COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..964988 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2565 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002213819.1:contact-dependent inhibition toxin CdiA locus_tag LOCUS_00010 CDS 2567..2986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 3164..3595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 3528..3761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 note possible pseudo, frameshifted CDS 4004..4291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(4300..4845) product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069602.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene kptA CDS 5366..5737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 5980..6771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 6779..7018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 7286..7816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 7851..8135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 8782..9198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 9276..9629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 tRNA complement(9706..9793) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 9966..10562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 10673..11410 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 11468..13138 product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 13160..13723 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169125.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 13740..14897 product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018672.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene rlmG CDS complement(14973..15542) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211218.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(15630..16835) product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816537.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene mdtH CDS 16977..17561 product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169134.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene rimJ CDS 17573..18250 product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097145.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 18426..19961 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816533.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene murJ CDS 20104..20328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(20359..22101) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816530.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene argS CDS complement(22358..22909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 23710..23940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(23951..24160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 24478..24726 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512153.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(24802..25404) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218168.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene pth CDS 25759..26031 product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367115.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene ychH CDS complement(26177..27124) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211240.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene prs CDS complement(27272..28111) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211239.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene ispE CDS complement(28111..28740) product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224468.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene lolB CDS 28966..30228 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169107.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene hemA CDS 30261..31346 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161322.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene prfA CDS 31356..32198 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705084.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene prmC CDS 32244..32636 product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211234.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 32633..33448 product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816540.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene sirB1 CDS 33520..34374 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161312.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene kdsA CDS 34654..35034 product DUF1090 family protein YqjC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298323.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene yqjC CDS complement(35095..36795) product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816539.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene dauA CDS complement(37328..37822) product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420230.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene eco CDS 38295..39878 product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 40572..41795 product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112811.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 41875..42897 product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112809.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene rtcA CDS complement(42980..43786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 44040..45101 product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055032204.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 45211..45693 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766220.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(45898..47550) product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175115.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(47853..48179) product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173625.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(48533..49003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(49230..50495) product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815914.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene agp CDS 52076..54913 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 55614..58445 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001358436.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 58579..61800 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001358436.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 62394..65252 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 65895..68723 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 69322..72189 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001358436.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 72492..75335 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001358436.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(75385..77421) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169471.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(77434..78288) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816375.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(78293..78529) product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816374.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 79357..79635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 80067..80618 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326725.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(80725..81879) product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 81991..82755 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169161.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene cutC CDS complement(83076..84305) product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817270.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(84468..85301) product YaeF family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209908.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(85327..86298) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211208.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene cmoB CDS complement(86295..87038) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661448.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene cmoA CDS complement(87168..87563) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165969.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 88251..90023 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169176.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene aspS CDS 90023..90466 product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211203.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene nudB CDS 90496..91239 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165984.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 91239..91763 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211201.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene ruvC CDS complement(91737..91916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 91931..92542 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816524.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene ruvA CDS 92559..93569 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211198.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene ruvB CDS complement(93672..93935) product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004873700.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 94184..94906 product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189141.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene nfsA CDS complement(94909..95097) product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046693.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 95213..95713 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208763.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 95772..96908 product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816017.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene rlmC CDS complement(96902..97414) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828387.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(97521..98252) product ABC transporter substrate-binding protein ArtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097364.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene artJ CDS complement(98458..99789) product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097432.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene rimO CDS complement(99974..102688) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816318.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(103312..104073) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 104348..105379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 105384..106010 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198722.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene dgoA CDS 106068..107507 product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704304.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 107584..107973 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 108022..109464 product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704305.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 109562..110818 product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704303.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(110991..111560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(111844..113532) product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208766.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(113751..114536) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816522.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene znuB CDS complement(114533..115291) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169189.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene znuC CDS 115375..116331 product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816521.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene znuA CDS 116352..117644 product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228437.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene mepM CDS 117774..118751 product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816519.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene lpxM CDS complement(118809..120251) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365996.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene pyk CDS complement(120490..121329) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169198.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 121698..123173 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene zwf CDS 123259..123954 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene pgl CDS 124061..124702 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800512.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene kdgA CDS 125214..125603 product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163026.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene mdtJ CDS 125590..125922 product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163022.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene mdtI CDS complement(126028..126372) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169202.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 126636..128555 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849399.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 128645..129346 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816515.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene tsaB CDS 129544..131226 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169210.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene fadD CDS 131313..132449 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162182289.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene rnd CDS complement(132585..133199) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210501.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(133426..133833) product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731552.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 134015..134677 product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369657.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene qseB CDS 134674..136026 product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779337.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene qseC CDS 136110..136772 product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098725.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene qseB CDS 136769..138118 product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673359.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene qseC CDS complement(138165..139802) product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169462.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene eptA CDS complement(139995..140822) product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815345.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 141231..141887 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(141941..142501) product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene mntP CDS complement(142847..143998) product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097970.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene setB CDS complement(144205..144489) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171826.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene ilvN CDS complement(144492..146186) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298157.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene ilvB CDS complement(146657..147778) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651665.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 148102..149520 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462118.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 149510..149854 product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532978.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 149880..150923 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(151131..152063) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948563.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 152186..152611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948562.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 152887..153726 product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287872.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 153726..154565 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene panB CDS 154584..155435 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287875.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene panC CDS 155445..155837 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966199.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 156197..157915 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095797.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 158083..158358 product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705585.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 158379..159497 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366371.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 159557..160405 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097959.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene fghA CDS complement(160496..161401) product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987753.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene eamA CDS 161625..163085 product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169715.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 163616..166480 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001334788.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 167103..169925 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001334788.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 170551..173373 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001334788.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 173530..174063 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079074.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 174113..174517 product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 175057..175548 product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815947.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 175833..176450 product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078533.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(176554..178803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 179907..180794 product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295328.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene tsx CDS complement(180895..181992) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096922.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(182047..182646) product DNA-binding transcriptional regulator NemR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032947.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene nemR CDS 182905..183318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 183359..183607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 note possible pseudo, frameshifted CDS 183795..186134 product Orn/Lys/Arg decarboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229207.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(186192..188375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 188800..189621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 189635..190888 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 190944..191912 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965886.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(191989..192951) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094852.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(192979..193755) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094851.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 193906..194115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 194491..195420 product omptin family outer membrane protease OmpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201840.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene ompT CDS complement(195513..197591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 197539..197697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 198651..199112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(199237..199965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(200384..201598) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537085.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(201797..202987) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706746.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(202984..204909) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706745.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(205377..208022) product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(208024..208767) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267299.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(208749..209219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 note possible pseudo, internal stop codon CDS complement(209515..210057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(210070..210618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(210596..211309) product long polar fimbrial biogenesis chaperone LpfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822643.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene lpfB CDS complement(211364..211894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(212096..212383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(212482..212865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 213625..214434 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094866.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 214424..214891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(215024..215425) product DUF3224 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071754.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 215630..216262 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267941.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 216401..217387 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(217465..217893) product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007372636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene arsC CDS complement(217954..219243) product arsenite efflux transporter membrane subunit ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540054.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene arsB CDS complement(219296..221044) product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095196.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene arsA CDS complement(221063..221425) product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817072.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene arsD CDS complement(221487..221840) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817071.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(221809..221940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(222162..223019) product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920700.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(223116..223256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 223499..223804 product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182971.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene yqfB CDS 224791..225351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 225412..226131 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001330060.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 226106..226669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 226688..227422 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078009.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 227446..228180 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195169.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 228202..230835 product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 230832..231962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 232736..235558 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816318.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(235616..235882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 236217..236540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 237377..239806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 240431..240613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 240620..240883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 240894..241373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(241465..241791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(241963..242820) product Vmh family MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705499.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 243107..243691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 243994..245382 product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366191.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 245553..245891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 246336..247052 product osmoprotectant ABC transporter permease OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096821.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene osmY CDS 247140..248015 product osmoprotectant ABC transporter substrate-binding protein OsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211196.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene osmX CDS 248026..248673 product osmoprotectant ABC transporter permease OsmW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379676.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene osmW CDS 248673..249809 product osmoprotectant ABC transporter ATP-binding protein OsmV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096823.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene osmV CDS complement(249897..250643) product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185593.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene ydfG CDS complement(250757..251455) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919213.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene bioD CDS complement(251698..252915) product ROK family transcriptional regulator Mlc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169799.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene mlc CDS 253211..254515 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091806.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(254577..255971) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169824.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene fumC CDS 256246..257772 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816295.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 258081..260087 product formate-dependent uric acid utilization protein AegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981380.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene aegA CDS complement(260158..260763) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169439.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 261013..262386 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816381.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 tRNA 262560..262636 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA 262664..262740 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 263065..264477 product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210936.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene pykF CDS 264799..265056 product major outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002908860.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(265476..266399) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211803.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 266754..267257 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210984.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene tpx CDS complement(267318..268907) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210983.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene tyrR CDS 269202..270470 product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704479.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(270537..271595) product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210980.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(271592..272989) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169547.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(273342..273686) product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050078551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene pspC CDS complement(273683..273919) product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161022.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene pspB CDS complement(274009..274680) product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169534.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene pspA CDS 274876..275886 product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816362.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene pspF CDS 276067..277719 product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816365.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene sapA CDS 277716..278681 product peptide ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583298.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene sapB CDS 278668..279558 product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210971.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene sapC CDS 279558..280553 product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210970.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene sapD CDS 280553..281365 product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169510.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene sapF CDS 281557..282345 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene fabI CDS complement(282413..282697) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160560.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene ppnP CDS 282945..284888 product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485019.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 285023..285274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(285552..285761) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159934.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 286226..286735 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210404.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(286744..286926) product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457334.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 287231..287671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 287958..289325 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419892.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene sdaA CDS complement(289266..289445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 289542..290789 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210192.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(290838..291671) product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170523.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene rlmA CDS complement(291845..292051) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211317.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(292253..292462) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159934.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(292754..293530) product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816068.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 294424..296127 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661416.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 296240..296821 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210595.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene rsxA CDS 296821..297399 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210596.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene rsxB CDS 297392..299548 product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816279.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene rsxC CDS 299612..300598 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210599.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene rsxD CDS 300608..301234 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210600.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene rsxG CDS 301235..301954 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210601.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 301951..302586 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705230.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene nth CDS 302692..303297 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816371.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene gstA CDS complement(303448..303762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(304158..305018) product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210961.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene pdxY CDS complement(305150..306421) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816372.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene tyrS CDS complement(306537..307187) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210959.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene pdxH CDS complement(307285..307599) product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816373.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(307667..308773) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165918.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene anmK CDS complement(308968..309411) product virulence master transcriptional regulator RovA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210955.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene rovA CDS complement(309763..310290) product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266857.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(310457..310696) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 310918..311325 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165939.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene gloA CDS 311480..312133 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227904.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene rnt CDS complement(312187..312519) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 312932..313510 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169447.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene sodB CDS complement(313580..314491) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene nagK CDS complement(314601..315572) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366218.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(315654..318011) product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705740.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(318029..319393) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705741.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(319638..320774) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437792.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(321106..322218) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638288.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(322202..322915) product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097134.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(323216..323992) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213084.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(324021..324998) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170707.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene holB CDS complement(324995..325633) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170710.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene tmk CDS complement(325636..326655) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217396.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene mltG CDS complement(326783..328024) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213079.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene fabF CDS complement(328106..328339) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300909.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene acpP CDS complement(328492..329226) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007236.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene fabG CDS complement(329260..330189) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210934.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene fabD CDS complement(330211..331164) product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288151.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene fabH CDS complement(331171..332199) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210932.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene plsX CDS complement(332214..332384) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544470.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene rpmF CDS complement(332401..332922) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004709643.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene yceD CDS 333167..333937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 333970..334557 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170743.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(334631..335596) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157930.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene rluC CDS 336192..339476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(339546..339836) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193694.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(339880..341265) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816168.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene dbpA CDS 341671..343233 product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816407.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 343233..343811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 344119..345135 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079502.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene trpD CDS 345136..346500 product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050075568.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene trpCF CDS 346533..347723 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076940213.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene trpB CDS 347723..348532 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169334.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene trpA CDS complement(348766..349341) product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036065.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(349477..350763) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208684.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene phoR CDS complement(350787..351476) product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208685.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene phoB CDS 351671..352924 product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208687.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene sbcD CDS 352921..356601 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816917.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 356721..357632 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208691.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene rdgC CDS 357818..358615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 358612..359094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 359296..360513 product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815802.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 360510..363644 product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815801.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 363646..366741 product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815800.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene mdtC CDS 366796..368217 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209795.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 368239..369642 product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162191.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene baeS CDS 369639..370352 product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815798.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene baeR CDS 370408..371244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 371404..372768 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209798.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene yegQ CDS complement(373058..373402) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392606.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(373657..374100) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705368.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(374209..374832) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705369.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(374836..376083) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705370.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 376404..377306 product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815796.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene yegS CDS complement(377309..378238) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162185063.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 378404..380200 product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706084.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 380300..381601 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365755.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(381658..382374) product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162963.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene fadR CDS 382679..383206 product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227934.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene dsbB CDS 383758..384495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(384796..385242) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162992.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(385346..386002) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162993.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(386159..387169) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223847752.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(387263..387544) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162995.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 387692..388375 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220631.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene minC CDS 388399..389211 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163000.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene minD CDS 389218..389490 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211180.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene minE CDS complement(389737..390126) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947724.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 390709..391323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(391368..391685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(391814..392269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(392412..393647) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190513.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(393889..394665) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(395188..397584) product DUF3772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(397705..399660) product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313806.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene rlhA CDS complement(400077..400361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(400557..402257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(402258..404417) product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(404443..405696) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 406727..410374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 410487..412580 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739071.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 412594..413835 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096690.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 413836..415467 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096692.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 415448..415657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 416305..416910 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 417859..418752 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706785.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 418846..419109 product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210964.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(419175..419492) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227951.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(419497..419994) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132911.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(419984..420703) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117262.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(420707..421843) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172653834.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(421833..423113) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212051.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(423116..424489) product Fe-S-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168965.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(424663..425190) product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132914.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(425251..427203) product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168961.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(427448..427738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 428110..428319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 428355..429104 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004862555.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene fnr CDS 429225..430169 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096866.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene uspE CDS complement(430249..431655) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169667.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene pntB CDS complement(431665..433197) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211019.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene pntA CDS 433555..434511 product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211018.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene ydgH CDS 434835..436229 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412379.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(436258..436902) product Qnr family pentapeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(436968..440855) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072088404.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene hrpA CDS 441073..441678 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816349.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene azoR CDS complement(442249..442572) product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169623.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(442582..442770) product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366326.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(442767..445391) product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816351.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 445549..446535 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210998.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 446718..447149 product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214605.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene hslJ CDS complement(447334..447582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(447917..450868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 452130..455669 product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816353.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene nifJ CDS complement(455859..456134) product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228052.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 456674..457597 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081419.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene ttcA CDS complement(457647..458630) product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169583.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene zntB CDS complement(458690..459112) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169420.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(459147..462200) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211811.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 462524..463624 product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169418.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene ydiK CDS complement(463704..466094) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211813.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene ppsA CDS 466388..467209 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211814.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 467582..468628 product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419178.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene aroH CDS complement(468711..469727) product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105844.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene lplA CDS complement(469942..470307) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(470416..471105) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971211.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(471135..471599) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216102.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 471919..472974 product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene ltaE CDS complement(473132..474262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(474373..475506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(475751..476878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(477072..478199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(478200..480998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(481011..481886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(481890..485006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(485048..485461) product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211943.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene tssE CDS complement(485473..486015) product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484008.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene tssJ CDS complement(486028..487068) product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373315.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene tssG CDS complement(487032..488798) product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342476.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene tssF CDS complement(489050..490639) product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211937.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene tssA CDS complement(490620..494228) product type VI secretion system membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(494225..495424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211935.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(495433..495699) product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532395.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(495854..496687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(496766..497581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(497659..498474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(498553..499374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(499453..500271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(500350..501198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(501211..504213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(504230..505237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(505268..508369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(508374..511157) product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210013.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene tssH CDS complement(511322..511810) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(511821..513536) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214568.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(513790..514437) product type VI secretion system protein TssL, short form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710992.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene tssL CDS complement(514434..515786) product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211664.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene tssK CDS complement(515808..517343) product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214707.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene tssC CDS complement(517383..517895) product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211662.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene tssB CDS complement(518508..519275) product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050983.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene btuD CDS complement(519259..520260) product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816398.