protein_id gnl|my_center|LOCUS_26040 2729232 2728396 gene locus_tag LOCUS_26050 gene dph5 2729232 2728396 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289280.1 protein_id gnl|my_center|LOCUS_26050 2729369 2730121 gene locus_tag LOCUS_26060 2729369 2730121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289386.1 protein_id gnl|my_center|LOCUS_26060 2730721 2730137 gene locus_tag LOCUS_26070 2730721 2730137 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289316.1 protein_id gnl|my_center|LOCUS_26070 2730917 2731348 gene locus_tag LOCUS_26080 2730917 2731348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 2731368 2732387 gene locus_tag LOCUS_26090 2731368 2732387 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902803.1 protein_id gnl|my_center|LOCUS_26090 2732450 2732523 gene locus_tag LOCUS_t00300 2732450 2732523 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2734173 2732719 gene locus_tag LOCUS_26100 2734173 2732719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 2734443 2734856 gene locus_tag LOCUS_26110 2734443 2734856 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904240.1 protein_id gnl|my_center|LOCUS_26110 2735957 2735091 gene locus_tag LOCUS_26120 2735957 2735091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 2736058 2737299 gene locus_tag LOCUS_26130 2736058 2737299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2737472 2738308 gene locus_tag LOCUS_26140 gene hop 2737472 2738308 CDS product halorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902090.1 protein_id gnl|my_center|LOCUS_26140 2738354 2739349 gene locus_tag LOCUS_26150 2738354 2739349 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060981.1 protein_id gnl|my_center|LOCUS_26150 2739410 2739802 gene locus_tag LOCUS_26160 2739410 2739802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 2739915 2740064 gene locus_tag LOCUS_26170 2739915 2740064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 2740148 2741401 gene locus_tag LOCUS_26180 2740148 2741401 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289505.1 protein_id gnl|my_center|LOCUS_26180 2741478 2742713 gene locus_tag LOCUS_26190 2741478 2742713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 2743392 2742715 gene locus_tag LOCUS_26200 2743392 2742715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 2743555 2744094 gene locus_tag LOCUS_26210 2743555 2744094 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289517.1 protein_id gnl|my_center|LOCUS_26210 2746923 2744971 gene locus_tag LOCUS_26220 gene gatE 2746923 2744971 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902981.1 protein_id gnl|my_center|LOCUS_26220 2747054 2750479 gene locus_tag LOCUS_26230 2747054 2750479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 2750563 2751525 gene locus_tag LOCUS_26240 2750563 2751525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 2752962 2751547 gene locus_tag LOCUS_26250 2752962 2751547 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902984.1 protein_id gnl|my_center|LOCUS_26250 2753199 2752987 gene locus_tag LOCUS_26260 2753199 2752987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 2753105 2753386 gene locus_tag LOCUS_26270 2753105 2753386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 2753719 2753456 gene locus_tag LOCUS_26280 2753719 2753456 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902985.1 protein_id gnl|my_center|LOCUS_26280 2753870 2755972 gene locus_tag LOCUS_26290 2753870 2755972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 2757739 2755991 gene locus_tag LOCUS_26300 2757739 2755991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 2758809 2757826 gene locus_tag LOCUS_26310 gene fen 2758809 2757826 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902986.1 protein_id gnl|my_center|LOCUS_26310 2760313 2759225 gene locus_tag LOCUS_26320 2760313 2759225 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_26320 2762203 2760395 gene locus_tag LOCUS_26330 2762203 2760395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 2763984 2762296 gene locus_tag LOCUS_26340 2763984 2762296 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289376.1 protein_id gnl|my_center|LOCUS_26340 2764345 2763989 gene locus_tag LOCUS_26350 2764345 2763989 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903293.1 protein_id gnl|my_center|LOCUS_26350 2764561 2764866 gene locus_tag LOCUS_26360 2764561 2764866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 2765420 2764887 gene locus_tag LOCUS_26370 2765420 2764887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 2766001 2765555 gene locus_tag LOCUS_26380 2766001 2765555 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289360.1 protein_id gnl|my_center|LOCUS_26380 2766118 2767986 gene locus_tag LOCUS_26390 2766118 2767986 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_26390 2768811 2767993 gene locus_tag LOCUS_26400 2768811 2767993 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533089.1 protein_id gnl|my_center|LOCUS_26400 2768932 2769513 gene locus_tag LOCUS_26410 2768932 2769513 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902501.1 protein_id gnl|my_center|LOCUS_26410 2769510 2771030 gene locus_tag LOCUS_26420 2769510 2771030 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_26420 2771085 2772260 gene locus_tag LOCUS_26430 gene gcvT 2771085 2772260 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903168.1 protein_id gnl|my_center|LOCUS_26430 2772506 2772790 gene locus_tag LOCUS_26440 2772506 2772790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 2772870 2773253 gene locus_tag LOCUS_26450 gene gcvH 2772870 2773253 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903167.1 protein_id gnl|my_center|LOCUS_26450 2773378 2774709 gene locus_tag LOCUS_26460 gene gcvPA 2773378 2774709 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903166.1 protein_id gnl|my_center|LOCUS_26460 2774706 2776154 gene locus_tag LOCUS_26470 gene gcvPB 2774706 2776154 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903165.1 protein_id gnl|my_center|LOCUS_26470 2777340 2776336 gene locus_tag LOCUS_26480 2777340 2776336 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421550.1 protein_id gnl|my_center|LOCUS_26480 2777607 2777437 gene locus_tag LOCUS_26490 2777607 2777437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 2777833 2779314 gene locus_tag LOCUS_26500 2777833 2779314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 2779466 2780617 gene locus_tag LOCUS_26510 2779466 2780617 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228952.1 protein_id gnl|my_center|LOCUS_26510 2782137 2780863 gene locus_tag LOCUS_26520 gene hisD 2782137 2780863 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903049.1 protein_id gnl|my_center|LOCUS_26520 2782313 2783587 gene locus_tag LOCUS_26530 2782313 2783587 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577656.1 protein_id gnl|my_center|LOCUS_26530 2783590 2784822 gene locus_tag LOCUS_26540 2783590 2784822 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398440.1 protein_id gnl|my_center|LOCUS_26540 2784839 2785549 gene locus_tag LOCUS_26550 2784839 2785549 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289175.1 protein_id gnl|my_center|LOCUS_26550 2786179 2785559 gene locus_tag LOCUS_26560 2786179 2785559 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902398.1 protein_id gnl|my_center|LOCUS_26560 2786588 2786334 gene locus_tag LOCUS_26570 2786588 2786334 CDS product MTH865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060916.1 protein_id gnl|my_center|LOCUS_26570 2787055 2788152 gene locus_tag LOCUS_26580 2787055 2788152 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878673.1 protein_id gnl|my_center|LOCUS_26580 2788222 2789979 gene locus_tag LOCUS_26590 2788222 2789979 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_26590 2791644 2789992 gene locus_tag LOCUS_26600 2791644 2789992 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_26600 2792194 2791766 gene locus_tag LOCUS_26610 2792194 2791766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 2792305 2792685 gene locus_tag LOCUS_26620 2792305 2792685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 2792828 2793097 gene locus_tag LOCUS_26630 2792828 2793097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 2793294 2793103 gene locus_tag LOCUS_26640 2793294 2793103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 2794780 2793431 gene locus_tag LOCUS_26650 2794780 2793431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 2795185 2794823 gene locus_tag LOCUS_26660 2795185 2794823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 2795758 2795528 gene locus_tag LOCUS_26670 2795758 2795528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2795664 2796131 gene locus_tag LOCUS_26680 2795664 2796131 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_26680 2797493 2796135 gene locus_tag LOCUS_26690 2797493 2796135 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902866.1 protein_id gnl|my_center|LOCUS_26690 2798507 2799700 gene locus_tag LOCUS_26700 gene priS 2798507 2799700 CDS product DNA primase small subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289337.1 protein_id gnl|my_center|LOCUS_26700 2799714 2801111 gene locus_tag LOCUS_26710 2799714 2801111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 2801338 2801093 gene locus_tag LOCUS_26720 2801338 2801093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 2802245 2801595 gene locus_tag LOCUS_26730 2802245 2801595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2802569 2802874 gene locus_tag LOCUS_26740 2802569 2802874 CDS product DUF5785 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902883.1 protein_id gnl|my_center|LOCUS_26740 2802997 2803764 gene locus_tag LOCUS_26750 2802997 2803764 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902721.1 protein_id gnl|my_center|LOCUS_26750 2803892 2805127 gene locus_tag LOCUS_26760 2803892 2805127 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_26760 2806000 2805254 gene locus_tag LOCUS_26770 2806000 2805254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_26770 2806899 2805997 gene locus_tag LOCUS_26780 2806899 2805997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 protein_id gnl|my_center|LOCUS_26780 2808283 2806892 gene locus_tag LOCUS_26790 2808283 2806892 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228604.1 protein_id gnl|my_center|LOCUS_26790 2809419 2808280 gene locus_tag LOCUS_26800 2809419 2808280 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532983.1 protein_id gnl|my_center|LOCUS_26800 2809560 2810777 gene locus_tag LOCUS_26810 gene pgk 2809560 2810777 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902880.1 protein_id gnl|my_center|LOCUS_26810 2810774 2811301 gene locus_tag LOCUS_26820 2810774 2811301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 2811335 2811410 gene locus_tag LOCUS_t00310 2811335 2811410 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2811855 2811604 gene locus_tag LOCUS_26830 2811855 2811604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 2812288 2812058 gene locus_tag LOCUS_26840 2812288 2812058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 2812424 2813230 gene locus_tag LOCUS_26850 2812424 2813230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 2813281 2813511 gene locus_tag LOCUS_26860 2813281 2813511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 2814672 2813527 gene locus_tag LOCUS_26870 2814672 2813527 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902861.1 protein_id gnl|my_center|LOCUS_26870 2815166 2814714 gene locus_tag LOCUS_26880 2815166 2814714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 2815590 2815405 gene locus_tag LOCUS_26890 2815590 2815405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 2816903 2815671 gene locus_tag LOCUS_26900 2816903 2815671 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901949.1 protein_id gnl|my_center|LOCUS_26900 2818587 2817433 gene locus_tag LOCUS_26910 2818587 2817433 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902861.1 protein_id gnl|my_center|LOCUS_26910 2821003 2818742 gene locus_tag LOCUS_26920 2821003 2818742 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903073.1 protein_id gnl|my_center|LOCUS_26920 2821320 2821000 gene locus_tag LOCUS_26930 2821320 2821000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 2821467 2822252 gene locus_tag LOCUS_26940 2821467 2822252 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289338.1 protein_id gnl|my_center|LOCUS_26940 2822709 2823386 gene locus_tag LOCUS_26950 2822709 2823386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 2824192 2823380 gene locus_tag LOCUS_26960 gene panB 2824192 2823380 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903078.1 protein_id gnl|my_center|LOCUS_26960 2825223 2825507 gene locus_tag LOCUS_26970 2825223 2825507 CDS product DUF5822 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289339.1 protein_id gnl|my_center|LOCUS_26970 2826079 2825522 gene locus_tag LOCUS_26980 2826079 2825522 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289340.1 protein_id gnl|my_center|LOCUS_26980 2827266 2826133 gene locus_tag LOCUS_26990 2827266 2826133 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903082.1 protein_id gnl|my_center|LOCUS_26990 2828596 2827340 gene locus_tag LOCUS_27000 2828596 2827340 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361690.1 protein_id gnl|my_center|LOCUS_27000 2829230 2828757 gene locus_tag LOCUS_27010 2829230 2828757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 2829789 2829364 gene locus_tag LOCUS_27020 2829789 2829364 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890426.1 protein_id gnl|my_center|LOCUS_27020 2830359 2829871 gene locus_tag LOCUS_27030 2830359 2829871 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890418.1 protein_id gnl|my_center|LOCUS_27030 2830892 2830356 gene locus_tag LOCUS_27040 2830892 2830356 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890417.1 protein_id gnl|my_center|LOCUS_27040 2832118 2830892 gene locus_tag LOCUS_27050 2832118 2830892 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890416.1 protein_id gnl|my_center|LOCUS_27050 2832349 2832594 gene locus_tag LOCUS_27060 2832349 2832594 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890415.1 protein_id gnl|my_center|LOCUS_27060 2832591 2833211 gene locus_tag LOCUS_27070 2832591 2833211 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890414.1 protein_id gnl|my_center|LOCUS_27070 2833217 2834020 gene locus_tag LOCUS_27080 2833217 2834020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 2834100 2835290 gene locus_tag LOCUS_27090 2834100 2835290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2835388 2836005 gene locus_tag LOCUS_27100 2835388 2836005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 2836040 2836678 gene locus_tag LOCUS_27110 2836040 2836678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 2837217 2836675 gene locus_tag LOCUS_27120 2837217 2836675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902413.1 protein_id gnl|my_center|LOCUS_27120 2837924 2837412 gene locus_tag LOCUS_27130 2837924 2837412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 2838061 2838786 gene locus_tag LOCUS_27140 2838061 2838786 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903274.1 protein_id gnl|my_center|LOCUS_27140 2838871 2839542 gene locus_tag LOCUS_27150 2838871 2839542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 2839544 2841064 gene locus_tag LOCUS_27160 2839544 2841064 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902982.1 protein_id gnl|my_center|LOCUS_27160 2841192 2841040 gene locus_tag LOCUS_27170 2841192 2841040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 2841311 2841964 gene locus_tag LOCUS_27180 2841311 2841964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 2843372 2841945 gene locus_tag LOCUS_27190 2843372 2841945 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_27190 2843881 2843411 gene locus_tag LOCUS_27200 2843881 2843411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089667507.1 protein_id gnl|my_center|LOCUS_27200 2844050 2844229 gene locus_tag LOCUS_27210 2844050 2844229 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902845.1 protein_id gnl|my_center|LOCUS_27210 2844232 2844498 gene locus_tag LOCUS_27220 2844232 2844498 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289285.1 protein_id gnl|my_center|LOCUS_27220 2844616 2844975 gene locus_tag LOCUS_27230 2844616 2844975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 2845101 2845394 gene locus_tag LOCUS_27240 2845101 2845394 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902842.1 protein_id gnl|my_center|LOCUS_27240 2845399 2845755 gene locus_tag LOCUS_27250 2845399 2845755 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902841.1 protein_id gnl|my_center|LOCUS_27250 2845904 2846065 gene locus_tag LOCUS_27260 2845904 2846065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 2846984 2846130 gene locus_tag LOCUS_27270 2846984 2846130 CDS product translation initiation factor eIF-2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903055.1 protein_id gnl|my_center|LOCUS_27270 2846950 2847165 gene locus_tag LOCUS_27280 2846950 2847165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 2847131 2847466 gene locus_tag LOCUS_27290 2847131 2847466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289331.1 protein_id gnl|my_center|LOCUS_27290 2847563 2847721 gene locus_tag LOCUS_27300 2847563 2847721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177170774.1 protein_id gnl|my_center|LOCUS_27300 2849338 2847833 gene locus_tag LOCUS_27310 2849338 2847833 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903057.1 protein_id gnl|my_center|LOCUS_27310 2849289 2850458 gene locus_tag LOCUS_27320 2849289 2850458 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530136.1 protein_id gnl|my_center|LOCUS_27320 2851098 2850514 gene locus_tag LOCUS_27330 2851098 2850514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 2852187 2851150 gene locus_tag LOCUS_27340 2852187 2851150 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289630.1 protein_id gnl|my_center|LOCUS_27340 2852318 2852611 gene locus_tag LOCUS_27350 2852318 2852611 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143981.1 protein_id gnl|my_center|LOCUS_27350 2852608 2853387 gene locus_tag LOCUS_27360 2852608 2853387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 2853665 2855119 gene locus_tag LOCUS_27370 2853665 2855119 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289301.1 protein_id gnl|my_center|LOCUS_27370 2855116 2855676 gene locus_tag LOCUS_27380 gene moaC 2855116 2855676 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902923.1 protein_id gnl|my_center|LOCUS_27380 2855777 2857156 gene locus_tag LOCUS_27390 2855777 2857156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2858481 2857171 gene locus_tag LOCUS_27400 gene hflX 2858481 2857171 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902924.1 protein_id gnl|my_center|LOCUS_27400 2858628 2858951 gene locus_tag LOCUS_27410 2858628 2858951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 2859780 2859328 gene locus_tag LOCUS_27420 2859780 2859328 CDS product DUF5793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902637.1 protein_id gnl|my_center|LOCUS_27420 2859830 2860402 gene locus_tag LOCUS_27430 2859830 2860402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 2860539 2862206 gene locus_tag LOCUS_27440 2860539 2862206 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289232.1 protein_id gnl|my_center|LOCUS_27440 2862208 2864418 gene locus_tag LOCUS_27450 2862208 2864418 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361678.1 protein_id gnl|my_center|LOCUS_27450 2864420 2865118 gene locus_tag LOCUS_27460 2864420 2865118 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902573.1 protein_id gnl|my_center|LOCUS_27460 2865313 2865383 gene locus_tag LOCUS_t00320 2865313 2865383 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2865668 2867557 gene locus_tag LOCUS_27470 2865668 2867557 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289232.1 protein_id gnl|my_center|LOCUS_27470 2867554 2869572 gene locus_tag LOCUS_27480 2867554 2869572 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878495.1 protein_id gnl|my_center|LOCUS_27480 2869575 2871437 gene locus_tag LOCUS_27490 2869575 2871437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 2871507 2872208 gene locus_tag LOCUS_27500 2871507 2872208 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289247.1 protein_id gnl|my_center|LOCUS_27500 2872205 2872825 gene locus_tag LOCUS_27510 2872205 2872825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902481.1 protein_id gnl|my_center|LOCUS_27510 2873687 2872836 gene locus_tag LOCUS_27520 2873687 2872836 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289227.1 protein_id gnl|my_center|LOCUS_27520 2873834 2874088 gene locus_tag LOCUS_27530 2873834 2874088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 2874136 2874450 gene locus_tag LOCUS_27540 2874136 2874450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 2874490 2874562 gene locus_tag LOCUS_t00330 2874490 2874562 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2874942 2875592 gene locus_tag LOCUS_27550 2874942 2875592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 2875672 2876940 gene locus_tag LOCUS_27560 2875672 2876940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 2877127 2878821 gene locus_tag LOCUS_27570 2877127 2878821 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534776.1 protein_id gnl|my_center|LOCUS_27570 2881085 2879304 gene locus_tag LOCUS_27580 2881085 2879304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 2881741 2881082 gene locus_tag LOCUS_27590 2881741 2881082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 2881890 2882948 gene locus_tag LOCUS_27600 2881890 2882948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 2883133 2884167 gene locus_tag LOCUS_27610 2883133 2884167 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903958.1 protein_id gnl|my_center|LOCUS_27610 2884935 2884180 gene locus_tag LOCUS_27620 2884935 2884180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 2885016 2885564 gene locus_tag LOCUS_27630 2885016 2885564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 2885687 2885613 gene locus_tag LOCUS_t00340 2885687 2885613 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2885907 2886947 gene locus_tag LOCUS_27640 2885907 2886947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902695.1 protein_id gnl|my_center|LOCUS_27640 2886947 2887786 gene locus_tag LOCUS_27650 2886947 2887786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 2887863 2889188 gene locus_tag LOCUS_27660 2887863 2889188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 2889185 2890051 gene locus_tag LOCUS_27670 2889185 2890051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 2890131 2890751 gene locus_tag LOCUS_27680 2890131 2890751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 2890860 2891063 gene locus_tag LOCUS_27690 2890860 2891063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 2891115 2891786 gene locus_tag LOCUS_27700 gene deoC 2891115 2891786 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_27700 2893155 2891902 gene locus_tag LOCUS_27710 2893155 2891902 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023306.1 protein_id gnl|my_center|LOCUS_27710 2893461 2896211 gene locus_tag LOCUS_27720 2893461 2896211 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_27720 2896373 2896873 gene locus_tag LOCUS_27730 2896373 2896873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 2897513 2896986 gene locus_tag LOCUS_27740 2897513 2896986 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928468.1 protein_id gnl|my_center|LOCUS_27740 2898130 2897702 gene locus_tag LOCUS_27750 2898130 2897702 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_27750 2898249 2898800 gene locus_tag LOCUS_27760 2898249 2898800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2898843 2899760 gene locus_tag LOCUS_27770 2898843 2899760 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404152.1 protein_id gnl|my_center|LOCUS_27770 2899844 2900614 gene locus_tag LOCUS_27780 2899844 2900614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2900919 2901311 gene locus_tag LOCUS_27790 2900919 2901311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 2901473 2903020 gene locus_tag LOCUS_27800 2901473 2903020 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879947.1 protein_id gnl|my_center|LOCUS_27800 2903103 2903393 gene locus_tag LOCUS_27810 2903103 2903393 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869817.1 protein_id gnl|my_center|LOCUS_27810 2903398 2903979 gene locus_tag LOCUS_27820 2903398 2903979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 2904076 2905422 gene locus_tag LOCUS_27830 2904076 2905422 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259421.1 protein_id gnl|my_center|LOCUS_27830 2905927 2905529 gene locus_tag LOCUS_27840 2905927 2905529 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890426.1 protein_id gnl|my_center|LOCUS_27840 2906446 2906045 gene locus_tag LOCUS_27850 2906446 2906045 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890426.1 protein_id gnl|my_center|LOCUS_27850 2906757 2906551 gene locus_tag LOCUS_27860 2906757 2906551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 2907020 2907169 gene locus_tag LOCUS_27870 2907020 2907169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2907172 2908206 gene locus_tag LOCUS_27880 2907172 2908206 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890425.1 protein_id gnl|my_center|LOCUS_27880 2908382 2908918 gene locus_tag LOCUS_27890 2908382 2908918 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888029.1 