COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..1176943 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3424..6501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 6594..7166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 7163..8872 product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640164.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 8874..9113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 9778..12312 product autotransporter adhesin YapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817383.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene yapE CDS 12498..15170 product autotransporter adhesin YapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817383.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene yapE CDS complement(15302..18469) product autotransporter adhesin YapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene yapE CDS complement(19273..20970) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(21317..22123) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453767.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(22145..22987) product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948217.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(23009..23683) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358543.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(23725..24693) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949059.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 25024..25908 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095399.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(26056..26358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 26993..27868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(27888..29315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 29402..29587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 tmRNA complement(29832..30196) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(30246..30728) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166313.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene smpB CDS 30946..31386 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815876.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 31373..31666 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848491.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(31709..32056) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172787.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene bamE CDS complement(32230..33891) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081869.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene recN CDS complement(33988..34869) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172782.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene nadK CDS 34973..35554 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172778.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene grpE CDS 35843..37243 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209412.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(37667..38344) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209663.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene ung CDS 38705..39088 product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209664.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene grcA CDS complement(39155..40474) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219193.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene srmB CDS 40785..41450 product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302911.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene trmN CDS 41781..42356 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209672.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene rpoE CDS 42408..43043 product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172760.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene rseA CDS 43047..43991 product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098322.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene rseB CDS 44004..44465 product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589049.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene rseC CDS complement(44575..44835) product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367588.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene ybiJ CDS 45148..46965 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098320.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene lepA CDS 46975..47964 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815754.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene lepB CDS 48201..48881 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172746.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene rnc CDS 48878..49804 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159414.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene era CDS 49814..50542 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209680.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene recO CDS 50710..51444 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815755.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene pdxJ CDS complement(51578..51853) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421273.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(51857..52105) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141823.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(52457..55249) product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209371.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene barA CDS 55451..56650 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167240.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene rlmD CDS 56671..58902 product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167242.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene relA CDS 58984..59778 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209374.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene mazG CDS 59942..61588 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167247.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene pyrG CDS 61765..63063 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209377.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene eno CDS 63177..63404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 63364..63564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 63645..63926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(63990..64313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 64967..66340 product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461272.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 66470..67735 product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815557.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene mtr CDS 67925..68161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 68130..68420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(68515..69480) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099330.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(69473..71944) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816198.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(71954..72685) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210856.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(72709..73266) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170228.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(73283..73822) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216613.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(73842..74360) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207028.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 74873..76120 product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816927.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene frsA CDS 76246..76581 product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174689.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene crl CDS 76774..77877 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095745.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene proB CDS 77890..79140 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011191846.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene proA CDS 79865..80050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(80147..80425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(80552..81184) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710149.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(81283..81606) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314753.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(81613..82125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(82112..83641) product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 84109..85431 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167571.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene brnQ CDS 85529..86893 product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167572.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene proY CDS 87728..90979 product autotransporter adhesin EhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386603.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene ehaA CDS 91714..97080 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704642.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 97705..101850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 101976..102209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(102304..102906) product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004707520.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(103178..103759) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167576.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 103925..104989 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208673.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene queA CDS 105238..106371 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208672.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene tgt CDS 106391..106723 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166605.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene yajC CDS 106799..108649 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208670.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene secD CDS 108660..109628 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167586.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene secF CDS complement(109707..110756) product low conductance mechanosensitive channel YnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559900.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene ynaI CDS complement(110821..111525) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216554.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene bioD CDS complement(111535..112575) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704794.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene bioB CDS 112695..113984 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205503.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene bioA CDS 114001..114864 product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099246.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 114898..116019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(116144..116614) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095605.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 116885..117484 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167676.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(117535..118059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(118476..118928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(119019..119588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(119633..120121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(120156..120602) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095605.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(120606..121193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(121277..121903) product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095607.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 122217..122666 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004716459.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene nrdR CDS 122673..123788 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167588.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene ribD CDS 123891..124361 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166502.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene ribE CDS 124415..124849 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208665.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene nusB CDS 124935..125903 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742107.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene thiL CDS complement(125953..127818) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006791.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene dxs CDS complement(127856..128758) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816905.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene ispA CDS complement(128758..129000) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208660.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene xseB CDS 129075..129242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 129413..130855 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816391.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 130992..132446 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668687.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene thiI CDS 132651..133109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 133145..133885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 133994..134524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879781.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 134566..134877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 134928..135149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(135284..136204) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085064.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(136793..137011) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193665.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(137008..137469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201267.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 137879..139342 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095848669.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 139494..140738 product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044296.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene agp CDS complement(140827..141414) product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367984.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene yajL CDS 141545..142036 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167608.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(142091..142411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(142417..142884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 143488..143907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 143920..145440 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813871.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 145478..146479 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813864.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(146691..147659) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157737.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(147656..148636) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157734.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(148629..150110) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081001.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(150227..151210) product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816705.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(151869..152771) product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210586.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene araC CDS complement(152875..153879) product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210587.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene araH CDS complement(153895..155418) product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694981.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene araG CDS complement(155586..156575) product arabinose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816287.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 156975..158651 product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210590.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 158716..160218 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816285.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene araA CDS 160588..161286 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169913.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene araD CDS complement(161344..162024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(162056..163531) product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167629.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene ampG CDS complement(163578..164177) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095854.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 164487..164783 product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261442.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene bolA CDS 165103..166407 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208643.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene tig CDS 166561..167145 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095857.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene clpP CDS 167287..168561 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130305.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene clpX CDS complement(168572..168727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 169562..172129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 173134..175761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 175956..178322 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367948.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene lon CDS 178506..178778 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene hupB CDS 179004..180890 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167642.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene ppiD CDS 181061..181417 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(181438..182127) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817227.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene queC CDS 182399..183526 product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815922.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene pdxB CDS 183713..184723 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209726.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 184723..185532 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283590.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene truA CDS 185541..186206 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098139.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(186528..187589) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533659.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(187817..187975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(187972..188184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(188213..188836) product DUF5420 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098086.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 189080..189589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096329.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 189768..189905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(189954..190184) product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096102.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(190217..190495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011057.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(190522..190767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(190767..191453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(191643..192086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(192286..192498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(192499..192750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(192780..193196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951323.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(193196..194059) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098079.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(194074..194268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(194265..194441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(194487..195062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(195533..195748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(195759..195968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(195971..196219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(196236..196406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 196786..197124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(197702..198724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(199137..199865) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133087235.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 199973..200203 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067458.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 200250..200717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 200739..201170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 201227..201490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 201397..201630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 201623..202543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065666.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 202533..204965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 204965..205420 product recombination protein NinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705713.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 205420..205707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 205704..206288 product recombination protein NinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813671.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 206285..206632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 206907..207509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 208143..208562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 208555..208947 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816103.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 208962..209399 product lysis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095972.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 209534..209917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 210369..210548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(210576..210797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 210832..211395 product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816478.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 211392..212963 product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816477.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 212966..214387 product DUF4055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267980.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 214443..215468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211721.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 215568..216266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 216280..217260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390337.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 217276..218778 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096315.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 218763..219374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 219371..219856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211718.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 219856..220215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211716.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 220208..220633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931438.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 220630..221031 product DUF4128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211714.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 221096..221773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 221815..222168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 222231..222476 product DUF1799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071525538.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 222644..223399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(223761..224285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(224507..225355) product phage repressor protein/antirepressor Ant inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835342.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 225714..226676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 226819..227604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 227747..228343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 228431..231391 product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019209152.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 231397..231621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 231693..232043 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816464.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 232043..232813 product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211709.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 232826..233557 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096343.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 233545..234144 product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211700.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 234291..237527 product host specificity protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211698.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 238538..240136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(240267..240980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 241047..241220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 241303..241449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 241687..242055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 242052..242264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(242354..243115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 243690..244616 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209729.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene accD CDS 244704..245981 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815926.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene folC CDS 245974..246681 product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209731.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene dedD CDS 246810..247307 product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158480.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene cvpA CDS 247353..248870 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098134.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene purF CDS 249034..249609 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706171.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(249624..250526) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815929.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 250772..251317 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706165.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene yfcE CDS 251332..251874 product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815932.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene yfcD CDS 251930..252406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(252468..254624) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082007.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene pta CDS complement(254699..255901) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171756.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene ackA CDS 256338..256790 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171754.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene yfbV CDS 257012..257518 product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159196.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 257595..258254 product hexitol phosphatase HxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203415.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene hxpA CDS 258815..259048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(259112..262045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 262436..262573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(262647..263501) product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295322.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene cnoX CDS complement(263577..264353) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208574.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(264373..265035) product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167777.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene tesA CDS 265003..265689 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208572.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 265686..268121 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208571.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 268802..271954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 272052..272954 product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705524.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene yddG CDS complement(273231..273566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(273566..273835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175303.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(273914..274156) product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074401.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(274515..274742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 274996..275892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 275944..276534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 276584..277318 product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951133.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(277348..278424) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208570.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene purK CDS complement(278421..278930) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208569.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene purE CDS complement(279104..279829) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167787.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(279847..280341) product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095923.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene ppiB CDS complement(280453..281208) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119135.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 281464..283773 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460252.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 283776..284330 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460251.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 284342..285208 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693381.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 285282..285731 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668289.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 285989..287377 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222677.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene cysS CDS 287455..289752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(289871..290239) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722027.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(290372..290602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 290699..290857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 tRNA complement(291221..291297) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 291500..292387 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816853.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene folD CDS 292595..293782 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704179.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 294034..294561 product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(294636..295727) product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705623.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene ompC CDS complement(296076..296303) product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296778.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 296548..296772 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366425.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 296981..297241 product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419130.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 297555..297977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 298046..298225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 298535..299182 product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704095.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene leuE CDS 299243..299602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 299626..299856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 300570..301271 product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene endA CDS 301510..301827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(302123..302737) product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602086.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene prfH CDS complement(302734..303873) product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528894.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(304088..304705) product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702296.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 304918..305517 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209770.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 305536..306456 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209769.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 306468..307106 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209768.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 307103..308860 product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215255.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 308916..310247 product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209766.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 310244..310654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209765.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(310651..311019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 311855..312058 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167881.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene tatA CDS complement(312125..313090) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004712243.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene lipA CDS complement(313083..313742) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218201.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene lipB CDS complement(313882..314301) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550737.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(314454..314717) product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858718.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene ybeD CDS complement(314836..316047) product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210323.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene dacA CDS complement(316214..317266) product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167887.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene rlpA CDS complement(317307..318416) product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816839.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene mrdB CDS complement(318438..320339) product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167891.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene mrdA CDS complement(320364..320834) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210328.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene rlmH CDS complement(320838..321155) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894623.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene rsfS CDS complement(321283..321945) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210330.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene nadD CDS complement(321947..322969) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210331.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene holA CDS complement(322966..323517) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816836.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene lptE CDS complement(323532..326114) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816835.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene leuS CDS complement(326349..327074) product glutamate/aspartate ABC transporter ATP-binding protein GltL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631388.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene gltL CDS complement(327074..327757) product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272809.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene gltK CDS complement(327761..328498) product glutamate/aspartate ABC transporter permease GltJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020944.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene gltJ CDS complement(328588..329484) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167919.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(329906..331438) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210341.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene lnt CDS complement(331446..332324) product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158416.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene corC CDS complement(332343..332816) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084477.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene ybeY CDS complement(332834..333889) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018040.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(334042..335496) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162740.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene miaB CDS 335664..336857 product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene ubiF tRNA complement(336944..337018) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(337046..337130) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(337159..337235) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(337437..337511) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(337559..337633) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(337664..337748) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(337752..337828) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(338050..339720) product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337077.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene asnB CDS complement(339940..341163) product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051352.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(341181..342338) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816828.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene nagA CDS complement(342359..343159) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262751.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene nagB CDS 343536..345488 product PTS N-acetyl glucosamine transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704747.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene nagE CDS 345687..347357 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287164.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene glnS CDS complement(347479..347928) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131702.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene fur CDS complement(348151..349200) product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094852.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene yjiA CDS complement(349331..349525) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(349611..351677) product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529393.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(352349..352864) product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163372.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene fldA CDS complement(352993..353262) product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163374.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene ybfE CDS complement(353378..354145) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215390.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene ybfF CDS 354290..354817 product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816824.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene seqA CDS 354840..356492 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216360.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene pgm CDS 356901..368459 product autotransporter BatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038821.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene batB CDS complement(368505..368933) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209647.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 369126..369299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 369284..369679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 369780..370538 product type 2 GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354507.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 370565..371356 product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114002.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene nei CDS 371440..372027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681729.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 372101..372319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 note possible pseudo, internal stop codon CDS 372738..374159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 375080..377167 product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096797.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 377172..377792 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096798.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene dmsB CDS 377794..378642 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526517.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(379010..379207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(379389..380282) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705975.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(380312..380998) product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366894.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 381042..381644 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163369.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(381908..382093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 382086..384365 product thiosulfate reductase PhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028230.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene phsA CDS 384378..384947 product thiosulfate reductase electron transport protein PhsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016236.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene phsB CDS 384944..385699 product thiosulfate reductase cytochrome B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092553.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(385744..386601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(386610..387233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(387432..388727) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210721.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 389472..392288 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168018.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene sucA CDS 392302..393537 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210727.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene odhB CDS 393752..394924 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210728.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene sucC CDS 394924..395835 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501094.