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene btuC CDS complement(520354..520650) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211830.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene ihfA CDS complement(520655..523042) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672322.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene pheT CDS complement(523059..524042) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161570.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene pheS CDS complement(524420..524776) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211833.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene rplT CDS complement(524813..525010) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211834.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene rpmI CDS complement(525107..525550) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023616141.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene infC CDS complement(525653..527581) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816225.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene thrS CDS complement(527844..528632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(528706..529578) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816220.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(529783..530328) product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170142.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 530893..531909 product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165644.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene purR CDS 532169..532654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(532735..533607) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170215.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene htpX CDS complement(533838..535877) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170217.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene prc CDS complement(535897..536595) product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170218.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene proQ CDS complement(536724..537188) product L-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299249.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene msrC CDS complement(537268..537594) product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096377.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene yciH CDS complement(537600..538295) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210613.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene pyrF CDS complement(538363..539532) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210615.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene lapB CDS complement(539539..539868) product lipopolysaccharide assembly protein LapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876286.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene lapA CDS complement(540041..540799) product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816261.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene pgpB CDS 541054..541644 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169929.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene ribA CDS complement(541710..542684) product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705738.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene cysB CDS complement(542933..545515) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816400.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene topA CDS 545896..546147 product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165861.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(546564..547610) product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816401.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene sohB CDS 547791..548552 product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210625.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(548619..549890) product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694556.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(549913..551217) product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162366.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene dcuC CDS complement(551863..553794) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174285.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(554069..554809) product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174290.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(554813..555925) product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174293.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(555909..557048) product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262860.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(557084..557731) product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174295.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(557831..558628) product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392358.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(558662..558958) product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174302.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(558958..559323) product glycine-rich SFCGS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817273.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(559344..559682) product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174305.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(560120..561004) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072081652.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene rluB CDS complement(561110..561730) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210628.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(561834..562769) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098057497.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 563092..564213 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816845.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(564337..565350) product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094995.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene dppF CDS complement(565347..566327) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174903.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene dppD CDS complement(566339..567229) product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084666.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene dppC CDS complement(567240..568259) product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228714.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene dppB CDS complement(568456..570048) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817398.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(570473..571714) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816138.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene pepT CDS 572109..573224 product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531604.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene potA CDS 573208..574083 product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799401.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene potB CDS 574080..574856 product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580313.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene potC CDS 574927..575967 product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705058.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene potD CDS 576296..577537 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694560.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(577700..577927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(578275..578520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(578874..579317) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263862.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(579555..582584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(583009..583251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(583302..584153) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816137.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene cobB CDS complement(584183..585094) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170645.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene nagK CDS complement(585142..586395) product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705054.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene lolE CDS complement(586395..587099) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158007.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene lolD CDS complement(587092..588294) product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170663.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene lolC CDS 588739..592188 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816135.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene mfd CDS complement(592353..593657) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213097.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(594095..594634) product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170673.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene ycfP CDS complement(594724..595761) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816133.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene nagZ CDS complement(595901..596458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(596739..597320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(597374..597724) product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097111.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene hinT CDS complement(598160..600697) product autotransporter adhesin YapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817383.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene yapE CDS 601879..602109 product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095964.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 602454..603401 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014308.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 603398..604810 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(604927..605355) product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295855.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene uspG CDS complement(606118..606318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(607024..607830) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(608052..609305) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170624.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene icd CDS 609437..610057 product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218214.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene rluE CDS 610050..610520 product phosphatase NudJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476089.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene nudJ CDS 610618..611721 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170633.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene mnmA CDS 611725..612348 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210914.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene hflD CDS 612376..613746 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210915.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene purB CDS complement(614061..615449) product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418812.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene dcuC CDS complement(615446..616699) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261693.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene pepT CDS 617127..617786 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210414.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(617924..618136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 618284..618508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(618638..619135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(619132..619983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 620553..621080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 621163..623457 product TcfC E-set like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815360.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 623486..624172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211517.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 624163..624636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 624633..625196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 625193..625867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211517.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 626052..627038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 tRNA complement(627253..627339) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(627352..627425) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(627460..627535) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(627704..628252) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170287.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene pgsA CDS complement(628315..630147) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220477.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene uvrC CDS complement(630140..630736) product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211176.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene uvrY CDS 631679..631987 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704428.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(632034..632696) product phage N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022296583.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(634150..634467) product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160102.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene hspQ CDS complement(634587..634916) product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213046.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene tusE tRNA 635132..635219 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(635340..635747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(635913..636539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(636711..637094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 637352..638593 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816750.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene moeA CDS 638596..639354 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211948.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene moeB CDS complement(639416..639976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(640298..642682) product autotransporter YapL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208523.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene yapL CDS 643445..644383 product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168116.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene dusC CDS complement(644510..646876) product autotransporter YapL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208523.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene yapL CDS 647840..648826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(648843..649508) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 649823..650752 product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816789.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene pbpG CDS 650966..651892 product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816789.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene pbpG CDS 652034..652978 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 653157..653750 product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210965.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 653913..654143 product 4Fe-4S mono-cluster protein YjdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098586.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene yjdI CDS 654145..654423 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369862.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(654448..655206) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096615.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(655221..656204) product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448742.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(656197..657456) product D-threonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783298.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(657458..658447) product 2-keto-3-deoxygluconate permease 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022089.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 659236..661422 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174776.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene glgB CDS 661422..663449 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174773.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene glgX CDS 663515..664792 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817364.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene glgC CDS 664919..666352 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817363.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene glgA CDS 666535..668982 product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817362.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene glgP CDS 669060..671183 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208925.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene malQ CDS 671225..671701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 671896..672774 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816010.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(673177..674667) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211164.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene putP CDS 675286..679260 product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211162.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene putA CDS complement(679369..680109) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558842.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 680379..681977 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961457.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(682136..683539) product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene rhlE CDS 684097..685488 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086774.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(685629..686330) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158923.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(686498..687073) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038751.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(687282..687743) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051315.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene moaE CDS complement(687745..687990) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210773.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene moaD CDS complement(687990..688469) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367605.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene moaC CDS complement(688484..688999) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482393.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene moaB CDS complement(689050..690033) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168084.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene moaA CDS 690433..691344 product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210769.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene yvcK CDS complement(691403..691870) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996417.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 repeat_region 692114..692441 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagccgcctatacggcggttcag CDS complement(692629..693243) product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene cas6f CDS complement(693247..694242) product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene csy3 CDS complement(694281..695252) product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120898.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene csy2 CDS complement(695249..696550) product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene csy1 CDS complement(696882..700037) product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene cas3f CDS complement(700111..700383) product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445805.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 700626..701597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(701655..703607) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816794.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene uvrB CDS 704572..705390 product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210759.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(705436..706503) product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158969.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene modC CDS complement(706503..707192) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158971.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene modB CDS complement(707189..707965) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210756.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene modA CDS complement(708168..708332) product AcrZ family multidrug efflux pump-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097516.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 708525..709310 product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210754.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene modE CDS complement(709358..710266) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438886.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(710355..711125) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292544.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene deoC CDS complement(711146..711304) product DUF1427 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658727.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(711412..712668) product xanthosine/proton symporter XapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020390.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene xapB CDS complement(712767..713600) product xanthosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119752.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene xapA CDS 713815..715041 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209216.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene deoB CDS complement(715094..715318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 715808..716572 product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716367.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 716790..718259 product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096900.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene modF CDS 718305..718874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 719061..719543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 719736..720767 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168055.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene galE CDS 720748..721818 product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187468.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene galT CDS 722115..722867 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301554.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene gpmA CDS complement(722944..723996) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109185.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene aroG CDS 724459..724851 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 tRNA complement(725688..725763) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(725856..725931) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(726103..726852) product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165506.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene cpoB CDS complement(726862..727371) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295306.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene pal CDS complement(727419..728711) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165502.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene tolB CDS complement(728852..729817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(729985..730419) product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393306.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene tolR CDS complement(730434..731108) product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097532.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene tolQ CDS complement(731114..731518) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165498.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene ybgC CDS complement(731662..731955) product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011191945.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene ybgE CDS complement(732080..733219) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168027.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene cydB CDS complement(733234..734805) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210730.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene cydA tRNA complement(734044..734136) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(735865..736944) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115608061.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(737177..738088) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367669.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene sucD CDS complement(738088..739260) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210728.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene sucC CDS complement(739482..740702) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816812.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene odhB CDS complement(740716..743523) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210726.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene sucA CDS 744159..745454 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210721.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(745539..746300) product thiosulfate reductase cytochrome B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092553.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(746293..746865) product thiosulfate reductase electron transport protein PhsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016236.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene phsB CDS complement(746879..749158) product thiosulfate reductase PhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028230.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene phsA CDS complement(749396..750187) product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114002.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene nei CDS complement(750246..751004) product type 2 GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354507.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(751181..752245) product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816658.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene fbpC CDS complement(752262..754340) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168575.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(754408..755439) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168576.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(755501..756823) product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816657.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene uhpC CDS complement(756920..758470) product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168581.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(758474..759103) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168584.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(759214..760647) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209655.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene phrB CDS complement(760672..761622) product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418304.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(761828..762028) product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209653.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(762158..762517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(762514..762726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 762949..763377 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167964.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(763516..765159) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167960.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene pgm CDS complement(765203..765721) product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816824.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene seqA CDS 765818..766567 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215390.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene ybfF CDS 766725..767030 product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163374.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene ybfE CDS 767154..767669 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215386.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene fldA CDS 768264..768857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 note possible pseudo, frameshifted CDS 768833..770323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 note possible pseudo, frameshifted CDS 770423..770617 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399964.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 771229..771678 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428651.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene fur CDS complement(771740..772156) product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207714.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(772241..773908) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816826.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene glnS CDS complement(774159..776102) product PTS N-acetyl glucosamine transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023104.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene nagE CDS 776483..777283 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237072.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene nagB CDS 777305..778444 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816828.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene nagA CDS 778483..779706 product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051352.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 779989..781656 product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337077.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene asnB tRNA 781893..781969 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 781973..782057 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 782083..782157 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 782203..782277 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 782507..782583 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 782587..782671 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 782697..782771 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(782858..784048) product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816831.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene ubiF CDS 784207..785631 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162748.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene miaB CDS complement(785727..786029) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918758.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(786016..786273) product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305156.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 786604..787659 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210345.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 787672..788145 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084477.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene ybeY CDS 788164..789042 product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158416.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene corC CDS 789050..790585 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210341.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene lnt CDS 791065..791961 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167919.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 792060..792800 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097579.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 792800..793483 product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167916.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene gltK CDS 793483..794208 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167914.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 794368..795015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078137.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 795203..797785 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816835.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene leuS CDS 797800..798360 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210332.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene lptE CDS 798357..799379 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210331.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene holA CDS 799381..800043 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816837.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene nadD CDS 800195..800512 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894623.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene rsfS CDS 800516..800986 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene rlmH CDS 801011..802912 product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167891.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene mrdA CDS 802933..804042 product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816839.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene mrdB CDS 804054..805223 product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167887.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene rlpA CDS 805354..806580 product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210323.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene dacA CDS 806706..806969 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210322.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene ybeD CDS 807243..807662 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550737.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 807817..808488 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218201.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene lipB CDS 808499..809446 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004712243.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene lipA CDS complement(809528..809725) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167881.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene tatA CDS complement(810266..811591) product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209766.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(811653..813413) product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215255.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(813410..814048) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209768.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(814067..814987) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209769.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(815003..815632) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209770.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 815864..816505 product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702296.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 816705..817856 product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528894.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 817853..818467 product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602086.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene prfH CDS complement(818614..818928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(819169..819819) product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209973.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene endA CDS complement(820633..820866) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097162.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(821100..821483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(821652..821966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(822089..822733) product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457202.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene leuE CDS 823128..823517 product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170441.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene yobA CDS 823521..824402 product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211094.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene copD CDS 824555..827305 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112791.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 827302..827856 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094903.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 827853..829100 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112792.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(829210..829866) product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817194.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene alkB CDS complement(829902..830162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(830550..830750) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419545.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(830925..831137) product cold shock protein CspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163087.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene cspG CDS 832111..832329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(832596..832784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(833402..833818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 834141..834578 product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082296.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene uspF CDS 835003..835236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004132711.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 835500..835814 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370060.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(836018..836728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 836988..837383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(837478..838335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(839605..840390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(840737..841033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 note possible pseudo, frameshifted tRNA complement(841301..841377) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 841733..842593 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816853.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene folD CDS complement(842662..844053) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222677.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene cysS CDS complement(844233..844676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 845280..845780 product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367878.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene ppiB CDS 845791..846525 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208568.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 846755..847264 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208569.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene purE CDS 847261..848328 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208570.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene purK CDS complement(848406..850841) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208571.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(850838..851524) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208572.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 851558..852145 product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167777.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene tesA CDS 852172..852948 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208574.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 853027..853881 product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295322.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene cnoX CDS complement(854045..855304) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693428.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 855748..856305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 856404..857318 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158246.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 857318..857785 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970312.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(857836..858252) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816860.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene cueR CDS complement(858359..858760) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882762.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(858788..859171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 859349..860338 product sulfate/thiosulfate ABC transporter substrate-binding protein Sbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045704.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene sbp CDS complement(860424..861071) product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816813.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene pcp CDS complement(861088..862098) product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209661.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(862098..862826) product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209660.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(862919..863656) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816815.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene pxpA CDS complement(863646..864575) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209658.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(864569..865240) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168006.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene pxpB CDS complement(865689..866462) product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210232.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene tam CDS 866842..867294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 867971..871366 product autotransporter adhesin YapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817383.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene yapE CDS complement(871422..872018) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209388.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene cysC CDS complement(872025..873482) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172666017.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene cysN CDS complement(873493..874401) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372392.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene cysD CDS complement(874434..875864) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815607.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene cysG CDS complement(876239..876547) product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817079.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(876550..876879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(876987..877721) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(877731..879440) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815605.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene cysI CDS complement(879440..881248) product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815604.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene cysJ CDS 881617..884553 product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816861.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene copA CDS 884786..885622 product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816862.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 885649..886134 product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704619.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene ybaK CDS 886422..887642 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208584.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 887864..889558 product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158223.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene ybaL CDS complement(889637..890596) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208599.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene hemH CDS complement(891041..891685) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208600.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene adk CDS complement(891944..893827) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354670.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene htpG CDS complement(894245..894850) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195026.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene recR CDS complement(894850..895179) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(895252..897240) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208605.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene dnaX CDS complement(897317..897868) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208606.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene apt CDS complement(898021..898362) product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704615.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 898602..899138 product primosomal replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208610.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 899477..899638 product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456217.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene rsmS CDS complement(899640..900185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(900221..900574) product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169669.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene ychN CDS complement(900577..901305) product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167699.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene acrR CDS 901427..902593 product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386618.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene acrA CDS 902613..905762 product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167694.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene acrB CDS 905883..906839 product iron exporter MbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090619.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene mbfA CDS complement(907252..907434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 907629..908876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 909156..909965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 910003..910458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 910877..911218 product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409908.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(911237..911662) product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461146.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 911918..912784 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208625.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene tesB CDS 913286..914587 product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171308.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(914655..915941) product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167660.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene amtB CDS complement(915980..916318) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208627.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene glnK CDS complement(916790..916996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(917031..917243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(917820..919601) product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256185.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(919594..921333) product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816892.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(921465..921926) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095868.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 922071..923111 product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167652.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(923278..924192) product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213809.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene rhtA CDS complement(924377..925591) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815909.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene fabB CDS 925765..927789 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815908.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene mnmC CDS complement(927918..928148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(928344..928628) product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171926.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(928675..929235) product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365544.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(929282..930082) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815907.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(930086..930919) product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171929.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene mepA CDS complement(930934..932019) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171931.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene aroC CDS complement(932085..933017) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171935.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene prmB CDS 933209..933751 product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227846.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene smrB CDS 934405..934629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 934626..934955 product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(935003..935482) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209707.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene sixA CDS complement(935565..935858) product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171954.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 936273..937568 product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209702.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene fadL CDS complement(937670..938425) product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815902.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene mlaA CDS complement(938462..939667) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815901.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene ccmI CDS complement(939664..940158) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703210.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(940158..940712) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171969.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(940709..942670) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209698.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(942667..943167) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158631.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene ccmE CDS complement(943164..943379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(943379..944113) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815898.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(944161..944820) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209694.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene ccmB CDS complement(944820..945482) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209693.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene ccmA tRNA 945731..945805 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(945908..946186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(946617..947474) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704262.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(947966..950035) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529845.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(950076..954131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(954190..958248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(958288..959580) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938317.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(959580..960161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(960179..961402) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090505.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 961452..961634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(961752..963332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 tRNA complement(964706..964782) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 sequence02 source 1..556723 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 137..213 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 1343..3379 product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094848.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 3409..4638 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094850.