protein_id gnl|my_center|LOCUS_27890 2909348 2908929 gene locus_tag LOCUS_27900 2909348 2908929 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_27900 2910538 2909429 gene locus_tag LOCUS_27910 2910538 2909429 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888750.1 protein_id gnl|my_center|LOCUS_27910 2911483 2910632 gene locus_tag LOCUS_27920 2911483 2910632 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250984.1 protein_id gnl|my_center|LOCUS_27920 2912315 2911575 gene locus_tag LOCUS_27930 2912315 2911575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 2913463 2912318 gene locus_tag LOCUS_27940 2913463 2912318 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 protein_id gnl|my_center|LOCUS_27940 2913696 2913460 gene locus_tag LOCUS_27950 2913696 2913460 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878063.1 protein_id gnl|my_center|LOCUS_27950 2915024 2913774 gene locus_tag LOCUS_27960 2915024 2913774 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812305.1 protein_id gnl|my_center|LOCUS_27960 2915574 2915104 gene locus_tag LOCUS_27970 2915574 2915104 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890418.1 protein_id gnl|my_center|LOCUS_27970 2916053 2915571 gene locus_tag LOCUS_27980 2916053 2915571 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890417.1 protein_id gnl|my_center|LOCUS_27980 2917263 2916064 gene locus_tag LOCUS_27990 2917263 2916064 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890416.1 protein_id gnl|my_center|LOCUS_27990 2917560 2917814 gene locus_tag LOCUS_28000 2917560 2917814 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890415.1 protein_id gnl|my_center|LOCUS_28000 2917931 2918401 gene locus_tag LOCUS_28010 2917931 2918401 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890414.1 protein_id gnl|my_center|LOCUS_28010 2918578 2918988 gene locus_tag LOCUS_28020 2918578 2918988 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_28020 2919464 2919018 gene locus_tag LOCUS_28030 2919464 2919018 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_28030 2919680 2920267 gene locus_tag LOCUS_28040 2919680 2920267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 2920460 2920311 gene locus_tag LOCUS_28050 2920460 2920311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 2920752 2921906 gene locus_tag LOCUS_28060 2920752 2921906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 2923155 2921932 gene locus_tag LOCUS_28070 2923155 2921932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903588.1 protein_id gnl|my_center|LOCUS_28070 2923352 2923762 gene locus_tag LOCUS_28080 2923352 2923762 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902412.1 protein_id gnl|my_center|LOCUS_28080 2924163 2923810 gene locus_tag LOCUS_28090 2924163 2923810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 2924290 2924694 gene locus_tag LOCUS_28100 2924290 2924694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 2925197 2927245 gene locus_tag LOCUS_28110 gene fdhF 2925197 2927245 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774551.1 protein_id gnl|my_center|LOCUS_28110 2927346 2927792 gene locus_tag LOCUS_28120 2927346 2927792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 2927922 2928596 gene locus_tag LOCUS_28130 2927922 2928596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 2928723 2929892 gene locus_tag LOCUS_28140 2928723 2929892 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877710.1 protein_id gnl|my_center|LOCUS_28140 2930377 2929958 gene locus_tag LOCUS_28150 2930377 2929958 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081422747.1 protein_id gnl|my_center|LOCUS_28150 2930615 2931007 gene locus_tag LOCUS_28160 2930615 2931007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 2931586 2931014 gene locus_tag LOCUS_28170 2931586 2931014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 2932176 2931583 gene locus_tag LOCUS_28180 2932176 2931583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 2932707 2932228 gene locus_tag LOCUS_28190 2932707 2932228 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902425.1 protein_id gnl|my_center|LOCUS_28190 2932706 2933116 gene locus_tag LOCUS_28200 2932706 2933116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 2933208 2933453 gene locus_tag LOCUS_28210 2933208 2933453 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902408.1 protein_id gnl|my_center|LOCUS_28210 2933450 2934373 gene locus_tag LOCUS_28220 2933450 2934373 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902838.1 protein_id gnl|my_center|LOCUS_28220 2934630 2934893 gene locus_tag LOCUS_28230 2934630 2934893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 2936856 2935120 gene locus_tag LOCUS_28240 2936856 2935120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 2937288 2938112 gene locus_tag LOCUS_28250 2937288 2938112 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338959.1 protein_id gnl|my_center|LOCUS_28250 2938278 2938652 gene locus_tag LOCUS_28260 2938278 2938652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 2940425 2938707 gene locus_tag LOCUS_28270 2940425 2938707 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892595.1 protein_id gnl|my_center|LOCUS_28270 2941418 2940531 gene locus_tag LOCUS_28280 2941418 2940531 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089826111.1 protein_id gnl|my_center|LOCUS_28280 2942219 2941425 gene locus_tag LOCUS_28290 gene fba1 2942219 2941425 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902472.1 protein_id gnl|my_center|LOCUS_28290 2942302 2943540 gene locus_tag LOCUS_28300 2942302 2943540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 2943590 2944261 gene locus_tag LOCUS_28310 2943590 2944261 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903770.1 protein_id gnl|my_center|LOCUS_28310 2944401 2944823 gene locus_tag LOCUS_28320 2944401 2944823 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902462.1 protein_id gnl|my_center|LOCUS_28320 2944831 2946003 gene locus_tag LOCUS_28330 2944831 2946003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 2947965 2946106 gene locus_tag LOCUS_28340 2947965 2946106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 2948125 2949138 gene locus_tag LOCUS_28350 2948125 2949138 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289638.1 protein_id gnl|my_center|LOCUS_28350 2950462 2949185 gene locus_tag LOCUS_28360 2950462 2949185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 2951173 2950565 gene locus_tag LOCUS_28370 2951173 2950565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 2951910 2951173 gene locus_tag LOCUS_28380 2951910 2951173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 2952071 2952511 gene locus_tag LOCUS_28390 2952071 2952511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 2952578 2953591 gene locus_tag LOCUS_28400 2952578 2953591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 2953707 2955389 gene locus_tag LOCUS_28410 2953707 2955389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 2955386 2956414 gene locus_tag LOCUS_28420 2955386 2956414 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138789.1 protein_id gnl|my_center|LOCUS_28420 2957149 2956415 gene locus_tag LOCUS_28430 2957149 2956415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 2957148 2958926 gene locus_tag LOCUS_28440 2957148 2958926 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903101.1 protein_id gnl|my_center|LOCUS_28440 2959908 2958976 gene locus_tag LOCUS_28450 2959908 2958976 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_28450 2960902 2960006 gene locus_tag LOCUS_28460 2960902 2960006 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902500.1 protein_id gnl|my_center|LOCUS_28460 2961869 2961015 gene locus_tag LOCUS_28470 2961869 2961015 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903774.1 protein_id gnl|my_center|LOCUS_28470 2962909 2961866 gene locus_tag LOCUS_28480 2962909 2961866 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_28480 2962924 2963310 gene locus_tag LOCUS_28490 2962924 2963310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 2963505 2963263 gene locus_tag LOCUS_28500 2963505 2963263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 2963420 2964184 gene locus_tag LOCUS_28510 2963420 2964184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 2964369 2964869 gene locus_tag LOCUS_28520 2964369 2964869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 2964866 2965225 gene locus_tag LOCUS_28530 2964866 2965225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 2965267 2965476 gene locus_tag LOCUS_28540 2965267 2965476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 2967336 2965480 gene locus_tag LOCUS_28550 gene menD 2967336 2965480 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902775.1 protein_id gnl|my_center|LOCUS_28550 2967814 2967452 gene locus_tag LOCUS_28560 2967814 2967452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 2969323 2967875 gene locus_tag LOCUS_28570 2969323 2967875 CDS product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902776.1 protein_id gnl|my_center|LOCUS_28570 2970849 2970382 gene locus_tag LOCUS_28580 2970849 2970382 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318983.1 protein_id gnl|my_center|LOCUS_28580 2971385 2970873 gene locus_tag LOCUS_28590 2971385 2970873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 2973349 2971385 gene locus_tag LOCUS_28600 2973349 2971385 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902952.1 protein_id gnl|my_center|LOCUS_28600 2973549 2975705 gene locus_tag LOCUS_28610 2973549 2975705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 2976027 2975722 gene locus_tag LOCUS_28620 2976027 2975722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 protein_id gnl|my_center|LOCUS_28620 2976225 2977688 gene locus_tag LOCUS_28630 2976225 2977688 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902782.1 protein_id gnl|my_center|LOCUS_28630 2977792 2979978 gene locus_tag LOCUS_28640 2977792 2979978 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902430.1 protein_id gnl|my_center|LOCUS_28640 2980064 2981269 gene locus_tag LOCUS_28650 2980064 2981269 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892490.1 protein_id gnl|my_center|LOCUS_28650 2982157 2981273 gene locus_tag LOCUS_28660 2982157 2981273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 2983476 2982508 gene locus_tag LOCUS_28670 2983476 2982508 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_28670 2983789 2985219 gene locus_tag LOCUS_28680 2983789 2985219 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406951.1 protein_id gnl|my_center|LOCUS_28680 2985362 2987503 gene locus_tag LOCUS_28690 2985362 2987503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 2987784 2987587 gene locus_tag LOCUS_28700 2987784 2987587 CDS product DUF5800 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902336.1 protein_id gnl|my_center|LOCUS_28700 2989500 2987851 gene locus_tag LOCUS_28710 2989500 2987851 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902770.1 protein_id gnl|my_center|LOCUS_28710 2990659 2989556 gene locus_tag LOCUS_28720 2990659 2989556 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289275.1 protein_id gnl|my_center|LOCUS_28720 2991636 2990659 gene locus_tag LOCUS_28730 2991636 2990659 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902772.1 protein_id gnl|my_center|LOCUS_28730 2992548 2991742 gene locus_tag LOCUS_28740 2992548 2991742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 2992752 2993567 gene locus_tag LOCUS_28750 gene hisF 2992752 2993567 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902602.1 protein_id gnl|my_center|LOCUS_28750 2994138 2993851 gene locus_tag LOCUS_28760 2994138 2993851 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902601.1 protein_id gnl|my_center|LOCUS_28760 2994611 2994210 gene locus_tag LOCUS_28770 2994611 2994210 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289270.1 protein_id gnl|my_center|LOCUS_28770 2994750 2995259 gene locus_tag LOCUS_28780 2994750 2995259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 2995383 2996183 gene locus_tag LOCUS_28790 2995383 2996183 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902366.1 protein_id gnl|my_center|LOCUS_28790 2996246 2996452 gene locus_tag LOCUS_28800 2996246 2996452 CDS product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902365.1 protein_id gnl|my_center|LOCUS_28800 2997619 2996645 gene locus_tag LOCUS_28810 2997619 2996645 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903108.1 protein_id gnl|my_center|LOCUS_28810 2997705 2997896 gene locus_tag LOCUS_28820 2997705 2997896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 2998532 2997951 gene locus_tag LOCUS_28830 2998532 2997951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 2998780 2999445 gene locus_tag LOCUS_28840 gene tenA 2998780 2999445 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 protein_id gnl|my_center|LOCUS_28840 2999442 3000146 gene locus_tag LOCUS_28850 2999442 3000146 CDS product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993682.1 protein_id gnl|my_center|LOCUS_28850 3000327 3000662 gene locus_tag LOCUS_28860 3000327 3000662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289346.1 protein_id gnl|my_center|LOCUS_28860 3001545 3000730 gene locus_tag LOCUS_28870 3001545 3000730 CDS product DUF5821 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289323.1 protein_id gnl|my_center|LOCUS_28870 3003777 3001750 gene locus_tag LOCUS_28880 3003777 3001750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289324.1 protein_id gnl|my_center|LOCUS_28880 3004098 3005348 gene locus_tag LOCUS_28890 3004098 3005348 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289325.1 protein_id gnl|my_center|LOCUS_28890 3005489 3006880 gene locus_tag LOCUS_28900 3005489 3006880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 3007821 3006955 gene locus_tag LOCUS_28910 3007821 3006955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 3007890 3008426 gene locus_tag LOCUS_28920 3007890 3008426 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289350.1 protein_id gnl|my_center|LOCUS_28920 3010480 3008483 gene locus_tag LOCUS_28930 3010480 3008483 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903521.1 protein_id gnl|my_center|LOCUS_28930 3010598 3011863 gene locus_tag LOCUS_28940 3010598 3011863 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903672.1 protein_id gnl|my_center|LOCUS_28940 3011928 3013112 gene locus_tag LOCUS_28950 3011928 3013112 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006824761.1 protein_id gnl|my_center|LOCUS_28950 3014197 3013151 gene locus_tag LOCUS_28960 3014197 3013151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 3014453 3014527 gene locus_tag LOCUS_t00350 3014453 3014527 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3014761 3015825 gene locus_tag LOCUS_28970 3014761 3015825 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903788.1 protein_id gnl|my_center|LOCUS_28970 3015830 3017680 gene locus_tag LOCUS_28980 3015830 3017680 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903789.1 protein_id gnl|my_center|LOCUS_28980 3017670 3018740 gene locus_tag LOCUS_28990 3017670 3018740 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903790.1 protein_id gnl|my_center|LOCUS_28990 3019408 3018821 gene locus_tag LOCUS_29000 3019408 3018821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 3019519 3020151 gene locus_tag LOCUS_29010 3019519 3020151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 3020277 3022409 gene locus_tag LOCUS_29020 3020277 3022409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 3022406 3023095 gene locus_tag LOCUS_29030 3022406 3023095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 3023092 3024450 gene locus_tag LOCUS_29040 3023092 3024450 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902121.1 protein_id gnl|my_center|LOCUS_29040 3024447 3026039 gene locus_tag LOCUS_29050 3024447 3026039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 3027024 3026068 gene locus_tag LOCUS_29060 3027024 3026068 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_29060 3027172 3027873 gene locus_tag LOCUS_29070 3027172 3027873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 3027987 3028724 gene locus_tag LOCUS_29080 3027987 3028724 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101294608.1 protein_id gnl|my_center|LOCUS_29080 3028840 3029283 gene locus_tag LOCUS_29090 3028840 3029283 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319975.1 protein_id gnl|my_center|LOCUS_29090 3029360 3031363 gene locus_tag LOCUS_29100 3029360 3031363 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903521.1 protein_id gnl|my_center|LOCUS_29100 3032086 3031364 gene locus_tag LOCUS_29110 3032086 3031364 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902025.1 protein_id gnl|my_center|LOCUS_29110 3033205 3032129 gene locus_tag LOCUS_29120 gene aglJ 3033205 3032129 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902752.1 protein_id gnl|my_center|LOCUS_29120 3033512 3034381 gene locus_tag LOCUS_29130 3033512 3034381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 3034447 3035697 gene locus_tag LOCUS_29140 3034447 3035697 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041861981.1 protein_id gnl|my_center|LOCUS_29140 3036427 3035876 gene locus_tag LOCUS_29150 3036427 3035876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 3037324 3036431 gene locus_tag LOCUS_29160 3037324 3036431 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903030.1 protein_id gnl|my_center|LOCUS_29160 3038008 3037391 gene locus_tag LOCUS_29170 3038008 3037391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 3038124 3038633 gene locus_tag LOCUS_29180 3038124 3038633 CDS product DUF5797 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902272.1 protein_id gnl|my_center|LOCUS_29180 3038723 3039157 gene locus_tag LOCUS_29190 3038723 3039157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 3040368 3039277 gene locus_tag LOCUS_29200 3040368 3039277 CDS product DUF5787 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289155.1 protein_id gnl|my_center|LOCUS_29200 3040475 3042784 gene locus_tag LOCUS_29210 3040475 3042784 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466031.1 protein_id gnl|my_center|LOCUS_29210 3043315 3042788 gene locus_tag LOCUS_29220 3043315 3042788 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902274.1 protein_id gnl|my_center|LOCUS_29220 3043458 3043775 gene locus_tag LOCUS_29230 3043458 3043775 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902269.1 protein_id gnl|my_center|LOCUS_29230 3043842 3044168 gene locus_tag LOCUS_29240 3043842 3044168 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902269.1 protein_id gnl|my_center|LOCUS_29240 3044426 3045019 gene locus_tag LOCUS_29250 gene cysE 3044426 3045019 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929921.1 protein_id gnl|my_center|LOCUS_29250 3045460 3045041 gene locus_tag LOCUS_29260 3045460 3045041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 3045979 3045575 gene locus_tag LOCUS_29270 3045979 3045575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 3046227 3046601 gene locus_tag LOCUS_29280 3046227 3046601 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136360906.1 protein_id gnl|my_center|LOCUS_29280 3046604 3046876 gene locus_tag LOCUS_29290 3046604 3046876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 3046873 3047286 gene locus_tag LOCUS_29300 3046873 3047286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 3047946 3047293 gene locus_tag LOCUS_29310 3047946 3047293 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902951.1 protein_id gnl|my_center|LOCUS_29310 3049634 3048252 gene locus_tag LOCUS_29320 3049634 3048252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 3051355 3049715 gene locus_tag LOCUS_29330 3051355 3049715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 3051519 3052619 gene locus_tag LOCUS_29340 3051519 3052619 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227959.1 protein_id gnl|my_center|LOCUS_29340 3052934 3052671 gene locus_tag LOCUS_29350 3052934 3052671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 3053089 3053280 gene locus_tag LOCUS_29360 3053089 3053280 CDS product small nuclear ribonucleoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289341.1 protein_id gnl|my_center|LOCUS_29360 3053277 3053453 gene locus_tag LOCUS_29370 3053277 3053453 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903091.1 protein_id gnl|my_center|LOCUS_29370 3053623 3055098 gene locus_tag LOCUS_29380 gene purF 3053623 3055098 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903090.1 protein_id gnl|my_center|LOCUS_29380 3055378 3055118 gene locus_tag LOCUS_29390 3055378 3055118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 3056030 3055446 gene locus_tag LOCUS_29400 3056030 3055446 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903089.1 protein_id gnl|my_center|LOCUS_29400 3056120 3056263 gene locus_tag LOCUS_29410 3056120 3056263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 3056376 3056651 gene locus_tag LOCUS_29420 3056376 3056651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 3057178 3057093 gene locus_tag LOCUS_t00360 3057178 3057093 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3057346 3057843 gene locus_tag LOCUS_29430 3057346 3057843 CDS product multiprotein-bridging factor 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903083.1 protein_id gnl|my_center|LOCUS_29430 3057956 3059437 gene locus_tag LOCUS_29440 3057956 3059437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 3059439 3062135 gene locus_tag LOCUS_29450 3059439 3062135 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022632.1 protein_id gnl|my_center|LOCUS_29450 3062155 3063165 gene locus_tag LOCUS_29460 3062155 3063165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 3063223 3063705 gene locus_tag LOCUS_29470 3063223 3063705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 3063783 3065498 gene locus_tag LOCUS_29480 3063783 3065498 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902829.1 protein_id gnl|my_center|LOCUS_29480 3066216 3065554 gene locus_tag LOCUS_29490 3066216 3065554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 3067298 3066285 gene locus_tag LOCUS_29500 3067298 3066285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 3067452 3067781 gene locus_tag LOCUS_29510 3067452 3067781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 3067824 3068330 gene locus_tag LOCUS_29520 3067824 3068330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 3068379 3069188 gene locus_tag LOCUS_29530 3068379 3069188 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902972.1 protein_id gnl|my_center|LOCUS_29530 3070770 3069358 gene locus_tag LOCUS_29540 3070770 3069358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 3071546 3070899 gene locus_tag LOCUS_29550 3071546 3070899 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902309.1 protein_id gnl|my_center|LOCUS_29550 3071736 3073505 gene locus_tag LOCUS_29560 3071736 3073505 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902308.1 protein_id gnl|my_center|LOCUS_29560 3073502 3074365 gene locus_tag LOCUS_29570 3073502 3074365 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902307.1 protein_id gnl|my_center|LOCUS_29570 3074704 3075135 gene locus_tag LOCUS_29580 3074704 3075135 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902267.1 protein_id gnl|my_center|LOCUS_29580 3075132 3076013 gene locus_tag LOCUS_29590 3075132 3076013 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902268.1 protein_id gnl|my_center|LOCUS_29590 3076084 3076296 gene locus_tag LOCUS_29600 3076084 3076296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902953.1 protein_id gnl|my_center|LOCUS_29600 3076289 3076690 gene locus_tag LOCUS_29610 3076289 3076690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 3077329 3076727 gene locus_tag LOCUS_29620 3077329 3076727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 3077512 3078567 gene locus_tag LOCUS_29630 3077512 3078567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 3078976 3078569 gene locus_tag LOCUS_29640 3078976 3078569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 3080417 3079029 gene locus_tag LOCUS_29650 3080417 3079029 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289330.1 protein_id gnl|my_center|LOCUS_29650 3080539 3080850 gene locus_tag LOCUS_29660 3080539 3080850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 3082650 3081319 gene locus_tag LOCUS_29670 3082650 3081319 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_29670 3082872 3084578 gene locus_tag LOCUS_29680 3082872 3084578 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892595.1 protein_id gnl|my_center|LOCUS_29680 3085027 3085770 gene locus_tag LOCUS_29690 3085027 3085770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902320.1 protein_id gnl|my_center|LOCUS_29690 3086163 3085777 gene locus_tag LOCUS_29700 gene mce 3086163 3085777 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289162.1 protein_id gnl|my_center|LOCUS_29700 3087909 3086227 gene locus_tag LOCUS_29710 3087909 3086227 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289163.1 protein_id gnl|my_center|LOCUS_29710 3088945 3087995 gene locus_tag LOCUS_29720 3088945 3087995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 3089587 3089000 gene locus_tag LOCUS_29730 3089587 3089000 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902314.1 protein_id gnl|my_center|LOCUS_29730 3089753 3091732 gene locus_tag LOCUS_29740 3089753 3091732 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138655632.1 protein_id gnl|my_center|LOCUS_29740 3092263 3091838 gene locus_tag LOCUS_29750 3092263 3091838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 