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene sucD CDS 396669..398240 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene cydA CDS 398255..399394 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210731.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene cydB CDS 399522..399815 product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011191945.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene ybgE CDS 399964..400368 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165498.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene ybgC CDS 400365..401048 product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097532.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene tolQ CDS 401064..401495 product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393306.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene tolR CDS 401600..402601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 402728..404020 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165502.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene tolB CDS 404076..404588 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295306.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene pal CDS 404598..405347 product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165506.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene cpoB tRNA 405512..405587 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 405628..405703 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 405881..406102 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193665.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 406182..406748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 406811..407389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 407412..408272 product DUF4240 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449124.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 408296..408625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 408644..409114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194199.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(409117..409974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490841.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(410250..410459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 410655..411113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 411231..412298 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109196.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene aroG CDS complement(412360..413112) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301554.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene gpmA CDS complement(413266..414312) product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168049.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene galM CDS complement(414306..415472) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816804.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene galK CDS complement(415644..416309) product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331451.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene ytfE CDS complement(416445..417500) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210749.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene galT CDS complement(417493..418512) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene galE CDS complement(418678..419160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(419370..419942) product pyrimidine utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367243.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene rutB CDS complement(419975..420520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(420549..422027) product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096900.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene modF CDS complement(422274..423059) product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210754.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene modE CDS 423306..423437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 423650..424426 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210756.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene modA CDS 424426..425112 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158971.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene modB CDS 425112..426179 product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210758.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene modC CDS complement(426228..427052) product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210759.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 427780..429801 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816794.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene uvrB CDS complement(429874..432534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 433646..437275 product autotransporter adhesin YapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817383.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene yapE CDS 437440..437694 product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445805.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 437959..438441 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082056.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(438503..439414) product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816793.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene yvcK CDS 439795..440778 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168084.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene moaA CDS 440841..441356 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482393.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene moaB CDS 441371..441853 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097492.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene moaC CDS 441868..442113 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210773.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene moaD CDS 442115..442573 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545202.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene moaE CDS complement(442677..443771) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798133.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 444217..444801 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197907.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 444930..445631 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158923.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 445873..447204 product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007095.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene rhlE CDS 447471..448208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558837.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 448495..449049 product YfaZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001574701.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(449123..450016) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345437.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(450026..450793) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201787933.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(450815..451678) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245029.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(451678..452550) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703193.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(452543..453427) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532966.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(453429..454220) product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene garL CDS complement(454270..456021) product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083210.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene araD CDS 456339..457970 product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077417416.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 458040..459011 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478719.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 459061..459531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762799.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 459699..461177 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245695.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene amyA CDS complement(461245..462345) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083283.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 462800..464029 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094951.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 464086..465801 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966867.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 465896..466807 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714563.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(466922..468025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(468198..469406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(469406..469696) product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228052.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(469707..472253) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210844.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(472372..473076) product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484311.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(473162..473719) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074180.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(474200..474403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 475304..479422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 480168..481037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 481317..482096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 482771..483160 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072317.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(483378..484133) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894191.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 484588..486078 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211164.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene putP CDS 486544..488757 product intimin-like inverse autotransporter SinH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002432009.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene sinH CDS 488836..489795 product SinI family autotransporter-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149068.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 489914..498913 product DUF823/DUF824 repeat adhesin RatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837143.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene ratB CDS 499015..501246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(501382..502263) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816010.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(502544..502756) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193665.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(502753..503214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201267.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(503166..503315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 503778..503972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 504177..504623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 504841..505212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(505288..505437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 505546..505716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 505720..505947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 505959..506447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 506497..506757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 507164..507373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 507384..507755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 508094..508540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(508877..509353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(509350..511488) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444369.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene malQ CDS complement(511501..513945) product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209497.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene glgP CDS complement(514082..515515) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209498.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene glgA CDS complement(515603..516901) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817364.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene glgC CDS complement(516966..518960) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174773.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene glgX CDS complement(518962..521145) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174776.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene glgB CDS complement(521723..522658) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(522760..523683) product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210780.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene pbpG CDS complement(523773..524648) product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816789.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene pbpG CDS 525047..525637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(525661..526593) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168116.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene dusC CDS complement(526809..527093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(527308..528063) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829211.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene moeB CDS complement(528066..529307) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816750.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene moeA CDS 529526..530197 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004709152.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene folE CDS 530207..531373 product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816743.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene yeiB CDS complement(531370..532143) product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816726.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene sanA CDS complement(532315..534012) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168296.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(534309..534992) product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162334.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(534992..535387) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816723.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 536107..537456 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704981.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 537741..538352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 538608..539375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(539560..540459) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343890.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene rarD CDS complement(540530..541960) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816708.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene sbcB CDS 542161..542868 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812168.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(542929..543147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 543302..543622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(543914..544927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(545506..545859) product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015497.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(546020..547171) product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350150.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene fucO CDS 547490..548014 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704199.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 548690..550051 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978280.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 550054..550851 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027215.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 550871..551728 product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027214.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 551893..552591 product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969361.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 552588..552905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 553040..553315 product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259386.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 553312..553686 product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(553734..554783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(555054..555674) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211889.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene hisIE CDS complement(555668..556444) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168354.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene hisF CDS complement(556426..557163) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097846.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene hisA CDS complement(557170..557757) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168362.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene hisH CDS complement(557757..558824) product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168369.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene hisB CDS complement(558837..559895) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211894.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene hisC CDS complement(559892..561202) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816713.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene hisD CDS complement(561207..562106) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211896.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene hisG CDS complement(562480..563112) product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403797.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 563463..564314 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365825.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(564354..567089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(567621..568286) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211370.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene artM CDS complement(568289..568990) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001677.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene artQ CDS complement(569003..569734) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211368.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene artJ CDS complement(569752..570480) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367515.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene artP CDS complement(570648..571238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 571535..572017 product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083525.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene nikR CDS 572052..572966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(573025..574182) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene yqhD CDS 574337..574627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(574676..576415) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene ade CDS complement(576486..578291) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970160.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(578309..579619) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215577.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 579959..580849 product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114171.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(580896..581099) product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388926.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 581285..582817 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168494.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 582814..583374 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168495.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene cobU CDS 583380..584132 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168496.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene cobS CDS 584136..584744 product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241899.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 584767..585816 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168498.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene cobT CDS complement(586053..586763) product LuxR family transcriptional regulator AbaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene abaR CDS 587045..587452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 587554..588111 product acyl-homoserine-lactone synthase AbaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208102.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene abaI CDS complement(588174..588773) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816403.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene cobO CDS 589044..590240 product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368753.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene tyrB CDS 590828..591922 product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459939.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 591980..594421 product trimethylamine N-oxide reductase TorZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176787.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene torZ CDS 594688..596010 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225315.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(596095..597816) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815882.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(597968..599248) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815881.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(599779..600636) product thiosulfate reductase cytochrome B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070009.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(600650..601288) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309532.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 601962..603923 product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209698.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 603920..604813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(605060..605527) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070830.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(605800..607761) product dissimilatory sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070829.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene sirA CDS 608615..608956 product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974818.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene yajD CDS complement(608994..609485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(609616..612708) product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457967.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(612701..613795) product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481686.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene nrfD CDS complement(613792..614541) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481653.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 614765..616561 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481667.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 616573..617172 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457930.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(617279..618421) product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973447.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 618513..619424 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973450.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 619855..620283 product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295855.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene uspG CDS 620742..621134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(621280..622692) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(622689..623636) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014308.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(623673..624899) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703938.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(625078..625308) product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097727.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 626127..628742 product autotransporter adhesin YapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817383.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene yapE CDS 629042..629194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 629339..629689 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097111.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene hinT CDS 629700..630275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 630463..631497 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097107.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene nagZ CDS 631569..632108 product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170673.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene ycfP CDS 632365..633681 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213097.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(633726..634610) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366366.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(634835..638281) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816135.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene mfd CDS 638699..639901 product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170663.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene lolC CDS 639894..640598 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210923.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene lolD CDS 640598..641851 product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097096.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene lolE CDS 641876..642787 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170645.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene nagK CDS 642839..643690 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816137.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene cobB CDS 643720..644172 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094870.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 644184..644753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 644802..645446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(645516..646859) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392014.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(646870..647511) product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640948.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(647535..648206) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727135.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 648293..649186 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089870.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(649274..650515) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694560.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(650715..651638) product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052500.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene rihC CDS complement(651763..652809) product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705058.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene potD CDS complement(652874..653650) product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580316.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene potC CDS complement(653647..654525) product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799401.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene potB CDS complement(654506..655624) product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531604.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene potA CDS 656040..657269 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816138.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene pepT CDS complement(657345..658469) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816845.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 658755..659636 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098057497.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 659700..660320 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210628.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 660338..660703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 660902..661771 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291217.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene rluB CDS 662189..662530 product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174305.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 662554..662919 product SFCGS family glycine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368576.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 662919..663215 product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174302.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 663248..664045 product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392358.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 664070..664720 product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707606.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 664747..665886 product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262860.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 665870..666982 product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174293.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 666986..667726 product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174290.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 667832..669769 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174285.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 670361..671668 product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418812.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene dcuC CDS 671719..672990 product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694556.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(673068..673829) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816402.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 674141..675187 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816401.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene sohB CDS 675480..675692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(675818..676066) product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210623.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 676456..679041 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304419.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene topA CDS 679255..680229 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210621.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene cysB CDS complement(680287..680877) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366227.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene ribA CDS 681084..681815 product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816261.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene pgpB CDS 682022..682330 product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165840.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 682337..683506 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210615.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene lapB CDS 683568..684275 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027957.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene pyrF CDS 684272..684592 product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096377.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene yciH CDS 684650..685114 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816204.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 685243..685902 product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210849.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene proQ CDS 685922..687958 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170217.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene prc CDS 688164..689036 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210847.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene htpX CDS complement(689096..690919) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(691188..691631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(691783..692799) product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165644.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene purR CDS 693378..693923 product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170142.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 694097..694969 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816220.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 695198..695416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704882.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 695751..697679 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816225.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene thrS CDS 697884..698225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 698320..698517 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211834.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene rpmI CDS 698556..698912 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211833.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene rplT CDS 699261..700244 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211832.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene pheS CDS 700261..702648 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211831.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene pheT CDS 702653..702949 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211830.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene ihfA CDS 703042..704046 product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816398.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene btuC CDS 704030..704788 product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050983.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene btuD CDS complement(704822..705493) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102109.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 tRNA complement(705627..705702) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(705881..706741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 707488..707877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(707925..708392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704702.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(708448..709482) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118268.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 709747..710892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 711231..711461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(711492..712553) product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816022.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene ltaE CDS 712979..713446 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209795.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 713456..714145 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398720.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 714246..714611 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971212.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 714726..715745 product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105884.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene lplA CDS complement(715805..716851) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169413.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(717047..717868) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169416.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 718272..720560 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211813.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene ppsA CDS 720887..723775 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001334788.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(723860..724963) product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211812.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene ydiK CDS 725263..728316 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211811.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 728340..728762 product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637982.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene menI CDS 728797..729780 product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169583.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene zntB CDS complement(729831..730754) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157412.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene ttcA CDS 731214..731501 product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228052.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(731628..735179) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816353.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene nifJ CDS 735689..735928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(735987..736418) product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214605.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene hslJ CDS complement(736489..737475) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210998.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 737656..740286 product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816351.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 740279..740473 product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366326.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 740483..740806 product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169623.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(740858..741463) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366346.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene azoR CDS 741669..745556 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072088404.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene hrpA CDS complement(745629..746585) product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211018.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene ydgH CDS 747053..748585 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816338.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene pntA CDS 748600..750006 product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169667.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene pntB CDS complement(750083..751027) product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096866.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene uspE CDS complement(751193..752650) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428186.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(752845..753594) product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004862555.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene fnr CDS 754261..756171 product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168961.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 756266..756793 product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132914.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 756924..758297 product Fe-S-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168965.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 758300..759580 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816576.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 759570..760703 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172653834.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 760706..761428 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117262.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 761418..761924 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132911.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 761921..762238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 762773..763489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 763684..764346 product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096647.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(765206..765817) product virulence factors two-component system response regulator BvgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930609.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene bvgA CDS complement(766262..767827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(767828..769042) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096690.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(769084..771177) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739071.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(771289..774891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 775093..775227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 775762..777015 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 777037..779217 product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105688.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 779219..779836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 779838..781382 product TolC family type I secretion outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938786.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 781646..781933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 782091..784019 product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309488.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene rlhA CDS 784073..786523 product DUF3772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298473.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(786555..787430) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533591.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(787487..789532) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973426.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(789717..790559) product heme ABC transporter substrate-binding protein ShuT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302516.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene shuT CDS complement(790571..792607) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966626.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 793144..794445 product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209066.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene hutW CDS 794539..795051 product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020040.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene hutX CDS 795048..795668 product anaerobilin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189351.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene chuY CDS 795703..796701 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175607.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 796688..797458 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209058.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(797498..798139) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210501.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(798278..799141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(799453..799779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(799814..800668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(801040..801441) product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731552.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 801606..802268 product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098725.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene qseB CDS 802265..803620 product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098726.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene qseC CDS 803664..804326 product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221574.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene qseB CDS 804323..805672 product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673390.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene qseC CDS complement(805726..806109) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024297.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(806120..807535) product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169462.