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 4846..5640 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230983.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(5664..7184) product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018127.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene mltD CDS complement(7255..8010) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173058.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene gloB CDS 8055..8774 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173047.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(8788..9255) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210699.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene rnhA CDS 9303..10067 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210700.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene dnaQ tRNA 10183..10259 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(10398..11096) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220696.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 11245..11598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 11920..12477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 12491..13996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 14064..14495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 14495..14884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 15045..16898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 16902..17675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 17695..18021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 18008..18829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 18822..19532 product Gp138 family membrane-puncturing spike protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001685627.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 19522..19869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270632.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 19903..21048 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197093.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 21045..21698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 21695..22951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 22951..23541 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057643.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 23626..25383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 25383..25736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 25827..27299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 27437..28954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 29100..29708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 29817..30395 product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095727.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene lpcA CDS 30450..31217 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208719.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(31227..31964) product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225658.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene dpaA CDS 32681..33604 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227821.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 33683..34738 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167525.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene dinB CDS complement(34901..36361) product beta-Ala-His dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167527.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene pepD CDS complement(36517..36696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 36659..37159 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268545.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 37311..37769 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002889733.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene gpt CDS complement(37842..38831) product spore coat protein U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210858.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(38838..41216) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816198.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(41396..42175) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210856.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(42202..42768) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170228.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(42779..43306) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170225.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(43345..43869) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046695056.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 44483..45730 product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816927.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene frsA CDS 45791..46189 product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174689.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene crl CDS 46306..47409 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167536.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene proB CDS 47421..48674 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011191846.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene proA CDS 48754..49869 product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756910.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(49929..50219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 50515..51366 product bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071196.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(51410..51733) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816304.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(51791..52303) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263075.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(52300..53733) product Ada metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091823.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 54311..55636 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167571.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene brnQ CDS 55719..57092 product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167572.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene proY CDS complement(57523..58125) product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004707520.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(58357..58875) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216927.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 59118..60191 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208673.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene queA CDS 60243..61367 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208672.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene tgt CDS 61400..61732 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166605.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene yajC CDS 61807..63624 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208670.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene secD CDS 63635..64603 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167586.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene secF CDS 64707..66149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 66535..67809 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 67812..69047 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732668.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 69088..69594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 69594..70298 product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426729.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 70314..71048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426728.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(71410..72126) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030919.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene bioD CDS complement(72119..72886) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072084097.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene bioC CDS complement(72858..74021) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168073.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene bioF CDS complement(74026..75063) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816797.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene bioB CDS 75151..76440 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816798.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene bioA CDS 76765..77214 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208668.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene nrdR CDS 77220..78329 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167588.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene ribD CDS 78441..78911 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208666.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene ribE CDS 78968..79390 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208665.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene nusB CDS 79477..80445 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816909.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene thiL CDS complement(80584..82449) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367989.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene dxs CDS complement(82488..83390) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816905.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene ispA CDS complement(83390..83641) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124944.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene xseB CDS 84008..85453 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816391.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 85593..87041 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668685.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene thiI CDS complement(87138..87725) product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208657.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene yajL CDS 87964..88263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 88473..88964 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167608.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(89058..90536) product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167629.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene ampG CDS complement(90582..91181) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208646.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 91528..91839 product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456570.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene bolA CDS 92170..93474 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208643.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene tig CDS 93577..94212 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122257.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene clpP CDS 94360..95631 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130305.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene clpX CDS 95856..98222 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene lon CDS 98411..98683 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043542.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene hupB CDS 98873..100753 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167642.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene ppiD CDS 100924..101274 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047081000.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(101391..102080) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817227.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene queC CDS 102372..103499 product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815922.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene pdxB CDS 103602..104612 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815923.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 104612..105427 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283586.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene truA CDS 105440..106105 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098139.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 106293..107201 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815925.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene accD CDS 107301..108581 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815926.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene folC CDS 108574..109287 product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209731.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene dedD CDS 109407..109913 product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158480.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene cvpA CDS 109965..111482 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene purF CDS 111617..112189 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706171.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(112246..112386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(112690..113592) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815929.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 113997..114542 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158446.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene yfcE CDS 114557..115105 product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815932.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene yfcD CDS complement(115191..117338) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082007.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene pta CDS complement(117410..118612) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095707.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene ackA CDS 119004..119456 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171754.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene yfbV CDS 119880..120386 product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159196.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 120434..121114 product sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210285.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 121432..123300 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082012.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 123389..125146 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389044.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 125149..125640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389045.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 125653..126342 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389046.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 126339..127511 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389047.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(127560..128165) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171739.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene yfbR CDS complement(128312..129808) product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365583.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene alaA CDS complement(130298..131671) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479733.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene brnQ CDS 132701..133123 product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062997.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene nuoA CDS 133138..133812 product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913178.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene nuoB CDS 133882..135678 product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815938.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene nuoC CDS 135681..136166 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144413951.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene nuoE CDS 136163..137530 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815940.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene nuoF CDS 137608..140355 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815941.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene nuoG CDS 140352..141329 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159221.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene nuoH CDS 141345..141887 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815942.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene nuoI CDS 141899..142429 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159228.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene nuoJ CDS 142426..142728 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612644.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene nuoK CDS 142725..144569 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815943.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene nuoL CDS 144641..146173 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210269.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene nuoM CDS 146180..147634 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815945.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene nuoN CDS 148049..149371 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815958.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene menF CDS complement(149442..150269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 150669..151139 product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261733.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 151385..152791 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817163.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 152938..153978 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195765892.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 153983..154966 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817165.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 155098..156732 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173899.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 156868..157473 product YebB family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024930.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 157505..158032 product DUF4303 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071853.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 158322..159995 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815959.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene menD CDS 159995..160777 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210246.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene menH CDS 160780..161637 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098093.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene menB CDS 161637..162608 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210244.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene menC CDS 162596..164005 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210243.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene menE CDS complement(164047..165774) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722110.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene pabB CDS complement(165776..166357) product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601879.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene pabA CDS complement(166495..167928) product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175627974.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene katA CDS 168214..169641 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762889.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 169644..170912 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532883.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(171106..172311) product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221775.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene tyrP CDS 172658..173857 product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210814.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 174058..174435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(174542..175678) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210817.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene nrdB CDS complement(175723..178011) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075180.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene nrdA CDS complement(178374..179084) product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815973.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 179359..182169 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815974.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene gyrA CDS 182563..183216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(183350..183592) product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213110.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene dinI CDS complement(183907..184125) product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296778.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(184339..184566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704882.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(184994..185275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 185334..185651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 185694..185858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 186567..187931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 187933..188145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 188611..188889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 188886..189149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212004.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 tRNA complement(189721..189797) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(189870..191609) product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171465.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene yejM CDS complement(191673..191900) product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208836.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 192200..193210 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208835.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene yejK CDS complement(193313..193597) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494192.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene rplY CDS complement(193719..195479) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815987.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(195479..195718) product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377223.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 195849..196553 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208832.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene rsuA CDS 196642..197865 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208831.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 198224..198583 product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094639.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(198653..200242) product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815989.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene yejF CDS complement(200244..201269) product microcin C ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002353954.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(201266..202357) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171436.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(202367..204238) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208825.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(204467..204982) product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208822.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene mepS CDS complement(205348..206079) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171423.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(206109..207086) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815993.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 207295..207546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 207461..207784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(207839..208411) product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815996.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene yeiP CDS complement(208577..209815) product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208812.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene mtr CDS 210031..210288 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389030.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 210468..211406 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171387.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene fruK CDS complement(211680..212537) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208791.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene nfo CDS complement(212637..213728) product YeiH family putative sulfate export transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024911344.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 213843..214745 product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548291.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene yieE CDS 214893..216392 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161755.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 216778..217137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 217143..218009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 218244..219392 product iron-siderophore ABC transporter substrate-binding protein YiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene yiuA CDS 219425..220507 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171333.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 220504..221292 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161751.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 221762..223723 product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488257.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene cirA CDS complement(224041..226083) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816718.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene metG CDS 226361..227476 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816717.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene apbC CDS 227781..228362 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211873.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene dcd CDS 228418..230277 product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211874.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene asmA CDS complement(230394..231971) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168322.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 232364..233770 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211888.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene gndA CDS 233934..234248 product PTS system regulator TmaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene tmaR CDS complement(234413..235873) product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157966.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene ptsG CDS 236965..239151 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022963022.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 tRNA complement(239906..239981) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 240448..242934 product GGDEF and EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128651.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 tRNA complement(243158..243233) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(244340..244552) product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366849.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene ydgT CDS complement(244760..245914) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 246113..247093 product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304427.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 247090..248094 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304426.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 248100..248903 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074140.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 248903..250192 product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612466.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 250835..251968 product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281624.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(252085..253461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(253554..254171) product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418930.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene lpoB CDS complement(254229..255794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(255794..256477) product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(256792..257364) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406500.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(257372..262309) product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(262519..264702) product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113833.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(264827..265471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100672.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 265734..266591 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816210.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(266636..268087) product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816021.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(268275..269282) product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816025.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene hcr CDS complement(269341..270990) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816026.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene hcp CDS complement(271202..272104) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816027.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 272338..274005 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211356.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(274019..274651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 275520..275843 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520781.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene clpS CDS 275869..278151 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162786.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene clpA CDS complement(278249..278467) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211347.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene infA CDS complement(278607..279299) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241673.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene aat CDS complement(279447..280016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(280200..281918) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211344.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene cydC CDS complement(281921..283699) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217690.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene cydD CDS complement(283825..284778) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816032.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene trxB CDS 285356..285850 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228473.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene lrp CDS 285975..289571 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171070.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 289762..290373 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211338.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene lolA CDS 290437..291723 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171047.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 291831..293123 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211336.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene serS CDS 293665..296106 product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850310.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene dmsA CDS 296117..296737 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213069.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene dmsB CDS 296739..297593 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209429.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 297665..298306 product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209430.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene dmsD CDS 298732..299358 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098817.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 299364..302921 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267442.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 303083..303535 product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098815.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 303608..305923 product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420653.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 306298..307443 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211335.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(307447..307851) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(307899..308540) product cytochrome c oxidase assembly factor Coa1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173707.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(308565..309323) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171041.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene pflA CDS complement(309661..311943) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211332.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene pflB CDS complement(312008..312859) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166519.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene focA CDS complement(313234..314997) product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816035.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 315386..316435 product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394125.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene ansB CDS 316549..317274 product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792797.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 317507..318592 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211326.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene serC CDS 318728..319423 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815911.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 319486..320772 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171024.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene aroA CDS 321035..321712 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211324.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene cmk CDS 321855..323540 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391091.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene rpsA CDS 323599..323883 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159907.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene ihfB CDS 324151..326442 product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816036.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 326477..328225 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551270.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene msbA CDS 328222..329211 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211319.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene lpxK CDS 329368..329550 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211315.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 329547..330302 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211314.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene kdsB CDS complement(330383..331138) product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816039.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene elyC CDS 331291..332094 product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301572.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene cmoM CDS 332091..333413 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170970.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene mukF CDS 333394..334110 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050078444.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene mukE CDS 334107..338591 product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211308.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene mukB CDS 338805..340571 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830416.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene ldtD CDS 340831..341403 product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170957.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 341545..342189 product hydroxyacylglutathione hydrolase GloC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109455.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene gloC CDS complement(342369..343559) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211303.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(343790..344878) product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(345168..346568) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882977.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene asnS CDS complement(346850..348058) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816044.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene pncB CDS 348371..350992 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220013.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene pepN CDS 351269..352279 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295352.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene pyrD CDS 352471..353025 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211295.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(353044..354147) product YcbX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816047.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 354359..356527 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816048.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene rlmKL CDS 356531..358435 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816049.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 358650..359984 product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026017889.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene pqiA CDS 359996..361624 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211290.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene pqiB CDS 361621..362190 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene pqiC CDS 362263..363012 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211680.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(363400..364272) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(364375..365370) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224141.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene gapA CDS 365731..366138 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211677.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene msrB CDS complement(366213..366836) product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816427.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene pncA CDS complement(366850..367875) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166135.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene ansA CDS complement(367991..369847) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816426.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene sppA CDS 370010..370558 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339283.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 370738..371781 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169286.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene selD CDS 371781..372875 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095917.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene mnmH CDS 372875..374806 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211670.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(374813..375226) product pyrimidine (deoxy)nucleoside triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166143.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(375274..376080) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169291.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene xthA CDS complement(376194..376766) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 tRNA complement(377269..377353) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(377544..378377) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555857.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene purU CDS complement(378494..378952) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816423.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 379144..380166 product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169304.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene rssB CDS 380464..381318 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718995.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene galU CDS 381345..382688 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210664.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 382694..383701 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097849.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(384008..384415) product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004103116.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene hns CDS complement(385719..388391) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816419.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene adhE CDS 388862..389509 product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210656.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(389592..389927) product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069343.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(389966..391426) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816416.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene cls CDS complement(391867..392265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(392281..392439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 392507..393181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(393238..393657) product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169322.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene yciA CDS complement(393828..394388) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210640.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 394783..396495 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816413.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(396630..397394) product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169326.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 398065..398715 product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164191.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene ompW CDS complement(398779..400326) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072076535.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene ppx CDS complement(400332..402422) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162157.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene ppk1 CDS complement(403016..403534) product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704907.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene fabA CDS complement(403634..405385) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224683.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 405581..406036 product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877153.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene matP CDS complement(406145..407221) product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005047463.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene ompA CDS complement(408023..408517) product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097256.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene sulA CDS 408753..409397 product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213064.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(409549..411690) product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816054.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene yccS CDS complement(411734..412183) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097253.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 412406..414460 product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816055.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene helD CDS complement(414512..414970) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816056.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 415154..415570 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170853.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 415850..416455 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926370.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 416486..417298 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704262.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 417302..417817 product FidL-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368469.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 419020..419298 product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012542984.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 419323..419607 product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502010.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 419620..419898 product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004146125.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 419961..421580 product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704261.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 421622..421879 product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599365.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 421895..423043 product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 423162..426590 product choline trimethylamine-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704259.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene cutC CDS 426690..427640 product choline TMA-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275637.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene cutD CDS 427654..428094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 428144..428785 product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704257.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 428805..429500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 429578..429934 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095890.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 429949..430278 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481836.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 430668..432491 product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096401.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 432766..433434 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004709152.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene folE CDS 433489..434631 product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211961.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene yeiB CDS complement(434615..435385) product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816726.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene sanA CDS complement(435544..437241) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211968.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(437593..438276) product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162334.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(438276..438677) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816723.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 439334..440752 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704981.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 repeat_region 440968..441235 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcaccgccgcataggcggcttagaaa CDS complement(441718..442029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(442046..442951) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343890.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene rarD CDS complement(443078..444508) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211904.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene sbcB CDS 444716..445558 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045367413.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 445558..446088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 446222..446746 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704720.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 446864..447616 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258311.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(447946..448557) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168349.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene hisIE CDS complement(448551..449327) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168354.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene hisF CDS complement(449309..450046) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211891.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene hisA CDS complement(450052..450639) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168362.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene hisH CDS complement(450639..451706) product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168369.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene hisB CDS complement(451721..452776) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168372.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene hisC CDS complement(452777..454081) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816713.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene hisD CDS complement(454087..454986) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211896.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene hisG CDS 455440..456267 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816712.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(456611..457276) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464489.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene artM CDS complement(457276..457980) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097362.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene artQ CDS complement(457992..458723) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211368.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene artJ CDS complement(458742..459470) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162824.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene artP CDS complement(459691..460281) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713757.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(460964..462121) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212174.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene yqhD CDS 462473..462685 product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367252.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 462960..463667 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703931.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 463677..464663 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703932.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 464895..466154 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956312.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(466224..467957) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene ade CDS complement(468099..469907) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970160.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(469925..471256) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215577.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 471737..472522 product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114171.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(472558..473496) product HTH-type transcriptional activator AllS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460148.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene allS CDS 473965..475323 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201828.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(475640..476425) product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540981.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene allE CDS complement(476514..477770) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378762.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(477782..479050) product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310618.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene allC CDS complement(479247..480296) product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703915.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene allD CDS 480790..482457 product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580919.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 482468..483727 product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495330.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 483814..484674 product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152513.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 484827..485753 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855388.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(485870..486070) product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388926.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 486253..487791 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168494.