3092440 3093021 gene locus_tag LOCUS_29760 3092440 3093021 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903176.1 protein_id gnl|my_center|LOCUS_29760 3093306 3093028 gene locus_tag LOCUS_29770 3093306 3093028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 3093485 3094132 gene locus_tag LOCUS_29780 3093485 3094132 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903104.1 protein_id gnl|my_center|LOCUS_29780 3094215 3095189 gene locus_tag LOCUS_29790 3094215 3095189 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_29790 3096291 3095206 gene locus_tag LOCUS_29800 3096291 3095206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 3097405 3096383 gene locus_tag LOCUS_29810 3097405 3096383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 3097581 3098717 gene locus_tag LOCUS_29820 3097581 3098717 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903039.1 protein_id gnl|my_center|LOCUS_29820 3099793 3098738 gene locus_tag LOCUS_29830 3099793 3098738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 3100040 3100702 gene locus_tag LOCUS_29840 3100040 3100702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 3101218 3100748 gene locus_tag LOCUS_29850 3101218 3100748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 3102343 3101474 gene locus_tag LOCUS_29860 gene sucD 3102343 3101474 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903125.1 protein_id gnl|my_center|LOCUS_29860 3103485 3102340 gene locus_tag LOCUS_29870 gene sucC 3103485 3102340 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289349.1 protein_id gnl|my_center|LOCUS_29870 3103622 3104017 gene locus_tag LOCUS_29880 gene erpA 3103622 3104017 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255939.1 protein_id gnl|my_center|LOCUS_29880 3104262 3104062 gene locus_tag LOCUS_29890 3104262 3104062 CDS product dodecin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289329.1 protein_id gnl|my_center|LOCUS_29890 3105034 3104357 gene locus_tag LOCUS_29900 3105034 3104357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903725.1 protein_id gnl|my_center|LOCUS_29900 3105762 3105031 gene locus_tag LOCUS_29910 3105762 3105031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 3106502 3105984 gene locus_tag LOCUS_29920 3106502 3105984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 3106714 3107502 gene locus_tag LOCUS_29930 3106714 3107502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 3108561 3107593 gene locus_tag LOCUS_29940 3108561 3107593 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903051.1 protein_id gnl|my_center|LOCUS_29940 3109047 3108637 gene locus_tag LOCUS_29950 3109047 3108637 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289332.1 protein_id gnl|my_center|LOCUS_29950 3110309 3109044 gene locus_tag LOCUS_29960 3110309 3109044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 3110518 3111000 gene locus_tag LOCUS_29970 3110518 3111000 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892508.1 protein_id gnl|my_center|LOCUS_29970 3111291 3111073 gene locus_tag LOCUS_29980 3111291 3111073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 3112980 3111733 gene locus_tag LOCUS_29990 3112980 3111733 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_29990 3113063 3114124 gene locus_tag LOCUS_30000 3113063 3114124 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889453.1 protein_id gnl|my_center|LOCUS_30000 3114121 3114798 gene locus_tag LOCUS_30010 3114121 3114798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 3115005 3115397 gene locus_tag LOCUS_30020 3115005 3115397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 3115707 3115414 gene locus_tag LOCUS_30030 3115707 3115414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 3116052 3115786 gene locus_tag LOCUS_30040 3116052 3115786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 3117091 3116120 gene locus_tag LOCUS_30050 3117091 3116120 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731198.1 protein_id gnl|my_center|LOCUS_30050 3117163 3117462 gene locus_tag LOCUS_30060 3117163 3117462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 3117528 3118274 gene locus_tag LOCUS_30070 gene yqeC 3117528 3118274 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_30070 3118339 3118515 gene locus_tag LOCUS_30080 3118339 3118515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 3119185 3118538 gene locus_tag LOCUS_30090 3119185 3118538 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902576.1 protein_id gnl|my_center|LOCUS_30090 3119269 3120819 gene locus_tag LOCUS_30100 3119269 3120819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 3121499 3120825 gene locus_tag LOCUS_30110 3121499 3120825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 3124962 3121666 gene locus_tag LOCUS_30120 3124962 3121666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 3126518 3124959 gene locus_tag LOCUS_30130 3126518 3124959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 3126552 3126881 gene locus_tag LOCUS_30140 3126552 3126881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 3127275 3126883 gene locus_tag LOCUS_30150 3127275 3126883 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061340.1 protein_id gnl|my_center|LOCUS_30150 3127694 3127900 gene locus_tag LOCUS_30160 3127694 3127900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 3127893 3128195 gene locus_tag LOCUS_30170 3127893 3128195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 3128198 3129046 gene locus_tag LOCUS_30180 3128198 3129046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 3130523 3131782 gene locus_tag LOCUS_30190 3130523 3131782 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896009.1 protein_id gnl|my_center|LOCUS_30190 3131885 3132076 gene locus_tag LOCUS_30200 3131885 3132076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 3132297 3134201 gene locus_tag LOCUS_30210 3132297 3134201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 3134322 3135263 gene locus_tag LOCUS_30220 3134322 3135263 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_30220 3135598 3135371 gene locus_tag LOCUS_30230 3135598 3135371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 3136371 3135787 gene locus_tag LOCUS_30240 3136371 3135787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 3137607 3136408 gene locus_tag LOCUS_30250 3137607 3136408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 3137730 3138113 gene locus_tag LOCUS_30260 3137730 3138113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 3138999 3138118 gene locus_tag LOCUS_30270 3138999 3138118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 3139831 3139040 gene locus_tag LOCUS_30280 3139831 3139040 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902271.1 protein_id gnl|my_center|LOCUS_30280 3140068 3140484 gene locus_tag LOCUS_30290 3140068 3140484 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809022.1 protein_id gnl|my_center|LOCUS_30290 3140676 3140491 gene locus_tag LOCUS_30300 3140676 3140491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 3141061 3141612 gene locus_tag LOCUS_30310 3141061 3141612 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085497.1 protein_id gnl|my_center|LOCUS_30310 3141653 3143344 gene locus_tag LOCUS_30320 3141653 3143344 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_30320 3144329 3143382 gene locus_tag LOCUS_30330 3144329 3143382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 3144571 3144765 gene locus_tag LOCUS_30340 3144571 3144765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 3144762 3145604 gene locus_tag LOCUS_30350 3144762 3145604 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_30350 3145778 3147187 gene locus_tag LOCUS_30360 3145778 3147187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 3147850 3147272 gene locus_tag LOCUS_30370 3147850 3147272 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_30370 3148258 3147854 gene locus_tag LOCUS_30380 3148258 3147854 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903020.1 protein_id gnl|my_center|LOCUS_30380 3148366 3149040 gene locus_tag LOCUS_30390 3148366 3149040 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049924277.1 protein_id gnl|my_center|LOCUS_30390 3149158 3149550 gene locus_tag LOCUS_30400 gene sdhC 3149158 3149550 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289306.1 protein_id gnl|my_center|LOCUS_30400 3149552 3149932 gene locus_tag LOCUS_30410 3149552 3149932 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902949.1 protein_id gnl|my_center|LOCUS_30410 3149932 3150822 gene locus_tag LOCUS_30420 3149932 3150822 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902948.1 protein_id gnl|my_center|LOCUS_30420 3150978 3152843 gene locus_tag LOCUS_30430 3150978 3152843 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902947.1 protein_id gnl|my_center|LOCUS_30430 3153250 3154275 gene locus_tag LOCUS_30440 3153250 3154275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 3154400 3155746 gene locus_tag LOCUS_30450 3154400 3155746 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902270.1 protein_id gnl|my_center|LOCUS_30450 3155845 3156201 gene locus_tag LOCUS_30460 3155845 3156201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 3156198 3157304 gene locus_tag LOCUS_30470 3156198 3157304 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902489.1 protein_id gnl|my_center|LOCUS_30470 3157421 3158032 gene locus_tag LOCUS_30480 gene sod 3157421 3158032 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902966.1 protein_id gnl|my_center|LOCUS_30480 3158250 3158888 gene locus_tag LOCUS_30490 3158250 3158888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 3158957 3159229 gene locus_tag LOCUS_30500 3158957 3159229 CDS product DUF5827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902964.1 protein_id gnl|my_center|LOCUS_30500 3159950 3159243 gene locus_tag LOCUS_30510 3159950 3159243 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289133.1 protein_id gnl|my_center|LOCUS_30510 3161321 3160074 gene locus_tag LOCUS_30520 3161321 3160074 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903320.1 protein_id gnl|my_center|LOCUS_30520 3161483 3162079 gene locus_tag LOCUS_30530 3161483 3162079 CDS product DUF6149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903316.1 protein_id gnl|my_center|LOCUS_30530 3162382 3162152 gene locus_tag LOCUS_30540 3162382 3162152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 3162632 3162904 gene locus_tag LOCUS_30550 3162632 3162904 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904071.1 protein_id gnl|my_center|LOCUS_30550 3162901 3163182 gene locus_tag LOCUS_30560 3162901 3163182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 3164387 3163848 gene locus_tag LOCUS_30570 3164387 3163848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 3164504 3165310 gene locus_tag LOCUS_30580 3164504 3165310 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467786.1 protein_id gnl|my_center|LOCUS_30580 3168026 3165339 gene locus_tag LOCUS_30590 3168026 3165339 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289343.1 protein_id gnl|my_center|LOCUS_30590 3168185 3168736 gene locus_tag LOCUS_30600 3168185 3168736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289342.1 protein_id gnl|my_center|LOCUS_30600 3168938 3168747 gene locus_tag LOCUS_30610 3168938 3168747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 3169121 3169768 gene locus_tag LOCUS_30620 3169121 3169768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 3170874 3169837 gene locus_tag LOCUS_30630 3170874 3169837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 3171433 3170915 gene locus_tag LOCUS_30640 3171433 3170915 CDS product DUF5804 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289303.1 protein_id gnl|my_center|LOCUS_30640 3171736 3171602 gene locus_tag LOCUS_30650 3171736 3171602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 3171857 3172831 gene locus_tag LOCUS_30660 3171857 3172831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902476.1 protein_id gnl|my_center|LOCUS_30660 3172828 3174660 gene locus_tag LOCUS_30670 3172828 3174660 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902477.1 protein_id gnl|my_center|LOCUS_30670 3174653 3175867 gene locus_tag LOCUS_30680 3174653 3175867 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892491.1 protein_id gnl|my_center|LOCUS_30680 3175922 3176725 gene locus_tag LOCUS_30690 3175922 3176725 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902235.1 protein_id gnl|my_center|LOCUS_30690 3176752 3177624 gene locus_tag LOCUS_30700 3176752 3177624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 3178494 3177793 gene locus_tag LOCUS_30710 3178494 3177793 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902530.1 protein_id gnl|my_center|LOCUS_30710 3179408 3178563 gene locus_tag LOCUS_30720 3179408 3178563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 3180181 3179492 gene locus_tag LOCUS_30730 3180181 3179492 CDS product DUF2110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902528.1 protein_id gnl|my_center|LOCUS_30730 3180718 3180182 gene locus_tag LOCUS_30740 3180718 3180182 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289219.1 protein_id gnl|my_center|LOCUS_30740 3180842 3181345 gene locus_tag LOCUS_30750 3180842 3181345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 3181681 3181394 gene locus_tag LOCUS_30760 3181681 3181394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 3181810 3182367 gene locus_tag LOCUS_30770 3181810 3182367 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484893.1 protein_id gnl|my_center|LOCUS_30770 3182559 3183497 gene locus_tag LOCUS_30780 3182559 3183497 CDS product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289447.1 protein_id gnl|my_center|LOCUS_30780 3183499 3184104 gene locus_tag LOCUS_30790 3183499 3184104 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903600.1 protein_id gnl|my_center|LOCUS_30790 3184219 3185052 gene locus_tag LOCUS_30800 3184219 3185052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 3185428 3185976 gene locus_tag LOCUS_30810 3185428 3185976 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902616.1 protein_id gnl|my_center|LOCUS_30810 3186048 3186341 gene locus_tag LOCUS_30820 3186048 3186341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3186511 3186690 gene locus_tag LOCUS_30830 3186511 3186690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 3187813 3186776 gene locus_tag LOCUS_30840 3187813 3186776 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929295.1 protein_id gnl|my_center|LOCUS_30840 3188957 3187875 gene locus_tag LOCUS_30850 gene purM 3188957 3187875 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902615.1 protein_id gnl|my_center|LOCUS_30850 3189082 3192198 gene locus_tag LOCUS_30860 3189082 3192198 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902766.1 protein_id gnl|my_center|LOCUS_30860 3192200 3193168 gene locus_tag LOCUS_30870 3192200 3193168 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902767.1 protein_id gnl|my_center|LOCUS_30870 3193169 3194488 gene locus_tag LOCUS_30880 3193169 3194488 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939181.1 protein_id gnl|my_center|LOCUS_30880 3194591 3195958 gene locus_tag LOCUS_30890 gene nreA 3194591 3195958 CDS product DNA repair protein NreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289141.1 protein_id gnl|my_center|LOCUS_30890 3196023 3196313 gene locus_tag LOCUS_30900 3196023 3196313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 3196869 3196417 gene locus_tag LOCUS_30910 3196869 3196417 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902059.1 protein_id gnl|my_center|LOCUS_30910 3197406 3197113 gene locus_tag LOCUS_30920 3197406 3197113 CDS product DUF5789 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289142.1 protein_id gnl|my_center|LOCUS_30920 3197607 3199394 gene locus_tag LOCUS_30930 3197607 3199394 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892506.1 protein_id gnl|my_center|LOCUS_30930 3199490 3200959 gene locus_tag LOCUS_30940 3199490 3200959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 3202144 3200975 gene locus_tag LOCUS_30950 3202144 3200975 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903025.1 protein_id gnl|my_center|LOCUS_30950 3202240 3203193 gene locus_tag LOCUS_30960 3202240 3203193 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892525.1 protein_id gnl|my_center|LOCUS_30960 3203190 3204194 gene locus_tag LOCUS_30970 3203190 3204194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 3206107 3204293 gene locus_tag LOCUS_30980 3206107 3204293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 3206542 3206458 gene locus_tag LOCUS_t00370 3206542 3206458 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3206657 3207121 gene locus_tag LOCUS_30990 3206657 3207121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 3207345 3207151 gene locus_tag LOCUS_31000 3207345 3207151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 3207455 3207940 gene locus_tag LOCUS_31010 3207455 3207940 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903017.1 protein_id gnl|my_center|LOCUS_31010 3209425 3208055 gene locus_tag LOCUS_31020 3209425 3208055 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902279.1 protein_id gnl|my_center|LOCUS_31020 3210468 3209491 gene locus_tag LOCUS_31030 3210468 3209491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 3210642 3211883 gene locus_tag LOCUS_31040 gene prf1 3210642 3211883 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289438.1 protein_id gnl|my_center|LOCUS_31040 3211986 3212828 gene locus_tag LOCUS_31050 3211986 3212828 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289160.1 protein_id gnl|my_center|LOCUS_31050 3212878 3213693 gene locus_tag LOCUS_31060 3212878 3213693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 3213761 3213967 gene locus_tag LOCUS_31070 3213761 3213967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3215289 3214321 gene locus_tag LOCUS_31080 3215289 3214321 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902295.1 protein_id gnl|my_center|LOCUS_31080 3216590 3215418 gene locus_tag LOCUS_31090 3216590 3215418 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006824761.1 protein_id gnl|my_center|LOCUS_31090 3217395 3216760 gene locus_tag LOCUS_31100 3217395 3216760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 3217872 3217531 gene locus_tag LOCUS_31110 3217872 3217531 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289157.1 protein_id gnl|my_center|LOCUS_31110 3218041 3219111 gene locus_tag LOCUS_31120 3218041 3219111 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174092.1 protein_id gnl|my_center|LOCUS_31120 3220885 3219224 gene locus_tag LOCUS_31130 3220885 3219224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 3222289 3221090 gene locus_tag LOCUS_31140 3222289 3221090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 3222476 3223390 gene locus_tag LOCUS_31150 gene rnz 3222476 3223390 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903662.1 protein_id gnl|my_center|LOCUS_31150 3223451 3223870 gene locus_tag LOCUS_31160 3223451 3223870 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226161.1 protein_id gnl|my_center|LOCUS_31160 3224078 3223872 gene locus_tag LOCUS_31170 3224078 3223872 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902305.1 protein_id gnl|my_center|LOCUS_31170 3224482 3224078 gene locus_tag LOCUS_31180 3224482 3224078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 3224605 3226590 gene locus_tag LOCUS_31190 3224605 3226590 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903661.1 protein_id gnl|my_center|LOCUS_31190 3227360 3226602 gene locus_tag LOCUS_31200 3227360 3226602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 3227595 3228530 gene locus_tag LOCUS_31210 3227595 3228530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 3228475 3228750 gene locus_tag LOCUS_31220 3228475 3228750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 3228955 3228752 gene locus_tag LOCUS_31230 3228955 3228752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 3229015 3230043 gene locus_tag LOCUS_31240 3229015 3230043 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124123.1 protein_id gnl|my_center|LOCUS_31240 3230114 3230638 gene locus_tag LOCUS_31250 3230114 3230638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 3231190 3230663 gene locus_tag LOCUS_31260 3231190 3230663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 3232134 3231187 gene locus_tag LOCUS_31270 gene rio1 3232134 3231187 CDS product serine/threonine-protein kinase Rio1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289466.1 protein_id gnl|my_center|LOCUS_31270 3232622 3232134 gene locus_tag LOCUS_31280 3232622 3232134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 3232658 3233689 gene locus_tag LOCUS_31290 3232658 3233689 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403481.1 protein_id gnl|my_center|LOCUS_31290 3235975 3233927 gene locus_tag LOCUS_31300 3235975 3233927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 3236990 3236214 gene locus_tag LOCUS_31310 3236990 3236214 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902800.1 protein_id gnl|my_center|LOCUS_31310 3237440 3237189 gene locus_tag LOCUS_31320 3237440 3237189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 3238047 3237463 gene locus_tag LOCUS_31330 3238047 3237463 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289178.1 protein_id gnl|my_center|LOCUS_31330 3238272 3241589 gene locus_tag LOCUS_31340 3238272 3241589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 3242386 3241628 gene locus_tag LOCUS_31350 3242386 3241628 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902364.1 protein_id gnl|my_center|LOCUS_31350 3242476 3242691 gene locus_tag LOCUS_31360 3242476 3242691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 3243096 3243368 gene locus_tag LOCUS_31370 3243096 3243368 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_31370 3244112 3243387 gene locus_tag LOCUS_31380 3244112 3243387 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902448.1 protein_id gnl|my_center|LOCUS_31380 3244449 3245144 gene locus_tag LOCUS_31390 3244449 3245144 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289173.1 protein_id gnl|my_center|LOCUS_31390 3245864 3245187 gene locus_tag LOCUS_31400 3245864 3245187 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978110.1 protein_id gnl|my_center|LOCUS_31400 3246802 3246005 gene locus_tag LOCUS_31410 3246802 3246005 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902170.1 protein_id gnl|my_center|LOCUS_31410 3247125 3246853 gene locus_tag LOCUS_31420 3247125 3246853 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902171.1 protein_id gnl|my_center|LOCUS_31420 3247506 3248297 gene locus_tag LOCUS_31430 3247506 3248297 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902174.1 protein_id gnl|my_center|LOCUS_31430 3249357 3248314 gene locus_tag LOCUS_31440 3249357 3248314 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902173.1 protein_id gnl|my_center|LOCUS_31440 3249869 3249507 gene locus_tag LOCUS_31450 3249869 3249507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 3250438 3249872 gene locus_tag LOCUS_31460 3250438 3249872 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227738.1 protein_id gnl|my_center|LOCUS_31460 3250530 3251444 gene locus_tag LOCUS_31470 3250530 3251444 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902239.1 protein_id gnl|my_center|LOCUS_31470 3251545 3252033 gene locus_tag LOCUS_31480 3251545 3252033 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902240.1 protein_id gnl|my_center|LOCUS_31480 3252082 3252864 gene locus_tag LOCUS_31490 3252082 3252864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 3253154 3252861 gene locus_tag LOCUS_31500 3253154 3252861 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902241.1 protein_id gnl|my_center|LOCUS_31500 3253324 3254220 gene locus_tag LOCUS_31510 3253324 3254220 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289150.1 protein_id gnl|my_center|LOCUS_31510 3254993 3254247 gene locus_tag LOCUS_31520 3254993 3254247 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902243.1 protein_id gnl|my_center|LOCUS_31520 3256183 3255056 gene locus_tag LOCUS_31530 3256183 3255056 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902244.1 protein_id gnl|my_center|LOCUS_31530 3257246 3256242 gene locus_tag LOCUS_31540 3257246 3256242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 3257857 3257579 gene locus_tag LOCUS_31550 3257857 3257579 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902779.1 protein_id gnl|my_center|LOCUS_31550 3258174 3257962 gene locus_tag LOCUS_31560 3258174 3257962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902778.1 protein_id gnl|my_center|LOCUS_31560 3258395 3258988 gene locus_tag LOCUS_31570 3258395 3258988 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902777.1 protein_id gnl|my_center|LOCUS_31570 3259071 3259451 gene locus_tag LOCUS_31580 3259071 3259451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 3260047 3259484 gene locus_tag LOCUS_31590 3260047 3259484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 3260140 3260811 gene locus_tag LOCUS_31600 3260140 3260811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289480.1 protein_id gnl|my_center|LOCUS_31600 3261441 3260839 gene locus_tag LOCUS_31610 3261441 3260839 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903724.1 protein_id gnl|my_center|LOCUS_31610 3261966 3261448 gene locus_tag LOCUS_31620 3261966 3261448 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903723.1 protein_id gnl|my_center|LOCUS_31620 3262328 3261966 gene locus_tag LOCUS_31630 3262328 3261966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 3262474 