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene eptA CDS 807425..807892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 807967..808656 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080191.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 808785..809489 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904011.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 809499..810347 product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576816.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene modD CDS complement(810361..810936) product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170500.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene mntP CDS 811614..812237 product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295335.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene iprA CDS complement(812787..813071) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171826.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene ilvN CDS complement(813074..814768) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298157.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene ilvB CDS complement(815111..816049) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948563.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 816142..816564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948562.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 816674..818113 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462118.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 818100..818453 product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532978.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 818473..819522 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 819639..820073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 820146..820493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001999997.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(820544..821551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 821830..822258 product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295855.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene uspG CDS 822417..823676 product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802486.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 823687..824469 product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109278.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 824883..834620 product autotransporter adhesin YapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211638.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene yapH CDS 834718..835062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(835090..835791) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225220.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(835973..836554) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096509.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 836494..836727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 836724..837872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 837925..838353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 838481..839230 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705162.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 839269..839811 product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151855.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene kptA CDS 839821..840624 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070651736.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 840684..841118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(841171..842157) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209763.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 842478..842936 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070690482.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(842986..843888) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817251.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 844311..844490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 844565..847600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 847775..850426 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene acnA CDS 850449..851396 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807817.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(851403..852494) product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533013.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 852789..856052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 856518..856862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 857003..857554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 857757..859148 product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050999.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 859292..859639 product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096796.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 860019..860747 product osmoprotectant ABC transporter permease OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096821.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene osmY CDS 860767..861711 product osmoprotectant ABC transporter substrate-binding protein OsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211196.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene osmX CDS 861723..862370 product osmoprotectant ABC transporter permease OsmW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379676.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene osmW CDS 862371..863510 product osmoprotectant ABC transporter ATP-binding protein OsmV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096823.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene osmV CDS complement(863596..864345) product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene ydfG CDS complement(864440..865111) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366772.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene bioD CDS complement(865338..866558) product ROK family transcriptional regulator Mlc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169799.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene mlc CDS 866800..868104 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091806.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 868119..868265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(868332..869729) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210578.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene fumC CDS 869994..871520 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043382.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 871825..873822 product formate-dependent uric acid utilization protein AegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078902.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene aegA CDS complement(873874..874488) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169439.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 874727..876100 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210937.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 tRNA 876279..876355 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 876617..877747 product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070707.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene prpF CDS complement(877802..878638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(878745..879524) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184872.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene bamE CDS complement(879607..886104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(886143..886838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(887041..887430) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705537.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 888110..888940 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305806.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 888937..889407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 889783..891195 product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816382.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene pykF CDS 891536..891748 product major outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002908860.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(892130..893053) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165628.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 893352..893867 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366280.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene tpx CDS complement(893939..895498) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210983.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene tyrR CDS 895497..895682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 895787..897055 product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(897102..898163) product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169550.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(898160..899557) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169547.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(899520..899768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(899867..900211) product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050078551.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene pspC CDS complement(900211..900444) product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210976.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene pspB CDS complement(900520..901191) product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene pspA CDS 901369..902400 product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210974.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene pspF CDS 902622..904217 product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816365.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene sapA CDS 904214..905179 product putrescine ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210972.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene sapB CDS 905166..906056 product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210971.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene sapC CDS 906056..907051 product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210970.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene sapD CDS 907051..907863 product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169510.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene sapF CDS 908051..908839 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506494.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene fabI CDS complement(908893..909177) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368017.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene ppnP CDS 909411..911354 product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096382.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(911414..911623) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159934.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 912021..912524 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210404.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(912550..912726) product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457334.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 912924..913496 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705928.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 913706..915073 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624289.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene sdaA CDS complement(915120..915938) product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211061.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene rlmA CDS complement(916070..916276) product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212220.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene cspA CDS complement(916464..916673) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159934.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(916964..917653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(918082..919062) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169841.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 919289..920995 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661416.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 921114..921695 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169884.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene rsxA CDS 921695..922273 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169885.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene rsxB CDS 922266..924425 product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816279.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene rsxC CDS 924426..925475 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231887.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene rsxD CDS 925485..926114 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816276.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene rsxG CDS 926111..926806 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210601.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 926818..927453 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705230.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene nth CDS 927686..928291 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816371.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene gstA CDS complement(928357..929217) product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165910.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene pdxY CDS complement(929349..930620) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816372.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene tyrS CDS complement(930733..931380) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282319.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene pdxH CDS complement(931554..931853) product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218323.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(931885..932988) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366864.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene anmK CDS complement(933094..933546) product virulence master transcriptional regulator RovA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210955.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene rovA CDS complement(933852..934376) product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266857.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 935077..935484 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165939.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene gloA CDS 935632..936285 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169454.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene rnt CDS complement(936361..936696) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366878.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 937010..937588 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169447.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene sodB CDS complement(937649..938764) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638288.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(938748..939473) product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097134.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(939730..940509) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816079.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(940537..941514) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213083.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene holB CDS complement(941511..942146) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170710.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene tmk CDS complement(942149..943168) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217396.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene mltG CDS 943184..943402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(943323..944564) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044679.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene fabF CDS complement(944652..944888) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220787.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene acpP CDS complement(945042..945776) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367190.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene fabG CDS complement(945810..946739) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816075.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene fabD CDS complement(946762..947715) product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288151.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene fabH CDS complement(947722..948750) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170740.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene plsX CDS complement(948765..948935) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544470.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene rpmF CDS complement(948952..949473) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210930.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene yceD CDS 949724..950314 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367195.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(950381..951307) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157930.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene rluC CDS 951946..955128 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816074.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene rne CDS complement(955222..955512) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170755.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 955904..957472 product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228454.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 957472..958050 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215981.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 958366..959382 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079502.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene trpD CDS 959386..960747 product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050075568.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene trpCF CDS 960812..962002 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076940213.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene trpB CDS 962002..962808 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169334.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene trpA CDS complement(962878..964167) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208684.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene phoR CDS complement(964182..964871) product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208685.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene phoB CDS 965083..966342 product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208687.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene sbcD CDS 966339..970019 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208688.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 970144..971055 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160563.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene rdgC CDS complement(971205..971342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 971298..972098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 972095..972580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 973058..974113 product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815802.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 974128..977256 product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209793.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 977253..980333 product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815800.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene mdtC CDS 980351..981760 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661347.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 981784..983178 product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162191.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene baeS CDS 983175..983882 product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216825.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene baeR CDS 983978..984871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 984868..985731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 986089..987099 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 987176..987676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 987686..988987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 989027..989986 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974651.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 990007..990936 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703939.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 991091..992095 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232704.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(992105..994024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 994205..995581 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172489.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene yegQ CDS complement(995985..996704) product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162963.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene fadR CDS 996989..997516 product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816443.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene dsbB CDS complement(997593..998465) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176736.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 998681..999862 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(999913..1000596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(1000639..1001055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 1001462..1001701 product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096288.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene yedF CDS 1001983..1002858 product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746206.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(1002922..1003368) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162992.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(1003462..1004118) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211740.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(1004318..1004584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(1004615..1005628) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223847752.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(1005699..1005956) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162995.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 1006210..1006896 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220631.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene minC CDS 1006920..1007735 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163000.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene minD CDS 1007739..1008008 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366053.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene minE CDS complement(1008079..1008612) product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060300.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(1008640..1009764) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162182289.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene rnd CDS complement(1009851..1011533) product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169210.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene fadD CDS complement(1011641..1012342) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211184.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene tsaB CDS complement(1012418..1014340) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849399.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 1014586..1014930 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169202.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 1015378..1016613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 1017093..1018358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 1019729..1019950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 1020406..1021632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(1021706..1022221) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096726.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 1022362..1022829 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096727.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(1023121..1024008) product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(1024035..1024367) product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163022.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene mdtI CDS complement(1024354..1024722) product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163026.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene mdtJ CDS complement(1025235..1025876) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800512.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene kdgA CDS complement(1025976..1026680) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene pgl CDS complement(1026755..1028230) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211191.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene zwf CDS 1028599..1029435 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169198.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 1029684..1031126 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169197.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene pyk CDS complement(1031194..1032174) product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816519.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene lpxM CDS complement(1032449..1033780) product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228437.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene mepM CDS complement(1033801..1034508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 1034893..1035651 product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169189.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene znuC CDS 1035648..1036436 product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211197.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene znuB CDS 1036649..1038334 product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208766.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(1038483..1038707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 1038694..1039263 product DUF1523 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383227.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 1039398..1040717 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097432.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene rimO CDS 1040914..1041645 product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171154.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 1041754..1042248 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828387.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(1042255..1043412) product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149787.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene rlmC CDS complement(1043438..1043932) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208763.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 1044048..1044245 product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705982.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(1044235..1044957) product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189159.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene nfsA CDS 1044925..1045143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 1045418..1045687 product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809455.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(1045749..1046756) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163065.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene ruvB CDS complement(1046796..1047407) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211199.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene ruvA CDS complement(1047611..1048135) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211201.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene ruvC CDS complement(1048135..1048878) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165984.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(1048929..1049366) product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211203.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene nudB CDS complement(1049368..1051137) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169176.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene aspS CDS complement(1051150..1051410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 1051784..1052179 product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165969.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 1052227..1052613 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141564.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 1052751..1053482 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019588.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene cmoA CDS 1053475..1054449 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569029.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene cmoB CDS 1054461..1055282 product YaeF family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360445.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(1055330..1056100) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211209.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene cutC CDS 1056218..1057375 product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(1057433..1057996) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602283.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(1058629..1058814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(1059045..1060055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(1060798..1061064) product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666413.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(1061054..1062133) product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680420.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene yedE CDS 1062687..1063544 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816375.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 1063553..1065562 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169471.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(1065618..1066889) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297939.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(1066969..1068174) product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene rhmD CDS complement(1068193..1069095) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858487.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(1069123..1069908) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894191.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(1070199..1072970) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309459.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(1073819..1076725) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001358436.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(1076837..1079626) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309459.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(1080486..1083347) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309459.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 1084183..1084650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 1084881..1086596 product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175115.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(1086638..1087126) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766220.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 1087386..1088180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(1088230..1089453) product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704030.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 1089876..1090364 product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005046814.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene eco CDS complement(1090425..1092593) product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208668.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene etk CDS complement(1092556..1093038) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097923.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(1093035..1094201) product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706056.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 1095025..1096716 product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816539.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene dauA CDS complement(1096807..1097190) product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707067.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(1097455..1098309) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811065.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene kdsA CDS complement(1098380..1099204) product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816540.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene sirB1 CDS complement(1099201..1099593) product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211234.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(1099644..1100480) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816541.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene prmC CDS complement(1100488..1101573) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161322.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene prfA CDS complement(1101609..1102871) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169107.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene hemA CDS 1103130..1103753 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130678.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene lolB CDS 1103750..1104592 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene ispE CDS 1104846..1105676 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211240.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene prs CDS complement(1105820..1106092) product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161340.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene ychH CDS 1106395..1106985 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816544.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene pth CDS 1107983..1108687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 1108946..1110688 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211212.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene argS CDS complement(1110764..1112341) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816533.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene murJ CDS complement(1112481..1113143) product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097145.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(1113158..1113742) product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468182.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene rimJ CDS 1113878..1115086 product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816537.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene mdtH CDS 1115160..1115726 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211218.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(1115781..1116944) product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018656.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene rlmG CDS complement(1116941..1117501) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169125.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(1117526..1119187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(1119231..1119968) product zinc-binding phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283667.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene ycdX tRNA 1120273..1120360 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(1120535..1123342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(1123923..1125485) product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269228.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene eptB CDS complement(1125915..1126688) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919864.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene surE CDS 1126892..1127986 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169097.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene ychF CDS complement(1128045..1129418) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123756.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene dbpA CDS complement(1129644..1130654) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224898.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(1130657..1131646) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200039.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 1131864..1132760 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460107.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(1132843..1133691) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287875.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene panC CDS complement(1134818..1135708) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene focA CDS 1136292..1136915 product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165876.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene ycaC CDS complement(1137010..1137855) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989022.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 1139038..1139955 product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096698.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene wzz(fepE) CDS complement(1140011..1141264) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170624.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene icd CDS 1141396..1142019 product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046083206.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene rluE CDS 1142012..1142464 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210912.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 1142557..1143660 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210913.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene mnmA CDS 1143663..1144286 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297479.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene hflD CDS 1144313..1145683 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210915.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene purB CDS complement(1145752..1147002) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene pepT CDS 1147456..1148118 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210414.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(1148168..1148407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(1148600..1148878) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512149.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(1148961..1149233) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369862.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 tRNA complement(1149465..1149551) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(1149558..1149631) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(1149671..1149746) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(1149899..1150447) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220475.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene pgsA CDS complement(1150514..1152346) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170283.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene uvrC CDS complement(1152339..1152995) product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211176.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene uvrY CDS 1153456..1153764 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704428.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(1153746..1154486) product phage N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066917.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(1155354..1155674) product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367415.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene hspQ CDS complement(1155828..1156157) product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213046.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene tusE CDS 1156342..1157148 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(1157200..1157544) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528651.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(1157631..1158230) product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122865.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene caiE CDS 1158548..1159477 product thiosulfate utilization transporter TsuA/YeeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492327.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene tsuA CDS 1159482..1159709 product thiosulfate utilization sulfurtransferase TsuB/YeeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985273.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene tsuB tRNA complement(1159898..1159970) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(1160031..1160255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 tRNA complement(1160413..1160500) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(1160858..1161271) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170853.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 1161400..1161858 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367424.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene mgsA CDS complement(1161914..1163968) product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816055.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene helD CDS 1164219..1164674 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704910.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 1164686..1166833 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213063.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene yccS CDS complement(1166850..1167491) product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170872.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 1167725..1168210 product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213065.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene sulA CDS 1168226..1168486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 1168992..1170053 product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005047463.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene ompA CDS complement(1170136..1170591) product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226586.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene matP CDS 1170769..1172517 product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032900735.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 1172614..1173132 product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704907.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene fabA CDS 1173325..1175412 product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209782.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene ppk1 sequence02 source 1..525836 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 285..1046 product DUF4184 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963374.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1041..1865) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130548.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 2067..3659 product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112813.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene rtcR CDS complement(3731..6304) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167451.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene clpB CDS complement(6483..7214) product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040160.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene yfiH CDS complement(7211..8191) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079097.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene rluD CDS 8325..9056 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209469.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene bamD CDS 9241..10419 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849007.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(10515..11777) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368950.