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 487788..488348 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168495.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene cobU CDS 488351..489100 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365836.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene cobS CDS 489104..489706 product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704735.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 489750..490802 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168498.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene cobT CDS complement(491071..491781) product LuxR family transcriptional regulator AbaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208103.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene abaR CDS 492064..492492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 492590..493147 product acyl-homoserine-lactone synthase AbaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208102.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene abaI CDS complement(493241..493840) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816403.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene cobO CDS 494165..495358 product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368753.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene tyrB CDS complement(495759..497468) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815882.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(497682..499013) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815881.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 500339..502984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 503276..503620 product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158894.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene yajD CDS 503666..504307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(504367..504864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 505674..519311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 519477..520874 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090505.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 520885..523023 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739054.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 523034..524203 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208471.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 524473..525156 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098813.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(525212..525370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(525385..526587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(526584..527999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(527996..528976) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930443.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(528973..529662) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113296.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(529688..530638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(530674..531231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 531474..532283 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909376.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(532436..534910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 535666..537543 product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033690.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene gss CDS 537631..538626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(539066..540817) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368616.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(540814..542820) product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538222.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(543296..543577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 note possible pseudo, frameshifted CDS complement(543748..544839) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505866.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene ychF CDS complement(544984..545481) product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907521.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(545481..546221) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707457.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(546226..548250) product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815918.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(548303..548665) product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118904.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(548935..549069) product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025482.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene ecnB CDS 549559..549831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 550105..550308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 550333..550641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 551513..554365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 sequence03 source 1..523743 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209965.1:transketolase locus_tag LOCUS_12980 CDS 1482..2645 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157067.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene pgk CDS 2746..3822 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209962.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene fbaA CDS complement(3911..5095) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819149.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(5088..6335) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732668.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(6339..7565) product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356229.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 7986..8852 product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817032.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene mscS CDS 9031..9657 product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173528.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene argO CDS 9797..10519 product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209959.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(10526..11419) product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163344.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 11566..12222 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163342.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene rpiA CDS 12519..13751 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163339.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene serA CDS complement(13965..14651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555960.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 15177..16526 product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054657.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene opgE CDS complement(16530..17117) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209955.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(17444..17773) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004706812.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene zapA CDS 17995..18570 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 18675..20003 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209952.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene pepP CDS 19991..21172 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209951.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene ubiH CDS 21184..22392 product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209950.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene ubiI CDS 23050..24144 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817029.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene gcvT CDS 24234..24620 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173499.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene gcvH CDS 24763..27642 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209947.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene gcvP CDS 28093..29511 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948912.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 29985..30632 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250274.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(30690..31688) product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209940.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene ygfZ CDS 32025..32288 product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354046.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene sdhE CDS 32347..32691 product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 32736..33416 product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209937.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene creB CDS 33413..34843 product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209936.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene creC CDS 34961..36496 product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220113.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene creD CDS complement(36567..37547) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097910.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(37534..38553) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846212.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(38628..39899) product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858523.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 40005..40235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 40475..41134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 41371..42009 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220164.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 42623..45283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(45532..45861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 46562..47917 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 48213..48983 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 49571..51904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 52255..54624 product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971142.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 54977..57289 product BB2324 family autotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039723.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 57447..57788 product DUF6506 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 57798..58631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 59510..59779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 60629..61186 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206555.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 61267..61971 product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484311.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 62058..64610 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210844.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 64787..65899 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206552.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(66533..66724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 67542..68324 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705401.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 68317..68790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(68848..70764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 70967..71188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 71661..72389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(72469..73638) product glycerate 3-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706350.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene glxK CDS complement(73826..75178) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201828.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(75278..76165) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765839.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene glxR CDS complement(76295..77074) product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943597.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene hyi CDS complement(77088..78869) product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096878.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene gcl CDS complement(79036..79848) product HTH-type transcriptional repressor AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141275.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene allR CDS complement(79970..80452) product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776388.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene allA CDS 80918..81661 product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704791.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 82459..83649 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895828.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 83639..84778 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 84910..86349 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114462.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 86418..87176 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390825.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 87207..88148 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 88198..89895 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449775.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 90567..100328 product autotransporter adhesin YapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211638.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene yapH CDS 100503..100784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 note possible pseudo, frameshifted CDS 102971..104530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 104527..105513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705929.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(105865..106449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(106424..107008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 107739..108872 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168631.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 108869..110317 product SAVED domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816647.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 110314..112479 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092520565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 tRNA complement(114063..114147) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(114464..114880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(115020..116069) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047080945.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(116186..116959) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529934.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(117031..118953) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966460.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(119060..120097) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176203.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(120419..121936) product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189292.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(122591..123667) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223173.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene lptG CDS complement(123670..124764) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420700.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene lptF CDS 125003..126514 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098951.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene pepA CDS 126612..127103 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209309.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 127120..129975 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815475.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(130057..130536) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(130619..131467) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972011.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(131493..131927) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368550.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene rraB CDS 132107..133114 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175288.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene argF CDS complement(133183..133653) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175289.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 133909..134295 product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162498.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene ridA CDS complement(134374..135369) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817240.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(135509..136564) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209206.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene rsmC CDS 136723..137154 product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095480.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 137123..137563 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216075.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene rimI CDS complement(137916..138230) product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169331.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(138686..139087) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199881.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 139264..139701 product DUF2938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525781.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 139858..141447 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095483.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene prfC CDS complement(142098..142352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 143021..143527 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 143813..146326 product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034162516.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 146363..147082 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071881865.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 147115..147627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 147637..148149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 148176..149162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 149223..149555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 151640..152146 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 152494..154941 product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034162516.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 154961..155689 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071881865.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 155812..156234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 156244..156747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 157032..157760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 157883..158167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 158501..158707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 158970..159413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 159784..160005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 161097..161603 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 161891..164392 product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034162516.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 164417..165133 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071881865.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 165150..165680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 165690..166187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 166522..167226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 167421..167621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 168684..169649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 170198..170845 product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166907.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene osmY CDS 170884..171072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 171083..172081 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815516.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 172112..172888 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815517.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(172889..173590) product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209218.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 173718..174695 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166929.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene serB CDS 174807..176186 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209220.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene radA CDS complement(176226..177227) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815524.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 177333..178244 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166937.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(178623..179270) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086288.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(179491..181176) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005180723.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene ettA CDS 181413..183368 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815528.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene sltY CDS 183448..183750 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368371.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene trpR CDS complement(183804..184331) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene yjjX CDS 184385..185032 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene gpmB CDS complement(185029..185898) product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166950.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene robA CDS 185947..186192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 186221..186709 product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875811.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene creA CDS complement(186781..187500) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209234.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene arcA CDS 188543..191002 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209237.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene thrA CDS 191004..191933 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166953.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene thrB CDS 191933..193240 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209239.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene thrC CDS complement(193557..194333) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209240.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene yaaA CDS 194602..195555 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130175.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene tal CDS 195740..196327 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166957.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene mog CDS 196686..198008 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815535.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(198324..198896) product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815537.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene satP CDS 199233..201143 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368351.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene dnaK CDS 201260..202390 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502040.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene dnaJ CDS 202746..203930 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166980.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene nhaA CDS complement(204092..204355) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220715.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene rpsT CDS 204742..205680 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166981.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene ribF CDS 205712..208528 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210509.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene ileS CDS 208525..209019 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083369.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene lspA CDS 209093..210037 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815541.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene ispH CDS 210326..211144 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166986.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene dapB CDS 211631..212779 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166988.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene carA CDS 212798..216019 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210502.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene carB CDS 216332..217018 product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166994.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 217015..217479 product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005180751.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 217505..217987 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080544.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene folA CDS complement(218040..218873) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815544.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene apaH CDS complement(218909..219286) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156966.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene apaG CDS complement(219364..220173) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704372.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene rsmA CDS complement(220166..221164) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167004.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene pdxA CDS complement(221151..222431) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167006.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene surA CDS complement(222562..224919) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815546.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene lptD CDS 225099..225914 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167009.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene djlA CDS 225975..227057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 227084..227590 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704154.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(227633..228289) product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210485.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene rluA CDS complement(228374..231280) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167013.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene rapA CDS complement(231420..233786) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815549.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 234385..235092 product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966717.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(235406..235846) product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098815.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(235929..236630) product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051608.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene thiQ CDS complement(236614..238233) product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214276.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene thiP CDS complement(238197..239204) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214274.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene thiB CDS 239543..240238 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087053.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(240267..240983) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816224.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 241693..241992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 242096..242422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(242507..244603) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140817.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene flhA CDS complement(244596..245726) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211451.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene flhB CDS complement(245719..246498) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213766.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(246507..246779) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211449.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene fliQ CDS complement(246782..247591) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211448.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene fliP CDS complement(247588..247980) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211447.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene fliN CDS complement(247973..248794) product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211446.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 249428..250450 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211445.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 250524..250877 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211444.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene fliE CDS 250888..252516 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211443.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene fliF CDS 252479..253525 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211442.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 253530..254294 product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213763.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene fliH CDS 254287..255606 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279402.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene fliI CDS 255680..256105 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248917.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene fliJ CDS complement(256249..259050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(259376..259771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(261899..262327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(262333..262611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(263045..263866) product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211436.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene flgA CDS 263963..264313 product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512950.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 264316..264741 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211434.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene flgC CDS 264741..265433 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463939.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene flgD CDS 265440..266627 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119538.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene flgE CDS 266638..267369 product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375450.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 267436..268221 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211430.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene flgG CDS 268292..268966 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211429.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene flgH CDS 269003..270112 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042468851.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 270123..270434 product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211427.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 270548..271909 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367245.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene flgK CDS 272014..272931 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266799.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene flgL CDS 272943..273971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211424.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(274320..274820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211423.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(274834..275829) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211422.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 277221..277916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 278007..278798 product fimbria/pilus chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098962.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 278925..281255 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914994.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 281277..281831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 282098..282928 product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949083.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene lafA CDS 283115..283954 product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949083.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene lafA CDS 284306..285616 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462779.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene fliD CDS 285646..286041 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285322.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene fliS CDS 286034..286348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 286353..287498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 287513..288004 product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211414.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 288026..288745 product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211413.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 288758..289621 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169518.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene motA CDS 289621..290577 product putative lateral flagellar export/assembly protein LafU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211411.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene lafU CDS complement(290974..291576) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025800380.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene leuD CDS complement(291590..292990) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167044.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene leuC CDS complement(292993..294084) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210454.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene leuB CDS complement(294136..295689) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815560.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene leuA CDS 296298..296684 product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210102.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene cybC CDS 296994..298793 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815561.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 299208..300926 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815562.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene ilvI CDS 300929..301420 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388986.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene ilvN CDS 301826..302836 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815563.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene cra CDS 303378..303836 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210443.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene mraZ CDS 303840..304781 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815565.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene rsmH CDS 304778..305098 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156880.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene ftsL CDS 305181..306950 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210440.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 306937..308436 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848752.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene murE CDS 308433..309809 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210438.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene murF CDS 309803..310885 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167069.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene mraY CDS 310888..312207 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796484.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene murD CDS 312207..313418 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210435.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene ftsW CDS 313415..314473 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210434.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene murG CDS 314533..316008 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815569.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene murC CDS 316001..316912 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815570.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 316914..317744 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228100.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene ftsQ CDS 317747..319003 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210431.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene ftsA CDS 319073..320230 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389003.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene ftsZ CDS 320349..321266 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389005.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene lpxC CDS complement(321270..321788) product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705424.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 321825..322349 product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156845.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene secM CDS 322456..325173 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905780.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene secA CDS 325512..325925 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167088.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene mutT CDS complement(326002..326199) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209317.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene yacG CDS complement(326267..327019) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167091.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene zapD CDS complement(327016..327639) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095584.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene coaE CDS complement(327636..328151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 328650..329693 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167093.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(329980..331167) product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167094.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene hofC CDS complement(331164..332654) product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216083.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene gspE CDS complement(332651..333100) product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360914.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene ppdD CDS 333359..333901 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051592.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene ampD CDS complement(333970..335310) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633582.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 336094..336858 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389026.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene pdhR CDS 336982..339651 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209329.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene aceE CDS 339666..341531 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704415.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene aceF CDS 341712..343136 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102485.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene lpdA CDS 343620..345017 product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704749.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene chiP CDS 345075..345404 product ChiQ/YbfN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167950.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene chiQ CDS 345426..348110 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816825.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(348446..348721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 348915..351674 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209333.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene acnB CDS 351886..352248 product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167120.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene yacL CDS complement(352245..353132) product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167123.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene yddG CDS complement(353405..354688) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167221.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene hemL CDS 355065..355409 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368181.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene erpA CDS complement(355540..356154) product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095644.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(356176..357030) product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175631671.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene btuF CDS complement(357030..357731) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209368.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene mtnN CDS 357994..359490 product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164096.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene dgt CDS 359787..360941 product CdaR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368175.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 361265..362263 product reverse transcriptase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046082755.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(362359..363921) product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273719.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene garD CDS 364480..365820 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703312.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 365935..367272 product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098237.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene gudD CDS 367376..368143 product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098883.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene garL CDS 368242..369126 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350452.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene garR CDS 369216..370355 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815413.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(370581..372131) product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208746.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene emrB CDS complement(372139..373305) product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208745.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene emrA CDS complement(373484..373990) product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208744.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene mprA CDS complement(374273..374989) product transcriptional regulator AlpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085982.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene alpR CDS 375129..375488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 375939..376256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 376246..376671 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207064.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 376668..377069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 377041..377253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 377601..378098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 378103..379185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 379203..379640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 379732..380148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 380148..380348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 380345..382453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 382450..383136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 383154..383477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 383648..384613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 384600..385265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 385262..385615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 385615..387036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 387033..387776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 387773..388441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 388441..389031 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057643.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 389158..390174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(390624..390980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 391063..391626 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904922.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 391793..392665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 392729..393295 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954203.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(393578..395110) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827567.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(395094..396194) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(396775..397470) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639796.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(397657..398304) product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780893.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene grxB CDS complement(398523..398915) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(399080..399406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(399657..400985) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705398.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(401183..403255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 403545..404477 product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(404574..405725) product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210940.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene cfa CDS 406226..407125 product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704270.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(407145..407504) product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191031.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(407622..408176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(408493..409542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(409569..409817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 410775..411026 product pyocin activator PrtN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267327.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(411149..411331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 411573..412655 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391834.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 412648..414840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 415119..415430 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001406079.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 tmRNA complement(416649..417013) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(417218..417727) product DUF2165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209941.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(418021..418458) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210714.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene smpB CDS 418759..419193 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502504.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 419183..419479 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848491.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(419524..419874) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172787.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene bamE CDS complement(420059..421720) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210718.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene recN CDS complement(421805..422686) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172782.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene nadK CDS 422811..423392 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172778.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene grpE CDS 423733..425130 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209412.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(425218..425895) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209663.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene ung CDS 426281..426664 product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209664.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene grcA CDS complement(426767..428107) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209669.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene srmB CDS 428281..429039 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227868.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 429388..429963 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209672.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene rpoE CDS 430010..430642 product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172760.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene rseA CDS 430646..431590 product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098322.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene rseB CDS 431602..432057 product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589049.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene rseC CDS complement(432156..432416) product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367588.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene ybiJ CDS 432782..434596 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172749.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene lepA CDS 434613..435602 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209678.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene lepB CDS 435768..436448 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209679.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene rnc CDS 436445..437371 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159414.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene era CDS 437380..438126 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172741.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene recO CDS 438339..439070 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211569.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene pdxJ CDS complement(439128..441812) product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209371.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene barA CDS 441981..443312 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167240.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene rlmD CDS 443329..445560 product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167242.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene relA CDS 445673..446479 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209374.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene mazG CDS 446593..448230 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167247.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene pyrG CDS 448410..449711 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164105.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene eno CDS 449802..450473 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369971.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene queE CDS complement(450589..450951) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165931770.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene queD CDS 451406..452650 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705409.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(452918..454030) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097629.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(454086..454553) product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423470.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(454565..455395) product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083620.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 455760..456536 product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705157.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 456605..457366 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705158.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 457359..458087 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705159.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 458185..459180 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210909.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(459193..460398) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096165.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(460423..461892) product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194514.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene cscA CDS complement(461901..463148) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 463365..464315 product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704926.