3263880 gene locus_tag LOCUS_31640 3262474 3263880 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903721.1 protein_id gnl|my_center|LOCUS_31640 3265039 3263987 gene locus_tag LOCUS_31650 3265039 3263987 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903720.1 protein_id gnl|my_center|LOCUS_31650 3265023 3265208 gene locus_tag LOCUS_31660 3265023 3265208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 3265352 3265813 gene locus_tag LOCUS_31670 gene ribH 3265352 3265813 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902429.1 protein_id gnl|my_center|LOCUS_31670 3265810 3266958 gene locus_tag LOCUS_31680 3265810 3266958 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902428.1 protein_id gnl|my_center|LOCUS_31680 3267023 3268576 gene locus_tag LOCUS_31690 3267023 3268576 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230760.1 protein_id gnl|my_center|LOCUS_31690 3270398 3268704 gene locus_tag LOCUS_31700 3270398 3268704 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902970.1 protein_id gnl|my_center|LOCUS_31700 3272629 3270518 gene locus_tag LOCUS_31710 3272629 3270518 CDS product bacterio-opsin activator domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902709.1 protein_id gnl|my_center|LOCUS_31710 3274646 3272721 gene locus_tag LOCUS_31720 3274646 3272721 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064996.1 protein_id gnl|my_center|LOCUS_31720 3274819 3275346 gene locus_tag LOCUS_31730 3274819 3275346 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902543.1 protein_id gnl|my_center|LOCUS_31730 3275343 3275810 gene locus_tag LOCUS_31740 3275343 3275810 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902542.1 protein_id gnl|my_center|LOCUS_31740 3277071 3276310 gene locus_tag LOCUS_31750 gene psmA 3277071 3276310 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902078.1 protein_id gnl|my_center|LOCUS_31750 3277682 3277140 gene locus_tag LOCUS_31760 3277682 3277140 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902926.1 protein_id gnl|my_center|LOCUS_31760 3278388 3277690 gene locus_tag LOCUS_31770 3278388 3277690 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902927.1 protein_id gnl|my_center|LOCUS_31770 3279193 3278372 gene locus_tag LOCUS_31780 3279193 3278372 CDS product RNase P subunit p30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289302.1 protein_id gnl|my_center|LOCUS_31780 3279303 3279683 gene locus_tag LOCUS_31790 3279303 3279683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 3280915 3279725 gene locus_tag LOCUS_31800 3280915 3279725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 3281867 3281085 gene locus_tag LOCUS_31810 3281867 3281085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 3282085 3282001 gene locus_tag LOCUS_t00380 3282085 3282001 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3282671 3282132 gene locus_tag LOCUS_31820 3282671 3282132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 3283102 3282755 gene locus_tag LOCUS_31830 3283102 3282755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 3283222 3283530 gene locus_tag LOCUS_31840 3283222 3283530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 3284059 3283532 gene locus_tag LOCUS_31850 3284059 3283532 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903012.1 protein_id gnl|my_center|LOCUS_31850 3284638 3284117 gene locus_tag LOCUS_31860 3284638 3284117 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903013.1 protein_id gnl|my_center|LOCUS_31860 3285990 3284806 gene locus_tag LOCUS_31870 3285990 3284806 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903015.1 protein_id gnl|my_center|LOCUS_31870 3287035 3286397 gene locus_tag LOCUS_31880 3287035 3286397 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902848.1 protein_id gnl|my_center|LOCUS_31880 3287913 3287032 gene locus_tag LOCUS_31890 3287913 3287032 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902847.1 protein_id gnl|my_center|LOCUS_31890 3287930 3288451 gene locus_tag LOCUS_31900 3287930 3288451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 3288638 3288438 gene locus_tag LOCUS_31910 3288638 3288438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 3288671 3288844 gene locus_tag LOCUS_31920 3288671 3288844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 3288937 3289116 gene locus_tag LOCUS_31930 3288937 3289116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 3289493 3289113 gene locus_tag LOCUS_31940 3289493 3289113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 3289720 3290148 gene locus_tag LOCUS_31950 3289720 3290148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 3290173 3291177 gene locus_tag LOCUS_31960 3290173 3291177 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289495.1 protein_id gnl|my_center|LOCUS_31960 3291352 3292419 gene locus_tag LOCUS_31970 3291352 3292419 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294576.1 protein_id gnl|my_center|LOCUS_31970 3292412 3293044 gene locus_tag LOCUS_31980 3292412 3293044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 3293528 3294889 gene locus_tag LOCUS_31990 3293528 3294889 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666062.1 protein_id gnl|my_center|LOCUS_31990 3295124 3295489 gene locus_tag LOCUS_32000 3295124 3295489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 3295676 3297835 gene locus_tag LOCUS_32010 3295676 3297835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 3298147 3299031 gene locus_tag LOCUS_32020 3298147 3299031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 3299156 3300565 gene locus_tag LOCUS_32030 3299156 3300565 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228947.1 protein_id gnl|my_center|LOCUS_32030 3300773 3302284 gene locus_tag LOCUS_32040 3300773 3302284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 3302621 3302340 gene locus_tag LOCUS_32050 3302621 3302340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 3303310 3302669 gene locus_tag LOCUS_32060 3303310 3302669 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_32060 3305179 3303410 gene locus_tag LOCUS_32070 3305179 3303410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 3305606 3307168 gene locus_tag LOCUS_32080 3305606 3307168 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_32080 3307710 3307240 gene locus_tag LOCUS_32090 3307710 3307240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 3308345 3307779 gene locus_tag LOCUS_32100 3308345 3307779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 3308689 3308525 gene locus_tag LOCUS_32110 3308689 3308525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 3309144 3308686 gene locus_tag LOCUS_32120 3309144 3308686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 3310070 3309141 gene locus_tag LOCUS_32130 3310070 3309141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 3310420 3310070 gene locus_tag LOCUS_32140 3310420 3310070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 3311361 3310423 gene locus_tag LOCUS_32150 gene paaG 3311361 3310423 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889012.1 protein_id gnl|my_center|LOCUS_32150 3311446 3312084 gene locus_tag LOCUS_32160 3311446 3312084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 3312560 3312099 gene locus_tag LOCUS_32170 3312560 3312099 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318983.1 protein_id gnl|my_center|LOCUS_32170 3312691 3314337 gene locus_tag LOCUS_32180 3312691 3314337 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089670226.1 protein_id gnl|my_center|LOCUS_32180 3314398 3315075 gene locus_tag LOCUS_32190 3314398 3315075 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289554.1 protein_id gnl|my_center|LOCUS_32190 3316957 3315227 gene locus_tag LOCUS_32200 3316957 3315227 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402899.1 protein_id gnl|my_center|LOCUS_32200 3318989 3316950 gene locus_tag LOCUS_32210 3318989 3316950 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421608.1 protein_id gnl|my_center|LOCUS_32210 3319133 3320329 gene locus_tag LOCUS_32220 3319133 3320329 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_32220 3320326 3321759 gene locus_tag LOCUS_32230 3320326 3321759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 3321817 3322665 gene locus_tag LOCUS_32240 3321817 3322665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 3323731 3322814 gene locus_tag LOCUS_32250 3323731 3322814 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902918.1 protein_id gnl|my_center|LOCUS_32250 3323838 3324320 gene locus_tag LOCUS_32260 3323838 3324320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 3324657 3324421 gene locus_tag LOCUS_32270 3324657 3324421 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902916.1 protein_id gnl|my_center|LOCUS_32270 3324903 3325307 gene locus_tag LOCUS_32280 3324903 3325307 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902915.1 protein_id gnl|my_center|LOCUS_32280 3325593 3325417 gene locus_tag LOCUS_32290 3325593 3325417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902914.1 protein_id gnl|my_center|LOCUS_32290 3326695 3325727 gene locus_tag LOCUS_32300 3326695 3325727 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_32300 3329729 3326946 gene locus_tag LOCUS_32310 3329729 3326946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 3330174 3329890 gene locus_tag LOCUS_32320 3330174 3329890 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902913.1 protein_id gnl|my_center|LOCUS_32320 3330595 3331947 gene locus_tag LOCUS_32330 3330595 3331947 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902826.1 protein_id gnl|my_center|LOCUS_32330 3333132 3331960 gene locus_tag LOCUS_32340 3333132 3331960 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902167.1 protein_id gnl|my_center|LOCUS_32340 3333524 3333135 gene locus_tag LOCUS_32350 gene tnpA 3333524 3333135 CDS product IS200/IS605-like element ISH22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902166.1 protein_id gnl|my_center|LOCUS_32350 3333810 3334046 gene locus_tag LOCUS_32360 3333810 3334046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 3334178 3335230 gene locus_tag LOCUS_32370 3334178 3335230 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902827.1 protein_id gnl|my_center|LOCUS_32370 3337679 3335244 gene locus_tag LOCUS_32380 3337679 3335244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 3337942 3338517 gene locus_tag LOCUS_32390 3337942 3338517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 3338563 3338826 gene locus_tag LOCUS_32400 3338563 3338826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 3340005 3338761 gene locus_tag LOCUS_32410 gene aroC 3340005 3338761 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902889.1 protein_id gnl|my_center|LOCUS_32410 3341650 3340508 gene locus_tag LOCUS_32420 3341650 3340508 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903598.1 protein_id gnl|my_center|LOCUS_32420 3341773 3342591 gene locus_tag LOCUS_32430 3341773 3342591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 3343023 3342592 gene locus_tag LOCUS_32440 3343023 3342592 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157849921.1 protein_id gnl|my_center|LOCUS_32440 3344091 3343081 gene locus_tag LOCUS_32450 3344091 3343081 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902019.1 protein_id gnl|my_center|LOCUS_32450 3346587 3344140 gene locus_tag LOCUS_32460 gene ppk1 3346587 3344140 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921077.1 protein_id gnl|my_center|LOCUS_32460 3347410 3346673 gene locus_tag LOCUS_32470 3347410 3346673 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_32470 3347692 3348582 gene locus_tag LOCUS_32480 gene map 3347692 3348582 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903366.1 protein_id gnl|my_center|LOCUS_32480 3348921 3348724 gene locus_tag LOCUS_32490 3348921 3348724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903365.1 protein_id gnl|my_center|LOCUS_32490 3349297 3349848 gene locus_tag LOCUS_32500 3349297 3349848 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903364.1 protein_id gnl|my_center|LOCUS_32500 3349920 3351035 gene locus_tag LOCUS_32510 3349920 3351035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 3351110 3351637 gene locus_tag LOCUS_32520 3351110 3351637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 3351814 3353625 gene locus_tag LOCUS_32530 3351814 3353625 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903485.1 protein_id gnl|my_center|LOCUS_32530 3354640 3353645 gene locus_tag LOCUS_32540 3354640 3353645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 3356062 3354764 gene locus_tag LOCUS_32550 3356062 3354764 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903362.1 protein_id gnl|my_center|LOCUS_32550 3357364 3356561 gene locus_tag LOCUS_32560 3357364 3356561 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903597.1 protein_id gnl|my_center|LOCUS_32560 3358699 3357410 gene locus_tag LOCUS_32570 3358699 3357410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 3359898 3358696 gene locus_tag LOCUS_32580 3359898 3358696 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337819.1 protein_id gnl|my_center|LOCUS_32580 3360479 3359982 gene locus_tag LOCUS_32590 3360479 3359982 CDS product Tfx family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496415.1 protein_id gnl|my_center|LOCUS_32590 3360963 3360451 gene locus_tag LOCUS_32600 3360963 3360451 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289446.1 protein_id gnl|my_center|LOCUS_32600 3361681 3361064 gene locus_tag LOCUS_32610 3361681 3361064 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902238.1 protein_id gnl|my_center|LOCUS_32610 3363252 3361678 gene locus_tag LOCUS_32620 gene pabB 3363252 3361678 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902237.1 protein_id gnl|my_center|LOCUS_32620 3363379 3363816 gene locus_tag LOCUS_32630 3363379 3363816 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968595.1 protein_id gnl|my_center|LOCUS_32630 3364610 3363846 gene locus_tag LOCUS_32640 3364610 3363846 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328055.1 protein_id gnl|my_center|LOCUS_32640 3364722 3366581 gene locus_tag LOCUS_32650 3364722 3366581 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903390.1 protein_id gnl|my_center|LOCUS_32650 3366702 3367496 gene locus_tag LOCUS_32660 3366702 3367496 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228886.1 protein_id gnl|my_center|LOCUS_32660 3367620 3368993 gene locus_tag LOCUS_32670 3367620 3368993 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089186.1 protein_id gnl|my_center|LOCUS_32670 3369027 3369893 gene locus_tag LOCUS_32680 3369027 3369893 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877735.1 protein_id gnl|my_center|LOCUS_32680 3369895 3371142 gene locus_tag LOCUS_32690 3369895 3371142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 3371139 3371969 gene locus_tag LOCUS_32700 3371139 3371969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 3373278 3372154 gene locus_tag LOCUS_32710 3373278 3372154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 3374512 3373385 gene locus_tag LOCUS_32720 3374512 3373385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 3375759 3374620 gene locus_tag LOCUS_32730 3375759 3374620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 3376638 3375949 gene locus_tag LOCUS_32740 3376638 3375949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 3377028 3378311 gene locus_tag LOCUS_32750 3377028 3378311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082818.1 protein_id gnl|my_center|LOCUS_32750 3378308 3379663 gene locus_tag LOCUS_32760 3378308 3379663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 3379726 3380520 gene locus_tag LOCUS_32770 3379726 3380520 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_32770 3380635 3381783 gene locus_tag LOCUS_32780 3380635 3381783 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902861.1 protein_id gnl|my_center|LOCUS_32780 3382031 3381786 gene locus_tag LOCUS_32790 3382031 3381786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 3382360 3382028 gene locus_tag LOCUS_32800 3382360 3382028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 3382459 3383643 gene locus_tag LOCUS_32810 gene hisC 3382459 3383643 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289267.1 protein_id gnl|my_center|LOCUS_32810 3383643 3384233 gene locus_tag LOCUS_32820 3383643 3384233 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902737.1 protein_id gnl|my_center|LOCUS_32820 3384230 3384853 gene locus_tag LOCUS_32830 3384230 3384853 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902736.1 protein_id gnl|my_center|LOCUS_32830 3386102 3384939 gene locus_tag LOCUS_32840 3386102 3384939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 3386241 3387563 gene locus_tag LOCUS_32850 3386241 3387563 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903112.1 protein_id gnl|my_center|LOCUS_32850 3387822 3389381 gene locus_tag LOCUS_32860 3387822 3389381 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_32860 3389600 3391453 gene locus_tag LOCUS_32870 3389600 3391453 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903116.1 protein_id gnl|my_center|LOCUS_32870 3391756 3391586 gene locus_tag LOCUS_32880 3391756 3391586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 3392035 3391856 gene locus_tag LOCUS_32890 3392035 3391856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 3394031 3392376 gene locus_tag LOCUS_32900 3394031 3392376 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902740.1 protein_id gnl|my_center|LOCUS_32900 3394774 3394100 gene locus_tag LOCUS_32910 3394774 3394100 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065619.1 protein_id gnl|my_center|LOCUS_32910 3395604 3394834 gene locus_tag LOCUS_32920 3395604 3394834 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289269.1 protein_id gnl|my_center|LOCUS_32920 3397660 3395693 gene locus_tag LOCUS_32930 3397660 3395693 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903521.1 protein_id gnl|my_center|LOCUS_32930 3397816 3398814 gene locus_tag LOCUS_32940 3397816 3398814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 3398879 3399406 gene locus_tag LOCUS_32950 3398879 3399406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902976.1 protein_id gnl|my_center|LOCUS_32950 3399467 3399943 gene locus_tag LOCUS_32960 3399467 3399943 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_32960 3401317 3400094 gene locus_tag LOCUS_32970 3401317 3400094 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089117.1 protein_id gnl|my_center|LOCUS_32970 3401834 3401418 gene locus_tag LOCUS_32980 3401834 3401418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 3403591 3401954 gene locus_tag LOCUS_32990 3403591 3401954 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480118.1 protein_id gnl|my_center|LOCUS_32990 3403872 3404558 gene locus_tag LOCUS_33000 3403872 3404558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 3405448 3406611 gene locus_tag LOCUS_33010 3405448 3406611 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_33010 3406611 3407609 gene locus_tag LOCUS_33020 3406611 3407609 CDS product TIGR04024 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_33020 3408508 3407627 gene locus_tag LOCUS_33030 3408508 3407627 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289364.1 protein_id gnl|my_center|LOCUS_33030 3409695 3408655 gene locus_tag LOCUS_33040 3409695 3408655 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902422.1 protein_id gnl|my_center|LOCUS_33040 3409881 3411044 gene locus_tag LOCUS_33050 gene dnaJ 3409881 3411044 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902321.1 protein_id gnl|my_center|LOCUS_33050 3411133 3411618 gene locus_tag LOCUS_33060 3411133 3411618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 3411704 3414073 gene locus_tag LOCUS_33070 3411704 3414073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 3414593 3414192 gene locus_tag LOCUS_33080 3414593 3414192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 3414756 3415031 gene locus_tag LOCUS_33090 3414756 3415031 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_33090 3415138 3415452 gene locus_tag LOCUS_33100 3415138 3415452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 3415540 3416820 gene locus_tag LOCUS_33110 3415540 3416820 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 protein_id gnl|my_center|LOCUS_33110 3417068 3417541 gene locus_tag LOCUS_33120 3417068 3417541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 3417931 3417653 gene locus_tag LOCUS_33130 3417931 3417653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 3418370 3417975 gene locus_tag LOCUS_33140 3418370 3417975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 3418551 3419183 gene locus_tag LOCUS_33150 3418551 3419183 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902599.1 protein_id gnl|my_center|LOCUS_33150 3420865 3419210 gene locus_tag LOCUS_33160 3420865 3419210 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902600.1 protein_id gnl|my_center|LOCUS_33160 3421959 3420958 gene locus_tag LOCUS_33170 3421959 3420958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 3422125 3422910 gene locus_tag LOCUS_33180 3422125 3422910 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902972.1 protein_id gnl|my_center|LOCUS_33180 3423464 3424468 gene locus_tag LOCUS_33190 3423464 3424468 CDS product TIGR04024 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_33190 3424596 3425303 gene locus_tag LOCUS_33200 3424596 3425303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 3425342 3425764 gene locus_tag LOCUS_33210 3425342 3425764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 3425994 3427322 gene locus_tag LOCUS_33220 3425994 3427322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 3427415 3429115 gene locus_tag LOCUS_33230 3427415 3429115 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_33230 3429204 3430205 gene locus_tag LOCUS_33240 3429204 3430205 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_33240 3430266 3430397 gene locus_tag LOCUS_33250 3430266 3430397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 3430692 3430402 gene locus_tag LOCUS_33260 3430692 3430402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 3431557 3430667 gene locus_tag LOCUS_33270 3431557 3430667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 3432137 3432424 gene locus_tag LOCUS_33280 3432137 3432424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 3432417 3432590 gene locus_tag LOCUS_33290 3432417 3432590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 3432591 3435134 gene locus_tag LOCUS_33300 3432591 3435134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 3435147 3435506 gene locus_tag LOCUS_33310 3435147 3435506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 3435570 3436088 gene locus_tag LOCUS_33320 3435570 3436088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 3436085 3436279 gene locus_tag LOCUS_33330 3436085 3436279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 3436513 3436782 gene locus_tag LOCUS_33340 3436513 3436782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 3436772 3436948 gene locus_tag LOCUS_33350 3436772 3436948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 3436945 3437160 gene locus_tag LOCUS_33360 3436945 3437160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 3437472 3437909 gene locus_tag LOCUS_33370 3437472 3437909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066411693.1 protein_id gnl|my_center|LOCUS_33370 3437906 3438400 gene locus_tag LOCUS_33380 3437906 3438400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902111.1 protein_id gnl|my_center|LOCUS_33380 3438393 3439505 gene locus_tag LOCUS_33390 3438393 3439505 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902112.1 protein_id gnl|my_center|LOCUS_33390 3441156 3439603 gene locus_tag LOCUS_33400 3441156 3439603 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361675.1 protein_id gnl|my_center|LOCUS_33400 3442726 3441281 gene locus_tag LOCUS_33410 3442726 3441281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 3443536 3442766 gene locus_tag LOCUS_33420 3443536 3442766 CDS product protein sorting system archaetidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902547.1 protein_id gnl|my_center|LOCUS_33420 3443619 3445241 gene locus_tag LOCUS_33430 3443619 3445241 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902444.1 protein_id gnl|my_center|LOCUS_33430 3445296 3446126 gene locus_tag LOCUS_33440 3445296 3446126 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902445.1 protein_id gnl|my_center|LOCUS_33440 3446141 3447217 gene locus_tag LOCUS_33450 3446141 3447217 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_33450 3447214 3448074 gene locus_tag LOCUS_33460 3447214 3448074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 3448530 3448108 gene locus_tag LOCUS_33470 3448530 3448108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 3448634 3450334 gene locus_tag LOCUS_33480 3448634 3450334 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289204.1 protein_id gnl|my_center|LOCUS_33480 3450385 3450786 gene locus_tag LOCUS_33490 3450385 3450786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 3451719 3450838 gene locus_tag LOCUS_33500 3451719 3450838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 3452669 3451716 gene locus_tag LOCUS_33510 3452669 3451716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_33510 3452846 3454801 gene locus_tag LOCUS_33520 gene acs 3452846 3454801 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902710.1 protein_id gnl|my_center|LOCUS_33520 3455021 3457165 gene locus_tag LOCUS_33530 3455021 3457165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 3457207 3459204 gene locus_tag LOCUS_33540 gene acs 3457207 3459204 