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(11859..12512) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391958.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(12548..13342) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 13533..14099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(14189..14548) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167434.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene rplS CDS complement(14602..15351) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393426.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene trmD CDS complement(15404..15946) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703198.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene rimM CDS complement(15956..16204) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166006.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene rpsP CDS complement(16423..17838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 18030..19154 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(19370..20665) product PTS N-acetylmuramic acid transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261745.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene murP CDS complement(20682..21587) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687190.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene murQ CDS complement(21761..22588) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704383.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(22649..24007) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098351.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene ffh CDS 24166..24957 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209455.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 25184..26470 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162097907.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(26529..27038) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004877244.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene luxS CDS complement(27188..27544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(27813..29375) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209452.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene gshA CDS complement(29447..29875) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209451.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(29872..30438) product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703238.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene yqaB CDS 30766..31326 product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170533.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene pagP CDS 31490..32599 product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096238.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene chaA CDS 32773..33807 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113689.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(33861..35096) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131734.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 35819..36793 product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065126.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 37043..38851 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065127.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 38885..40438 product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097435.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene gsiB CDS 40514..41434 product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065129.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene gsiC CDS 41446..42351 product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524243.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene gsiD CDS 42458..43525 product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065131.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 43540..44358 product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040202.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 tRNA complement(44451..44526) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(44712..46010) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222185.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene gltX tRNA 46389..46464 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 46508..46583 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 46612..46687 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 46708..46783 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(46908..47126) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092249.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(47142..49163) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443697.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene ligA CDS complement(49230..50123) product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139343690.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene zipA CDS 50426..51106 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254835.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene cysZ CDS complement(51174..52319) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(52517..53431) product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592106.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(53431..54567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(55158..56156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(56332..57666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545573.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(57751..58797) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105806.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(58801..60516) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261041.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(60574..61887) product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene rfbH CDS complement(61915..62994) product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene rfbG CDS complement(62999..63772) product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648783.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene rfbF CDS complement(63788..64762) product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018226.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(64772..65320) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973711.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene rfbC CDS complement(65429..66328) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023616.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene rfbD CDS complement(66474..67565) product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299252.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene wzzE CDS 68177..69145 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098198.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene cysK CDS 69605..69862 product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208488.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene ptsH CDS 69909..71636 product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208490.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene ptsI CDS 71828..72337 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392561.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene crr CDS complement(72397..73731) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815859.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(73737..74414) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172242.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 74631..75818 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815858.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 75823..77787 product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050129821.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(77851..78138) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172322.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(78135..78326) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172325.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(78480..79367) product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849665.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene cysM CDS complement(79397..80491) product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172252.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene cysA CDS complement(80481..81356) product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208510.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene cysW CDS complement(81356..82192) product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208511.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene cysT CDS complement(82192..83199) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815856.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(83726..84022) product SymE family type I addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703845.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(84448..86742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(86816..87247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(87307..88200) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208519.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(88341..88916) product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098207.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(88965..89390) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208525.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 89622..90068 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815835.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(90160..90405) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103251.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 90530..90664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(90961..91560) product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528376.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene napC CDS complement(91573..92025) product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835174.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene napB CDS complement(92022..92966) product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694327.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene napH CDS complement(92966..93718) product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694328.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene napG CDS complement(93740..96223) product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778064.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene napA CDS complement(96220..96501) product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165688.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene napD CDS complement(96485..96916) product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208536.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene napF CDS 96843..97037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 97367..99061 product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350312.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene narQ CDS 99104..99733 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165685.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 99961..100320 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208548.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 100325..101461 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815825.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene dapE CDS 101458..102147 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208550.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 102135..102338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(102348..102632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(102629..103102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550170.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(103300..105345) product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208552.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(105448..105900) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172363.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(105996..106796) product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365467.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(107077..107790) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208555.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(107855..108892) product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208557.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene bamC CDS complement(108909..109787) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494019.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene dapA CDS 109889..110503 product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227068.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 110500..110973 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068682.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene bcp CDS complement(111059..112126) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208563.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 112453..113919 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217569.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 113935..114285 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208565.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene arsC CDS 114314..114724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(114796..117015) product autotransporter YejO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554210.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene yejO CDS complement(117468..118655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(119047..119736) product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815818.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene hda CDS complement(119848..121122) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072791.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(121322..122221) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366366.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(122329..122955) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162121.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene upp CDS 123268..124305 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301832.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene purM CDS 124305..124940 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098242.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene purN CDS 125080..125631 product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209779.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene speG CDS 125758..126381 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403787.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 126341..126514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(126521..126724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(126815..127153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096037.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 127423..128481 product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209964.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene epd CDS complement(128544..129341) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172521.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene thiD CDS complement(129338..130150) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694556.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene thiM CDS 130622..130960 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209468.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene raiA CDS 131452..132609 product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815647.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene pheA CDS complement(133109..133288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 133257..135857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(135912..137780) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392246.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(137940..139103) product metallo-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977198.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(139121..140515) product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368319.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(140603..141301) product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872391.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(141313..142266) product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(142531..143592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(143698..146010) product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815593.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene mrcB CDS complement(146127..148523) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298481.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene hrpB CDS 148840..150051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 150051..151166 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167641.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 151316..152020 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298442.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene sfsA CDS 152219..152674 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209354.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene dksA CDS 152747..153631 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095631.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene gluQRS CDS 153767..155227 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174639.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene pcnB CDS 155231..155719 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156774.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene folK CDS complement(155730..157022) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298440.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(157135..157788) product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647854.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(157834..158298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(158380..159150) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209344.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(159147..160073) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167154.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 160344..161006 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651604.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene can CDS complement(161062..161598) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368206.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene hpt CDS complement(161834..162433) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080191.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(162867..163178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(163292..163561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 163992..164315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 164433..164783 product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167131.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 164917..165777 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209338.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene speE CDS 165820..166617 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156788.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene speD CDS complement(166671..167792) product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167445.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene tyrA CDS complement(168206..169279) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167443.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 169519..170235 product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815646.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene btsR CDS 170241..170621 product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098344.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(170631..170948) product thiosulfate sulfurtransferase PspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473125.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene pspE CDS 171377..173056 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303114.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 173106..174278 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302127.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(174317..175639) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477481.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 175755..176657 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477420.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 176779..177615 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 177677..177895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(177989..178321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(178457..178837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(178869..179366) product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705161.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(179392..179559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170387.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 179701..180060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(180127..180459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370386.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(180492..180725) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004853132.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 181139..181369 product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380366.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene vapB CDS 181369..181773 product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770950.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene vapC CDS 181881..182180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(182315..183475) product DUF3396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104953.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(183729..184691) product DUF3396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104953.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(184866..186443) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098264.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene guaA CDS complement(186870..188339) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172545.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene guaB CDS 188591..189865 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815788.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene xseA CDS complement(189862..190089) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209811.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 190585..193398 product BB0821 family autotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039005.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(193447..194406) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172553.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 194857..196674 product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112454.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene kefB CDS complement(196752..198230) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882245.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene der CDS complement(198338..199519) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209814.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene bamB CDS complement(199531..200136) product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172568.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(200152..201426) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703166.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene hisS CDS complement(201544..202659) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556021.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene ispG CDS complement(202698..203582) product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098278.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene rodZ CDS complement(203647..204399) product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209819.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene pilW CDS complement(204475..205641) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098279.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(205930..206355) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172605.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene ndk CDS 206619..207497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(207514..208128) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005645090.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(208115..208903) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005568139.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(208910..209662) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693547.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene modA CDS complement(209779..210273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(210298..212649) product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175631705.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene pbpC CDS complement(212962..217929) product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815782.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(218035..219330) product voltage-gated ClC-type chloride channel ClcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096825.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene clcB CDS complement(219395..220690) product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081828.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene pepB CDS complement(220778..220978) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523621.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene iscX CDS complement(220996..221331) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004713939.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene fdx CDS complement(221335..223185) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196613.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene hscA CDS complement(223198..223716) product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209833.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene hscB CDS complement(223825..224148) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004702422.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene iscA CDS complement(224207..224593) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331711.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene iscU CDS complement(224654..225868) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene iscS CDS complement(225921..226424) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222202.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene iscR CDS complement(226624..227406) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940018.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene trmJ CDS complement(227430..228206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 228417..229220 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213305.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene suhB CDS 229261..230010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(230007..230732) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263776.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(230744..231760) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081833.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(231751..232389) product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815775.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(232400..232774) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957355.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(233010..234263) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098302.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 234583..235758 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815771.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene hmpA CDS complement(235813..236151) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717694.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene glnB CDS complement(236165..237784) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(237853..239196) product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene glrR CDS complement(239227..240267) product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072084141.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene qseG CDS complement(240274..241698) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216114.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(242519..246406) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211561.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene purL CDS 246759..247928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 note possible pseudo, frameshifted CDS 247910..248248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 note possible pseudo, frameshifted CDS complement(248273..248776) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene tadA CDS complement(248773..249453) product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370297.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene yfhb CDS 249685..249945 product 4Fe-4S dicluster ferredoxin YfhL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196285.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene yfhL CDS 249992..250366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(250460..251524) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208747.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 251712..252134 product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098717.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene trxC CDS 252215..252943 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098331.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene tapT CDS 253171..254529 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018051.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene pssA CDS 254718..255482 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703221.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(255556..257145) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095483.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene prfC CDS 257472..257786 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210636.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(257833..258273) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095481.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene rimI CDS complement(258245..258685) product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204030.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene holD CDS 258824..259852 product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209206.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene rsmC CDS complement(259931..260317) product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047539.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene ridA CDS 260546..261010 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175289.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(261075..262082) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209302.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene argF CDS 262257..262700 product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002940.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene rraB CDS 262731..263579 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972011.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 263634..264125 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(264132..264371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 264542..265642 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010829.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 265744..266022 product PTS sugar transporter subunit IIB SgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene sgcB CDS 266035..267348 product PTS sugar transporter subunit IIC SgcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460843.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene sgcC CDS 267387..268193 product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118614.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene sgcQ CDS 268319..268762 product SgcA family PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606406.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene sgcA CDS 268759..269409 product ribulose-phosphate 3 epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600614.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 269402..270184 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670738.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 270181..270840 product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070789.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene hxpB CDS 271464..271649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(271720..274575) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815475.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(274593..275042) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786399.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene holC CDS complement(275172..276683) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098951.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene pepA CDS 276939..278033 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420700.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene lptF CDS 278036..279112 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223173.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene lptG CDS 279250..279579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 279672..281201 product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189292.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(281239..282153) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846261.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(282190..283557) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291196.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(283612..285057) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078438.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(285154..286164) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357967.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(286221..287084) product tagatose-bisphosphate aldolase subunit KbaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022773.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene kbaY CDS complement(287126..288013) product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099368.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene yihU CDS 288203..289099 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520529.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 289148..289939 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059689.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(289996..290571) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096447.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 tRNA 290746..290830 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 291018..292274 product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032666220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 292522..293007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 293026..294819 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296385.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(294911..297349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(297652..298005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(298005..300020) product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene dndD CDS complement(300004..301638) product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene dndC CDS complement(301635..302630) product DNA sulfur modification protein DndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134924.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene dndB CDS 302883..303113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 303302..304894 product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333576.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(306101..306313) product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703404.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 306823..307938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 308107..308994 product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047369808.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 309426..312965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 313066..313884 product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101824524.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 314001..314453 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703393.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene radC CDS 314464..314826 product type IV toxin-antitoxin system YeeU family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007869729.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 314823..315182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 315313..316140 product DUF4942 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034461534.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 316395..316994 product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104390.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(317078..317782) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948175.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 318160..318369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 319153..319962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 321501..322400 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027274180.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 322516..323088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(323185..323799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(323925..324146) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193665.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(324146..324604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201267.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 326205..326414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(326531..327565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(327562..327840) product YrhB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634159.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(327912..328181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812455.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(328388..328723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209201.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(328766..329161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(329427..329816) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287876.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(329886..330728) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene panB CDS complement(330725..331582) product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002349114.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(332105..335038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(335857..338256) product trimethylamine-N-oxide reductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459941.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(338338..339432) product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(340293..341150) product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298833.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene citG CDS complement(341188..341724) product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368283.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene citX CDS complement(341728..342756) product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704362.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene citC CDS complement(342986..344530) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272879.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene citF CDS complement(344527..345402) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679317.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(345405..345704) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263227.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene citD CDS complement(345724..347031) product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512722.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(347267..347935) product two-component system response regulator MaeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968074.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene maeM CDS complement(347928..349553) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746421.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 350211..351173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 351391..352365 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776724.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(352653..352982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(353569..354330) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598772.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(354320..355147) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173871.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(355152..355997) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437750.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(355994..356902) product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703735.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene nikB CDS complement(356970..358541) product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene nikA CDS complement(358581..359360) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(359570..361207) product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene ubiB CDS 361426..362214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439798.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(362219..362755) product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212153.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 363005..363205 product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391680.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 363192..363458 product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218374.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene rof CDS complement(363520..363840) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212150.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(364175..365542) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816961.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene tilS CDS complement(365613..366008) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212148.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 366188..367732 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948686.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 367912..368631 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102115.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 368645..370066 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023927.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 370082..370786 product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069255.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 370934..371704 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368130.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 372055..373602 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450003.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene gntK CDS 373619..374572 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 374683..375684 product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075125.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 375767..376525 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029015.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 376669..377988 product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369355.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene gntT CDS 378077..378715 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096096.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 378931..380529 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961457.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 380586..381017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(381113..381694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 382039..382578 product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168624.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(382692..382904) product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860775.