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 464392..464688 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167289.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene ftsB CDS 464688..465395 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209391.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene ispD CDS 465414..465887 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219242.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene ispF CDS 465884..466936 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene truD CDS 467263..468012 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209394.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene surE CDS 468015..468647 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167299.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 468950..470095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 470155..471144 product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209397.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene rpoS CDS complement(471228..473339) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819036.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 473561..474667 product iron-siderophore ABC transporter substrate-binding protein YiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene yiuA CDS 474672..475247 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167922.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(475413..477974) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209399.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene mutS CDS 478630..478788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 478858..479868 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 480137..480307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(480304..480921) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268606.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(481452..482222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049698.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(482263..483621) product type VI secretion system ImpA and VasL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211944.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(483669..487196) product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212111.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene tssM CDS complement(487200..488612) product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240544.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene tssA CDS complement(488620..489306) product type VI secretion system-associated protein VasI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212109.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene vasI CDS complement(489300..491972) product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705721.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene tssH CDS complement(491984..492748) product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212106.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene icmH CDS complement(492748..494091) product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212105.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene tssK CDS complement(494101..494625) product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212104.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene tssJ CDS complement(494622..495857) product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705717.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene tagH CDS complement(495861..496838) product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705716.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene tssG CDS complement(496817..498535) product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705715.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene tssF CDS complement(498568..498984) product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212100.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene tssE CDS complement(498989..500476) product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819811.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene tssC CDS complement(500566..501072) product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705712.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene tssB CDS 501581..501757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 501825..502340 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212097.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 502415..504166 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189792.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene tssF CDS 504251..506431 product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211400.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 506449..507663 product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525297.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 507678..508031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 508049..508255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 508274..508792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 508814..509920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 509949..510467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 510911..511171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 511425..512111 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948152.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 512337..513422 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene mltB CDS 513659..514402 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(514479..515915) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208842.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(516131..516865) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098618.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 517087..517626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816577.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 517846..518346 product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209445.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene pncC CDS 518451..519494 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707431.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene recA CDS 519522..520004 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167422.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene recX CDS 520145..522772 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047184.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene alaS CDS 523046..523231 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene csrA tRNA 523514..523606 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 523632..523708 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 sequence04 source 1..302864 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1061..2038 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004789.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene epmA CDS complement(2102..2518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(2571..5888) product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080723.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene mscM CDS complement(5925..6785) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175537.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene asd CDS complement(6962..8005) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815419.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene rsgA CDS 8096..8641 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095280.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene orn tRNA 8820..8895 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 8945..9020 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(9194..9790) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703229.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 9958..10908 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094781.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(11281..12420) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294246.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene queG CDS 12419..13921 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815422.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene nnr CDS 13947..14435 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene tsaE CDS 14440..16164 product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175628029.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene amiB CDS 16190..18169 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209148.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene mutL CDS 18162..19088 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704169.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene miaA CDS 19232..19534 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209151.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene hfq CDS 19564..20850 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095288.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene hflX CDS 20909..22198 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209154.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene hflK CDS 22205..23209 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232417.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene hflC CDS 24540..31532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 31778..33076 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006178975.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 33550..34113 product DUF1440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996728.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 34544..35005 product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175497.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene nsrR CDS 35005..37437 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704173.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene rnr CDS 37516..38250 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209161.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene rlmB CDS complement(38311..38988) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532554.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(39065..40021) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815364.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 40345..40842 product YbaK/prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097062.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 41108..41506 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004098001.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene rpsF CDS 41513..41833 product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210154.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene priB CDS 41838..42065 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene rpsR CDS 42102..42554 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175476.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene rplI CDS 42713..43102 product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164450.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(43062..43769) product LysM-like peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368604.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(43908..44834) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108987323.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 44935..46149 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298533.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 46252..46872 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311330.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene fklB CDS complement(46951..47616) product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210159.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene ytfE CDS 47807..48583 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175628026.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene cysQ CDS 48832..49038 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(49130..50392) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368593.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(50641..51279) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704191.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene msrA CDS 51544..53199 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046695507.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 53196..56960 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154295113.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 56963..57310 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210168.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(57388..57921) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368588.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene ppa CDS complement(58285..59031) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817053.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(59222..60226) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216946.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene fbp CDS 60398..61765 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368582.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene mpl CDS complement(61875..62345) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389210.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene argR CDS 62642..63580 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210174.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene mdh CDS complement(63650..63910) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210175.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 64521..64898 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210176.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 64928..65302 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210176.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(65361..66293) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210177.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene ispB CDS 66604..66915 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271396.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene rplU CDS 66935..67192 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434222.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene rpmA CDS 67353..68315 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175407.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 68443..69621 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156290.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene cgtA CDS complement(69691..71121) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217314.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene dacB CDS 71503..71979 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210184.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene greA CDS complement(72067..72360) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210185.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene yhbY CDS 72474..73103 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145975.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene rlmE CDS 73271..75100 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107467.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene ftsH CDS 75354..76187 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703603.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene folP CDS 76194..77534 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175398.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene glmM CDS 77628..78350 product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823111.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 78458..79288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 79621..79953 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272680.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene secG tRNA 79998..80084 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 80444..80626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 80623..80835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 note possible pseudo, internal stop codon, frameshifted CDS 80825..81067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 note possible pseudo, internal stop codon, frameshifted CDS 81230..83671 product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985413.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 83668..85008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 85021..85677 product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 85674..86741 product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400551.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 86762..89857 product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041594898.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 89857..90573 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(90614..90940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(91339..92304) product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297640.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene yjiA CDS complement(92337..92540) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(92688..94841) product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299714.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene btsT CDS 95474..96079 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098408.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 96465..97865 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704651.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 98035..98964 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704657.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 tRNA 99549..99625 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 99829..100281 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300397.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene rimP CDS 100304..101791 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156278.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene nusA CDS 101815..104496 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703597.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene infB CDS 104565..104966 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040205.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene rbfA CDS 104966..105913 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815446.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene truB CDS complement(106008..107312) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418379.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(107309..108328) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(108318..109571) product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112781.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(109574..111094) product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(111084..112082) product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768670.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(112079..112771) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(112814..113638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 114066..114335 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369527.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene rpsO CDS 114621..116738 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156266.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene pnp CDS 116886..117773 product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209260.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene nlpI CDS 117946..119880 product DEAD/DEAH family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209261.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 120100..120858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 121174..122397 product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209054.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene yedE CDS 122394..122639 product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790504.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene yedF CDS complement(122695..123651) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(123729..124739) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815448.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(124783..126162) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216717.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(126389..127282) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163530.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene cyoE CDS complement(127294..127626) product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706741.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(127627..128253) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061708214.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(128243..130240) product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163523.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene cyoB CDS complement(130244..131131) product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167626.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene cyoA CDS complement(131524..132090) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208541.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 132352..134064 product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994202.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(134560..135444) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209269.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(135454..136449) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309783.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 136980..137501 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815454.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 137495..137998 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098905.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(137995..138312) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369538.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 138438..138875 product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209282.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(138872..139138) product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167035.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(139142..139399) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050113752.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(139594..140058) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095356.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene nrdG CDS complement(140187..142325) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209296.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene nrdD CDS 142722..144968 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174086.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 146109..146699 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817195.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 146988..147224 product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091314.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 147363..147797 product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211459.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 147868..148695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211460.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 148700..150052 product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817199.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 150049..150552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 150564..151700 product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213784.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 151712..152995 product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213785.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 152992..153873 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212164.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 153870..154706 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212165.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 154699..155442 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 155512..155940 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212167.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 155903..156493 product tight adherence pilus pseudopilin TadF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817205.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene tadF CDS 156495..156899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 156992..158212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 158792..159376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 159525..159950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 160071..162566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 162583..163251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848157.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 163256..164269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 164303..164830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(164894..165049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(165255..166445) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171409.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene uxuA CDS 167191..168501 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209891.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 168513..170912 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209892.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 170920..172407 product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815994.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 172404..173813 product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477444.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene uxaC CDS complement(174027..175175) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818456.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 175468..176910 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209784.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene mgtE CDS complement(176982..177914) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083418.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene panE CDS 178160..178882 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298340.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 178901..179488 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097424.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene ybjG CDS 179945..181222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 181295..183022 product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175308.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(183088..183549) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210791.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(183748..184623) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815868.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 184735..185199 product multidrug/biocide efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597495.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 185631..186656 product tellurium resistance membrane protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255079.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene terC CDS complement(186713..187078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(187164..188519) product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368806.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene zraR CDS complement(188506..190338) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940637.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 190688..191194 product zinc resistance sensor/chaperone ZraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828133.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene zraP CDS complement(191516..192214) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168627.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 192409..192891 product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705072.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(192922..193389) product DUF6392 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098592.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(193450..193917) product DUF6392 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098592.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(193978..194445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(194507..194974) product DUF6392 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098592.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(195033..195494) product DUF6392 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098592.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(195555..196022) product DUF6392 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098592.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(196025..197560) product S-type pyocin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096824.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(198024..198755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626369.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 199154..200956 product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037879.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 201443..202219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 202410..203567 product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816744.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 203822..204886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402229.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 205439..206554 product erythritol/L-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209403.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 206722..207981 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991765.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 208063..208833 product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209404.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 208906..209907 product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228229.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 209913..210554 product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209406.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene dhaL CDS 211517..245236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 245560..246375 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021186.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 246598..247371 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211680.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 248213..258466 product autotransporter adhesin YapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211638.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene yapH CDS 259900..270150 product autotransporter adhesin YapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211638.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene yapH CDS complement(270504..271163) product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096647.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 272000..272212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 note possible pseudo, internal stop codon tRNA complement(272404..272479) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 272814..273497 product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096626.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 273707..274291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(274679..276097) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222877.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(276412..277137) product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687756.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(277218..277355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(277417..278502) product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157159.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene mltC CDS complement(278535..278807) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098674.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(278810..279862) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847823.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene mutY CDS 280174..280893 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173629.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene trmB CDS 280893..281225 product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173625.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 281664..282389 product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817048.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(282603..283733) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239943.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene hemW CDS complement(283726..284319) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173616.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 284647..285459 product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326656.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene cdh CDS complement(285610..285912) product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173614.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene yggU CDS complement(285912..286457) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157142.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(286601..287419) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817046.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene proC CDS complement(287476..288177) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173610.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 288201..289193 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069504.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 289305..289838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(289846..290268) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209978.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene ruvX CDS complement(290268..290831) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817044.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(291011..291961) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173586.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene gshB CDS complement(291973..292605) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300912.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene rsmE CDS complement(292919..293392) product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878142.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(293689..294195) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228059.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(294285..295439) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098658.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene metK CDS 296205..298103 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209969.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene speA CDS complement(298167..298763) product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174792.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 299120..300037 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434404.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene speB CDS complement(300101..300667) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404446.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(301035..301778) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792300.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 sequence05 source 1..273738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(913..1884) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098213.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene tal CDS complement(1963..2421) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209402.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene rpiB CDS complement(2929..3897) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209407.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(4344..5300) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267647.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(5476..6795) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114259.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(6898..9162) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114258.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(9159..9644) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097907.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 9969..10217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704706.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 10227..11114 product cystine transporter YijE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271242.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene yijE CDS 11579..14392 product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 14389..15822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(15911..16333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(16512..16781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 17300..19633 product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211602.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 19644..20261 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211603.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene dmsB CDS 20263..21039 product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211604.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 21147..21746 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228419.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 21746..22282 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211606.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(22347..23246) product DUF4434 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224554.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(23246..26218) product bacteriophage adsorption protein NfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662366.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene nfrA CDS complement(26220..28451) product cyclic di-3',5'-guanylate-activated glycosyltransferase NrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383920.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene nrfB CDS 29097..32405 product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051444.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene mscK CDS complement(32517..33608) product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171545.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(34012..34272) product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768134.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(34275..35207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 tRNA complement(36447..36522) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 36665..37165 product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703525.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene mug CDS complement(37230..39071) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210359.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene rpoD CDS complement(39233..40984) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210358.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene dnaG CDS complement(41134..41349) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene rpsU CDS complement(41594..43144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 43444..44463 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369630.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene tsaD CDS complement(44542..45183) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160822.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene plsY CDS 45291..45650 product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174138.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene folB CDS 45805..46626 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833310.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene bacA CDS complement(46955..47521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(47518..47697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(47666..48898) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212197.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(49009..49632) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125325.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 49815..51131 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817221.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 51167..54007 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212194.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene glnE CDS complement(54054..54986) product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816068.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 55111..56538 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817219.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene hldE CDS 56549..57805 product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817218.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene yjeH CDS complement(57857..58135) product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098757.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene ubiK CDS 58574..59230 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212190.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene ribB CDS complement(59506..60273) product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098748.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene zupT CDS 60591..61373 product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene ygiD CDS complement(61437..62597) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160795.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(62610..63287) product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357252.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(63657..65006) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735268.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene tolC CDS 65243..65878 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212184.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene nudF CDS 65988..66326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 66602..67027 product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160781.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 67078..67905 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817215.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene cpdA CDS 67905..68486 product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077091.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene yqiA CDS 68591..70480 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212181.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene parE CDS 70552..72828 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817211.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene parC CDS 73095..73835 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369660.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene plsC CDS 74030..75475 product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817210.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene ftsP CDS complement(75579..76829) product two-component system response regulator PgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930841.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene pgtA CDS complement(76831..78807) product two-component system sensor histidine kinase PgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678500.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene pgtB CDS complement(78804..80027) product phosphoglycerate transport regulator PgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467983.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene pgtC CDS 80587..81975 product phosphoglycerate transporter PgtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955756.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene pgtP CDS complement(82267..82986) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887789.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene deoD CDS complement(83086..84213) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168094.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(84213..85367) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168097.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(85360..87114) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168099.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(87124..88113) product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158910.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene hlyD CDS complement(88311..88742) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170794.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 89271..89963 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211859.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(90448..91257) product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225093.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(91592..92266) product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209890.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene torD CDS complement(92352..94874) product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063172.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene torA CDS complement(94899..96062) product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386714.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene torC CDS 96241..96945 product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120285.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene torR CDS complement(96918..97985) product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265011.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene torT CDS 98196..100937 product TMAO reductase system sensor histidine kinase/response regulator TorS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054718.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene torS CDS complement(101102..103774) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215187.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene acnA CDS 104097..104843 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434049.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(104910..105428) product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209934.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene fldB CDS 105514..106431 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209933.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene xerD CDS 106468..107205 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817020.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene dsbC CDS 107296..109026 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209931.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene recJ CDS complement(109679..110620) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206906.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(110638..111807) product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338972.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(111986..112918) product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000336599.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene hpaA CDS complement(112989..114374) product 4-hydroxyphenylacetate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285769.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene hpaX CDS complement(114528..115352) product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431692.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene hpaI CDS complement(115363..116166) product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887487.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene hpaH CDS complement(116160..117629) product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene gabD CDS complement(117629..118021) product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211073.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(118080..118955) product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095453.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene hpaD CDS complement(119053..120519) product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723530.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene hpaE CDS complement(120510..121280) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009485356.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(121277..121912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 122322..122771 product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211070.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene hpaR CDS complement(123117..124103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(124483..126498) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260991.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 127202..127993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 note possible pseudo, frameshifted CDS 128009..129532 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817018.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene lysS CDS complement(129902..131146) product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083171.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene eutH CDS complement(131172..132614) product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114294.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 132861..134261 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895572.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 134258..135472 product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114295.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 135514..136293 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418385.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 136428..136778 product DUF1937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083172.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 137164..137667 product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210233.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene dps CDS 138309..140351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 141371..142111 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816256.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 tRNA 142204..142277 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(142350..143255) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817251.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 143597..144652 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(144733..146055) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277854.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(146065..147849) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705184.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(147853..148593) product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366946.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 149343..150311 product TerC family membrane protein Alx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098806.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene alx CDS complement(150389..150622) product DUF2594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106483.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 150777..151226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(151380..151748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 152009..152341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 152355..153011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 153004..153318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 153302..153616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 153625..155694 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390606.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 155764..156519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(156701..157270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(157303..158328) product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209845.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene galR CDS 158736..160892 product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816988.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene aas CDS 160889..162103 product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620430.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene lplT CDS complement(162212..162910) product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165371.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene mutH CDS 163596..164150 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165374.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene rppH CDS 164383..165258 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816984.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene lgt CDS 165266..166060 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098550.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene thyA CDS 166269..166697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 166841..167359 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816982.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 167353..167979 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298794.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 167981..168451 product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098548.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 168439..168789 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228047.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(168855..169952) product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387905.