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404429.1 protein_id gnl|my_center|LOCUS_33540 3459395 3460759 gene locus_tag LOCUS_33550 3459395 3460759 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088976.1 protein_id gnl|my_center|LOCUS_33550 3460820 3461770 gene locus_tag LOCUS_33560 3460820 3461770 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966751.1 protein_id gnl|my_center|LOCUS_33560 3461767 3462981 gene locus_tag LOCUS_33570 3461767 3462981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 3462978 3463736 gene locus_tag LOCUS_33580 3462978 3463736 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_33580 3463733 3464476 gene locus_tag LOCUS_33590 3463733 3464476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_33590 3464479 3465213 gene locus_tag LOCUS_33600 3464479 3465213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 3466043 3465207 gene locus_tag LOCUS_33610 3466043 3465207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135825349.1 protein_id gnl|my_center|LOCUS_33610 3466142 3467758 gene locus_tag LOCUS_33620 3466142 3467758 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289110.1 protein_id gnl|my_center|LOCUS_33620 3468174 3467764 gene locus_tag LOCUS_33630 3468174 3467764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 3468613 3468266 gene locus_tag LOCUS_33640 3468613 3468266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 3469625 3468852 gene locus_tag LOCUS_33650 3469625 3468852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 3471558 3469750 gene locus_tag LOCUS_33660 gene ctaD 3471558 3469750 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902450.1 protein_id gnl|my_center|LOCUS_33660 3472044 3471706 gene locus_tag LOCUS_33670 3472044 3471706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 3472632 3472120 gene locus_tag LOCUS_33680 3472632 3472120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 3473614 3472745 gene locus_tag LOCUS_33690 3473614 3472745 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902453.1 protein_id gnl|my_center|LOCUS_33690 3473737 3475131 gene locus_tag LOCUS_33700 3473737 3475131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902642.1 protein_id gnl|my_center|LOCUS_33700 3475135 3475401 gene locus_tag LOCUS_33710 3475135 3475401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902641.1 protein_id gnl|my_center|LOCUS_33710 3476487 3475606 gene locus_tag LOCUS_33720 gene coxB 3476487 3475606 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902455.1 protein_id gnl|my_center|LOCUS_33720 3476592 3478031 gene locus_tag LOCUS_33730 gene cyoE 3476592 3478031 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902456.1 protein_id gnl|my_center|LOCUS_33730 3478114 3478806 gene locus_tag LOCUS_33740 3478114 3478806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902457.1 protein_id gnl|my_center|LOCUS_33740 3479140 3478904 gene locus_tag LOCUS_33750 3479140 3478904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 3479317 3479550 gene locus_tag LOCUS_33760 3479317 3479550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 3480455 3479574 gene locus_tag LOCUS_33770 3480455 3479574 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902470.1 protein_id gnl|my_center|LOCUS_33770 3481730 3480540 gene locus_tag LOCUS_33780 3481730 3480540 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195809.1 protein_id gnl|my_center|LOCUS_33780 3482994 3481933 gene locus_tag LOCUS_33790 3482994 3481933 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170747.1 protein_id gnl|my_center|LOCUS_33790 3483689 3482991 gene locus_tag LOCUS_33800 3483689 3482991 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259472.1 protein_id gnl|my_center|LOCUS_33800 3484540 3483686 gene locus_tag LOCUS_33810 3484540 3483686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259471.1 protein_id gnl|my_center|LOCUS_33810 3485912 3484542 gene locus_tag LOCUS_33820 3485912 3484542 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061992.1 protein_id gnl|my_center|LOCUS_33820 3486043 3486990 gene locus_tag LOCUS_33830 3486043 3486990 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974938.1 protein_id gnl|my_center|LOCUS_33830 3487709 3487002 gene locus_tag LOCUS_33840 3487709 3487002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 3487962 3488936 gene locus_tag LOCUS_33850 3487962 3488936 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902458.1 protein_id gnl|my_center|LOCUS_33850 3488936 3489736 gene locus_tag LOCUS_33860 3488936 3489736 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902459.1 protein_id gnl|my_center|LOCUS_33860 3489870 3490238 gene locus_tag LOCUS_33870 3489870 3490238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 3490384 3490986 gene locus_tag LOCUS_33880 3490384 3490986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 3491584 3490964 gene locus_tag LOCUS_33890 3491584 3490964 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902461.1 protein_id gnl|my_center|LOCUS_33890 3491686 3493101 gene locus_tag LOCUS_33900 3491686 3493101 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_33900 3493162 3494304 gene locus_tag LOCUS_33910 3493162 3494304 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289209.1 protein_id gnl|my_center|LOCUS_33910 3494419 3494649 gene locus_tag LOCUS_33920 3494419 3494649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 3494758 3495030 gene locus_tag LOCUS_33930 3494758 3495030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902467.1 protein_id gnl|my_center|LOCUS_33930 3496312 3495056 gene locus_tag LOCUS_33940 3496312 3495056 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089864262.1 protein_id gnl|my_center|LOCUS_33940 3496451 3496618 gene locus_tag LOCUS_33950 3496451 3496618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 3497002 3496619 gene locus_tag LOCUS_33960 3497002 3496619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 3497114 3498568 gene locus_tag LOCUS_33970 3497114 3498568 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902627.1 protein_id gnl|my_center|LOCUS_33970 3498943 3498578 gene locus_tag LOCUS_33980 3498943 3498578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 3499821 3499021 gene locus_tag LOCUS_33990 3499821 3499021 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903881.1 protein_id gnl|my_center|LOCUS_33990 3499979 3500788 gene locus_tag LOCUS_34000 3499979 3500788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 3500882 3501730 gene locus_tag LOCUS_34010 3500882 3501730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 3503511 3501751 gene locus_tag LOCUS_34020 3503511 3501751 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902419.1 protein_id gnl|my_center|LOCUS_34020 3503543 3504049 gene locus_tag LOCUS_34030 3503543 3504049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 3504520 3504224 gene locus_tag LOCUS_34040 3504520 3504224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 3505259 3504681 gene locus_tag LOCUS_34050 3505259 3504681 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894347.1 protein_id gnl|my_center|LOCUS_34050 3505787 3505335 gene locus_tag LOCUS_34060 3505787 3505335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 3507054 3505996 gene locus_tag LOCUS_34070 3507054 3505996 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878279.1 protein_id gnl|my_center|LOCUS_34070 3507188 3507652 gene locus_tag LOCUS_34080 3507188 3507652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 3507652 3507882 gene locus_tag LOCUS_34090 3507652 3507882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 3507969 3508958 gene locus_tag LOCUS_34100 3507969 3508958 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_34100 3509077 3510213 gene locus_tag LOCUS_34110 3509077 3510213 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902466.1 protein_id gnl|my_center|LOCUS_34110 3510210 3510611 gene locus_tag LOCUS_34120 3510210 3510611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 3511515 3510646 gene locus_tag LOCUS_34130 3511515 3510646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 3511591 3512004 gene locus_tag LOCUS_34140 3511591 3512004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 3512565 3512011 gene locus_tag LOCUS_34150 3512565 3512011 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227885.1 protein_id gnl|my_center|LOCUS_34150 3512935 3512672 gene locus_tag LOCUS_34160 3512935 3512672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 3513034 3515544 gene locus_tag LOCUS_34170 3513034 3515544 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877994.1 protein_id gnl|my_center|LOCUS_34170 3515541 3515906 gene locus_tag LOCUS_34180 3515541 3515906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 3516119 3516517 gene locus_tag LOCUS_34190 3516119 3516517 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008444919.1 protein_id gnl|my_center|LOCUS_34190 3516510 3517676 gene locus_tag LOCUS_34200 gene arsB 3516510 3517676 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876533.1 protein_id gnl|my_center|LOCUS_34200 3517786 3518565 gene locus_tag LOCUS_34210 3517786 3518565 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902496.1 protein_id gnl|my_center|LOCUS_34210 3518924 3519139 gene locus_tag LOCUS_34220 3518924 3519139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 3519509 3519147 gene locus_tag LOCUS_34230 3519509 3519147 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021357.1 protein_id gnl|my_center|LOCUS_34230 3519586 3520245 gene locus_tag LOCUS_34240 3519586 3520245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 3520303 3520947 gene locus_tag LOCUS_34250 gene hisH 3520303 3520947 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903536.1 protein_id gnl|my_center|LOCUS_34250 3521017 3521847 gene locus_tag LOCUS_34260 3521017 3521847 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618766.1 protein_id gnl|my_center|LOCUS_34260 3522981 3521872 gene locus_tag LOCUS_34270 3522981 3521872 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903039.1 protein_id gnl|my_center|LOCUS_34270 3523111 3523809 gene locus_tag LOCUS_34280 3523111 3523809 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892495.1 protein_id gnl|my_center|LOCUS_34280 3524317 3523910 gene locus_tag LOCUS_34290 3524317 3523910 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405486.1 protein_id gnl|my_center|LOCUS_34290 3524802 3524404 gene locus_tag LOCUS_34300 3524802 3524404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902725.1 protein_id gnl|my_center|LOCUS_34300 3525317 3527125 gene locus_tag LOCUS_34310 3525317 3527125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 3527455 3527132 gene locus_tag LOCUS_34320 3527455 3527132 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902900.1 protein_id gnl|my_center|LOCUS_34320 3528382 3527477 gene locus_tag LOCUS_34330 3528382 3527477 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902901.1 protein_id gnl|my_center|LOCUS_34330 3528627 3528860 gene locus_tag LOCUS_34340 3528627 3528860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 3528862 3529824 gene locus_tag LOCUS_34350 3528862 3529824 CDS product DUF5794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902715.1 protein_id gnl|my_center|LOCUS_34350 3530472 3529843 gene locus_tag LOCUS_34360 3530472 3529843 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289213.1 protein_id gnl|my_center|LOCUS_34360 3530577 3531407 gene locus_tag LOCUS_34370 3530577 3531407 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965766.1 protein_id gnl|my_center|LOCUS_34370 3532107 3531715 gene locus_tag LOCUS_34380 3532107 3531715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 3532101 3532295 gene locus_tag LOCUS_34390 3532101 3532295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 3532638 3532369 gene locus_tag LOCUS_34400 3532638 3532369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 3533917 3532712 gene locus_tag LOCUS_34410 3533917 3532712 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978098.1 protein_id gnl|my_center|LOCUS_34410 3534940 3533978 gene locus_tag LOCUS_34420 gene mvaD 3534940 3533978 CDS product phosphomevalonate decarboxylase MvaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289187.1 protein_id gnl|my_center|LOCUS_34420 3535817 3535137 gene locus_tag LOCUS_34430 3535817 3535137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 3537134 3535875 gene locus_tag LOCUS_34440 gene gdhA1 3537134 3535875 CDS product NADP-specific glutamate dehydrogenase GdhA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289198.1 protein_id gnl|my_center|LOCUS_34440 3538126 3537254 gene locus_tag LOCUS_34450 3538126 3537254 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289197.1 protein_id gnl|my_center|LOCUS_34450 3538251 3539375 gene locus_tag LOCUS_34460 3538251 3539375 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902533.1 protein_id gnl|my_center|LOCUS_34460 3539513 3540547 gene locus_tag LOCUS_34470 3539513 3540547 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902535.1 protein_id gnl|my_center|LOCUS_34470 3540687 3541277 gene locus_tag LOCUS_34480 3540687 3541277 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289287.1 protein_id gnl|my_center|LOCUS_34480 3541370 3542362 gene locus_tag LOCUS_34490 3541370 3542362 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904143.1 protein_id gnl|my_center|LOCUS_34490 3542543 3545458 gene locus_tag LOCUS_34500 3542543 3545458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 3545584 3546726 gene locus_tag LOCUS_34510 3545584 3546726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 3548610 3546991 gene locus_tag LOCUS_34520 3548610 3546991 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_34520 3549520 3548717 gene locus_tag LOCUS_34530 3549520 3548717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 3549632 3550255 gene locus_tag LOCUS_34540 gene purE 3549632 3550255 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902432.1 protein_id gnl|my_center|LOCUS_34540 3550386 3550793 gene locus_tag LOCUS_34550 3550386 3550793 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902433.1 protein_id gnl|my_center|LOCUS_34550 3550798 3551481 gene locus_tag LOCUS_34560 3550798 3551481 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902434.1 protein_id gnl|my_center|LOCUS_34560 3551486 3553174 gene locus_tag LOCUS_34570 3551486 3553174 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902435.1 protein_id gnl|my_center|LOCUS_34570 3553171 3554244 gene locus_tag LOCUS_34580 3553171 3554244 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289200.1 protein_id gnl|my_center|LOCUS_34580 3554249 3554710 gene locus_tag LOCUS_34590 3554249 3554710 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902437.1 protein_id gnl|my_center|LOCUS_34590 3555794 3555054 gene locus_tag LOCUS_34600 3555794 3555054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 3556665 3555994 gene locus_tag LOCUS_34610 3556665 3555994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 3556899 3557171 gene locus_tag LOCUS_34620 3556899 3557171 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902438.1 protein_id gnl|my_center|LOCUS_34620 3557168 3557563 gene locus_tag LOCUS_34630 3557168 3557563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 3557563 3557868 gene locus_tag LOCUS_34640 gene nuoK 3557563 3557868 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902440.1 protein_id gnl|my_center|LOCUS_34640 3557870 3559942 gene locus_tag LOCUS_34650 gene nuoL 3557870 3559942 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902441.1 protein_id gnl|my_center|LOCUS_34650 3559942 3561513 gene locus_tag LOCUS_34660 3559942 3561513 CDS product NuoM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902442.1 protein_id gnl|my_center|LOCUS_34660 3561510 3563042 gene locus_tag LOCUS_34670 3561510 3563042 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289203.1 protein_id gnl|my_center|LOCUS_34670 3563304 3563753 gene locus_tag LOCUS_34680 3563304 3563753 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902409.1 protein_id gnl|my_center|LOCUS_34680 3565433 3563796 gene locus_tag LOCUS_34690 3565433 3563796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 3566965 3565595 gene locus_tag LOCUS_34700 3566965 3565595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 3568457 3567258 gene locus_tag LOCUS_34710 3568457 3567258 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903276.1 protein_id gnl|my_center|LOCUS_34710 3568581 3569078 gene locus_tag LOCUS_34720 3568581 3569078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 3569817 3569125 gene locus_tag LOCUS_34730 3569817 3569125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 3571169 3570039 gene locus_tag LOCUS_34740 gene pdhA 3571169 3570039 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_34740 3571664 3571173 gene locus_tag LOCUS_34750 3571664 3571173 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157849921.1 protein_id gnl|my_center|LOCUS_34750 3571759 3572328 gene locus_tag LOCUS_34760 3571759 3572328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 3572591 3573379 gene locus_tag LOCUS_34770 gene queC 3572591 3573379 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904151.1 protein_id gnl|my_center|LOCUS_34770 3573493 3574014 gene locus_tag LOCUS_34780 3573493 3574014 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289478.1 protein_id gnl|my_center|LOCUS_34780 3574088 3575419 gene locus_tag LOCUS_34790 3574088 3575419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 3575526 3576173 gene locus_tag LOCUS_34800 3575526 3576173 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903713.1 protein_id gnl|my_center|LOCUS_34800 3576940 3576266 gene locus_tag LOCUS_34810 gene upp 3576940 3576266 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903718.1 protein_id gnl|my_center|LOCUS_34810 3577109 3577810 gene locus_tag LOCUS_34820 3577109 3577810 CDS product DUF5828 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903719.1 protein_id gnl|my_center|LOCUS_34820 3578317 3577910 gene locus_tag LOCUS_34830 3578317 3577910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 3578566 3578387 gene locus_tag LOCUS_34840 3578566 3578387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 3578823 3579695 gene locus_tag LOCUS_34850 3578823 3579695 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903357.1 protein_id gnl|my_center|LOCUS_34850 3579787 3580812 gene locus_tag LOCUS_34860 3579787 3580812 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_34860 3581278 3580823 gene locus_tag LOCUS_34870 3581278 3580823 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902479.1 protein_id gnl|my_center|LOCUS_34870 3581542 3583167 gene locus_tag LOCUS_34880 3581542 3583167 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_34880 3583164 3583538 gene locus_tag LOCUS_34890 3583164 3583538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 3583712 3584932 gene locus_tag LOCUS_34900 3583712 3584932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289248.1 protein_id gnl|my_center|LOCUS_34900 3584925 3586094 gene locus_tag LOCUS_34910 3584925 3586094 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902651.1 protein_id gnl|my_center|LOCUS_34910 3586094 3587707 gene locus_tag LOCUS_34920 3586094 3587707 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902650.1 protein_id gnl|my_center|LOCUS_34920 3587709 3588944 gene locus_tag LOCUS_34930 3587709 3588944 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902649.1 protein_id gnl|my_center|LOCUS_34930 3588952 3591186 gene locus_tag LOCUS_34940 3588952 3591186 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902648.1 protein_id gnl|my_center|LOCUS_34940 3591183 3591752 gene locus_tag LOCUS_34950 3591183 3591752 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902741.1 protein_id gnl|my_center|LOCUS_34950 3591813 3592127 gene locus_tag LOCUS_34960 3591813 3592127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 3592272 3593429 gene locus_tag LOCUS_34970 3592272 3593429 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902657.1 protein_id gnl|my_center|LOCUS_34970 3593426 3593830 gene locus_tag LOCUS_34980 3593426 3593830 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902658.1 protein_id gnl|my_center|LOCUS_34980 3594645 3593848 gene locus_tag LOCUS_34990 3594645 3593848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 3594734 3594883 gene locus_tag LOCUS_35000 3594734 3594883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 3595609 3595061 gene locus_tag LOCUS_35010 gene dpsA 3595609 3595061 CDS product DNA starvation/stationary phase protection protein DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903826.1 protein_id gnl|my_center|LOCUS_35010 3596077 3595697 gene locus_tag LOCUS_35020 3596077 3595697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 3596557 3596150 gene locus_tag LOCUS_35030 3596557 3596150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 3597212 3596622 gene locus_tag LOCUS_35040 3597212 3596622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 3597280 3597801 gene locus_tag LOCUS_35050 3597280 3597801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 3597914 3599068 gene locus_tag LOCUS_35060 3597914 3599068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 3599202 3600149 gene locus_tag LOCUS_35070 3599202 3600149 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902144.1 protein_id gnl|my_center|LOCUS_35070 3600353 3601963 gene locus_tag LOCUS_35080 3600353 3601963 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224348.1 protein_id gnl|my_center|LOCUS_35080 3602101 3603456 gene locus_tag LOCUS_35090 3602101 3603456 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615621.1 protein_id gnl|my_center|LOCUS_35090 3603466 3604053 gene locus_tag LOCUS_35100 3603466 3604053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 3604161 3604820 gene locus_tag LOCUS_35110 3604161 3604820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 3605039 3605962 gene locus_tag LOCUS_35120 3605039 3605962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 3606480 3606677 gene locus_tag LOCUS_35130 3606480 3606677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 3606953 3607810 gene locus_tag LOCUS_35140 3606953 3607810 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061433.1 protein_id gnl|my_center|LOCUS_35140 3607803 3608789 gene locus_tag LOCUS_35150 3607803 3608789 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090620535.1 protein_id gnl|my_center|LOCUS_35150 3610402 3608807 gene locus_tag LOCUS_35160 3610402 3608807 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887610.1 protein_id gnl|my_center|LOCUS_35160 3610652 3612823 gene locus_tag LOCUS_35170 3610652 3612823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 3612976 3613251 gene locus_tag LOCUS_35180 3612976 3613251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 3613359 3614282 gene locus_tag LOCUS_35190 gene arcC 3613359 3614282 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904160.1 protein_id gnl|my_center|LOCUS_35190 3615629 3614313 gene locus_tag LOCUS_35200 3615629 3614313 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_35200 3615871 3615701 gene locus_tag LOCUS_35210 3615871 3615701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 3617301 3615934 gene locus_tag LOCUS_35220 3617301 3615934 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977913.1 protein_id gnl|my_center|LOCUS_35220 3619445 3617379 gene locus_tag LOCUS_35230 3619445 3617379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 3620434 3619481 gene locus_tag LOCUS_35240 3620434 3619481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 3620633 3620421 gene locus_tag LOCUS_35250 3620633 3620421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 3625140 3620662 gene locus_tag LOCUS_35260 3625140 3620662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 3626395 3625253 gene locus_tag LOCUS_35270 3626395 3625253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 3627342 3626386 gene locus_tag LOCUS_35280 3627342 3626386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 3627814 3627335 gene locus_tag LOCUS_35290 3627814 3627335 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870965.1 protein_id gnl|my_center|LOCUS_35290 3628932 3627991 gene locus_tag LOCUS_35300 3628932 3627991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 3629601 3629014 gene locus_tag LOCUS_35310 3629601 3629014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 3629633 3630115 gene locus_tag LOCUS_35320 gene ndk 3629633 3630115 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_35320 3631012 3630179 gene locus_tag LOCUS_35330 3631012 3630179 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903130.1 protein_id gnl|my_center|LOCUS_35330 3631161 3631775 gene locus_tag LOCUS_35340 gene cbiT 3631161 3631775 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903131.1 protein_id gnl|my_center|LOCUS_35340 3631772 3632554 gene locus_tag LOCUS_35350 3631772 3632554 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903132.1 protein_id gnl|my_center|LOCUS_35350 3632551 3633459 gene locus_tag LOCUS_35360 3632551 3633459 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903133.1 protein_id gnl|my_center|LOCUS_35360 3633461 3634459 gene locus_tag LOCUS_35370 gene cbiG 3633461 3634459 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903134.1 protein_id gnl|my_center|LOCUS_35370 3634456 3635358 gene locus_tag LOCUS_35380 3634456 3635358 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903135.1 protein_id gnl|my_center|LOCUS_35380 3635365 3636354 gene locus_tag LOCUS_35390 gene cobJ 3635365 3636354 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903136.1 protein_id gnl|my_center|LOCUS_35390 3636356 3636604 gene locus_tag LOCUS_35400 3636356 3636604 