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene cspA CDS complement(383348..384217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(384214..384672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(384753..385022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(385662..386588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 387095..387424 product endoribonuclease SymE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132601.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene symE CDS 387818..388564 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161827.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 388639..389013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(389084..389911) product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225093.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(390193..390573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(390725..391684) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095666.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene accA CDS complement(391697..395179) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228634.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene dnaE CDS complement(395237..395845) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569423.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene rnhB CDS complement(395859..397013) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741216.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene lpxB CDS complement(397017..397832) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368155.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene lpxA CDS complement(397810..398265) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173178.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene fabZ CDS complement(398431..399459) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173181.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene lpxD CDS complement(399460..399945) product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212140.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene skp CDS complement(400012..402420) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095659.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene bamA CDS complement(402452..403810) product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212138.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene rseP CDS complement(403820..404671) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173216.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene cdsA CDS complement(404681..405439) product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212136.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene ispU CDS complement(405645..406841) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811924.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene ispC CDS complement(407409..407966) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212134.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene frr CDS complement(408051..408788) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164053.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene pyrH CDS complement(408894..409748) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212132.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene tsf CDS complement(409889..410614) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095653.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene rpsB CDS complement(411187..412491) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(412491..413417) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 413847..414641 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212130.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene map CDS complement(414663..415952) product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704158.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene yjeM CDS 416319..418994 product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173232.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene glnD CDS 419037..419861 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene dapD CDS complement(419936..420520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230911.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 420666..421061 product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164058.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(421121..422017) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819369.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(422297..422749) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807735.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(422776..423555) product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212125.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene truC CDS complement(423556..423885) product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173236.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(423953..424255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(424882..425430) product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173239.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene syd CDS 425520..426374 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098529.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene queF CDS 426545..427204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 427294..428661 product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098530.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene ppnN CDS 428716..429498 product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703315.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene xni CDS complement(429461..430573) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816972.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene rlmM CDS complement(430570..430956) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369946.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(431053..431967) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212117.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(432364..432633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 432845..434047 product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212116.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene csdA CDS 434051..434485 product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816974.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene csdE CDS complement(434494..435303) product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098539.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene tcdA CDS complement(435333..436451) product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228046.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene mltA tRNA 436668..436744 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 436780..436856 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 436892..436968 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 437051..437392 product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(437406..438584) product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211623.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene amiC CDS 438957..440282 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098542.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene argA CDS 440487..441476 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370087.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(441544..443418) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215834.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene recD CDS complement(443418..446954) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816977.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene recB CDS complement(446954..449842) product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816978.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene ptrA CDS complement(449954..453343) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816979.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene recC CDS 453583..454680 product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387905.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(454727..455083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(455080..455532) product YgdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211629.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(455529..456134) product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298794.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(456128..456634) product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816982.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(456763..457308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(457369..458163) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816232.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene thyA CDS complement(458196..459080) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816984.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene lgt CDS 458986..459231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(459267..459827) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098553.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene rppH CDS 460790..461488 product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165371.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene mutH CDS complement(461493..462698) product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620430.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene lplT CDS complement(462695..464851) product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209843.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene aas CDS complement(465234..465953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(466081..468150) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390606.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(468159..468482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(468466..468780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(468773..469405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(469417..469743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 470122..470490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(470579..470890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 471156..471386 product DUF2594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096025.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(471454..472437) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098857.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 473146..474450 product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171308.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 474484..475851 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419892.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene sdaA CDS complement(475970..476416) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876815.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 477088..477786 product MgtC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050075347.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 477989..480685 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050122726.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene mgtA CDS complement(480992..483484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(484237..486903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 487225..487425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(487437..487727) product DUF3861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209910.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(487801..488004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 488588..490738 product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387313.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene btsT CDS 491021..491224 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887451.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 491257..492222 product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068090.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene yjiA CDS complement(492258..493466) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211269.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(493467..494036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211270.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(494033..495157) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214329.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(495157..496119) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(496184..497470) product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612466.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(497467..498273) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074140.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(498251..499267) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304426.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(499264..500271) product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304427.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(500475..501401) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767508.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 501525..502688 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339264.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(502750..504321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(504404..505330) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062802403.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene gcvA CDS 505516..506292 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 507042..510263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(510384..510689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(510721..510921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(511269..511733) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032706451.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 511886..512500 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703356.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 512815..513072 product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095761.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 513089..513802 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213557.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(513768..513962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(514083..514670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(514879..515028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 tRNA complement(515239..515312) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 516048..517439 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190513.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 517472..519028 product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626662.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 519105..519836 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477266.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 519857..521068 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903642.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 521340..522251 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074826193.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(522263..522808) product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366387.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene rimL CDS complement(522899..524740) product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096401.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(525112..525615) product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210233.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene dps sequence03 source 1..473100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 392..928 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011193213.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(925..1182) product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070563.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(1179..1997) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209026.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene aroE CDS complement(2012..2569) product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174593.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene tsaC CDS complement(3214..4299) product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209022.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene dprA CDS 4581..5096 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114986.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene def CDS 5135..6082 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099014.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene fmt CDS 6166..7464 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817317.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene rsmB CDS 7505..8881 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166392.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene trkA CDS 9001..9411 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022450.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene mscL CDS 9769..11316 product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392775.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 11494..12864 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731242.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 12896..14482 product propionate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392773.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 14511..15248 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392772.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene fabG CDS 15259..16443 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392774.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 16500..17660 product glycerate 3-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706333.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene glxK CDS 17731..18876 product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693827.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(18873..19094) product alternative ribosome-rescue factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209016.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(19163..19606) product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369432.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene zntR CDS 19766..21025 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208223.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(21109..21498) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004868344.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene rplQ CDS complement(21539..22528) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438685.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene rpoA CDS complement(22554..23174) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene rpsD CDS complement(23207..23596) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388621.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene rpsK CDS complement(23613..23969) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004702348.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene rpsM CDS complement(24270..25598) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213344.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene secY CDS complement(25606..26040) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369426.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene rplO CDS complement(26044..26223) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213339.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene rpmD CDS complement(26230..26730) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703641.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene rpsE CDS complement(26745..27098) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099023.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene rplR CDS complement(27108..27641) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099024.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene rplF CDS complement(27655..28041) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062611.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene rpsH CDS complement(28079..28384) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118930.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene rpsN CDS complement(28399..28938) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625881.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene rplE CDS complement(28954..29268) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729185.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene rplX CDS complement(29279..29650) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613955.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene rplN CDS complement(29813..30067) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130100.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene rpsQ CDS complement(30067..30258) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644742.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene rpmC CDS complement(30258..30668) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941208.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene rplP CDS complement(30681..31382) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene rpsC CDS complement(31400..31732) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447529.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene rplV CDS complement(31746..32024) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027275662.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene rpsS CDS complement(32039..32863) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004709246.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene rplB CDS complement(32882..33184) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159841.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene rplW CDS complement(33181..33786) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218934.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene rplD CDS complement(33803..34432) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004709250.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene rplC CDS complement(34465..34776) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene rpsJ CDS complement(35102..36286) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368828.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene tuf CDS complement(36354..38462) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212325.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene fusA CDS complement(38556..39026) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861706.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene rpsG CDS complement(39123..39497) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212323.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene rpsL CDS complement(39664..39951) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903398.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene tusB CDS complement(39962..40321) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817321.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene tusC CDS complement(40331..40723) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209706.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene tusD CDS complement(40720..41433) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212319.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(41634..42428) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085068497.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene fkpA CDS complement(42641..43687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 43847..44071 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212317.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(44143..44754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(44904..46742) product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817326.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene kefB CDS complement(46743..47321) product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099040.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene kefG CDS 47618..49543 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634840.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 49700..50680 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174664.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 50677..50925 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586568.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 50897..51706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 51785..52654 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159760.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(52608..52799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 52940..53572 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242755.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene crp CDS 53630..55702 product YccS/YhfK family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012135464.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 55837..56379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(56435..57667) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174672.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 57856..58602 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434038.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(58576..59547) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097910.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(59544..60494) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846212.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(60545..61822) product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858523.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 62191..63405 product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690934.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 63423..64436 product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096790.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 64609..65991 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419305.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 66012..67493 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705299.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 67933..68622 product DNA-binding transcriptional regulator rspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215553.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene rspR CDS complement(68692..70212) product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298776.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 70689..73424 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188699.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(73488..74060) product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477225.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene ppiA CDS complement(74214..75494) product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180693.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(75484..76734) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076275.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene codB CDS 76881..77489 product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766229.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(77567..78571) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099067.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene trpS CDS complement(78581..79273) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208892.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(79270..79944) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174695.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene rpe CDS complement(79971..80789) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174698.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene dam CDS complement(80865..81836) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208897.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(81909..83000) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369386.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene aroB CDS complement(83056..83574) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391482.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene aroK CDS complement(83867..85156) product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298773.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene hofQ CDS complement(85156..85524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(85521..86078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(86075..86623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(86623..87492) product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051840.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene pilM CDS 87629..90241 product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817350.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene mrcA CDS complement(90317..90880) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208907.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene nudE CDS 91294..93378 product intracellular growth attenuator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817351.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 93498..93908 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208910.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene hslR CDS 94012..94896 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208911.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene hslO CDS 95170..96795 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361659.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene pckA CDS complement(96874..98205) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208913.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene envZ CDS complement(98202..98921) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004709363.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene ompR CDS complement(99051..99548) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174758.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene greB CDS 99942..102263 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980764.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 102854..103081 product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004702177.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene feoA CDS 103143..105458 product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174749.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene feoB CDS 105458..105706 product FeoC-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174747.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(105703..106485) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998145.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene bioH CDS 106534..107232 product DNA utilization protein GntX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817358.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene gntX CDS 107275..107853 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene nfuA CDS complement(108244..109296) product asparaginase AnsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene ansZ CDS complement(109378..110652) product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694556.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(110681..111967) product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360057.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene dcuC CDS 112279..113202 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339199.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(113267..113800) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397309.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(114043..115557) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174768.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene glpD CDS 115766..116332 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301696.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(116415..117176) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208930.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(117269..118108) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216348.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene glpG CDS complement(118251..118589) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694416.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene glpE CDS complement(118706..119563) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211506.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene rpoH CDS complement(119792..120772) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084329.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene ftsX CDS complement(120765..121430) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene ftsE CDS complement(121437..122882) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene ftsY CDS 123137..123724 product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211502.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene rsmD CDS 123738..124022 product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311191.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(124037..124357) product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163956.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 124520..125146 product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211498.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(125164..125412) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215973.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene tusA CDS 125552..126445 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112455.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 126602..127273 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211495.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 127403..127981 product DcrB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245277.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(128112..129314) product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211493.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene glpC CDS complement(129311..130573) product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176408.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene glpB CDS complement(130563..132203) product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815350.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene glpA CDS 132582..133940 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098018.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene glpT CDS 134198..135286 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050076852.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene glpQ CDS complement(135340..136137) product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211488.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene yigL CDS complement(136184..137185) product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176123.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene pldB CDS 137435..138298 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704474.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 138447..139073 product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176125.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene rhtB CDS 139282..140385 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174790.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene asd CDS complement(140439..141227) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815367.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(141377..142078) product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215918.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene fre CDS complement(142141..143628) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215917.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene ubiD CDS complement(144024..144749) product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707065.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene pepE CDS 145200..145691 product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192400.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene rfaH CDS complement(145776..146798) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815375.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene hemB CDS complement(146881..147672) product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277865.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene tatD CDS complement(147755..148552) product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815373.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene tatC CDS complement(148556..149107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(149111..149380) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165598.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene tatA CDS complement(149469..151100) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815371.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene ubiB CDS complement(151100..151705) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084314.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(152011..152766) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229009.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene ubiE CDS complement(152887..154395) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211532.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene rmuC CDS complement(154516..155049) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176305.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(155156..156901) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174778.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 157317..157583 product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367587.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(157598..158803) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420964.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 159078..160574 product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157393.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene pitA CDS 160851..161282 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323571.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene uspA CDS 161776..163119 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209529.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene gdhA CDS complement(163190..163936) product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174842.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene rsmJ CDS complement(163939..165981) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209531.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene prlC CDS complement(166102..166263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(166350..166583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(166745..167938) product 3-hydroxybenzoate 6-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150113.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(168011..168655) product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781184.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene maiA CDS complement(168689..169393) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196038.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(169439..170482) product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706105.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene gtdA CDS complement(170547..171896) product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365720.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 172029..172946 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024658.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(172947..173282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 173474..174316 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954235.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 174341..175102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 175192..176544 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817382.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene gorA CDS complement(176865..177632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 177807..178712 product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157374.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene yhjD CDS 178816..179751 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817387.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 179874..180596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(180598..182046) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209550.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(182503..183780) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209553.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(183994..185970) product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209560.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene hmsP CDS complement(186052..189570) product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817392.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene bcsC CDS complement(189585..190694) product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817393.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene bcsZ CDS complement(190699..193044) product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018077.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene bcsB CDS complement(193041..195662) product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817395.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene bcsA CDS complement(195665..196405) product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174891.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene bcsQ CDS complement(196402..196629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 197168..198787 product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174899.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene bcsG tRNA complement(198872..198948) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 199182..199928 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796310.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene fpr CDS 199960..200610 product DUF1454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215864.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 200770..201540 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208959.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene tpiA CDS complement(201610..202572) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099327.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene pfkA CDS complement(202880..203782) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368935.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene fieF CDS complement(203941..204303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 204615..205313 product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033719.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene cpxR CDS 205310..206689 product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175902.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene cpxA CDS 206757..207230 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208973.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene trmL CDS complement(207288..208106) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815280.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene cysE CDS complement(208189..209202) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene gpsA CDS complement(209213..209680) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003370.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene secB CDS complement(209794..210213) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815278.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 210540..212084 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208979.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene gpmM CDS 212142..213422 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815277.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene envC CDS 213425..214378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 214588..215520 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815275.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene rfaD CDS 215615..216697 product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703797.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene rfaF CDS 216698..217687 product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264595.