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 170282..173662 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816979.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene recC CDS 173822..176707 product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816978.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene ptrA CDS 176707..180243 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816977.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene recB CDS 180236..182095 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816976.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene recD CDS complement(182193..183167) product petrobactin ABC transporter substrate-binding protein YclQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246619.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene yclQ CDS complement(183453..184169) product Uxu operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841652.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene uxuR CDS 184792..186099 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784371.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(186188..187513) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211624.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene argA CDS 187821..189062 product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211623.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene amiC CDS complement(189223..190527) product purine/pyrimidine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847027.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(190790..191131) product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 tRNA complement(191354..191430) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(191501..191577) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(191648..191724) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 191886..193037 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228046.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene mltA CDS 193147..193953 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212114.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene tcdA CDS complement(193954..194388) product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816974.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene csdE CDS complement(194391..195641) product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703316.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene csdA CDS 195803..196027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 196413..197327 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166353.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 197426..197809 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369946.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 197812..198918 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212119.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene rlmM CDS complement(199027..199803) product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268232.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene xni CDS complement(199866..201233) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098530.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene ppnN CDS complement(201477..202334) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100463.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene queF CDS 202410..202961 product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173239.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene syd CDS 203852..204199 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212124.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 204803..208087 product autotransporter Vag8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930866.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene vag8 CDS 208439..209215 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212125.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene truC CDS 209244..209693 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164060.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(210083..210838) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705373.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(210877..212166) product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705374.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(212384..213289) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705372.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene surE CDS complement(213668..214507) product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene licT CDS complement(214821..216221) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706100.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene ascB CDS complement(216272..218179) product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001318143.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene bglF CDS complement(218571..218966) product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272188.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 219235..219615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 219612..220187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230911.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 220467..221411 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116069.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(221479..222306) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186650.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene dapD CDS complement(222340..225015) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212129.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene glnD CDS complement(225564..226358) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266399.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene map CDS 226793..227716 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 227716..229017 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 229331..230056 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004858107.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene rpsB CDS 230189..231043 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212132.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene tsf CDS 231140..231874 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164053.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene pyrH CDS 232019..232576 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212134.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene frr CDS 232798..233994 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816968.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene ispC CDS 234214..234972 product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295562.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene ispU CDS 234982..235833 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173216.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene cdsA CDS 235859..237214 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816967.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene rseP CDS 237246..239630 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095659.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene bamA CDS 239701..240186 product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212140.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene skp CDS 240187..241215 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173181.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene lpxD CDS 241353..241808 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212142.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene fabZ CDS 241813..242601 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173176.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene lpxA CDS 242605..243789 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212144.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene lpxB CDS 243792..244403 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212145.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene rnhB CDS 244460..247942 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228634.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene dnaE CDS 247955..248914 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391685.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene accA CDS 249319..250563 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097509.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene hutI CDS 250566..251534 product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704790.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene hutG CDS 251668..252405 product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704791.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 252402..252998 product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765559.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 253346..255031 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097506.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene hutU CDS 255033..256571 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050123526.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene hutH CDS 256673..258079 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817406.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(258156..258863) product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069255.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 note possible pseudo, internal stop codon, frameshifted CDS complement(258863..260284) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023933.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(260295..261014) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102123.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(261189..262733) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948686.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 262851..263309 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704453.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 263374..264699 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816961.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene tilS CDS 264767..265087 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816960.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(265143..265409) product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218374.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene rof CDS complement(265396..265596) product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501889.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 265949..266497 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212153.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 266502..266918 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173159.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene arfB CDS complement(267155..268894) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163997.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene proS CDS complement(269057..269764) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212157.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene tsaA CDS complement(269765..270106) product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816957.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene rcsF CDS 270105..270257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(270284..271099) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene metQ CDS complement(271159..271815) product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212160.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(271808..272770) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594009.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene metN CDS 273055..273624 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140187.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene gmhB sequence06 source 1..236388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3024..3401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 4561..5196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 note possible pseudo, internal stop codon, frameshifted CDS 5302..5850 product Raf kinase inhibitor-like protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313946.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene ybcL CDS 6053..9172 product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815827.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene acrD CDS complement(9261..10160) product LysR family transcriptional regulator AmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101291.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene ampR CDS 10389..11546 product class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925876.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene ampC CDS complement(11766..14312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 14828..15337 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814722.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(15353..17071) product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103125.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene ligB CDS 17361..17984 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046966.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene gmk CDS 18039..18314 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene rpoZ CDS 18295..20445 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209002.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene spoT CDS 20484..21158 product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165889.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene trmH CDS 21160..23241 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016758.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene recG CDS complement(23397..25034) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098641.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(25114..26583) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098642.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(26601..27395) product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098643.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(27426..28220) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098644.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(28217..29083) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098645.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(29114..29647) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098646.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(29681..30961) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098647.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(31014..32246) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703445.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(32243..33187) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098649.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(33244..34029) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028063.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(34072..34827) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098651.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(34824..35867) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369746.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(35886..36194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004144765.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(36197..36511) product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098654.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 36829..38232 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094877.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 38986..40770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815267.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(40995..41984) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208869.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(42024..42932) product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209008.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene fabY CDS complement(43000..43434) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209009.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene dtd CDS complement(43431..44324) product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920751.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(44450..45043) product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314324.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene yihX CDS 45391..45792 product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369693.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(45836..46987) product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369197.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene yiaY CDS complement(47268..49091) product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175744.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene typA CDS 49458..50867 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392048.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene glnA CDS 51034..52083 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213151.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene glnL CDS 52092..53513 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602497.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene glnG CDS complement(53880..55253) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116090.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene hemN CDS complement(55458..55979) product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213158.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene yihI CDS 56683..57330 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175759.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene yihA CDS complement(57843..60638) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175760.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene polA CDS 61399..62223 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099384.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(62463..63935) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689366.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(64248..66320) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817445.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene glyS CDS complement(66330..67253) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369211.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene glyQ CDS 67380..67949 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438940.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene tag CDS 67946..68395 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209627.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 68694..68960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 68990..69649 product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369222.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 69893..70867 product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369217.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene ghrB CDS 71146..72396 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144344.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene avtA CDS complement(72665..73090) product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161076.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene ibpB CDS complement(73185..73598) product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532742.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene ibpA CDS 73983..74264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(74440..74886) product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096210.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene lysM CDS complement(75025..76314) product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817455.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 76718..77677 product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209638.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(77717..78241) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229593.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(78321..79580) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521075.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 79837..80550 product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367040.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 80547..83273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 83325..84419 product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704976.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 84530..85987 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704972.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(86042..87727) product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367863.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene hscC CDS 88326..89774 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167417.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 89814..90380 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170245.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 90426..91562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 91559..92689 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(92751..93095) product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073636.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 93596..95875 product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172316.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene maeB CDS 96422..96904 product anti-virulence regulator CigR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097313.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(97022..98353) product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167354.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(98435..99772) product D-serine transporter DsdX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032644228.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene dsdX CDS 100001..100945 product DNA-binding transcriptional regulator DsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705340.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene dsdC CDS complement(100991..102550) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257472.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(102610..103953) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830664.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(103956..105119) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101134.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 105561..106484 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705260.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(106740..107789) product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene chrA CDS 109041..111089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 note possible pseudo, frameshifted CDS 111110..111871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 note possible pseudo, frameshifted CDS complement(112129..112443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(112491..114911) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209642.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene gyrB CDS complement(114931..116016) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209643.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene recF CDS complement(116041..117141) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161099.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene dnaN CDS complement(117147..118535) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220732.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene dnaA CDS 119441..119581 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831330.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene rpmH CDS 119638..119964 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703902.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene rnpA CDS 120191..121837 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220739.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene yidC CDS 121943..123307 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175133.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene mnmE CDS 123523..124104 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723344.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 124405..124815 product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105501.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(125096..127192) product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224746.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(127649..128995) product citrate-proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125471.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(129064..130230) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569571.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 130787..131830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 131843..132403 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 132384..132776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 132921..133907 product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172666006.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene rlmF CDS 134013..134408 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208261.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 134650..136386 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805086.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene ggt CDS complement(136714..137286) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761174.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(137286..138320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(138458..139618) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168556.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(139799..140668) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703507.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 140890..141705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(141754..142320) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(142411..143784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114398.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(143781..150101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(150125..150754) product 4Fe-4S cluster-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114396.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(150754..152610) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895630.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(152906..154003) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082083.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(154077..154478) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301470.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 154843..155568 product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815688.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 155664..156371 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694635.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 156371..156631 product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815690.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 156647..156895 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173115.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 156911..157501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815691.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 157468..158847 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195765893.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 158844..159188 product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173106.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 159179..160912 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173104.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 160902..161330 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369298.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 161327..161953 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173099.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 161928..164252 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298607.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 164249..164827 product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815695.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 164824..165993 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815696.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 165990..166475 product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815697.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 166472..167203 product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173090.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 167200..168429 product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032901333.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 168442..169164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 169198..171087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(171174..172508) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215577.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 172904..173572 product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215575.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene yieH CDS complement(173688..176918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 177296..178516 product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816067.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene mdtG CDS 178729..179505 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098823.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(179564..180310) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215573.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(180312..181052) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215571.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(181451..182302) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215568.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 182622..182804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 182896..184911 product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815406.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 184965..186005 product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209061.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 186002..186832 product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156544.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 186832..187836 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175607.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 187829..188608 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815405.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(188526..189209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(189394..189960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(189944..194371) product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211402.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(194368..195696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552171.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(195742..198015) product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211400.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(198377..199090) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817472.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene phoU CDS complement(199106..199885) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215562.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene pstB CDS complement(199899..200786) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175158.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene pstA CDS complement(200788..201744) product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215558.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene pstC CDS complement(201804..202844) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215557.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene pstS CDS 202899..203054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 203298..203993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 204300..205691 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886939.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 205930..207405 product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480236.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene yfcC CDS complement(207676..208734) product bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038544.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 208799..209620 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206820.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(209669..211669) product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130624425.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene betT CDS complement(212000..213835) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215552.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene glmS CDS complement(214046..215416) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175168.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene glmU CDS 215815..216708 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174098.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(216760..217479) product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532752.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(217576..217998) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024912932.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(218018..219397) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161168.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene atpD CDS complement(219431..220294) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896501.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene atpG CDS complement(220341..221882) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161175.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene atpA CDS complement(221895..222428) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175171.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene atpH CDS complement(222443..222913) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004107293.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene atpF CDS complement(222967..223206) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene atpE CDS complement(223253..224074) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135625.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene atpB CDS complement(224100..224483) product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161181.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene atpI CDS complement(225084..225701) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161183.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene rsmG CDS complement(225714..227603) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817477.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene mnmG CDS complement(227976..228425) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212258.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene mioC CDS complement(228517..228978) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161192.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene asnC CDS 229133..230122 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815250.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene asnA CDS complement(230119..231576) product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212255.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene viaA CDS complement(231579..233096) product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212254.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene ravA CDS 233498..235192 product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212253.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene kup CDS complement(235393..236097) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175190.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 sequence07 source 1..222217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(658..1506) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130548.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 1722..3320 product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704028.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene rtcR CDS complement(3399..5972) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167451.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene clpB CDS complement(6107..6838) product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815687.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene yfiH CDS complement(6838..7815) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079130.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene rluD CDS 7949..8680 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209469.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene bamD CDS 8882..10063 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849007.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(10126..10623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(10916..11272) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209461.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene rplS CDS complement(11329..12075) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393426.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene trmD CDS complement(12130..12660) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene rimM CDS complement(12679..12927) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209458.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene rpsP CDS 13401..14525 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(14708..16396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 16675..16998 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263159.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 17119..17571 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012669197.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(17603..18517) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261744.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene murQ CDS complement(18699..20057) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167432.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene ffh CDS 20464..21021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 21184..22389 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162197874.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(22463..22978) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098432.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene luxS CDS complement(23133..24695) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209452.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene gshA CDS complement(24769..25197) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209451.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(25194..25760) product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273303.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene yqaB CDS 26143..26697 product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170533.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene pagP CDS 26872..27981 product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212036.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene chaA CDS complement(28131..29360) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815865.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(29624..30127) product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723340.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 30873..31571 product MgtC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210891.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 31808..34528 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050122726.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene mgtA CDS 34621..34851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(35123..35917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(36139..36378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(36284..36682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(36679..37113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(37100..37432) product phage holin, lambda family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783734.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 37813..38757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(38855..39220) product antiterminator Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204832.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 39246..39572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 tRNA complement(39613..39688) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(39897..41318) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222185.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene gltX tRNA 41560..41635 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 41674..41749 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 41787..41862 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 41869..41944 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA 42051..42137 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(42368..42586) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092249.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(42590..44611) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172221.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene ligA CDS complement(44698..45582) product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139343690.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene zipA CDS 45801..46568 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254839.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene cysZ CDS complement(46613..47473) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980837.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene rfbD CDS complement(47473..48006) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261024.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene rfbC CDS complement(48035..49132) product DUF1972 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028306.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(49132..50274) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936352.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(50277..51173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(51314..51976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(51982..52848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(52845..54137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(54130..55005) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107727.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(55048..56361) product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene rfbH CDS complement(56375..57454) product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene rfbG CDS complement(57461..58234) product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816873.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene rfbF CDS complement(58255..59238) product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208598.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(59265..60356) product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208587.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene wzz(fepE) CDS 60958..61926 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098198.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene cysK CDS 62442..62699 product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene ptsH CDS 62745..64472 product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208490.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene ptsI CDS 64677..65186 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392561.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene crr CDS complement(65251..66597) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815859.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(66605..67282) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172242.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 67590..68684 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815858.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 68689..70650 product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050129821.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(70753..71637) product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208508.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene cysM CDS complement(71681..72775) product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172252.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene cysA CDS complement(72765..73640) product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208510.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene cysW CDS complement(73640..74476) product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208511.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene cysT CDS complement(74476..75483) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208512.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(75721..76632) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208519.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(76765..77343) product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208521.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(77386..77811) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208525.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 77973..78428 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208527.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(78621..79220) product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815830.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene napC CDS complement(79234..79686) product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835177.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene napB CDS complement(79683..80633) product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694327.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene napH CDS complement(80633..81385) product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694328.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene napG CDS complement(81406..83889) product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778064.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene napA CDS complement(83886..84155) product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165688.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene napD CDS complement(84139..84645) product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208536.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene napF CDS 84971..86665 product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350312.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene narQ CDS 86743..87372 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165685.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(87598..88119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(88334..89125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(89200..90093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(90147..90644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(90773..91378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(91509..92459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(92545..93402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(93403..96636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(96668..99619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 100026..100391 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208548.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 100391..101527 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815825.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene dapE CDS 101524..102201 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208550.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 102201..102398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(102399..104453) product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208552.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(104582..105034) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172363.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(105130..106005) product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365467.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(106225..106938) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208555.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(107023..108063) product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208557.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene bamC CDS complement(108080..108958) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311023.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene dapA CDS 109103..109672 product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176187.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 109672..110145 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098229.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene bcp CDS complement(110208..111275) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208563.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 111684..113147 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217569.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 113176..113526 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365459.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene arsC CDS complement(113806..114513) product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815818.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene hda CDS complement(114604..115878) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072791.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(116086..116985) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366366.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(117135..117761) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370402.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene upp CDS 118182..119219 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703153.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene purM CDS 119219..119857 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172390.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene purN CDS 120017..120550 product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815816.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene speG CDS 120769..121368 product TetR family multidrug efflux transcriptional regulator VceR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264144.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene vceR CDS 121398..122297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096415977.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 122552..123613 product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817037.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene epd CDS complement(123673..124470) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172521.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene thiD CDS complement(124467..125282) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694556.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene thiM CDS 125827..126165 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209468.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene raiA CDS 126491..127648 product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815647.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene pheA CDS complement(127976..130303) product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815593.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene mrcB CDS complement(130456..132897) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298481.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene hrpB CDS 133101..133805 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298442.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene sfsA CDS 134006..134461 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095632.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 gene dksA CDS 134591..135490 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228220.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene gluQRS CDS 135703..137001 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222090.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene pcnB CDS 137091..137579 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156774.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene folK CDS 137776..138876 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722298.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(138885..140186) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298440.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(140304..140933) product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647911.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(140960..141730) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156782.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(141727..142653) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368204.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 142967..143620 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651604.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene can CDS complement(143694..144230) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368206.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene hpt CDS complement(144408..145076) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080191.