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903137.1 protein_id gnl|my_center|LOCUS_35400 3636678 3637379 gene locus_tag LOCUS_35410 3636678 3637379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903138.1 protein_id gnl|my_center|LOCUS_35410 3637383 3638633 gene locus_tag LOCUS_35420 3637383 3638633 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289353.1 protein_id gnl|my_center|LOCUS_35420 3638683 3639108 gene locus_tag LOCUS_35430 3638683 3639108 CDS product DUF3209 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903140.1 protein_id gnl|my_center|LOCUS_35430 3639095 3640447 gene locus_tag LOCUS_35440 3639095 3640447 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903141.1 protein_id gnl|my_center|LOCUS_35440 3641299 3640532 gene locus_tag LOCUS_35450 3641299 3640532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 3641505 3641299 gene locus_tag LOCUS_35460 3641505 3641299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 3643737 3641578 gene locus_tag LOCUS_35470 3643737 3641578 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903142.1 protein_id gnl|my_center|LOCUS_35470 3643850 3647746 gene locus_tag LOCUS_35480 gene cobN 3643850 3647746 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289354.1 protein_id gnl|my_center|LOCUS_35480 3647736 3648461 gene locus_tag LOCUS_35490 3647736 3648461 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903144.1 protein_id gnl|my_center|LOCUS_35490 3648458 3649249 gene locus_tag LOCUS_35500 3648458 3649249 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903145.1 protein_id gnl|my_center|LOCUS_35500 3650099 3649299 gene locus_tag LOCUS_35510 3650099 3649299 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903146.1 protein_id gnl|my_center|LOCUS_35510 3651109 3650369 gene locus_tag LOCUS_35520 3651109 3650369 CDS product dolichyl-phosphate hexose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902647.1 protein_id gnl|my_center|LOCUS_35520 3651444 3651262 gene locus_tag LOCUS_35530 3651444 3651262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 3651668 3652069 gene locus_tag LOCUS_35540 3651668 3652069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903322.1 protein_id gnl|my_center|LOCUS_35540 3652434 3652913 gene locus_tag LOCUS_35550 3652434 3652913 CDS product DUF5805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289235.1 protein_id gnl|my_center|LOCUS_35550 3652906 3653952 gene locus_tag LOCUS_35560 3652906 3653952 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902588.1 protein_id gnl|my_center|LOCUS_35560 3654243 3654893 gene locus_tag LOCUS_35570 3654243 3654893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 3655822 3654902 gene locus_tag LOCUS_35580 3655822 3654902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902593.1 protein_id gnl|my_center|LOCUS_35580 3657172 3655862 gene locus_tag LOCUS_35590 3657172 3655862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902594.1 protein_id gnl|my_center|LOCUS_35590 3658114 3657263 gene locus_tag LOCUS_35600 3658114 3657263 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892496.1 protein_id gnl|my_center|LOCUS_35600 3658198 3658545 gene locus_tag LOCUS_35610 3658198 3658545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 3660067 3658709 gene locus_tag LOCUS_35620 3660067 3658709 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023992.1 protein_id gnl|my_center|LOCUS_35620 3660932 3660060 gene locus_tag LOCUS_35630 3660932 3660060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 3661707 3660925 gene locus_tag LOCUS_35640 gene proC 3661707 3660925 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_35640 3662592 3661831 gene locus_tag LOCUS_35650 gene hpaI 3662592 3661831 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 protein_id gnl|my_center|LOCUS_35650 3663053 3662646 gene locus_tag LOCUS_35660 3663053 3662646 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902597.1 protein_id gnl|my_center|LOCUS_35660 3663403 3663137 gene locus_tag LOCUS_35670 3663403 3663137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 3663581 3663411 gene locus_tag LOCUS_35680 3663581 3663411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 3663783 3664841 gene locus_tag LOCUS_35690 gene dph2 3663783 3664841 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902598.1 protein_id gnl|my_center|LOCUS_35690 3665162 3665671 gene locus_tag LOCUS_35700 3665162 3665671 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157849921.1 protein_id gnl|my_center|LOCUS_35700 3667032 3665704 gene locus_tag LOCUS_35710 3667032 3665704 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_35710 3667468 3668067 gene locus_tag LOCUS_35720 3667468 3668067 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902840.1 protein_id gnl|my_center|LOCUS_35720 3668138 3668977 gene locus_tag LOCUS_35730 3668138 3668977 CDS product 16S ribosomal RNA methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902839.1 protein_id gnl|my_center|LOCUS_35730 3668977 3670341 gene locus_tag LOCUS_35740 3668977 3670341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 3670334 3670930 gene locus_tag LOCUS_35750 3670334 3670930 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902837.1 protein_id gnl|my_center|LOCUS_35750 3671015 3672025 gene locus_tag LOCUS_35760 3671015 3672025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902836.1 protein_id gnl|my_center|LOCUS_35760 3672022 3673173 gene locus_tag LOCUS_35770 3672022 3673173 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_35770 3674233 3673205 gene locus_tag LOCUS_35780 3674233 3673205 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903854.1 protein_id gnl|my_center|LOCUS_35780 3674907 3674233 gene locus_tag LOCUS_35790 gene phoU 3674907 3674233 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892486.1 protein_id gnl|my_center|LOCUS_35790 3675836 3674913 gene locus_tag LOCUS_35800 gene pstB 3675836 3674913 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903855.1 protein_id gnl|my_center|LOCUS_35800 3677439 3675829 gene locus_tag LOCUS_35810 gene pstA 3677439 3675829 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903856.1 protein_id gnl|my_center|LOCUS_35810 3678569 3677439 gene locus_tag LOCUS_35820 gene pstC 3678569 3677439 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903857.1 protein_id gnl|my_center|LOCUS_35820 3679791 3678640 gene locus_tag LOCUS_35830 3679791 3678640 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903858.1 protein_id gnl|my_center|LOCUS_35830 3680030 3680959 gene locus_tag LOCUS_35840 3680030 3680959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 3681729 3680956 gene locus_tag LOCUS_35850 3681729 3680956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 3682509 3681895 gene locus_tag LOCUS_35860 3682509 3681895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 3683449 3682511 gene locus_tag LOCUS_35870 3683449 3682511 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729557.1 protein_id gnl|my_center|LOCUS_35870 3683598 3684857 gene locus_tag LOCUS_35880 3683598 3684857 CDS product acyl-CoA thioesterase/bile acid-CoA:amino acid N-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966677.1 protein_id gnl|my_center|LOCUS_35880 3684900 3686177 gene locus_tag LOCUS_35890 3684900 3686177 CDS product Single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289299.1 protein_id gnl|my_center|LOCUS_35890 3686174 3687814 gene locus_tag LOCUS_35900 3686174 3687814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902908.1 protein_id gnl|my_center|LOCUS_35900 3687818 3688624 gene locus_tag LOCUS_35910 3687818 3688624 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902907.1 protein_id gnl|my_center|LOCUS_35910 3688774 3689325 gene locus_tag LOCUS_35920 3688774 3689325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 3689982 3689326 gene locus_tag LOCUS_35930 3689982 3689326 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941851.1 protein_id gnl|my_center|LOCUS_35930 3690068 3690859 gene locus_tag LOCUS_35940 3690068 3690859 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_35940 3692208 3690883 gene locus_tag LOCUS_35950 3692208 3690883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 3692312 3692707 gene locus_tag LOCUS_35960 3692312 3692707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 3692795 3693160 gene locus_tag LOCUS_35970 3692795 3693160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 3693553 3693185 gene locus_tag LOCUS_35980 3693553 3693185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 3693675 3694145 gene locus_tag LOCUS_35990 3693675 3694145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 3694335 3695576 gene locus_tag LOCUS_36000 3694335 3695576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 3695997 3695608 gene locus_tag LOCUS_36010 3695997 3695608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 3697048 3696014 gene locus_tag LOCUS_36020 gene asd 3697048 3696014 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903044.1 protein_id gnl|my_center|LOCUS_36020 3698198 3697152 gene locus_tag LOCUS_36030 3698198 3697152 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177617.1 protein_id gnl|my_center|LOCUS_36030 3699654 3698191 gene locus_tag LOCUS_36040 3699654 3698191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 3700461 3699757 gene locus_tag LOCUS_36050 3700461 3699757 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902974.1 protein_id gnl|my_center|LOCUS_36050 3700708 3701100 gene locus_tag LOCUS_36060 3700708 3701100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 3702297 3701161 gene locus_tag LOCUS_36070 3702297 3701161 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289314.1 protein_id gnl|my_center|LOCUS_36070 3702429 3704066 gene locus_tag LOCUS_36080 3702429 3704066 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838674.1 protein_id gnl|my_center|LOCUS_36080 3704135 3705160 gene locus_tag LOCUS_36090 3704135 3705160 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021005.1 protein_id gnl|my_center|LOCUS_36090 3705249 3705956 gene locus_tag LOCUS_36100 3705249 3705956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 3707651 3705999 gene locus_tag LOCUS_36110 3707651 3705999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 3707813 3708121 gene locus_tag LOCUS_36120 3707813 3708121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 3708236 3708526 gene locus_tag LOCUS_36130 3708236 3708526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 3709801 3708560 gene locus_tag LOCUS_36140 3709801 3708560 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903808.1 protein_id gnl|my_center|LOCUS_36140 3709918 3710493 gene locus_tag LOCUS_36150 3709918 3710493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 3711622 3710531 gene locus_tag LOCUS_36160 3711622 3710531 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902067.1 protein_id gnl|my_center|LOCUS_36160 3712068 3711685 gene locus_tag LOCUS_36170 3712068 3711685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 3712375 3712569 gene locus_tag LOCUS_36180 3712375 3712569 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_36180 3713471 3712857 gene locus_tag LOCUS_36190 3713471 3712857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 3714073 3713567 gene locus_tag LOCUS_36200 3714073 3713567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 3714516 3715472 gene locus_tag LOCUS_36210 3714516 3715472 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403008.1 protein_id gnl|my_center|LOCUS_36210 3715583 3716674 gene locus_tag LOCUS_36220 3715583 3716674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 3716739 3717572 gene locus_tag LOCUS_36230 3716739 3717572 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887476.1 protein_id gnl|my_center|LOCUS_36230 3718001 3717717 gene locus_tag LOCUS_36240 3718001 3717717 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892515.1 protein_id gnl|my_center|LOCUS_36240 3718204 3718362 gene locus_tag LOCUS_36250 3718204 3718362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 3718801 3718364 gene locus_tag LOCUS_36260 3718801 3718364 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289494.1 protein_id gnl|my_center|LOCUS_36260 3720004 3718880 gene locus_tag LOCUS_36270 3720004 3718880 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289495.1 protein_id gnl|my_center|LOCUS_36270 3720252 3720713 gene locus_tag LOCUS_36280 3720252 3720713 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903278.1 protein_id gnl|my_center|LOCUS_36280 3721017 3720721 gene locus_tag LOCUS_36290 3721017 3720721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 3722669 3721038 gene locus_tag LOCUS_36300 3722669 3721038 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_36300 3722755 3723228 gene locus_tag LOCUS_36310 3722755 3723228 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688513.1 protein_id gnl|my_center|LOCUS_36310 3723315 3724733 gene locus_tag LOCUS_36320 3723315 3724733 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_36320 3724781 3725716 gene locus_tag LOCUS_36330 3724781 3725716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 3725900 3726598 gene locus_tag LOCUS_36340 3725900 3726598 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902372.1 protein_id gnl|my_center|LOCUS_36340 3726765 3726992 gene locus_tag LOCUS_36350 3726765 3726992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 3727076 3727978 gene locus_tag LOCUS_36360 3727076 3727978 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902785.1 protein_id gnl|my_center|LOCUS_36360 3728102 3729268 gene locus_tag LOCUS_36370 3728102 3729268 CDS product DR2241 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902784.1 protein_id gnl|my_center|LOCUS_36370 3729941 3729303 gene locus_tag LOCUS_36380 3729941 3729303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 3730192 3729995 gene locus_tag LOCUS_36390 3730192 3729995 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902783.1 protein_id gnl|my_center|LOCUS_36390 3731072 3730242 gene locus_tag LOCUS_36400 3731072 3730242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 3731151 3731783 gene locus_tag LOCUS_36410 3731151 3731783 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902963.1 protein_id gnl|my_center|LOCUS_36410 3732388 3731906 gene locus_tag LOCUS_36420 3732388 3731906 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933324.1 protein_id gnl|my_center|LOCUS_36420 3732883 3732482 gene locus_tag LOCUS_36430 3732883 3732482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 3733769 3732945 gene locus_tag LOCUS_36440 3733769 3732945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 3733896 3735155 gene locus_tag LOCUS_36450 3733896 3735155 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903386.1 protein_id gnl|my_center|LOCUS_36450 3735522 3735178 gene locus_tag LOCUS_36460 3735522 3735178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903389.1 protein_id gnl|my_center|LOCUS_36460 3736611 3735661 gene locus_tag LOCUS_36470 3736611 3735661 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902808.1 protein_id gnl|my_center|LOCUS_36470 3738497 3736611 gene locus_tag LOCUS_36480 3738497 3736611 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289282.1 protein_id gnl|my_center|LOCUS_36480 3738703 3739437 gene locus_tag LOCUS_36490 3738703 3739437 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902515.1 protein_id gnl|my_center|LOCUS_36490 3739646 3741664 gene locus_tag LOCUS_36500 3739646 3741664 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133412129.1 protein_id gnl|my_center|LOCUS_36500 3741661 3744204 gene locus_tag LOCUS_36510 3741661 3744204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 3744344 3744955 gene locus_tag LOCUS_36520 3744344 3744955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902413.1 protein_id gnl|my_center|LOCUS_36520 3745844 3745044 gene locus_tag LOCUS_36530 3745844 3745044 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902971.1 protein_id gnl|my_center|LOCUS_36530 3747218 3746019 gene locus_tag LOCUS_36540 3747218 3746019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 3748324 3747281 gene locus_tag LOCUS_36550 3748324 3747281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 3748448 3748636 gene locus_tag LOCUS_36560 3748448 3748636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 3748741 3748965 gene locus_tag LOCUS_36570 3748741 3748965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902537.1 protein_id gnl|my_center|LOCUS_36570 3749033 3749470 gene locus_tag LOCUS_36580 3749033 3749470 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902538.1 protein_id gnl|my_center|LOCUS_36580 3749467 3750333 gene locus_tag LOCUS_36590 3749467 3750333 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_36590 3751762 3750608 gene locus_tag LOCUS_36600 3751762 3750608 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289190.1 protein_id gnl|my_center|LOCUS_36600 3752791 3751820 gene locus_tag LOCUS_36610 3752791 3751820 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_36610 3753113 3753394 gene locus_tag LOCUS_36620 gene gatC 3753113 3753394 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289242.1 protein_id gnl|my_center|LOCUS_36620 3753394 3754758 gene locus_tag LOCUS_36630 gene gatA 3753394 3754758 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902611.1 protein_id gnl|my_center|LOCUS_36630 3755598 3754813 gene locus_tag LOCUS_36640 3755598 3754813 CDS product DUF6517 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289418.1 protein_id gnl|my_center|LOCUS_36640 3755796 3757469 gene locus_tag LOCUS_36650 3755796 3757469 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 protein_id gnl|my_center|LOCUS_36650 3757612 3758766 gene locus_tag LOCUS_36660 3757612 3758766 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289146.1 protein_id gnl|my_center|LOCUS_36660 3759073 3758873 gene locus_tag LOCUS_36670 3759073 3758873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 3759157 3759495 gene locus_tag LOCUS_36680 3759157 3759495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 3759431 3759877 gene locus_tag LOCUS_36690 3759431 3759877 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289078.1 protein_id gnl|my_center|LOCUS_36690 3761138 3760002 gene locus_tag LOCUS_36700 3761138 3760002 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902861.1 protein_id gnl|my_center|LOCUS_36700 3761208 3762800 gene locus_tag LOCUS_36710 3761208 3762800 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902970.1 protein_id gnl|my_center|LOCUS_36710 3763679 3762810 gene locus_tag LOCUS_36720 3763679 3762810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 3763889 3764641 gene locus_tag LOCUS_36730 gene fadH 3763889 3764641 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987267.1 protein_id gnl|my_center|LOCUS_36730 3764689 3764826 gene locus_tag LOCUS_36740 3764689 3764826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 3764887 3765450 gene locus_tag LOCUS_36750 3764887 3765450 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902490.1 protein_id gnl|my_center|LOCUS_36750 3765523 3765681 gene locus_tag LOCUS_36760 3765523 3765681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 3765873 3765694 gene locus_tag LOCUS_36770 3765873 3765694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 3767847 3765877 gene locus_tag LOCUS_36780 3767847 3765877 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495579.1 protein_id gnl|my_center|LOCUS_36780 3767935 3768609 gene locus_tag LOCUS_36790 3767935 3768609 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902491.1 protein_id gnl|my_center|LOCUS_36790 3768932 3768747 gene locus_tag LOCUS_36800 3768932 3768747 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903043.1 protein_id gnl|my_center|LOCUS_36800 3769559 3768990 gene locus_tag LOCUS_36810 3769559 3768990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 3770488 3769643 gene locus_tag LOCUS_36820 3770488 3769643 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496430.1 protein_id gnl|my_center|LOCUS_36820 3771294 3770485 gene locus_tag LOCUS_36830 3771294 3770485 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289327.1 protein_id gnl|my_center|LOCUS_36830 3770620 3770692 gene locus_tag LOCUS_t00390 3770620 3770692 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3772286 3771291 gene locus_tag LOCUS_36840 gene cofD 3772286 3771291 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903040.1 protein_id gnl|my_center|LOCUS_36840 3772388 3773602 gene locus_tag LOCUS_36850 3772388 3773602 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903121.1 protein_id gnl|my_center|LOCUS_36850 3773690 3774583 gene locus_tag LOCUS_36860 3773690 3774583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 3774672 3775112 gene locus_tag LOCUS_36870 3774672 3775112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 3775117 3775806 gene locus_tag LOCUS_36880 3775117 3775806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289461.1 protein_id gnl|my_center|LOCUS_36880 3775767 3777188 gene locus_tag LOCUS_36890 3775767 3777188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902642.1 protein_id gnl|my_center|LOCUS_36890 3777196 3777525 gene locus_tag LOCUS_36900 3777196 3777525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 3777819 3777568 gene locus_tag LOCUS_36910 3777819 3777568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 3778126 3777863 gene locus_tag LOCUS_36920 3778126 3777863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 3778405 3778133 gene locus_tag LOCUS_36930 3778405 3778133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 3781054 3778451 gene locus_tag LOCUS_36940 3781054 3778451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 3781829 3781047 gene locus_tag LOCUS_36950 3781829 3781047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 3782004 3782738 gene locus_tag LOCUS_36960 3782004 3782738 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892481.1 protein_id gnl|my_center|LOCUS_36960 3785074 3782795 gene locus_tag LOCUS_36970 3785074 3782795 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289344.1 protein_id gnl|my_center|LOCUS_36970 3787162 3785948 gene locus_tag LOCUS_36980 3787162 3785948 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_36980 3787282 3788649 gene locus_tag LOCUS_36990 gene aroA 3787282 3788649 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289296.1 protein_id gnl|my_center|LOCUS_36990 3788743 3789216 gene locus_tag LOCUS_37000 3788743 3789216 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045300.1 protein_id gnl|my_center|LOCUS_37000 3789213 3790142 gene locus_tag LOCUS_37010 gene rfbB 3789213 3790142 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_37010 3791662 3790163 gene locus_tag LOCUS_37020 3791662 3790163 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_37020 3791741 3792757 gene locus_tag LOCUS_37030 3791741 3792757 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877833.1 protein_id gnl|my_center|LOCUS_37030 3793739 3792798 gene locus_tag LOCUS_37040 3793739 3792798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 3794479 3793736 gene locus_tag LOCUS_37050 3794479 3793736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 3795648 3794485 gene locus_tag LOCUS_37060 3795648 3794485 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_37060 3795744 3798908 gene locus_tag LOCUS_37070 gene ileS 3795744 3798908 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903625.1 protein_id gnl|my_center|LOCUS_37070 3799004 3800329 gene locus_tag LOCUS_37080 3799004 3800329 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392828.1 protein_id gnl|my_center|LOCUS_37080 3801611 3800358 gene locus_tag LOCUS_37090 3801611 3800358 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272198.1 protein_id gnl|my_center|LOCUS_37090 3802345 3801695 gene locus_tag LOCUS_37100 3802345 3801695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 3803048 3802569 gene locus_tag LOCUS_37110 gene ndk 3803048 3802569 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902835.1 protein_id gnl|my_center|LOCUS_37110 3803416 3803045 gene locus_tag LOCUS_37120 3803416 3803045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 3803640 3803416 gene locus_tag LOCUS_37130 3803640 3803416 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902833.1 protein_id gnl|my_center|LOCUS_37130 3804004 3803642 gene locus_tag LOCUS_37140 gene rpl7ae 3804004 3803642 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902832.1 protein_id gnl|my_center|LOCUS_37140 3804288 3805184 gene locus_tag LOCUS_37150 3804288 3805184 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_37150 3805190 3806419 gene locus_tag LOCUS_37160 gene larA 3805190 3806419 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065079.1 protein_id gnl|my_center|LOCUS_37160 3807513 3806710 gene locus_tag LOCUS_37170 3807513 3806710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 3810500 3807639 gene locus_tag LOCUS_37180 3810500 3807639 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146858.1 protein_id gnl|my_center|LOCUS_37180 3810637 3811848 gene locus_tag LOCUS_37190 3810637 3811848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 3811901 3812851 gene locus_tag LOCUS_37200 3811901 3812851 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902327.1 protein_id gnl|my_center|LOCUS_37200 3812848 3813432 gene locus_tag LOCUS_37210 3812848 3813432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902326.1 protein_id gnl|my_center|LOCUS_37210 3813802 3814122 gene locus_tag LOCUS_37220 3813802 3814122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 3815162 3814263 gene locus_tag LOCUS_37230 3815162 3814263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 3816722 3815193 gene locus_tag LOCUS_37240 3816722 3815193 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868703.1 