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene rfaC CDS 217957..219081 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172601538.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene waaA CDS 219167..219664 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171873.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene coaD CDS complement(219669..220478) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208989.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene mutM CDS complement(220670..220837) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002922510.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene rpmG CDS complement(220849..221085) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091955.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene rpmB CDS complement(221087..221230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(221322..222005) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175951.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene radC CDS 222409..223620 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208993.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene coaBC CDS 223604..224062 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077682.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene dut CDS 224158..224751 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004714376.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene slmA CDS complement(224828..226147) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113742.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(226158..227933) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110747.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(227940..228653) product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110746.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(228953..230572) product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066639.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene fumB CDS complement(230886..232226) product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368823.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene dcuB CDS 233091..233339 product DUF2766 family protein YecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082127.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene yecJ CDS 233386..234705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(234776..234946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 235024..235365 product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170280.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(235388..235879) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808849.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(235911..236744) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176008.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(236860..237222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 237499..237942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 238022..238432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 238608..239189 product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(239253..239801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(239918..241294) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230081.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene argH CDS complement(241547..242320) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215335.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene argB CDS complement(242331..243335) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209489.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene argC CDS 243523..244677 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368914.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene argE CDS 244912..247548 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815299.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene ppc CDS complement(247592..248629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101600.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 248729..249244 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054412741.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(249346..250194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838295.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(250323..251216) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815297.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene metF CDS complement(251400..253835) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815295.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(253852..255000) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815294.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene metB CDS 255222..255539 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392248.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene metJ CDS complement(255694..255909) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216737.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene rpmE CDS 256132..258327 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208938.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene priA CDS 258484..259500 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216730.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene cytR CDS 259622..260395 product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815291.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene ftsN CDS 260673..261122 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004714422.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene hslV CDS 261134..262465 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175854.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene hslU CDS complement(262484..262672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 262694..263611 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298879.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 263732..264217 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872908.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene rraA CDS complement(264304..264546) product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392238.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene zapB CDS 265016..265828 product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084263.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene glpF CDS 265909..267417 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175870.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene glpK CDS 267598..268608 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815289.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene glpX CDS 268805..269008 product cell surface composition regulator GlgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928927.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene glgS CDS complement(269100..269765) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844529.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene pyrE CDS complement(269820..270539) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247078.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene rph CDS 270759..271622 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208998.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(271688..271999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(272372..272935) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815863.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(273162..273431) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990056.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(273538..277326) product outer membrane autotransporter IcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071795.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene icsA CDS complement(277836..278438) product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098990.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene msrQ CDS complement(278441..279445) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723876.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene msrP CDS complement(279501..280187) product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792797.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 280634..281470 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875269.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 281515..282507 product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206051.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 282605..283927 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392014.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(284021..284725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(284843..286096) product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704303.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(286181..287623) product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704305.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 287715..287846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(287825..288214) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(288207..289670) product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704304.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(289708..290331) product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094785.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(290350..291375) product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974693.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 291684..292436 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(292479..293462) product putative lateral flagellar export/assembly protein LafU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232550.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene lafU CDS complement(293465..294328) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169518.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene motA CDS complement(294390..295094) product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938726.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(295123..295596) product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725259.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(295605..296807) product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067489.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(296804..297121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415004.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(297125..297517) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285322.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene fliS CDS complement(297548..298855) product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609678.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene fliD CDS complement(299097..299999) product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949083.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene lafA CDS complement(300758..300997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 300884..301774 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211422.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 301752..302225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(302886..303911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195938.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(303962..304891) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266799.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene flgL CDS complement(304912..306285) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367245.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene flgK CDS complement(306375..306692) product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867281.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(306693..307817) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059224973.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(307831..308496) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800864.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene flgH CDS complement(308556..309341) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990540.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene flgG CDS complement(309367..310104) product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375450.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(310118..311317) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119538.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene flgE CDS complement(311357..312148) product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093678.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(312145..312576) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010941.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene flgC CDS complement(312580..312927) product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512950.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 313019..313807 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309268.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene flgA CDS 313896..314201 product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705404.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene flgM CDS 314208..314636 product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027804.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 314916..315863 product lysine-N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191775953.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 315881..318355 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181816997.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(318434..319105) product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211333.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(319102..319545) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248917.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene fliJ CDS complement(319542..320882) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279402.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene fliI CDS complement(320875..321579) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151516.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene fliH CDS complement(321586..322599) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293168.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(322577..324256) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993674.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene fliF CDS complement(324262..324615) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029087.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(324670..325680) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292195.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 326309..327163 product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922504.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 327156..327527 product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043127.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 327524..328282 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830282.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene fliP CDS 328291..328563 product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958542.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 328565..329347 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260504.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene fliR CDS 329340..330479 product flagellar type III secretion system protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785648.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 330472..332556 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140817.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene flhA CDS 332824..333219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(333308..333520) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193665.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(333517..333894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 note possible pseudo, frameshifted CDS 334127..334258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 334258..334782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 335083..335598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 335665..336960 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985735.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 337114..337590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(337599..338030) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(338030..338314) product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 339031..339615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(339652..340407) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056849.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 340729..341349 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706087.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 341481..342752 product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694556.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(342758..343690) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064554.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 343865..344959 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301333.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene mltB CDS complement(344975..346069) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626585.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 346456..349587 product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815827.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene acrD CDS complement(349945..350205) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074406.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 350393..350920 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814722.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(350917..352632) product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103125.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene ligB CDS 353003..353626 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094883.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene gmk CDS 353681..353956 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene rpoZ CDS 353975..356086 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209002.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene spoT CDS 356092..356799 product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165889.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene trmH CDS 356803..358884 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016758.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene recG CDS complement(358897..359691) product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703441.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 359872..361278 product xanthine/proton symporter XanP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115428.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene xanP CDS 361432..361725 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096224.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 361833..363608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209007.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(363625..364530) product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209008.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene fabY CDS 365345..366823 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760238.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(367174..367617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(367642..368007) product YbbC/YhhH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877768.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(368043..368177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(368189..368623) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209009.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene dtd CDS 368752..369648 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(369667..370254) product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209011.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene yihX CDS 370540..370941 product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369693.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 371028..371564 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004328577.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(371579..372550) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108459.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(372715..374523) product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570668.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene typA CDS 374930..376339 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213150.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene glnA CDS 376648..377697 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213151.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene glnL CDS 377706..379127 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188774.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene glnG CDS 379354..379476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(379541..380914) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116080.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene hemN CDS complement(380919..381098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(381115..381648) product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815258.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene yihI CDS 382336..382971 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175759.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene yihA CDS 382968..383489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(383912..384232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(384579..387365) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175760.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene polA CDS 388218..388961 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099384.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(389004..390566) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218844.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(390704..392779) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209623.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene glyS CDS complement(392789..393715) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209624.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene glyQ CDS 393890..394459 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188408.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene tag CDS 394456..394902 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094983.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 395091..395363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 395380..396039 product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369222.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(396103..396525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 396716..397690 product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817452.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene ghrB CDS 397968..399218 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144344.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene avtA CDS complement(399281..399721) product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161076.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene ibpB CDS complement(399807..400220) product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532742.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene ibpA CDS 400536..400895 product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175118.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 401789..404971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(405019..405609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(405698..408115) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072047.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene gyrB CDS complement(408129..409223) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209643.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene recF CDS complement(409246..410343) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161099.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene dnaN CDS complement(410349..411668) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220732.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene dnaA CDS complement(412731..412928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 413281..414927 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220739.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene yidC CDS 415309..416673 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175133.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene mnmE CDS complement(417930..418241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 418507..419850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(419917..420303) product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968136.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(420303..420611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 420709..421575 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532847.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 421861..422265 product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105501.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 422618..424072 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097758.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(424136..426229) product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224746.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(426511..427356) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816194.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(427436..428032) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112218.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(428414..429193) product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544919.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(429195..429812) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211603.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene dmsB CDS complement(429825..432260) product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211602.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(432745..433920) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208960.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 434114..434851 product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208961.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 434848..435564 product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208962.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 435810..437207 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208963.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(437344..437532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 437525..438184 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218867.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(438268..439611) product citrate-proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125471.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(439736..440902) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569571.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 441325..441720 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208261.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 441945..443681 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene ggt CDS complement(443678..445105) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816818.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene phrB CDS complement(445120..445899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(446227..446451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(446979..448124) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168556.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(448185..448757) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761174.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(448754..449821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(449805..455852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(456049..457140) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082083.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(457228..457623) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173129.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 457979..458710 product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815688.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 458698..459516 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694635.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 459509..459766 product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148686.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 459784..460038 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139646.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 460075..460644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815691.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 460611..461993 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195765893.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 461990..462331 product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173106.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 462322..464052 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173104.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 464042..464473 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099162.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 464470..465096 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173099.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 465071..467425 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298607.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 467422..468000 product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815695.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 467997..469166 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815696.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 469163..469648 product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815697.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 469645..470376 product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173090.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 470373..471602 product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032901333.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 471609..472346 product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190678.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 472388..472810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 sequence04 source 1..340173 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 126..806 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814029.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(846..1442) product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240327.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(1445..2338) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762701.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 2543..4357 product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209381.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene cysJ CDS 4357..6072 product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815605.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene cysI CDS 6097..6831 product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080392.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene cysH CDS 7131..7259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(7290..7592) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036266.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(7589..8005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(8184..8870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(8867..9277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(9295..10011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 10285..11058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(11095..12474) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211405.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 12874..14298 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815607.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene cysG CDS 14314..15222 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163310.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene cysD CDS 15232..16692 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703298.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene cysN CDS 16697..17299 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369981.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene cysC repeat_region 17622..18566 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gagttccccgcgccagcggggataaaccg CDS complement(18574..18750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 18883..19083 product host cell division inhibitor Icd-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051084.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 19073..19393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816233.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(19482..19913) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209792.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 20002..21336 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138449.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 21426..21767 product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281320.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(21816..22025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 21939..22715 product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210232.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene tam CDS 23037..23195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(23266..24255) product sulfate/thiosulfate ABC transporter substrate-binding protein Sbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045704.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene sbp CDS 24455..24859 product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255339.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 25196..25606 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816860.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene cueR CDS complement(25660..26565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 27042..28295 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693428.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 28897..30765 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082012.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 30857..32629 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389044.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 32629..33111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389045.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 33123..33812 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389046.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 33809..35038 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389047.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(35080..35685) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171739.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene yfbR CDS complement(35801..36265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(36397..37890) product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365583.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene alaA CDS complement(38266..39648) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261227.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene brnQ CDS 40326..41216 product virulence transcriptional regulator RovM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210280.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene rovM CDS 41241..42119 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090007.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 42652..43890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 43927..44460 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080953.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 44529..45278 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211998.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 45368..47905 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102159.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 47917..48672 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298844.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(48819..50201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(50595..51959) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857989.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene purB CDS 52543..53715 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064230.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene metC CDS 53788..55155 product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466989.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene dcuC CDS 55590..56153 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086804.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 56282..56542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 57348..57773 product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062997.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene nuoA CDS 57789..58463 product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913178.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene nuoB CDS 58481..60295 product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815938.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene nuoC CDS 60298..60783 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144413951.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene nuoE CDS 60780..62147 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815940.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene nuoF CDS 62205..64934 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210275.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene nuoG CDS 64931..65908 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210274.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene nuoH CDS 65922..66464 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815942.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene nuoI CDS 66476..67006 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210272.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene nuoJ CDS 67003..67305 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159229.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene nuoK CDS 67302..69146 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815943.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene nuoL CDS 69192..70724 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210269.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene nuoM CDS 70731..72191 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815945.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene nuoN CDS 72557..75592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 75755..77071 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815958.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene menF CDS 77084..77644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 77700..78167 product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792733.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 78361..79764 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817163.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 80176..81195 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195765892.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 81220..82206 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817165.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 82265..83905 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173899.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 84025..84630 product YebB family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024930.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 84695..85222 product DUF4303 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071853.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 85491..87167 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815959.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene menD CDS 87167..87952 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210246.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene menH CDS 87955..88812 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098093.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene menB CDS 88812..89783 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815961.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene menC CDS 89771..91168 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210243.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene menE CDS 91416..92501 product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005746663.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 92712..93662 product bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049034212.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(93725..95449) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722110.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene pabB CDS complement(95442..96023) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392854.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene pabA CDS complement(96127..97566) product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210811.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene katA CDS complement(98064..99272) product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815965.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene tyrP CDS 99593..100792 product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171600.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(100837..101745) product hypochlorite stress DNA-binding transcriptional regulator HypT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789104.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene hypT CDS complement(101873..102091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 102323..103042 product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677245.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 103119..104420 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262203.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 104514..105119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 105178..105528 product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388136.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 105495..106262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 106308..107285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(107528..107848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 108041..108454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 108656..109009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 109158..110096 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235943.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(110143..111279) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815971.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene nrdB CDS complement(111388..113676) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075180.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene nrdA CDS complement(114029..114739) product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365620.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene ubiG CDS 114908..117631 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210821.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene gyrA CDS complement(117718..117960) product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213110.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene dinI CDS 118182..119504 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063841.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 119745..119891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 119909..120274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 120298..120495 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061019.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 120625..120783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(120862..121641) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187753.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 121741..122622 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187634.