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 145194..146405 product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211477.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 146563..146883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(146978..147259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(147389..147658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 148133..148456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 148671..149021 product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167131.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 149188..150045 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167130.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene speE CDS 150090..150890 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156788.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene speD CDS complement(150937..152058) product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167445.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene tyrA CDS complement(152172..153245) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167443.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 153492..154208 product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815646.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene btsR CDS 154269..154628 product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296308.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(154679..154993) product thiosulfate sulfurtransferase PspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473115.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene pspE CDS 155541..156767 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355251.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 157110..157355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 158257..159369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(159500..161077) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098264.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene guaA CDS complement(161236..162705) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172545.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene guaB CDS 162877..164232 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815788.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene xseA CDS complement(164256..165062) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028054097.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(165059..165286) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209811.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(165299..166255) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209812.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 166661..168469 product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104927.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene kefC CDS complement(168770..170257) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296291.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene der CDS complement(170410..171591) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815787.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene bamB CDS complement(171602..172207) product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172568.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(172222..173496) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703166.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene hisS CDS complement(173643..174758) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261366.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene ispG CDS complement(174805..175758) product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090905.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene rodZ CDS complement(175748..176500) product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209819.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene pilW CDS complement(176582..177748) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098279.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(178069..178572) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963841.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene ndk CDS complement(178802..181012) product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175631705.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene pbpC CDS complement(181415..186367) product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815782.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 186854..187291 product DUF1795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318825.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(187487..188782) product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081828.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene pepB CDS complement(188886..189086) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004702435.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene iscX CDS complement(189108..189443) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004713939.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 gene fdx CDS complement(189446..191296) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172623.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene hscA CDS complement(191309..191827) product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209833.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene hscB CDS complement(191954..192277) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004702422.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene iscA CDS complement(192303..192689) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209835.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene iscU CDS complement(192744..193958) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775265.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene iscS CDS complement(194006..194509) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222202.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene iscR CDS complement(194713..195489) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217034.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene trmJ CDS 195659..196462 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213305.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene suhB CDS complement(196598..197356) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263776.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(197382..198380) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217028.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(198392..198994) product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815775.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(199048..199422) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957355.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(199575..200828) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098302.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 201220..201732 product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211926.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(201973..202311) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231018.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene glnB CDS complement(202324..203943) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(204019..205356) product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene glrR CDS complement(205381..206385) product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072084141.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene qseG CDS complement(206392..207816) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216114.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(208749..212639) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815763.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene purL CDS 212967..214457 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172712.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene mltF CDS complement(214464..214967) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene tadA CDS complement(215021..215665) product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298623.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene yfhb CDS 216116..216301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(216380..217423) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167464.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 217604..218035 product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098726.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene trxC CDS 218359..218898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 219101..220459 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018051.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene pssA CDS 220673..221434 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703221.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 sequence08 source 1..187526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209965.1:transketolase locus_tag LOCUS_25870 CDS 1385..1771 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465059.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene crcB CDS 2197..2871 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174197.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 3095..3406 product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210418.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 3409..3804 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174200.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 3801..4085 product YqjK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703570.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 4383..4778 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391987.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 4924..5916 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011193135.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 5927..6784 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114805.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(6949..7806) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114815.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(7856..8746) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817248.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 9296..10267 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091837.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 10249..11400 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098671.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 11400..12557 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113108.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(12800..13456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 13971..15131 product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815999.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 15144..17663 product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815998.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene torA CDS complement(17824..19323) product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047747.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(19474..20475) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047748.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene pdxA CDS complement(20476..21813) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047749.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(21842..22588) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915720.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 22820..23800 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(24148..25458) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113742.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(25525..25941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(25958..27538) product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275275.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 28610..31660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 31735..34839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(34950..38507) product autotransporter adhesin EhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001491890.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene ehaA CDS complement(38973..39476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 41006..43558 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309459.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 44143..45786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 45794..46114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(46351..47436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(47433..48038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 49045..49281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 49285..49542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(50393..51637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 52474..53103 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103083.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(53156..54112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(54207..55631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(56386..57261) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210149.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene rsmI CDS 57360..59105 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817253.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 59063..59464 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210147.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 59513..60103 product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004710884.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene diaA CDS 60117..60695 product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166550.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene dolP CDS complement(61402..62124) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162387.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene mtgA CDS complement(62121..62774) product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299134.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene elbB CDS complement(62909..65233) product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210142.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene arcB CDS complement(65413..66339) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817255.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 67067..71530 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077010.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene gltB CDS 71545..72963 product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081705.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene gltD CDS complement(73078..73560) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366126.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene sspB CDS complement(73581..74222) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162411.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene sspA CDS complement(74541..74933) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829815.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene rpsI CDS complement(74950..75378) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210132.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene rplM CDS complement(75689..77122) product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036491.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(77579..78721) product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036236.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene prpF CDS complement(78743..79663) product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982670.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene citG CDS complement(79644..80183) product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816653.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene citX CDS complement(80187..81743) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168600.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene citF CDS complement(81759..82655) product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309339.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene citE CDS complement(82652..82948) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164540.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene citD CDS complement(82945..84021) product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816655.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene citC CDS 84357..85985 product sensor histidine kinase DpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071843384.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene dpiB CDS 85991..86680 product two-component response regulator DpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168588.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene dpiA CDS 86963..87373 product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210130.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene zapG CDS 87792..89165 product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817258.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene degQ CDS 89254..90336 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098970.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene degS CDS complement(90442..91701) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210127.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 gene murA CDS complement(91803..92057) product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162441.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene ibaG CDS complement(92255..92575) product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210125.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene mlaB CDS complement(92575..93207) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476484.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene mlaC CDS complement(93228..93734) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210123.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene mlaD CDS complement(93739..94521) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174247.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene mlaE CDS complement(94521..95324) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032898349.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene mlaF CDS 96022..96192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 note possible pseudo, frameshifted CDS 96333..97301 product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210119.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene kdsD CDS 97355..97903 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228203.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene kdsC CDS 97900..98487 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174254.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene lptC CDS 98471..98995 product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162470.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene lptA CDS 99039..99764 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224099.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene lptB CDS 99821..101251 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809059.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene rpoN CDS 101256..101780 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213952.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene ptsN CDS 101910..102782 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243746.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene rapZ CDS 103105..103512 product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210103.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene rnk CDS complement(103589..104929) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817275.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene pmbA CDS 105145..105702 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210099.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene yjgA CDS complement(105972..106241) product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817276.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(106238..106549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(106910..107785) product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971962.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(107962..109407) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174328.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene tldD CDS complement(109413..110261) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817279.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(110258..114103) product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210080.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene yhdP CDS complement(114160..115629) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123188.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene rng CDS complement(115626..116222) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210078.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(116231..116719) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163138.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene mreD CDS complement(116716..117735) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163136.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene mreC CDS complement(117920..118963) product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918653.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene mreB CDS complement(119233..121152) product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817282.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene csrD CDS 121685..122686 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210073.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene msrP CDS 122686..123291 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174342.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene msrQ CDS 123522..123965 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210071.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene aroQ CDS 124007..124462 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163113.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene accB CDS 124474..125841 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817284.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene accC CDS 126086..126331 product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098993.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 126321..127769 product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817285.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene panF CDS 127810..128691 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817286.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene prmA CDS 129544..130458 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210062.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene dusB CDS 130440..130736 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene fis CDS complement(130888..131148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(131465..133114) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174376.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(133344..134711) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210039.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(134893..135219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 135867..137543 product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209652.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene kdpA CDS 137577..139643 product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816820.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene kdpB CDS 139689..140267 product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816821.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene kdpC CDS 140276..142975 product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209649.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene kdpD CDS 142972..143664 product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025470747.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene kdpE CDS complement(143651..145114) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817442.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 145258..145875 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050076557.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(145876..146649) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209724.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS 146773..147687 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171845.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 147776..148105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 148149..148394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(148397..148906) product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815410.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(148974..149687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(149820..150329) product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368746.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene ssb1 CDS 150797..153628 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174389.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene uvrA CDS complement(153709..154443) product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228151.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(154798..155166) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165225.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 155771..157084 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817389.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS complement(157167..158243) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174405.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene alr CDS complement(158400..159821) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165232.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene dnaB CDS 159975..160958 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209094.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 161038..161529 product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681732.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 161665..162042 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087349.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 162039..163010 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368404.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS complement(163265..164263) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817299.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene dusA CDS 164474..164923 product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214647.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene zur CDS 165312..165851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(165937..166548) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene lexA CDS complement(166649..167014) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368764.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 167137..169590 product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108900543.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene plsB CDS complement(169689..170561) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817300.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene ubiA CDS complement(170561..171067) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209087.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene ubiC CDS complement(171215..171625) product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705335.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene psiE CDS complement(171696..173342) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212085.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene pgi CDS complement(173526..174437) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040113.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 174586..175032 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705397.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 175082..175717 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227736.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 176376..177725 product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849837.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene lysC CDS 177894..178823 product ketopantoate/pantoate/pantothenate transporter PanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095031.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene panS CDS 179271..180725 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818491.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(180788..181204) product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS complement(181209..181643) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(181640..181975) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298602.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(182076..185756) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817311.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene metH CDS complement(185847..186776) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122789.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene metA rRNA complement(187267..187377) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence09 source 1..165121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(580..1371) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201804.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene murI CDS complement(1396..3243) product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815316.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene btuB CDS 3652..4755 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368905.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene trmA repeat_region 4972..7159 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctgtacggcagtgaac CDS complement(7316..7954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(7964..9007) product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957412.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene csy3 CDS complement(9019..9912) product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120898.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene csy2 CDS complement(9909..11186) product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene csy1 CDS complement(11186..14560) product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene cas3f CDS complement(14557..15546) product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene cas1f CDS complement(15666..16508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(16713..17087) product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501783.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(17106..17744) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163800.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene fabR CDS complement(17894..18811) product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025939.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene oxyR CDS 18971..19702 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209479.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 19814..21262 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209480.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(21738..21962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 22408..22977 product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(23062..24438) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209487.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene argH CDS complement(24655..25872) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465152.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(25961..26734) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215335.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene argB CDS complement(26747..27751) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209489.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene argC CDS 27927..29081 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368914.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene argE CDS 29324..31960 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815299.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene ppc CDS complement(32242..33129) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815297.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene metF CDS complement(33346..35781) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815295.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(35784..36944) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815294.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene metB CDS 37198..37515 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392248.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene metJ CDS complement(37622..37837) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216737.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene rpmE CDS 38069..40264 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208938.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene priA CDS 40548..41564 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216730.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene cytR CDS 41642..42439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 42633..43163 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004714422.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene hslV CDS 43175..44506 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175854.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene hslU CDS 44700..45617 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208944.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 45754..46239 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872908.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene rraA CDS complement(46314..46556) product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392238.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene zapB CDS 47043..47864 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175868.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 47914..49425 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175870.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene glpK CDS 49579..50589 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815289.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene glpX CDS complement(50661..51302) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806169.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene pyrE CDS complement(51372..52088) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175960.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene rph CDS complement(52340..52699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 53098..53862 product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171306.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene deoR CDS complement(54006..55355) product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072056542.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(55578..56879) product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243952.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(56935..58119) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046079.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene deoB CDS complement(58131..60083) product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815434.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(60163..61341) product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703389.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 61753..62433 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816010.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene deoC CDS 62675..63538 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621352.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 tRNA complement(63880..63956) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 64213..64959 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796330.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 gene fpr CDS 65120..65785 product DUF1454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046049972.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 65951..66721 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208959.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene tpiA CDS complement(66796..67758) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099327.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 gene pfkA CDS complement(68103..68867) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368935.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene fieF CDS complement(69130..69663) product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208969.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene cpxP CDS 69810..70508 product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862004.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene cpxR CDS 70586..71884 product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208971.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 gene cpxA CDS 71937..72410 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932347.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 gene trmL CDS complement(72464..73282) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815280.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene cysE CDS complement(73341..74354) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815279.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 gene gpsA CDS complement(74354..74830) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208976.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene secB CDS complement(74940..75371) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815278.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 75705..77249 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175917.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 gene gpmM CDS 77310..78590 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815277.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene envC CDS 78575..79576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 79670..80434 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703793.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 80567..81502 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815275.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene rfaD CDS 81611..82660 product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094907.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene rfaF CDS 82660..83622 product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264548.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene rfaC CDS 83622..84797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 84913..86079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 86118..87350 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094903.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(87412..88371) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094902.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 88568..89698 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703804.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 89699..90796 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418344.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 91103..92128 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172601538.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene waaA CDS 92132..92908 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175942.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 92905..93408 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171879.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene coaD CDS complement(93410..94219) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175950.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene mutM CDS complement(94384..94551) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208990.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene rpmG CDS complement(94563..94799) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091955.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene rpmB CDS complement(95041..95724) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175951.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene radC CDS 96141..97349 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175628128.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene coaBC CDS 97336..97791 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077682.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene dut CDS 97891..98484 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004714376.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene slmA CDS complement(98593..100212) product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066639.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene fumB CDS complement(100502..101842) product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368823.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene dcuB CDS complement(102444..102575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(102704..103195) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808849.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(103241..104074) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176008.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 104377..105051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 105099..105518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 106023..107057 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829995.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 107062..107289 product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804119.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(107474..108868) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383155.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(108871..110460) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385648.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(110487..110984) product sugar dehydrogenase complex small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385647.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 tRNA complement(111208..111302) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 111576..112208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 112383..112526 product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208618.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene ykgO CDS complement(112775..114655) product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817432.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 gene selB CDS complement(114652..116043) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209608.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 gene selA CDS 116926..117444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 117604..119883 product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 119876..120547 product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066545.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 gene fimC CDS 120558..121571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 121584..122117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 122131..122679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 122694..123227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 123830..124348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 124422..126809 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704150.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 126802..127473 product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066545.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene fimC CDS 127483..128481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 128499..129032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 129046..129594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 129591..130154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(130145..130294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 130378..131475 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208546.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 131553..133322 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208545.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 133315..134388 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705183.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(135010..135927) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161934.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene fdhE CDS complement(135920..136564) product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045646.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene fdnI CDS complement(136551..137450) product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209611.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene fdxH CDS complement(137463..140516) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830448.1 transl_table 11 codon_start 1 transl_except (pos:139929..139931,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_28680 gene fdnG CDS 140873..141703 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209612.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene fdhD CDS complement(141751..142050) product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967243.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(142047..142331) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483268.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(142673..142930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 note possible pseudo, frameshifted CDS complement(142899..143300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 note possible pseudo, frameshifted CDS complement(143701..144618) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161934.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene fdhE CDS complement(144611..145252) product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045648.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene fdnI CDS complement(145239..146129) product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240582.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene fdnH CDS complement(146142..149192) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904702.1 transl_table 11 codon_start 1 transl_except (pos:148605..148607,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_28770 gene fdnG CDS 149746..150372 product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122632.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene sodA CDS 150655..150993 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056482.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 151158..151832 product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817439.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene yiiM CDS complement(151880..152239) product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209618.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(152422..153138) product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175086.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(153526..154215) product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725344.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene dsbA CDS complement(154240..155226) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175762.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(155286..155555) product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175764.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(155621..156490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(156487..156948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(156945..157505) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070641.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(157502..159415) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070640.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(159438..160394) product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706298.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene nrfD CDS complement(160391..161062) product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220281.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene nrfC CDS complement(161059..161631) product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309136.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene nrfB CDS complement(161678..163096) product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101783.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene nrfA CDS 163588..164163 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050076897.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene mobA CDS 164166..164681 product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217538.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene mobB sequence10 source 1..103745 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2433 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704421.1:FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein locus_tag LOCUS_28960 CDS 2640..4277 product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene ubiB CDS complement(4317..5546) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210868.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene alr CDS complement(5836..7335) product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174191.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 7634..7786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 7818..9038 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194588.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS 9252..10025 product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174195.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene exuR CDS complement(10127..11113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 note possible pseudo, frameshifted CDS complement(11268..11600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29040 note possible pseudo, frameshifted CDS 11709..12167 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168562.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(12396..13079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS complement(13192..14376) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215044.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene metC CDS complement(14472..15758) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209057.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 16007..16939 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209056.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 17788..19809 product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209560.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene hmsP CDS 20049..21314 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817389.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 21581..23023 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817388.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(23092..24024) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817387.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(24138..25046) product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157374.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene yhjD CDS complement(25360..26712) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817382.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene gorA CDS complement(26806..27579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(27616..28458) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954235.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 28856..30898 product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157382.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 gene prlC CDS 30907..31653 product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686608.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 gene rsmJ CDS complement(31744..33087) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209529.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene gdhA CDS complement(33582..34013) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323571.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene uspA CDS complement(34300..35790) product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157393.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene pitA CDS 36071..37270 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215486.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 37821..39116 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208949.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 39109..41244 product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704147.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(41253..41519) product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168190.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 41708..41920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 41981..43720 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174778.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS 44235..44768 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176305.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS 44911..46401 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084315.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene rmuC CDS 46498..47253 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224024.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene ubiE CDS 47266..47871 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084314.