protein_id gnl|my_center|LOCUS_37240 3816836 3817036 gene locus_tag LOCUS_37250 3816836 3817036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 3817140 3818021 gene locus_tag LOCUS_37260 3817140 3818021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 3819884 3818040 gene locus_tag LOCUS_37270 3819884 3818040 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903944.1 protein_id gnl|my_center|LOCUS_37270 3821325 3819964 gene locus_tag LOCUS_37280 3821325 3819964 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022374.1 protein_id gnl|my_center|LOCUS_37280 3821498 3822232 gene locus_tag LOCUS_37290 3821498 3822232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 3822329 3822949 gene locus_tag LOCUS_37300 3822329 3822949 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902324.1 protein_id gnl|my_center|LOCUS_37300 3823089 3823892 gene locus_tag LOCUS_37310 3823089 3823892 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815888.1 protein_id gnl|my_center|LOCUS_37310 3824059 3826014 gene locus_tag LOCUS_37320 gene dnaK 3824059 3826014 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902322.1 protein_id gnl|my_center|LOCUS_37320 3827770 3826097 gene locus_tag LOCUS_37330 3827770 3826097 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_37330 3828931 3827864 gene locus_tag LOCUS_37340 3828931 3827864 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_37340 3830675 3828996 gene locus_tag LOCUS_37350 3830675 3828996 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534776.1 protein_id gnl|my_center|LOCUS_37350 3831807 3830740 gene locus_tag LOCUS_37360 3831807 3830740 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889453.1 protein_id gnl|my_center|LOCUS_37360 3831828 3832040 gene locus_tag LOCUS_37370 3831828 3832040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 3833958 3832033 gene locus_tag LOCUS_37380 3833958 3832033 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902249.1 protein_id gnl|my_center|LOCUS_37380 3834173 3834670 gene locus_tag LOCUS_37390 3834173 3834670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 3834725 3835660 gene locus_tag LOCUS_37400 gene aglG 3834725 3835660 CDS product glucosyl-dolichyl phosphate glucuronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289272.1 protein_id gnl|my_center|LOCUS_37400 3835718 3836902 gene locus_tag LOCUS_37410 3835718 3836902 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902861.1 protein_id gnl|my_center|LOCUS_37410 3837094 3837489 gene locus_tag LOCUS_37420 3837094 3837489 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903278.1 protein_id gnl|my_center|LOCUS_37420 3837566 3838711 gene locus_tag LOCUS_37430 3837566 3838711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 3840144 3838729 gene locus_tag LOCUS_37440 3840144 3838729 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902753.1 protein_id gnl|my_center|LOCUS_37440 3841534 3840146 gene locus_tag LOCUS_37450 3841534 3840146 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_37450 3841625 3842608 gene locus_tag LOCUS_37460 3841625 3842608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 3844116 3842671 gene locus_tag LOCUS_37470 3844116 3842671 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902756.1 protein_id gnl|my_center|LOCUS_37470 3844228 3845133 gene locus_tag LOCUS_37480 3844228 3845133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 3845290 3846297 gene locus_tag LOCUS_37490 3845290 3846297 CDS product TIGR04024 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_37490 3846384 3847259 gene locus_tag LOCUS_37500 3846384 3847259 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389061.1 protein_id gnl|my_center|LOCUS_37500 3848160 3847348 gene locus_tag LOCUS_37510 3848160 3847348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 3849100 3848306 gene locus_tag LOCUS_37520 3849100 3848306 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_37520 3849351 3849151 gene locus_tag LOCUS_37530 3849351 3849151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892519.1 protein_id gnl|my_center|LOCUS_37530 3849872 3849420 gene locus_tag LOCUS_37540 3849872 3849420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206964.1 protein_id gnl|my_center|LOCUS_37540 3849989 3850312 gene locus_tag LOCUS_37550 3849989 3850312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 3850456 3851796 gene locus_tag LOCUS_37560 3850456 3851796 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902278.1 protein_id gnl|my_center|LOCUS_37560 3851874 3852254 gene locus_tag LOCUS_37570 3851874 3852254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 3853208 3852267 gene locus_tag LOCUS_37580 3853208 3852267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 3854849 3853695 gene locus_tag LOCUS_37590 3854849 3853695 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902861.1 protein_id gnl|my_center|LOCUS_37590 3855035 3857002 gene locus_tag LOCUS_37600 3855035 3857002 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902952.1 protein_id gnl|my_center|LOCUS_37600 3857084 3857776 gene locus_tag LOCUS_37610 3857084 3857776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 3859202 3857967 gene locus_tag LOCUS_37620 3859202 3857967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 3861692 3859311 gene locus_tag LOCUS_37630 3861692 3859311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 3861839 3862042 gene locus_tag LOCUS_37640 3861839 3862042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 3862178 3862372 gene locus_tag LOCUS_37650 3862178 3862372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 3862439 3863155 gene locus_tag LOCUS_37660 3862439 3863155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289326.1 protein_id gnl|my_center|LOCUS_37660 3864758 3863172 gene locus_tag LOCUS_37670 3864758 3863172 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902486.1 protein_id gnl|my_center|LOCUS_37670 3864950 3867085 gene locus_tag LOCUS_37680 3864950 3867085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 3867156 3867737 gene locus_tag LOCUS_37690 3867156 3867737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 3867925 3870225 gene locus_tag LOCUS_37700 3867925 3870225 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902665.1 protein_id gnl|my_center|LOCUS_37700 3870222 3871382 gene locus_tag LOCUS_37710 3870222 3871382 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902666.1 protein_id gnl|my_center|LOCUS_37710 3871875 3871414 gene locus_tag LOCUS_37720 3871875 3871414 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_37720 3871789 3871998 gene locus_tag LOCUS_37730 3871789 3871998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 3872736 3872056 gene locus_tag LOCUS_37740 gene bioD 3872736 3872056 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_37740 3874044 3872788 gene locus_tag LOCUS_37750 gene bioF 3874044 3872788 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968008.1 protein_id gnl|my_center|LOCUS_37750 3875112 3874066 gene locus_tag LOCUS_37760 3875112 3874066 CDS product saccharopine dehydrogenase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928537.1 protein_id gnl|my_center|LOCUS_37760 3876300 3875188 gene locus_tag LOCUS_37770 gene bioB 3876300 3875188 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_37770 3877771 3876425 gene locus_tag LOCUS_37780 3877771 3876425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 3878930 3878064 gene locus_tag LOCUS_37790 3878930 3878064 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902414.1 protein_id gnl|my_center|LOCUS_37790 3879224 3880312 gene locus_tag LOCUS_37800 3879224 3880312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 3880539 3880309 gene locus_tag LOCUS_37810 3880539 3880309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 3880940 3880590 gene locus_tag LOCUS_37820 3880940 3880590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 3881347 3880937 gene locus_tag LOCUS_37830 3881347 3880937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 3881790 3881563 gene locus_tag LOCUS_37840 3881790 3881563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 3881902 3882294 gene locus_tag LOCUS_37850 3881902 3882294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 3882291 3884162 gene locus_tag LOCUS_37860 3882291 3884162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 3884353 3885183 gene locus_tag LOCUS_37870 3884353 3885183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 3885180 3885740 gene locus_tag LOCUS_37880 3885180 3885740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 3885733 3886194 gene locus_tag LOCUS_37890 3885733 3886194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 3886191 3887717 gene locus_tag LOCUS_37900 3886191 3887717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 3889094 3888213 gene locus_tag LOCUS_37910 3889094 3888213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 3889238 3889113 gene locus_tag LOCUS_37920 3889238 3889113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 3889405 3889229 gene locus_tag LOCUS_37930 3889405 3889229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 3889883 3889581 gene locus_tag LOCUS_37940 3889883 3889581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 3890142 3889894 gene locus_tag LOCUS_37950 3890142 3889894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 3890530 3890285 gene locus_tag LOCUS_37960 3890530 3890285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 3891280 3890693 gene locus_tag LOCUS_37970 3891280 3890693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 3892092 3891274 gene locus_tag LOCUS_37980 3892092 3891274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 3892667 3892092 gene locus_tag LOCUS_37990 3892667 3892092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 3893338 3892664 gene locus_tag LOCUS_38000 3893338 3892664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 3893730 3893329 gene locus_tag LOCUS_38010 3893730 3893329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 3893918 3893727 gene locus_tag LOCUS_38020 3893918 3893727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 3894922 3893915 gene locus_tag LOCUS_38030 3894922 3893915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 3895860 3894922 gene locus_tag LOCUS_38040 3895860 3894922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 3896921 3895857 gene locus_tag LOCUS_38050 3896921 3895857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 3899041 3896918 gene locus_tag LOCUS_38060 3899041 3896918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 3900759 3899038 gene locus_tag LOCUS_38070 3900759 3899038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 3902158 3900836 gene locus_tag LOCUS_38080 3902158 3900836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 3903280 3902267 gene locus_tag LOCUS_38090 3903280 3902267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 3903981 3903277 gene locus_tag LOCUS_38100 3903981 3903277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 3906040 3903971 gene locus_tag LOCUS_38110 3906040 3903971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 3906443 3906177 gene locus_tag LOCUS_38120 3906443 3906177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 3908314 3906470 gene locus_tag LOCUS_38130 3908314 3906470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 3908677 3908919 gene locus_tag LOCUS_38140 3908677 3908919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 3909914 3909498 gene locus_tag LOCUS_38150 3909914 3909498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 3910847 3909999 gene locus_tag LOCUS_38160 3910847 3909999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 3911565 3910864 gene locus_tag LOCUS_38170 3911565 3910864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 3911765 3911839 gene locus_tag LOCUS_t00400 3911765 3911839 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3912345 3912932 gene locus_tag LOCUS_38180 3912345 3912932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 3913016 3913336 gene locus_tag LOCUS_38190 3913016 3913336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 3914749 3913625 gene locus_tag LOCUS_38200 3914749 3913625 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890422.1 protein_id gnl|my_center|LOCUS_38200 3915557 3916132 gene locus_tag LOCUS_38210 3915557 3916132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 3916921 3916658 gene locus_tag LOCUS_38220 3916921 3916658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289345.1 protein_id gnl|my_center|LOCUS_38220 3918067 3917018 gene locus_tag LOCUS_38230 3918067 3917018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 3918826 3918386 gene locus_tag LOCUS_38240 3918826 3918386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 3919665 3919234 gene locus_tag LOCUS_38250 3919665 3919234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 3920094 3919765 gene locus_tag LOCUS_38260 3920094 3919765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 3920347 3920138 gene locus_tag LOCUS_38270 3920347 3920138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 3920423 3922111 gene locus_tag LOCUS_38280 3920423 3922111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 3922582 3923193 gene locus_tag LOCUS_38290 3922582 3923193 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289264.1 protein_id gnl|my_center|LOCUS_38290 3923198 3923764 gene locus_tag LOCUS_38300 3923198 3923764 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289250.1 protein_id gnl|my_center|LOCUS_38300 3923769 3924422 gene locus_tag LOCUS_38310 3923769 3924422 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902680.1 protein_id gnl|my_center|LOCUS_38310 3924484 3924930 gene locus_tag LOCUS_38320 3924484 3924930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902675.1 protein_id gnl|my_center|LOCUS_38320 3924931 3925392 gene locus_tag LOCUS_38330 3924931 3925392 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902674.1 protein_id gnl|my_center|LOCUS_38330 3925399 3926106 gene locus_tag LOCUS_38340 3925399 3926106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 3926287 3926646 gene locus_tag LOCUS_38350 gene cheY 3926287 3926646 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902692.1 protein_id gnl|my_center|LOCUS_38350 3926646 3927833 gene locus_tag LOCUS_38360 3926646 3927833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 3927833 3928342 gene locus_tag LOCUS_38370 3927833 3928342 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902687.1 protein_id gnl|my_center|LOCUS_38370 3928592 3930214 gene locus_tag LOCUS_38380 3928592 3930214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 3930216 3930986 gene locus_tag LOCUS_38390 3930216 3930986 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902673.1 protein_id gnl|my_center|LOCUS_38390 3930983 3932659 gene locus_tag LOCUS_38400 3930983 3932659 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902672.1 protein_id gnl|my_center|LOCUS_38400 3932662 3934386 gene locus_tag LOCUS_38410 gene flaJ 3932662 3934386 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902671.1 protein_id gnl|my_center|LOCUS_38410 3934389 3935267 gene locus_tag LOCUS_38420 gene cheF2 3934389 3935267 CDS product chemotaxis protein CheF2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902685.1 protein_id gnl|my_center|LOCUS_38420 3936655 3935789 gene locus_tag LOCUS_38430 gene cheF1 3936655 3935789 CDS product chemotaxis protein CheF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902684.1 protein_id gnl|my_center|LOCUS_38430 3937974 3936652 gene locus_tag LOCUS_38440 3937974 3936652 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289252.1 protein_id gnl|my_center|LOCUS_38440 3938819 3937977 gene locus_tag LOCUS_38450 gene cheR 3938819 3937977 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289253.1 protein_id gnl|my_center|LOCUS_38450 3941086 3938816 gene locus_tag LOCUS_38460 gene cheA 3941086 3938816 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902690.1 protein_id gnl|my_center|LOCUS_38460 3942189 3941083 gene locus_tag LOCUS_38470 gene cheB 3942189 3941083 CDS product protein-glutamate methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902691.1 protein_id gnl|my_center|LOCUS_38470 3942508 3943056 gene locus_tag LOCUS_38480 3942508 3943056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 3943785 3943099 gene locus_tag LOCUS_38490 3943785 3943099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 3943911 3944975 gene locus_tag LOCUS_38500 3943911 3944975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 3945099 3946682 gene locus_tag LOCUS_38510 gene hemAT 3945099 3946682 CDS product heme-containing aerotactic transducer HemAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903098.1 protein_id gnl|my_center|LOCUS_38510 3947340 3946918 gene locus_tag LOCUS_38520 3947340 3946918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 3947506 3948186 gene locus_tag LOCUS_38530 3947506 3948186 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250861.1 protein_id gnl|my_center|LOCUS_38530 3948186 3948578 gene locus_tag LOCUS_38540 3948186 3948578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 3949144 3948686 gene locus_tag LOCUS_38550 3949144 3948686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 3949809 3949354 gene locus_tag LOCUS_38560 3949809 3949354 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902667.1 protein_id gnl|my_center|LOCUS_38560 3949953 3950948 gene locus_tag LOCUS_38570 3949953 3950948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 3950945 3951172 gene locus_tag LOCUS_38580 3950945 3951172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902679.1 protein_id gnl|my_center|LOCUS_38580 3951290 3954061 gene locus_tag LOCUS_38590 3951290 3954061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 3955092 3954091 gene locus_tag LOCUS_38600 3955092 3954091 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902312.1 protein_id gnl|my_center|LOCUS_38600 3955561 3955160 gene locus_tag LOCUS_38610 3955561 3955160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 3955748 3956611 gene locus_tag LOCUS_38620 3955748 3956611 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728396.1 protein_id gnl|my_center|LOCUS_38620 3956729 3957190 gene locus_tag LOCUS_38630 3956729 3957190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 3957650 3957222 gene locus_tag LOCUS_38640 gene trxA 3957650 3957222 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890427.1 protein_id gnl|my_center|LOCUS_38640 3957803 3958750 gene locus_tag LOCUS_38650 3957803 3958750 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207993.1 protein_id gnl|my_center|LOCUS_38650 3958846 3959151 gene locus_tag LOCUS_38660 3958846 3959151 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902697.1 protein_id gnl|my_center|LOCUS_38660 3960630 3959179 gene locus_tag LOCUS_38670 3960630 3959179 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902698.1 protein_id gnl|my_center|LOCUS_38670 3960835 3960908 gene locus_tag LOCUS_t00410 3960835 3960908 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3961112 3961378 gene locus_tag LOCUS_38680 3961112 3961378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 3962070 3961636 gene locus_tag LOCUS_38690 3962070 3961636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 3962192 3962533 gene locus_tag LOCUS_38700 3962192 3962533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 3962536 3962853 gene locus_tag LOCUS_38710 3962536 3962853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 3963081 3962893 gene locus_tag LOCUS_38720 3963081 3962893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 3964819 3963332 gene locus_tag LOCUS_38730 gene guaB 3964819 3963332 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289261.1 protein_id gnl|my_center|LOCUS_38730 3965839 3964934 gene locus_tag LOCUS_38740 3965839 3964934 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902489.1 protein_id gnl|my_center|LOCUS_38740 3966922 3965912 gene locus_tag LOCUS_38750 3966922 3965912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 3966982 3968121 gene locus_tag LOCUS_38760 3966982 3968121 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903609.1 protein_id gnl|my_center|LOCUS_38760 3968514 3968128 gene locus_tag LOCUS_38770 3968514 3968128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 3968537 3968944 gene locus_tag LOCUS_38780 3968537 3968944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 3969744 3968953 gene locus_tag LOCUS_38790 3969744 3968953 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902825.1 protein_id gnl|my_center|LOCUS_38790 3970733 3969741 gene locus_tag LOCUS_38800 gene mvk 3970733 3969741 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902824.1 protein_id gnl|my_center|LOCUS_38800 3970843 3971391 gene locus_tag LOCUS_38810 3970843 3971391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 3972311 3971529 gene locus_tag LOCUS_38820 gene rpsB 3972311 3971529 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902822.1 protein_id gnl|my_center|LOCUS_38820 3973507 3972308 gene locus_tag LOCUS_38830 3973507 3972308 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902821.1 protein_id gnl|my_center|LOCUS_38830 3973698 3973504 gene locus_tag LOCUS_38840 3973698 3973504 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902820.1 protein_id gnl|my_center|LOCUS_38840 3973892 3973698 gene locus_tag LOCUS_38850 3973892 3973698 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902819.1 protein_id gnl|my_center|LOCUS_38850 3974333 3973935 gene locus_tag LOCUS_38860 3974333 3973935 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902818.1 protein_id gnl|my_center|LOCUS_38860 3974779 3974339 gene locus_tag LOCUS_38870 3974779 3974339 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902817.1 protein_id gnl|my_center|LOCUS_38870 3975132 3974776 gene locus_tag LOCUS_38880 3975132 3974776 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902816.1 protein_id gnl|my_center|LOCUS_38880 3975246 3975161 gene locus_tag LOCUS_t00420 3975246 3975161 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3976235 3975474 gene locus_tag LOCUS_38890 3976235 3975474 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902815.1 protein_id gnl|my_center|LOCUS_38890 3976635 3976237 gene locus_tag LOCUS_38900 3976635 3976237 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902814.1 protein_id gnl|my_center|LOCUS_38900 3977156 3976632 gene locus_tag LOCUS_38910 3977156 3976632 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902813.1 protein_id gnl|my_center|LOCUS_38910 3977689 3977156 gene locus_tag LOCUS_38920 3977689 3977156 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902812.1 protein_id gnl|my_center|LOCUS_38920 3977792 3977710 gene locus_tag LOCUS_t00430 3977792 3977710 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3979046 3977943 gene locus_tag LOCUS_38930 3979046 3977943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 3979348 3979100 gene locus_tag LOCUS_38940 3979348 3979100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902810.1 protein_id gnl|my_center|LOCUS_38940 3980403 3979345 gene locus_tag LOCUS_38950 3980403 3979345 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902811.1 protein_id gnl|my_center|LOCUS_38950 3980613 3981407 gene locus_tag LOCUS_38960 3980613 3981407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 3981407 3982162 gene locus_tag LOCUS_38970 gene psmA 3981407 3982162 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902078.1 protein_id gnl|my_center|LOCUS_38970 3983348 3982179 gene locus_tag LOCUS_38980 3983348 3982179 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902500.1 protein_id gnl|my_center|LOCUS_38980 3983480 3984475 gene locus_tag LOCUS_38990 gene moaA 3983480 3984475 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289091.1 protein_id gnl|my_center|LOCUS_38990 3985558 3984479 gene locus_tag LOCUS_39000 3985558 3984479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 3985719 3985555 gene locus_tag LOCUS_39010 3985719 3985555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 3988336 3986258 gene locus_tag LOCUS_39020 3988336 3986258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 3988463 3989998 gene locus_tag LOCUS_39030 3988463 3989998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 3990645 3990034 gene locus_tag LOCUS_39040 3990645 3990034 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289247.1 protein_id gnl|my_center|LOCUS_39040 3991229 3990780 gene locus_tag LOCUS_39050 3991229 3990780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903208.1 protein_id gnl|my_center|LOCUS_39050 3992336 3991320 gene locus_tag LOCUS_39060 3992336 3991320 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902943.1 protein_id gnl|my_center|LOCUS_39060 3993690 3992410 gene locus_tag LOCUS_39070 3993690 3992410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 3994686 3993769 gene locus_tag LOCUS_39080 3994686 3993769 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902774.1 protein_id gnl|my_center|LOCUS_39080 3995089 3994754 gene locus_tag LOCUS_39090 3995089 3994754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 3995570 3995289 gene locus_tag LOCUS_39100 3995570 3995289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 3996019 3995657 gene locus_tag LOCUS_39110 3996019 3995657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 3996145 3996582 gene locus_tag LOCUS_39120 3996145 3996582 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903106.1 protein_id gnl|my_center|LOCUS_39120 3998198 3996600 gene locus_tag LOCUS_39130 3998198 3996600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 4000428 3998392 gene locus_tag LOCUS_39140 4000428 3998392 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878495.1 protein_id gnl|my_center|LOCUS_39140 