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 122798..123901 product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096637.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 124094..124765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 tRNA complement(125873..125949) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 126336..126926 product tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369873.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 127322..127843 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521426.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 127950..128651 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097474.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 128669..131161 product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 131158..132099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 132691..133140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 133352..134347 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339291.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 134347..135381 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014531406.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 135381..136421 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967922.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 136418..137227 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339288.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(137233..138180) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140445.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 138447..140567 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339292.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(140705..142489) product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171465.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene yejM CDS complement(142516..142743) product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208836.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 143026..144036 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208835.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene yejK CDS complement(144132..144416) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494192.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene rplY CDS complement(144539..146299) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815987.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(146299..146538) product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705971.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 146648..147367 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097990.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene rsuA CDS 147758..148114 product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094639.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(148233..149825) product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815989.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene yejF CDS complement(149827..150852) product microcin C ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171439.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(150849..151940) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171436.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(151950..153806) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208825.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(153990..154379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(154884..155591) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171423.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(155658..156641) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815993.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 156924..157259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(157321..157893) product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815996.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene yeiP CDS complement(158049..159287) product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208812.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene mtr CDS complement(159369..159614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(160061..162982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 163448..164386 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208798.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene fruK CDS complement(164435..165292) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208791.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene nfo CDS complement(165419..166510) product YeiH family putative sulfate export transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024911344.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 166624..167523 product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548294.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene yieE CDS 167750..169168 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208786.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 169697..170071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 170076..170915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 171147..172244 product iron-siderophore ABC transporter substrate-binding protein YiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene yiuA CDS 172306..173364 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215451.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 173361..174149 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161751.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(174223..175323) product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098569.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene wzz(fepE) CDS complement(176052..178094) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816718.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene metG CDS 178362..179477 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816717.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene apbC CDS 179762..180343 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211873.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene dcd CDS 180459..182267 product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816716.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene asmA CDS complement(182329..183915) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168322.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 184277..185683 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211888.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene gndA CDS 185836..186150 product PTS system regulator TmaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157740.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene tmaR CDS complement(186225..187637) product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213085.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene ptsG CDS 188724..189401 product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704623.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene fetA CDS 189388..190164 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095910.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene fetB CDS complement(190323..193010) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034165920.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 193791..194033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 194038..194340 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213446.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 194711..194968 product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288812.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 194969..195301 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373724.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 tRNA complement(195369..195444) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 195819..198341 product GGDEF and EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128651.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 tRNA complement(198399..198474) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(199145..199357) product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217950.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene ydgT CDS complement(199556..200710) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198074.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(201007..202377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(202475..203092) product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418930.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene lpoB CDS complement(203148..204518) product COG3014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851858.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(204707..205390) product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(205672..206232) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245166.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(206239..211176) product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(211339..213516) product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113833.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(213696..214340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100672.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 214655..215488 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816210.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(215473..216918) product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816021.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 217084..217818 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692954.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(217864..218871) product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816025.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene hcr CDS complement(218935..220584) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211359.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene hcp CDS complement(220716..221618) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816027.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 221837..223504 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211356.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 223817..224143 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420184.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene clpS CDS 224169..226451 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162786.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene clpA CDS complement(226672..226890) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene infA CDS complement(227037..227750) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816030.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene aat CDS complement(227766..229484) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171075.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene cydC CDS complement(229487..231271) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217690.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene cydD CDS complement(231533..232486) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816032.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene trxB CDS 233051..233545 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228473.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene lrp CDS 233672..237199 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171070.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 237370..237993 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211338.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene lolA CDS 238001..239344 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171047.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 239449..240741 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211336.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene serS CDS 241428..243866 product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850332.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene dmsA tRNA 241509..241592 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 243877..244494 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096798.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene dmsB CDS 244496..245350 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209429.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 245445..246086 product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209430.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene dmsD CDS 246205..247398 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211335.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(247453..247953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(247983..248723) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171041.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene pflA CDS complement(248899..251181) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211332.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene pflB CDS complement(251240..252049) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642539.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene focA CDS complement(252457..254220) product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816035.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 254430..255479 product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394189.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene ansB CDS 255793..256878 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171026.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene serC CDS 256993..257688 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815911.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 257747..259033 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097306.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene aroA CDS 259221..259898 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211324.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene cmk CDS 260039..261718 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367470.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene rpsA CDS 261718..262062 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159907.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene ihfB CDS complement(262100..262342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(262398..262580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 262800..264587 product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211321.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 264619..264783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 264752..266371 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551266.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene msbA CDS 266368..267363 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170991.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene lpxK CDS 267469..267651 product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350061.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene ycaR CDS 267648..268403 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816038.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene kdsB CDS complement(268455..269222) product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816039.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene elyC CDS 269358..270155 product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298300.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene cmoM CDS 270152..271474 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170970.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene mukF CDS 271482..272177 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211309.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene mukE CDS 272174..276682 product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211308.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene mukB CDS 276893..278626 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830416.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene ldtD CDS 278855..279415 product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170957.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 279539..280183 product hydroxyacylglutathione hydrolase GloC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109455.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene gloC CDS complement(280252..281442) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816042.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 281769..283535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 283540..283875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 283909..284361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 284444..284992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 285063..285380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 285581..286045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201267.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 286042..286293 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193665.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(286347..287432) product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171545.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(287742..288848) product porin OmpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837937.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene ompN CDS complement(289142..290542) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117881.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene asnS CDS complement(290817..292025) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816044.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene pncB CDS 292469..295174 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220013.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene pepN CDS 295321..296340 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001370288.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene pyrD CDS 296612..297157 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816046.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(297222..298322) product YcbX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816047.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 298770..300935 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816048.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene rlmKL CDS 300939..302846 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816049.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 303055..304287 product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026017889.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene pqiA CDS 304300..305931 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211290.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene pqiB CDS 305928..306491 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097262.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene pqiC CDS 306546..307295 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211680.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(307360..308238) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816432.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(308298..309200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(309267..310262) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224141.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene gapA CDS 310732..311139 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211677.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene msrB CDS complement(311268..312287) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097048.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene ansA CDS complement(312426..314279) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816426.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene sppA CDS 314458..315006 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339283.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 315164..316207 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211671.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene selD CDS 316207..317301 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095917.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene mnmH CDS 317301..319262 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211670.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(319259..319672) product pyrimidine (deoxy)nucleoside triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166143.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(319678..320484) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211667.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene xthA CDS complement(320572..321147) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(321356..322189) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555857.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene purU CDS complement(322243..322707) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816423.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 322945..323961 product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210665.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene rssB CDS 324132..325046 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718995.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene galU CDS complement(325725..326132) product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502781.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene hns CDS complement(327359..330034) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816419.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene adhE CDS 330470..331117 product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164160.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(331173..331508) product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069343.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(331543..333003) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816416.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene cls CDS complement(333564..333941) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 334266..334970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(335036..335455) product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169322.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene yciA CDS complement(335552..336112) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366196.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 336337..338049 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816413.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(338104..338865) product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169326.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 339231..339887 product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164191.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene ompW sequence05 source 1..232359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 48..158 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS 643..1290 product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166907.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene osmY CDS 1350..1541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 1696..2481 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815517.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(2472..3155) product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166927.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 3284..4261 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166929.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene serB CDS 4320..5699 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209220.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene radA CDS complement(5752..6753) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815524.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 6860..7759 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166937.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(7783..8427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815461.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(8532..10199) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046772.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene ettA CDS 10481..12412 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815528.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene sltY CDS 12498..12797 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368371.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene trpR CDS complement(12846..13373) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209229.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene yjjX CDS 13431..14078 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704328.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene gpmB CDS complement(14075..14947) product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166950.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene robA CDS 15202..15684 product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875811.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene creA CDS complement(15757..16476) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004706052.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene arcA CDS 17621..20080 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209237.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene thrA CDS 20082..21011 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166953.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene thrB CDS 21182..22471 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209239.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene thrC CDS complement(22796..23575) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209240.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene yaaA CDS 23839..24792 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130175.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene tal CDS 24913..25377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 25621..26202 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209243.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene mog CDS 26433..27764 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815535.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 28273..29571 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089309.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 29820..30680 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878105.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(30738..31652) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089308.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(31714..33177) product L-tartrate/succinate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804928.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene ttdT CDS complement(33255..33860) product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722957.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene ttdB CDS complement(33857..34771) product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986803.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene ttdA CDS 35056..35979 product DNA-binding transcriptional activator TtdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935209.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene ttdR CDS complement(36086..36622) product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815537.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene satP CDS 37005..38924 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368351.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene dnaK CDS 39038..40174 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502040.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene dnaJ CDS 40488..41669 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166980.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene nhaA CDS complement(41761..42591) product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097174.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene csgG CDS complement(42607..43017) product curli production assembly/transport protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097173.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene csgF CDS complement(43027..43416) product curli production assembly/transport protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097172.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene csgE CDS complement(43419..44069) product biofilm master transcriptional regulator CsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097171.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene csgD CDS 44697..45158 product curli minor subunit CsgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005047380.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene csgB CDS 45211..45669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 45741..46067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(46138..46401) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518655.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene rpsT CDS 46774..47712 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210510.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene ribF CDS 47747..50563 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210509.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene ileS CDS 50563..51051 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157006.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene lspA CDS 51129..52073 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815541.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene ispH CDS 52264..53082 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704365.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene dapB CDS 53563..54714 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597260.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene carA CDS 54732..57953 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126385.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene carB CDS 58460..59239 product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166994.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 59236..59700 product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005180751.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 59732..60217 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210497.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene folA CDS complement(60265..61098) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815544.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene apaH CDS complement(61147..61524) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156966.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene apaG CDS complement(61530..62360) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210490.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene rsmA CDS complement(62353..63348) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095541.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene pdxA CDS complement(63338..64675) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167006.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene surA CDS complement(64753..67113) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815546.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene lptD CDS 67404..68213 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167009.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene djlA CDS 68249..68776 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389004.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(68782..69438) product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210485.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene rluA CDS complement(69456..72368) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167013.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene rapA CDS complement(72485..74851) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815549.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 75055..75633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 75890..76579 product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966717.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(76591..77286) product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051608.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene thiQ CDS complement(77273..78877) product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214276.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene thiP CDS complement(78853..79857) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214274.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene thiB CDS complement(80146..80862) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816224.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(81144..81875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(82566..83168) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818229.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene leuD CDS complement(83181..84593) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167044.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene leuC CDS complement(84596..85687) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174850093.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene leuB CDS complement(85758..87305) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210453.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene leuA CDS 87675..88061 product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817274.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene cybC CDS 88062..88568 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704784.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 88768..90486 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815562.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene ilvI CDS 90459..90980 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388986.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene ilvN CDS 91096..92166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 92324..93328 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815563.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene cra CDS 93794..94252 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368255.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene mraZ CDS 94255..95196 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368254.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene rsmH CDS 95193..95513 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029684613.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene ftsL CDS 95564..97351 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156878.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 97338..98837 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848752.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene murE CDS 98834..100210 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210438.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene murF CDS 100204..101286 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210437.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene mraY CDS 101289..102608 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796481.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene murD CDS 102609..103817 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210435.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene ftsW CDS 103814..104872 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016560.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene murG CDS 104925..106397 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704402.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene murC CDS 106390..107301 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815570.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 107303..108139 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228100.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene ftsQ CDS 108136..109392 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210431.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene ftsA CDS 109460..110617 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389003.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene ftsZ CDS 110727..111644 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389005.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene lpxC CDS complement(111653..112162) product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210428.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 112264..112716 product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156845.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene secM CDS 112823..115537 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905763.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene secA CDS 115622..116035 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167088.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene mutT CDS complement(116041..116238) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167089.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene yacG CDS complement(116277..117029) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095583.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene zapD CDS complement(117026..117649) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815573.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene coaE CDS complement(117646..118161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 118639..119682 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167093.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(119756..120766) product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704198.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene yjfF CDS complement(120759..121775) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799150.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(121788..123296) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704196.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(123379..124335) product galactofuranose ABC transporter substrate-binding protein YtfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265942.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene ytfQ CDS complement(124797..125690) product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212248.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene yedA CDS complement(125789..126976) product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209321.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene hofC CDS complement(126973..128445) product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216083.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene gspE CDS complement(128442..128891) product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704409.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene ppdD CDS 128941..129165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 129140..129682 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051592.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene ampD CDS complement(129754..131097) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633582.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 131900..132661 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389026.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene pdhR CDS 132768..135437 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209329.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene aceE CDS 135463..137334 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963535.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene aceF CDS 137516..138940 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102485.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene lpdA CDS 139438..140817 product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097565.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene chiP CDS 140868..141200 product ChiQ/YbfN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733594.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene chiQ CDS 141227..143920 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816825.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(143982..144266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 144527..147259 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095602.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene acnB CDS 147403..147765 product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368214.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene yacL CDS 148406..149035 product ferredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070230.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 149092..151194 product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273527.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 151212..151919 product YdhW family putative oxidoreductase system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001571509.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 152062..152781 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118430.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 152778..153563 product thiosulfate reductase cytochrome B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070009.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 153566..154543 product protein YdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587525.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene ydhT CDS complement(154602..155885) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167221.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene hemL CDS 156265..156609 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295564.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene erpA CDS complement(156660..157274) product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095644.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(157292..158113) product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222100.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene btuF CDS complement(158134..158838) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167232.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene mtnN CDS 159106..160602 product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164096.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene dgt CDS 160781..161935 product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929439.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene cdaR CDS 162136..162891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS 163007..163726 product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207067.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(163793..165355) product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273719.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene garD CDS 165900..167249 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703312.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 167267..168601 product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211789.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 168670..170010 product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107119.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene gudD CDS 170069..170839 product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098883.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene garL CDS 170939..171823 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369560.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene garR CDS 171910..173046 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815413.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(173109..174662) product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208746.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene emrB CDS complement(174659..175837) product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208745.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene emrA CDS complement(176082..176588) product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208744.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene mprA CDS complement(176852..177568) product transcriptional regulator AlpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085982.