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 47871..49502 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815371.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene ubiB CDS 49592..49867 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165598.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene tatA CDS 49871..50395 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815372.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 gene tatB CDS 50399..51196 product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211538.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene tatC CDS 51296..52078 product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001377145.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene tatD CDS 52168..53190 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815375.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene hemB CDS complement(53500..53991) product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192400.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene rfaH CDS 54214..54939 product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707065.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene pepE CDS 54998..56485 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215917.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene ubiD CDS 56538..57239 product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807928.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene fre CDS 57390..58178 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815367.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(58333..59442) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174790.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene asd CDS complement(59670..60296) product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176125.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene rhtB CDS 60559..61560 product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176123.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene pldB CDS 61617..62414 product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211488.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene yigL CDS complement(62717..63070) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729125.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(63497..64327) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098250.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene iolB CDS complement(64423..65313) product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098251.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene iolE CDS complement(65354..67261) product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098252.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 gene iolC CDS complement(67329..68462) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098253.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(68633..69346) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263231.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(69346..71223) product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482867.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(71285..72988) product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087120.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(73083..74069) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098257.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene iolG CDS complement(74501..76435) product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098258.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene iolD CDS complement(76457..77968) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098259.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 78269..79102 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098260.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(79490..80479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(80554..81651) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050076852.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 gene glpQ CDS complement(81896..83251) product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098018.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene glpT CDS 83627..85267 product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815350.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene glpA CDS 85257..86528 product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176408.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene glpB CDS 86525..87733 product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211493.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene glpC CDS complement(88076..88636) product phage sensitivity protein DcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245295.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene dcrB CDS complement(88733..89398) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211495.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 89664..89912 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215973.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene tusA CDS complement(89948..90574) product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176373.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(90638..90913) product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163952.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(90906..91520) product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211502.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene rsmD CDS 91839..93353 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099141.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene ftsY CDS 93358..94032 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211504.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene ftsE CDS 94013..95005 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084329.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene ftsX CDS 95284..96141 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163942.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene rpoH CDS 96284..96607 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694416.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene glpE CDS 96894..97724 product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174723.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene glpG CDS 97774..98535 product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208930.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS 98896..100401 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174768.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene glpD CDS 101550..102245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29800 sequence11 source 1..96237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 180..569 product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175556.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene frdC CDS 586..942 product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209134.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene frdD CDS 1492..2103 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703812.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(2149..3159) product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175187.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 gene rbsR CDS complement(3170..4093) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815255.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene rbsK CDS complement(4187..5074) product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175185.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene rbsB CDS complement(5099..6067) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368991.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene rbsC CDS complement(6074..7579) product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175183.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene rbsA CDS complement(7589..8008) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161210.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene rbsD CDS complement(8338..9006) product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693164.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(9006..9662) product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850540.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 gene atoD CDS complement(9675..10853) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666204.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(10850..11683) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(11685..12947) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693428.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(12963..13736) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 14194..14886 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037144.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(14932..15246) product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156471.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene sugE CDS complement(15368..15721) product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071582.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(15769..15900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(15973..16539) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855940.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene efp CDS 16581..17609 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940500.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene epmB CDS 18031..19101 product flagellin lysine-N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073855.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene fliB CDS complement(19187..20833) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729126.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene groL CDS complement(20888..21181) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(21366..21836) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175568.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene fxsA CDS 22247..23671 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069440.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene aspA CDS 23818..25119 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095257.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 25257..25601 product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209122.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene cutA CDS 25577..27346 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209121.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 tRNA 27457..27532 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(27745..28746) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869311.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(28834..29397) product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583077.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 29612..30649 product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973745.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 30653..32164 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762617.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene xylB CDS 32161..33663 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209903.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 33708..34748 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209904.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 34791..35795 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209906.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 36547..37725 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206552.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(37831..38172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 38268..38654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 39159..39377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS 39695..40531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 40700..41851 product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095696.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 42028..44169 product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706054.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 44833..45285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(45292..46518) product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261026.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 46644..48008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 48123..49271 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 49268..50437 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706040.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene ugd CDS complement(50530..52458) product autotransporter adhesin YapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209752.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 gene yapC CDS complement(53489..53839) product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368664.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(54017..54883) product SAM-dependent methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168976.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 gene tehB CDS 55455..55844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446690.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 55848..56399 product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120749.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene sigZ CDS complement(56460..59837) product autotransporter adhesin EhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001491890.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene ehaA CDS complement(61391..64564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(64899..65915) product ParB/Srx family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194141.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(66131..66454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(66727..67686) product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028521.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(67804..68406) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457930.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(68417..70165) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481667.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS 70421..71179 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481653.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 71176..72270 product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481686.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene nrfD CDS 72263..75349 product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457967.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(75404..76003) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(76203..76994) product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164952.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene kdgR CDS complement(77336..77830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(78189..79103) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098099.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene rnz CDS complement(79126..80049) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197652.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 80158..81024 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816436.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 81093..81710 product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082476.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene ycaC CDS complement(82024..82605) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212179.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 82816..83715 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283934.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS 83812..84528 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461994.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS 84525..84848 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088669.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(84918..86249) product sodium-coupled multidrug efflux MATE transporter VmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481584.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene vmrA CDS complement(86334..86945) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815883.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(87110..88420) product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175646.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene gltP CDS 89253..91211 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209031.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene acs CDS 91266..91577 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156735.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 91574..93229 product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175651.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene actP CDS complement(93282..93833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 94241..94942 product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704870.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene aqpZ CDS complement(94995..95927) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707304.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 sequence12 source 1..76319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(45..575) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176268.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene hemG CDS complement(597..2048) product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176271.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene trkH CDS complement(2088..2699) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099228.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(2699..4030) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211547.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene pepQ CDS complement(4138..6414) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176312.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene metE CDS 6516..7412 product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815365.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene metR CDS complement(7432..8307) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215597.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 8674..10812 product zinc/cadmium/mercury/lead-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815354.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(11140..12951) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050129919.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene edd CDS 13792..14730 product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174797.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene gntR CDS complement(14739..15263) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174793.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 15517..16851 product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174795.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene gntT CDS complement(16964..17590) product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928814.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene rhtC CDS complement(17916..19745) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211484.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene recQ CDS 20114..21004 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211481.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene rarD CDS complement(20996..21934) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705660.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(22211..23161) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166238.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene corA CDS complement(23681..25843) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703984.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 gene uvrD CDS complement(25887..26603) product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815342.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene yigB CDS complement(26603..27529) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815341.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene xerC CDS complement(27526..28245) product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211472.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(28242..29066) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211471.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene dapF CDS complement(29183..30433) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262842.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene lysA CDS complement(30547..30735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 30814..31137 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211469.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene cyaY CDS complement(31194..33749) product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211468.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 34101..35042 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211465.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene hemC CDS 35039..35782 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211464.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene hemD CDS 35800..36993 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176188.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene hemX CDS 36996..38177 product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815337.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene hemY CDS 38763..39143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 tRNA complement(39495..39571) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(39622..39707) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(39741..39816) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(39882..39958) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS 40321..41583 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174187.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene sstT CDS complement(41938..42666) product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176198.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene wecG CDS complement(42676..44046) product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211978.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene wzyE CDS complement(44046..45128) product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211979.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(45131..46381) product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176202.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene wzxE CDS complement(46383..47513) product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176203.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene rffA CDS complement(47524..48237) product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211982.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene rffC CDS complement(48215..49096) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815331.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene rfbA CDS complement(49209..50282) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216798.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene rffG CDS complement(50279..51541) product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211985.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene wecC CDS complement(51554..52669) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866672.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene wecB CDS complement(52737..53777) product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080212.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene wzzE CDS complement(53799..54896) product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176219.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene wecA CDS complement(54968..56290) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883293.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene rho CDS complement(56726..57052) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 gene trxA CDS 57199..58482 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228177.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene rhlB CDS 58585..60018 product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089447.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene gppA CDS 60121..61281 product YiiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602492.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(61369..63396) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099281.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene rep CDS 63415..63558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(63537..63899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(64083..65561) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176079.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 gene ilvC CDS 65727..66608 product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176081.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene ilvY CDS complement(66622..67314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(67397..68941) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176085.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene ilvA CDS complement(68947..70797) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212014.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene ilvD CDS complement(70879..71808) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099287.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene ilvE CDS complement(71829..72086) product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368897.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 gene ilvM CDS complement(72083..73735) product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815319.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 gene ilvG CDS 74309..75835 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815318.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(75862..76200) product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 gene maoP sequence13 source 1..74413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1653 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199699.1:trimeric autotransporter adhesin BpaE locus_tag LOCUS_31260 CDS 1714..2490 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184872.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene bamE CDS 2599..3573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(3726..4304) product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208924.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene nfuA CDS complement(4356..4520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 5111..5887 product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998145.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene bioH CDS 6002..6274 product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208921.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS complement(6358..6606) product FeoC-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174747.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(6607..8925) product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174749.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 gene feoB CDS complement(8985..9212) product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004702177.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene feoA CDS complement(9243..9425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(9805..12126) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817360.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS 12288..12776 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174758.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene greB CDS 12973..13692 product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004709363.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene ompR CDS 13788..15023 product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174760.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene envZ CDS complement(15106..16740) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361659.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene pckA CDS complement(16960..17844) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208911.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene hslO CDS complement(17901..18305) product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159667.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene hslR CDS complement(18476..20647) product intracellular growth attenuator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817351.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 20966..21532 product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045737.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene nudE CDS complement(21594..24098) product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208906.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene mrcA CDS 24320..25183 product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051840.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene pilM CDS 25183..25719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 25719..26288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 26285..26671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 26671..27990 product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298773.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene hofQ CDS 28396..28878 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391482.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene aroK CDS 28936..30021 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369386.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene aroB CDS 30097..31077 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208897.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 31155..31973 product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208895.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene dam CDS 32020..32694 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174695.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene rpe CDS 32691..33383 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208892.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 33393..34397 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099067.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene trpS CDS complement(34634..35185) product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766229.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 35362..36612 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076275.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene codB CDS 36602..37882 product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180693.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS 38044..38610 product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208878.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene ppiA CDS complement(38664..39740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS complement(39727..40752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(40877..43693) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188699.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 43988..45499 product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215686.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(45890..46579) product DNA-binding transcriptional regulator rspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215553.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene rspR CDS complement(47128..48609) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096786.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(48668..50032) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192118.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(50095..51108) product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096790.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(51123..52337) product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690934.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 52659..53882 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174672.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(53995..56070) product YccS/YhfK family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012135464.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(56142..56774) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242755.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene crp CDS complement(57075..57944) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212300.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(58036..58287) product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099053.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS complement(58284..59264) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174664.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 59365..59967 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174663.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(60020..61942) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099041.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 62292..62843 product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081510.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene kefG CDS 62843..64681 product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817326.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 gene kefB CDS 64842..65471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(65543..65770) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212317.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 65945..67417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 67638..68432 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174645.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 gene fkpA CDS 68592..69305 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091461.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 69302..69694 product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817322.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 gene tusD CDS 69711..70070 product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212321.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 gene tusC CDS 70080..70367 product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903371.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 gene tusB CDS 70599..70973 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212323.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene rpsL CDS 71070..71540 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861706.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene rpsG CDS 71636..73741 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212325.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene fusA sequence14 source 1..35754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 422..958 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011193213.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(955..1212) product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070562.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(1209..2027) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174590.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 gene aroE CDS complement(2045..2551) product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174593.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene tsaC CDS complement(2595..3146) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099010.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(3248..4315) product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209022.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene dprA CDS 4644..5156 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099013.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene def CDS 5197..6144 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174602.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene fmt CDS 6210..7499 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817317.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene rsmB CDS 7547..8923 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166392.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene trkA CDS 9050..9451 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099017.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene mscL CDS 9794..11329 product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392775.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 11512..12840 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731242.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 12928..14529 product propionate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392773.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 14578..15315 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392772.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene fabG CDS 15326..16510 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392774.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 16570..17739 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 17801..18931 product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482892.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(18924..19175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(19243..19683) product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099019.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene zntR CDS complement(19828..20217) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004868344.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene rplQ CDS complement(20258..21247) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438685.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene rpoA CDS complement(21273..21893) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene rpsD CDS complement(21928..22317) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388621.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene rpsK CDS complement(22334..22690) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004702348.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene rpsM CDS complement(22992..24320) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213344.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene secY CDS complement(24328..24762) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391411.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 gene rplO CDS complement(24766..24945) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213339.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene rpmD CDS complement(24952..25452) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940115.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene rpsE CDS complement(25467..25820) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099023.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene rplR CDS complement(25830..26363) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159860.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene rplF CDS complement(26377..26769) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062611.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene rpsH CDS complement(26801..27106) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625879.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene rpsN CDS complement(27120..27659) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331162.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene rplE CDS complement(27674..27988) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729185.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene rplX CDS complement(27999..28370) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613954.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene rplN CDS complement(28533..28787) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130100.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene rpsQ CDS complement(28787..28978) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644741.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 gene rpmC CDS complement(28978..29388) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941208.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene rplP CDS complement(29401..30102) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene rpsC CDS complement(30120..30452) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223844.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 gene rplV CDS complement(30467..30745) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027275662.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene rpsS CDS complement(30760..31584) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004709246.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene rplB CDS complement(31604..31906) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159841.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 gene rplW CDS complement(31903..32508) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218934.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene rplD CDS complement(32525..33154) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863274.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 gene rplC CDS complement(33187..33498) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 gene rpsJ CDS complement(33963..34133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 34357..35580 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951396.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 sequence15 source 1..34830 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 407..1993 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210692.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene purH CDS 2048..3337 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866856.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene purD CDS complement(3409..4065) product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355296.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(4119..4394) product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210689.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 gene hupA CDS complement(4582..5172) product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210688.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(5245..5919) product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095016.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 gene nfi CDS complement(5912..6976) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137619.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene hemE CDS complement(7094..7867) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166081.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene nudC CDS 7969..8466 product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210683.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene rsd CDS 8819..10753 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298956.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene thiC CDS 10746..11414 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849921.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene thiE CDS 11417..12178 product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210680.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS 12162..12362 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815386.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene thiS CDS 12364..13143 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217273.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS 13143..14267 product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210678.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene thiH CDS complement(14323..14712) product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211819.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene arnF CDS complement(14709..15053) product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211820.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene arnE CDS complement(15050..16705) product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211821.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene arnT CDS complement(16692..17606) product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169389.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene arnD CDS complement(17609..19588) product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211823.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene arnA CDS complement(19585..20568) product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816394.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene arnC CDS complement(20561..21709) product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704927.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene arnB CDS complement(22376..26602) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653944.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene rpoC CDS complement(26731..30759) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503453.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene rpoB CDS complement(31087..31455) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210675.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene rplL CDS complement(31519..32016) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210674.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene rplJ CDS complement(32341..33045) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165803.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 gene rplA CDS complement(33049..33477) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210672.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene rplK CDS complement(33638..34183) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210671.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene nusG CDS complement(34185..34568) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210670.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene secE sequence16 source 1..27078 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(84..2906) product autotransporter serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036491.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS complement(3622..4800) product DUF3298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042030482.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 5177..6130 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212290.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene coaA CDS complement(6210..7391) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704523.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(7410..8618) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368095.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 8937..9857 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095771.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS complement(9916..10881) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815379.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene birA CDS complement(10878..11915) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175719.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene murB CDS complement(12138..12407) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097246.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene yccX CDS 12566..13150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246043.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 13234..14229 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815405.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS complement(14309..14851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(14931..16682) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047951.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS 17064..18281 product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869174.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene dpaL CDS 18317..19501 product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421980.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS 19592..21184 product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812114.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 21264..22553 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807816.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 23068..23613 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816736.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS 23653..24072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 note possible pseudo, internal stop codon CDS 24160..25797 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816737.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene fdhF note possible pseudo, internal stop codon rRNA complement(26191..26301) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence17 source 1..21412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(721..796) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(800..874) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(1078..1162) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(1176..1251) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS 1934..3712 product two-component system sensor histidine kinase AtoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559125.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene atoS CDS 3709..5085 product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene atoC CDS 5393..6052 product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850540.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene atoD CDS 6055..6720 product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693164.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 6717..8039 product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580275.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 8067..9251 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786529.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene atoB CDS 9726..10523 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528764.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 gene hisN CDS 10558..11913 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706603.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(12036..13055) product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704302.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(13306..14901) product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113704.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(15011..15931) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807565.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(16155..17012) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368421.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 17456..18403 product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114954.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 18400..19563 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533810.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS 19821..21092 product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114957.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 sequence18 source 1..8455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(5281..5550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(5554..7203) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210212.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 misc_feature complement(7928..>8455) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208523.1:autotransporter YapL locus_tag LOCUS_33090 sequence19 source 1..5959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2705..5392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33100 sequence20 source 1..4724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(932..1471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(1496..1903) product ribonuclease toxin immunity protein CdiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704291.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene cdiI misc_feature complement(1932..>4724) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236626684.1:hemagglutinin repeat-containing protein locus_tag LOCUS_33130 sequence21 source 1..2290 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence22 source 1..1813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 1393..1469 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA 1605..1680 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 sequence23 source 1..1665 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1122 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815417.1:fumarate reductase (quinol) flavoprotein subunit locus_tag LOCUS_33140 sequence24 source 1..1513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 193..315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33150 sequence25 source 1..1248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..785 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005176097.1:HTH-type transcriptional regulator HdfR locus_tag LOCUS_33160 tRNA complement(885..960) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA complement(968..1044) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 sequence26 source 1..1059 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(118..474) product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209134.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 gene frdD CDS complement(491..880) product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175556.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 gene frdC sequence27 source 1..511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence28 source 1..438 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence29 source 1..383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@