4002476 4000425 gene locus_tag LOCUS_39150 4002476 4000425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 4004508 4002775 gene locus_tag LOCUS_39160 4004508 4002775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 4007059 4004534 gene locus_tag LOCUS_39170 4007059 4004534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 4008909 4007059 gene locus_tag LOCUS_39180 4008909 4007059 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289232.1 protein_id gnl|my_center|LOCUS_39180 4009739 4009011 gene locus_tag LOCUS_39190 4009739 4009011 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828730.1 protein_id gnl|my_center|LOCUS_39190 4011854 4009797 gene locus_tag LOCUS_39200 4011854 4009797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 4012668 4012012 gene locus_tag LOCUS_39210 gene tpiA 4012668 4012012 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902734.1 protein_id gnl|my_center|LOCUS_39210 4013004 4012759 gene locus_tag LOCUS_39220 4013004 4012759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 4013140 4013325 gene locus_tag LOCUS_39230 4013140 4013325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 4013679 4013479 gene locus_tag LOCUS_39240 4013679 4013479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 4014052 4013759 gene locus_tag LOCUS_39250 4014052 4013759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 4014051 4014380 gene locus_tag LOCUS_39260 4014051 4014380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 4014461 4015906 gene locus_tag LOCUS_39270 4014461 4015906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 4016060 4017034 gene locus_tag LOCUS_39280 4016060 4017034 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289348.1 protein_id gnl|my_center|LOCUS_39280 4017697 4017056 gene locus_tag LOCUS_39290 4017697 4017056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 4018176 4017715 gene locus_tag LOCUS_39300 4018176 4017715 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_39300 4018344 4019408 gene locus_tag LOCUS_39310 4018344 4019408 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902912.1 protein_id gnl|my_center|LOCUS_39310 4020461 4019505 gene locus_tag LOCUS_39320 4020461 4019505 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903094.1 protein_id gnl|my_center|LOCUS_39320 4020770 4022149 gene locus_tag LOCUS_39330 gene dinB 4020770 4022149 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289265.1 protein_id gnl|my_center|LOCUS_39330 4022190 4022465 gene locus_tag LOCUS_39340 4022190 4022465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 4022499 4022747 gene locus_tag LOCUS_39350 4022499 4022747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 4022835 4023056 gene locus_tag LOCUS_39360 4022835 4023056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 4024799 4023066 gene locus_tag LOCUS_39370 gene acsA 4024799 4023066 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 protein_id gnl|my_center|LOCUS_39370 4024900 4027374 gene locus_tag LOCUS_39380 4024900 4027374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 4027464 4028270 gene locus_tag LOCUS_39390 4027464 4028270 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338959.1 protein_id gnl|my_center|LOCUS_39390 4028327 4029217 gene locus_tag LOCUS_39400 4028327 4029217 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878705.1 protein_id gnl|my_center|LOCUS_39400 4029319 4029633 gene locus_tag LOCUS_39410 4029319 4029633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089696341.1 protein_id gnl|my_center|LOCUS_39410 4029960 4031174 gene locus_tag LOCUS_39420 4029960 4031174 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006824761.1 protein_id gnl|my_center|LOCUS_39420 4031840 4031340 gene locus_tag LOCUS_39430 4031840 4031340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 4032972 4032187 gene locus_tag LOCUS_39440 4032972 4032187 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227159.1 protein_id gnl|my_center|LOCUS_39440 4033847 4033131 gene locus_tag LOCUS_39450 4033847 4033131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 4034372 4033899 gene locus_tag LOCUS_39460 4034372 4033899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 4035583 4034369 gene locus_tag LOCUS_39470 gene bamB 4035583 4034369 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177072.1 protein_id gnl|my_center|LOCUS_39470 4035743 4036861 gene locus_tag LOCUS_39480 4035743 4036861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 4036858 4037925 gene locus_tag LOCUS_39490 4036858 4037925 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902904.1 protein_id gnl|my_center|LOCUS_39490 4037927 4038652 gene locus_tag LOCUS_39500 4037927 4038652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902903.1 protein_id gnl|my_center|LOCUS_39500 4039340 4038675 gene locus_tag LOCUS_39510 4039340 4038675 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_39510 4042675 4039538 gene locus_tag LOCUS_39520 4042675 4039538 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903811.1 protein_id gnl|my_center|LOCUS_39520 4042812 4043213 gene locus_tag LOCUS_39530 4042812 4043213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 4043261 4043920 gene locus_tag LOCUS_39540 4043261 4043920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 4044119 4043931 gene locus_tag LOCUS_39550 4044119 4043931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 4045393 4044650 gene locus_tag LOCUS_39560 gene thyX 4045393 4044650 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289309.1 protein_id gnl|my_center|LOCUS_39560 4046883 4045447 gene locus_tag LOCUS_39570 4046883 4045447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 4049088 4047001 gene locus_tag LOCUS_39580 4049088 4047001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 4049217 4050011 gene locus_tag LOCUS_39590 4049217 4050011 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289375.1 protein_id gnl|my_center|LOCUS_39590 4050073 4050495 gene locus_tag LOCUS_39600 4050073 4050495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 4051518 4050628 gene locus_tag LOCUS_39610 4051518 4050628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 4051615 4052487 gene locus_tag LOCUS_39620 4051615 4052487 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902893.1 protein_id gnl|my_center|LOCUS_39620 4052484 4054016 gene locus_tag LOCUS_39630 4052484 4054016 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902894.1 protein_id gnl|my_center|LOCUS_39630 4054110 4054916 gene locus_tag LOCUS_39640 gene surE 4054110 4054916 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902899.1 protein_id gnl|my_center|LOCUS_39640 4056863 4055070 gene locus_tag LOCUS_39650 4056863 4055070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 4056976 4057710 gene locus_tag LOCUS_39660 4056976 4057710 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902328.1 protein_id gnl|my_center|LOCUS_39660 4058963 4058100 gene locus_tag LOCUS_39670 4058963 4058100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 4059715 4059158 gene locus_tag LOCUS_39680 4059715 4059158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 4061015 4059885 gene locus_tag LOCUS_39690 4061015 4059885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903588.1 protein_id gnl|my_center|LOCUS_39690 4061382 4061636 gene locus_tag LOCUS_39700 4061382 4061636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 4061637 4062821 gene locus_tag LOCUS_39710 4061637 4062821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 4062864 4063322 gene locus_tag LOCUS_39720 4062864 4063322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 4063347 4064960 gene locus_tag LOCUS_39730 4063347 4064960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 4066820 4065177 gene locus_tag LOCUS_39740 4066820 4065177 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_39740 4067432 4066950 gene locus_tag LOCUS_39750 4067432 4066950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 4067594 4067938 gene locus_tag LOCUS_39760 4067594 4067938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 4067963 4068571 gene locus_tag LOCUS_39770 4067963 4068571 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339294.1 protein_id gnl|my_center|LOCUS_39770 4069320 4068673 gene locus_tag LOCUS_39780 4069320 4068673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 4069932 4069447 gene locus_tag LOCUS_39790 4069932 4069447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 4070101 4070646 gene locus_tag LOCUS_39800 4070101 4070646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 4073025 4070668 gene locus_tag LOCUS_39810 gene tmcA 4073025 4070668 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289283.1 protein_id gnl|my_center|LOCUS_39810 4073212 4074120 gene locus_tag LOCUS_39820 4073212 4074120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 4074252 4074521 gene locus_tag LOCUS_39830 4074252 4074521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 4074579 4074869 gene locus_tag LOCUS_39840 4074579 4074869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902911.1 protein_id gnl|my_center|LOCUS_39840 4075566 4074895 gene locus_tag LOCUS_39850 4075566 4074895 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902910.1 protein_id gnl|my_center|LOCUS_39850 4076354 4075620 gene locus_tag LOCUS_39860 4076354 4075620 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902086.1 protein_id gnl|my_center|LOCUS_39860 4076506 4078311 gene locus_tag LOCUS_39870 4076506 4078311 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808878.1 protein_id gnl|my_center|LOCUS_39870 4078644 4078489 gene locus_tag LOCUS_39880 4078644 4078489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 4078799 4081756 gene locus_tag LOCUS_39890 4078799 4081756 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206901.1 protein_id gnl|my_center|LOCUS_39890 4081877 4084828 gene locus_tag LOCUS_39900 4081877 4084828 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206901.1 protein_id gnl|my_center|LOCUS_39900 4085910 4084912 gene locus_tag LOCUS_39910 4085910 4084912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 4086578 4085988 gene locus_tag LOCUS_39920 4086578 4085988 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403206.1 protein_id gnl|my_center|LOCUS_39920 4088958 4086688 gene locus_tag LOCUS_39930 4088958 4086688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 4089936 4089028 gene locus_tag LOCUS_39940 4089936 4089028 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023323.1 protein_id gnl|my_center|LOCUS_39940 4090952 4089930 gene locus_tag LOCUS_39950 4090952 4089930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023324.1 protein_id gnl|my_center|LOCUS_39950 4091114 4091884 gene locus_tag LOCUS_39960 4091114 4091884 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903097.1 protein_id gnl|my_center|LOCUS_39960 4091939 4092358 gene locus_tag LOCUS_39970 4091939 4092358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 4093429 4092362 gene locus_tag LOCUS_39980 4093429 4092362 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903099.1 protein_id gnl|my_center|LOCUS_39980 4093528 4094868 gene locus_tag LOCUS_39990 4093528 4094868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899261.1 protein_id gnl|my_center|LOCUS_39990 4095695 4094991 gene locus_tag LOCUS_40000 4095695 4094991 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_40000 4098035 4095858 gene locus_tag LOCUS_40010 gene rqcH 4098035 4095858 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903100.1 protein_id gnl|my_center|LOCUS_40010 4098200 4098688 gene locus_tag LOCUS_40020 4098200 4098688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 4098887 4100902 gene locus_tag LOCUS_40030 4098887 4100902 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903521.1 protein_id gnl|my_center|LOCUS_40030 4101876 4101226 gene locus_tag LOCUS_40040 4101876 4101226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 4103705 4102512 gene locus_tag LOCUS_40050 4103705 4102512 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481009.1 protein_id gnl|my_center|LOCUS_40050 4105170 4103782 gene locus_tag LOCUS_40060 gene thiC 4105170 4103782 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902492.1 protein_id gnl|my_center|LOCUS_40060 4105346 4106293 gene locus_tag LOCUS_40070 4105346 4106293 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902138.1 protein_id gnl|my_center|LOCUS_40070 4106652 4107032 gene locus_tag LOCUS_40080 4106652 4107032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 4107512 4107045 gene locus_tag LOCUS_40090 gene pyrI 4107512 4107045 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289641.1 protein_id gnl|my_center|LOCUS_40090 4108426 4107509 gene locus_tag LOCUS_40100 gene pyrB 4108426 4107509 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289640.1 protein_id gnl|my_center|LOCUS_40100 4108651 4109277 gene locus_tag LOCUS_40110 4108651 4109277 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878668.1 protein_id gnl|my_center|LOCUS_40110 4109364 4109786 gene locus_tag LOCUS_40120 4109364 4109786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 4109854 4110279 gene locus_tag LOCUS_40130 4109854 4110279 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902944.1 protein_id gnl|my_center|LOCUS_40130 4112606 4110396 gene locus_tag LOCUS_40140 4112606 4110396 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289305.1 protein_id gnl|my_center|LOCUS_40140 4112717 4113613 gene locus_tag LOCUS_40150 4112717 4113613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 4113671 4114987 gene locus_tag LOCUS_40160 gene purD 4113671 4114987 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902946.1 protein_id gnl|my_center|LOCUS_40160 4115170 4117089 gene locus_tag LOCUS_40170 4115170 4117089 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289321.1 protein_id gnl|my_center|LOCUS_40170 4117091 4117549 gene locus_tag LOCUS_40180 4117091 4117549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 4117596 4118177 gene locus_tag LOCUS_40190 4117596 4118177 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903007.1 protein_id gnl|my_center|LOCUS_40190 4118987 4118190 gene locus_tag LOCUS_40200 4118987 4118190 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903009.1 protein_id gnl|my_center|LOCUS_40200 4119800 4118991 gene locus_tag LOCUS_40210 gene dacZ 4119800 4118991 CDS product diadenylate cyclase DacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903010.1 protein_id gnl|my_center|LOCUS_40210 4119935 4120756 gene locus_tag LOCUS_40220 4119935 4120756 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479170.1 protein_id gnl|my_center|LOCUS_40220 4120871 4120786 gene locus_tag LOCUS_t00440 4120871 4120786 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4121691 4120930 gene locus_tag LOCUS_40230 4121691 4120930 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902885.1 protein_id gnl|my_center|LOCUS_40230 4121751 4121966 gene locus_tag LOCUS_40240 4121751 4121966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 4122189 4122638 gene locus_tag LOCUS_40250 4122189 4122638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 4123614 4122646 gene locus_tag LOCUS_40260 4123614 4122646 CDS product R2-like ligand-binding oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230220.1 protein_id gnl|my_center|LOCUS_40260 4124223 4123756 gene locus_tag LOCUS_40270 4124223 4123756 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902933.1 protein_id gnl|my_center|LOCUS_40270 4124446 4124234 gene locus_tag LOCUS_40280 4124446 4124234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902934.1 protein_id gnl|my_center|LOCUS_40280 4124746 4125315 gene locus_tag LOCUS_40290 4124746 4125315 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535905.1 protein_id gnl|my_center|LOCUS_40290 4125740 4125324 gene locus_tag LOCUS_40300 4125740 4125324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 4126668 4125826 gene locus_tag LOCUS_40310 4126668 4125826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902935.1 protein_id gnl|my_center|LOCUS_40310 4126942 4127430 gene locus_tag LOCUS_40320 4126942 4127430 CDS product DUF5796 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902902.1 protein_id gnl|my_center|LOCUS_40320 4127430 4127672 gene locus_tag LOCUS_40330 4127430 4127672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 4128995 4128096 gene locus_tag LOCUS_40340 4128995 4128096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 4129182 4130006 gene locus_tag LOCUS_40350 4129182 4130006 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903393.1 protein_id gnl|my_center|LOCUS_40350 4130103 4131038 gene locus_tag LOCUS_40360 gene mptA 4130103 4131038 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903394.1 protein_id gnl|my_center|LOCUS_40360 4132301 4131069 gene locus_tag LOCUS_40370 4132301 4131069 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902940.1 protein_id gnl|my_center|LOCUS_40370 4132964 4132365 gene locus_tag LOCUS_40380 gene cyaB 4132964 4132365 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902939.1 protein_id gnl|my_center|LOCUS_40380 4133083 4134078 gene locus_tag LOCUS_40390 4133083 4134078 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902937.1 protein_id gnl|my_center|LOCUS_40390 4135163 4134336 gene locus_tag LOCUS_40400 4135163 4134336 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903313.1 protein_id gnl|my_center|LOCUS_40400 4135363 4135833 gene locus_tag LOCUS_40410 4135363 4135833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 4135814 4136242 gene locus_tag LOCUS_40420 4135814 4136242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 4136239 4137138 gene locus_tag LOCUS_40430 4136239 4137138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 4137132 4140218 gene locus_tag LOCUS_40440 4137132 4140218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 4140322 4140747 gene locus_tag LOCUS_40450 4140322 4140747 CDS product DUF5791 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289128.1 protein_id gnl|my_center|LOCUS_40450 4140749 4141627 gene locus_tag LOCUS_40460 4140749 4141627 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_40460 4141832 4143061 gene locus_tag LOCUS_40470 4141832 4143061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 4143123 4143272 gene locus_tag LOCUS_40480 4143123 4143272 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903526.1 protein_id gnl|my_center|LOCUS_40480 4144905 4143424 gene locus_tag LOCUS_40490 4144905 4143424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 4145623 4145003 gene locus_tag LOCUS_40500 4145623 4145003 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903529.1 protein_id gnl|my_center|LOCUS_40500 4145747 4147567 gene locus_tag LOCUS_40510 4145747 4147567 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289376.1 protein_id gnl|my_center|LOCUS_40510 4147648 4147998 gene locus_tag LOCUS_40520 4147648 4147998 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903478.1 protein_id gnl|my_center|LOCUS_40520 4148000 4148761 gene locus_tag LOCUS_40530 4148000 4148761 CDS product alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903477.1 protein_id gnl|my_center|LOCUS_40530 4148784 4149470 gene locus_tag LOCUS_40540 4148784 4149470 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289405.1 protein_id gnl|my_center|LOCUS_40540 4150141 4149812 gene locus_tag LOCUS_40550 4150141 4149812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 4151621 4150230 gene locus_tag LOCUS_40560 4151621 4150230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 4152544 4151747 gene locus_tag LOCUS_40570 4152544 4151747 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289134.1 protein_id gnl|my_center|LOCUS_40570 4153128 4152658 gene locus_tag LOCUS_40580 4153128 4152658 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921433.1 protein_id gnl|my_center|LOCUS_40580 4153265 4154701 gene locus_tag LOCUS_40590 gene mre11 4153265 4154701 CDS product DNA double-strand break repair protein Mre11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902340.1 protein_id gnl|my_center|LOCUS_40590 4154698 4157424 gene locus_tag LOCUS_40600 gene rad50 4154698 4157424 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902341.1 protein_id gnl|my_center|LOCUS_40600 4157950 4157516 gene locus_tag LOCUS_40610 4157950 4157516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289168.1 protein_id gnl|my_center|LOCUS_40610 4158429 4158016 gene locus_tag LOCUS_40620 4158429 4158016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 4158652 4158476 gene locus_tag LOCUS_40630 4158652 4158476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 4158848 4162930 gene locus_tag LOCUS_40640 4158848 4162930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 4163175 4164092 gene locus_tag LOCUS_40650 4163175 4164092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902347.1 protein_id gnl|my_center|LOCUS_40650 4164151 4165581 gene locus_tag LOCUS_40660 gene sufB 4164151 4165581 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902348.1 protein_id gnl|my_center|LOCUS_40660 4165581 4166795 gene locus_tag LOCUS_40670 gene sufD 4165581 4166795 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902349.1 protein_id gnl|my_center|LOCUS_40670 4167046 4168317 gene locus_tag LOCUS_40680 4167046 4168317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 4168314 4169294 gene locus_tag LOCUS_40690 4168314 4169294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 4169777 4169319 gene locus_tag LOCUS_40700 4169777 4169319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 4169895 4171151 gene locus_tag LOCUS_40710 4169895 4171151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 4171181 4171597 gene locus_tag LOCUS_40720 4171181 4171597 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903601.1 protein_id gnl|my_center|LOCUS_40720 4171870 4171631 gene locus_tag LOCUS_40730 4171870 4171631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 4172975 4171929 gene locus_tag LOCUS_40740 4172975 4171929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 4173203 4173130 gene locus_tag LOCUS_t00450 4173203 4173130 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4174006 4173449 gene locus_tag LOCUS_40750 4174006 4173449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 4174522 4174067 gene locus_tag LOCUS_40760 4174522 4174067 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902351.1 protein_id gnl|my_center|LOCUS_40760 4175004 4174519 gene locus_tag LOCUS_40770 4175004 4174519 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892592.1 protein_id gnl|my_center|LOCUS_40770 4176431 4175880 gene locus_tag LOCUS_40780 4176431 4175880 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722834.1 protein_id gnl|my_center|LOCUS_40780 4177107 4176511 gene locus_tag LOCUS_40790 4177107 4176511 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250156.1 protein_id gnl|my_center|LOCUS_40790 4177198 4177386 gene locus_tag LOCUS_40800 4177198 4177386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 4177417 4177728 gene locus_tag LOCUS_40810 4177417 4177728 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888922.1 protein_id gnl|my_center|LOCUS_40810 4178932 4177736 gene locus_tag LOCUS_40820 4178932 4177736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903445.1 protein_id gnl|my_center|LOCUS_40820 4179046 4179201 gene locus_tag LOCUS_40830 4179046 4179201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 4179756 4179394 gene locus_tag LOCUS_40840 4179756 4179394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 4180844 4179762 gene locus_tag LOCUS_40850 4180844 4179762 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902794.1 protein_id gnl|my_center|LOCUS_40850 4181485 4180844 gene locus_tag LOCUS_40860 4181485 4180844 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902795.1 protein_id gnl|my_center|LOCUS_40860 4182378 4181677 gene locus_tag LOCUS_40870 4182378 4181677 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421609.1 protein_id gnl|my_center|LOCUS_40870 4183088 4182600 gene locus_tag LOCUS_40880 4183088 4182600 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902796.1 protein_id gnl|my_center|LOCUS_40880 4183340 4183173 gene locus_tag LOCUS_40890 4183340 4183173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 4183275 4183496 gene locus_tag LOCUS_40900 4183275 4183496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 4183496 4184608 gene locus_tag LOCUS_40910 4183496 4184608 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902798.1 protein_id gnl|my_center|LOCUS_40910 4184747 4185910 gene locus_tag LOCUS_40920 4184747 4185910 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902162.1 protein_id gnl|my_center|LOCUS_40920 4186500 4185934 gene locus_tag LOCUS_40930 4186500 4185934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 4186649 4186497 gene locus_tag LOCUS_40940 4186649 4186497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 4186725 4187660 gene locus_tag LOCUS_40950 4186725 4187660 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361083.1 protein_id gnl|my_center|LOCUS_40950 4187822 4188019 gene locus_tag LOCUS_40960 4187822 4188019 CDS product DUF5786 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903530.1 protein_id gnl|my_center|LOCUS_40960 4188021 4188599 gene locus_tag LOCUS_40970 4188021 4188599 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903531.1 protein_id gnl|my_center|LOCUS_40970 4188683 4189270 gene locus_tag LOCUS_40980 4188683 4189270 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903532.1 protein_id gnl|my_center|LOCUS_40980 4189923 4189291 gene locus_tag LOCUS_40990 4189923 4189291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 4190285 4189995 gene locus_tag LOCUS_41000 4190285 4189995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000