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene alpR CDS complement(177468..177680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 177735..178067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(178080..178307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 178405..178722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 178712..179137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 179134..179496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 179474..179638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 180049..180546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 180551..181633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 181660..182097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 182200..182613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 182682..182813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 182810..184702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 184702..185394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 185407..185727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 185766..186707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 186717..187382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 187379..187729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 187732..189153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 189150..189890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 189887..190588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 190588..191181 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057643.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 191303..192166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 192279..193397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(193616..194002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(194002..194679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 194716..195285 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905027.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(195365..196060) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639796.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(196224..196871) product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780893.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene grxB CDS complement(197001..197393) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(197463..197813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(197990..199318) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705398.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 199666..200565 product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(200642..201793) product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210940.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene cfa CDS 202233..203132 product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704270.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 203146..203730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(204295..205230) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530589.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 205743..206375 product PhoP regulatory network protein YrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602196.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene yrbL CDS complement(206431..206832) product carnitine metabolism transcriptional regulator CaiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333324.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene caiF CDS 207305..208270 product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801820.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene aes CDS complement(208310..209626) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183201.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(209795..210082) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081072.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(210079..211368) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287774.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(211431..212384) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091506.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(212384..213157) product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692187.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(213498..213683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 213842..215371 product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787109.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene caiT CDS 215413..216555 product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene caiA CDS 216635..217861 product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349942.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene caiB CDS 217953..219503 product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309938.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene caiC CDS 219632..220417 product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004377.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene caiD CDS complement(220654..221850) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528237.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(221831..224020) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098388.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(224017..225423) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098387.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 misc_feature complement(225490..>232359) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098386.1:Ig-like domain-containing protein locus_tag LOCUS_25040 sequence06 source 1..193952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1576 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209965.1:transketolase locus_tag LOCUS_25050 CDS 1732..2118 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072309.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene crcB CDS 2577..3248 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174197.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 3422..3733 product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210418.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 3743..4138 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174200.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 4135..4425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 4687..5082 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391987.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 5162..6154 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703572.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 6170..7024 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114805.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(7063..7914) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114815.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(7952..8863) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817248.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 9118..9603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 9704..10402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS 10859..11830 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091837.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 11812..12963 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098671.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 12963..14105 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113108.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(14196..15002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(15140..16417) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336872.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(16408..16887) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235681.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(16998..18005) product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336874.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(18139..19581) product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854618.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene uxaB CDS 20153..21643 product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174191.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(21708..21992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(21989..22327) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381183.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(22624..23529) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091572.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 23677..24693 product L-galactonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106033.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene lgoD CDS complement(24757..25413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 25710..26966 product multidrug efflux MFS transporter MdtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136983.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene mdtM CDS complement(27063..28019) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113699.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(28046..29353) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224212.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 29819..30961 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071609.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 30933..31295 product Hg(II) uptake system permease component MerT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071610.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 31292..31576 product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071611.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(31633..32460) product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211478.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(32473..33687) product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211477.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(34000..34512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(35057..35926) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210149.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene rsmI CDS 35990..37774 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228200.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 37723..38133 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210147.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 38174..38764 product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004710884.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene diaA CDS 38778..39356 product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643280.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene dolP CDS complement(39718..40440) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162387.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene mtgA CDS complement(40437..41090) product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300411.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene elbB CDS complement(41281..43623) product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210142.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene arcB CDS complement(43817..44719) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817255.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 45434..49945 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077010.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene gltB CDS 49959..51377 product glutamate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210138.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(51438..52391) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089137.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 52844..54643 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459855.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 54718..55386 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040020.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 55399..56085 product protein-disulfide oxidoreductase DsbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345576.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene dsbI CDS complement(56160..56648) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369484.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene sspB CDS complement(56654..57295) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162411.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 gene sspA CDS complement(57611..58003) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829815.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene rpsI CDS complement(58018..58446) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918559.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene rplM CDS 58560..58775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(58762..60216) product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368319.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(60638..61783) product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224932.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene prpF CDS complement(61812..62726) product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982670.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene citG CDS complement(62723..63247) product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816653.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene citX CDS complement(63255..64769) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192245.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene citF CDS complement(64786..65682) product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309339.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene citE CDS complement(65679..65975) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164540.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene citD CDS complement(65972..67048) product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816655.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene citC CDS 67415..69049 product sensor histidine kinase DpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071843384.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene dpiB CDS 69052..69753 product two-component response regulator DpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168588.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene dpiA CDS 69978..70385 product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162428.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene zapG CDS 70747..72120 product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817258.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene degQ CDS 72209..73267 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098970.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene degS CDS complement(73354..74616) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210127.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene murA CDS complement(74718..74972) product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162441.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene ibaG CDS complement(75128..75451) product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210125.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene mlaB CDS complement(75451..76077) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476484.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene mlaC CDS complement(76116..76631) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210123.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene mlaD CDS complement(76636..77418) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174247.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene mlaE CDS complement(77418..78221) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032898349.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene mlaF CDS 78725..79693 product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210119.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene kdsD CDS 79747..80295 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174251.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene kdsC CDS 80292..80879 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174254.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene lptC CDS 80839..81387 product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669770.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene lptA CDS 81434..82159 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224099.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene lptB CDS 82184..83620 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809045.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene rpoN CDS 83638..84177 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213952.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene ptsN CDS 84347..85219 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243746.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene rapZ CDS 85486..85893 product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210103.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene rnk CDS complement(85978..87318) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817275.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene pmbA CDS 87463..88020 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174310.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene yjgA CDS 88219..89895 product aromatic amino acid lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602238.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 89905..91497 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072956.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 91513..91944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 91955..93577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 93776..95233 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072957.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(95276..95539) product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817276.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(95542..96024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(96141..97016) product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971962.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(97142..97642) product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(97726..99171) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210082.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene tldD CDS complement(99176..100024) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817279.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(100024..103821) product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817280.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene yhdP CDS complement(103883..105352) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123197.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 gene rng CDS complement(105349..105948) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098984.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(105956..106447) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163138.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene mreD CDS complement(106444..107451) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802506.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene mreC CDS complement(107633..108676) product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918653.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene mreB CDS complement(108945..110888) product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817282.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene csrD CDS 111269..112195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 112441..113421 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174340.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 113892..114335 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174343.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene aroQ CDS 114376..114837 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163113.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene accB CDS 114850..116217 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817284.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene accC CDS complement(116284..116715) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 116858..117253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 117452..117709 product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098993.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 117699..119144 product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817285.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene panF CDS 119193..120077 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145812.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 gene prmA CDS 120356..121363 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174350.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene dusB CDS 121345..121641 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene fis CDS 121802..122350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 122494..123882 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098348.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(123901..125250) product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095441.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(125385..126098) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518759.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(126073..126267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 126354..127655 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382267.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 127717..128907 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171409.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene uxuA CDS 129132..130412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 130496..131302 product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 131427..131579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(131569..132084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(132115..133014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(133132..133821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848157.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(133808..136366) product CS1-pili formation C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878114.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(136433..136942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(137001..137585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(138027..139289) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212169.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(139289..139675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(139679..140239) product tight adherence pilus pseudopilin TadF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817205.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene tadF CDS complement(140229..140723) product tight adherance operon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817204.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(140720..141469) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212166.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(141462..142295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(142295..143176) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032819623.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(143173..144453) product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079097.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(144463..145605) product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213784.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(145620..146123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(146120..147481) product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817199.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(147486..148301) product tight adherance operon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817198.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(148924..149160) product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091314.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(149441..150043) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817195.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(151204..153372) product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095186.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 153690..155828 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368566.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene nrdD CDS 155908..156372 product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095356.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene nrdG CDS 156406..156819 product DUF2251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225853.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(156806..157279) product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449449.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 157391..157708 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209274.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(157721..158224) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098905.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(158218..158739) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815454.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(158808..159002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(159139..159426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 159566..159781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 159823..161949 product DUF4034 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434232.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 162295..163290 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098907.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 163303..164184 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209269.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(164229..165203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(165231..166928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 167141..167689 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208541.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 168092..168979 product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167626.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene cyoA CDS 168983..170977 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163523.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene cyoB CDS 170967..171587 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061708214.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 171588..171914 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706741.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 171926..172819 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208653.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene cyoE CDS 172979..174400 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216717.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 174506..175519 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815448.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 175605..176561 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271954.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 176658..176816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 176813..177688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 177752..178888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 179405..179788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(179896..180450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294022.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(180777..182147) product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104433.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(182290..183066) product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168948.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(183070..183714) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168943.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(183711..184991) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298110.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(184991..185902) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847999.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 186301..187071 product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212058.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene ygbI CDS complement(187121..187810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(188109..189323) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260208.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(189609..190610) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047748.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene pdxA CDS complement(190607..191938) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047749.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(191958..192713) product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296319.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene ygbI CDS 192957..193934 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 sequence07 source 1..155489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(55..1923) product DEAD/DEAH family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369531.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(2091..2981) product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209260.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene nlpI CDS complement(3141..5252) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295554.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene pnp CDS complement(5535..5804) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369527.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene rpsO CDS 6237..7052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 7103..7792 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 7789..8784 product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768670.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 8774..10297 product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268794.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 10301..11593 product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112781.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 11583..12614 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 12611..13915 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112779.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(14003..14953) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209256.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene truB CDS complement(14953..15354) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040208.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene rbfA CDS complement(15445..18120) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703597.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene infB CDS complement(18144..19631) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369524.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene nusA CDS complement(19651..20103) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300397.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene rimP tRNA complement(20312..20388) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 20609..21508 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533150.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(21566..22423) product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461090.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(22425..22976) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815824.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene dmsB CDS complement(22979..25564) product dimethyl sulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392902.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(25631..26332) product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815827.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(26344..27666) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459874.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(27679..28611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(29118..31199) product bifunctional siderophore receptor/adhesin Iha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223352.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene iha CDS complement(31634..31816) product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513737.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(31819..32172) product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939317.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene yeaR CDS complement(32204..32530) product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248993.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene yeaR CDS complement(32582..33715) product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098453.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene norW CDS complement(33712..35160) product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703252.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene norV CDS 35348..36862 product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010723.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene norR CDS 37277..40015 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309459.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS complement(40103..40582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 40915..42585 product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556312.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(42719..43261) product copper-binding periplasmic metallochaperone CueP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047148.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene cueP CDS complement(43657..43785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(43820..44407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(44422..44841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(44865..46457) product urocanate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074216.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene urdA CDS 46615..48435 product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071621.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 48435..49061 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263004.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(49182..49391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 note possible pseudo, internal stop codon, frameshifted CDS 49954..51327 product diguanylate cyclase DosC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426292.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene dosC tRNA complement(51617..51703) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(51746..52078) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272680.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene secG CDS complement(52373..53182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(53292..54032) product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823111.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(54106..55446) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175398.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene glmM CDS complement(55456..56289) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703603.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene folP CDS complement(56368..57306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(57528..59480) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156284.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene ftsH CDS complement(59533..60207) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145975.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene rlmE CDS 60285..60578 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054420.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene yhbY CDS complement(60668..61144) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210184.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene greA CDS 61457..62890 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217314.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene dacB CDS complement(62948..64132) product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156290.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene cgtA CDS complement(64233..65195) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175407.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(65344..65601) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434222.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene rpmA CDS complement(65621..65932) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271396.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene rplU CDS 66195..67166 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047336.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene ispB CDS complement(67210..67596) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210176.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(67631..68005) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210176.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 68579..68845 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210175.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(68928..69866) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156310.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene mdh CDS 70154..70624 product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210173.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene argR CDS complement(70697..72070) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368582.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene mpl CDS 72320..73327 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216946.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene fbp CDS 73480..74226 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817053.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 74554..75084 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055075.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene ppa CDS complement(75171..75527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(75517..75867) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210168.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(75870..79634) product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154295113.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(79631..81292) product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704192.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene tamA CDS 81548..82186 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210165.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene msrA CDS 82401..83738 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210164.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(83827..84033) product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368594.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(84277..85056) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175628026.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene cysQ CDS 85378..86685 product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418812.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene dcuC CDS 86741..88012 product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694556.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(88086..88706) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502892.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene fklB CDS complement(88792..90006) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298533.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 90229..90927 product OapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095310.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(90934..91293) product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164450.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(91420..91872) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175476.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene rplI CDS complement(91908..92135) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene rpsR CDS complement(92140..92460) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210154.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene priB CDS complement(92467..92868) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004098001.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene rpsF CDS complement(93061..93465) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524853.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(93582..94718) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135177497.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(94884..95381) product YbaK/prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705788.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 95476..96132 product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816929.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 96328..97284 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815364.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 97366..98055 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532554.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(98104..98835) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209161.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene rlmB CDS complement(98910..101333) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704173.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene rnr CDS complement(101337..101795) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175497.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene nsrR CDS complement(102205..102405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 102840..105029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 105086..105289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(105404..106702) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209157.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(107015..107197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 107701..108288 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206555.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 108369..111011 product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 111037..111777 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112554.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 111777..112034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 112535..118165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 119223..119648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(119802..120008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(120083..121087) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156425.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene hflC CDS complement(121094..122383) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312481.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene hflK CDS complement(122438..123721) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704170.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 gene hflX CDS complement(123757..124050) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051883.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 gene hfq CDS complement(124251..125177) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704169.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene miaA CDS complement(125170..127113) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209148.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 gene mutL CDS complement(127130..128662) product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232017.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene amiB CDS complement(128709..129182) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene tsaE CDS complement(129231..130652) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295189.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 gene nnr CDS 130735..131874 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294246.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene queG CDS complement(132211..133626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(133630..135012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(135009..136166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325761.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 136406..137254 product tetratricopeptide repeat protein YfbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767280.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene yfbP CDS 137299..137817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 137810..138187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 138301..139476 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022250.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 139477..140124 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920512.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 140291..140998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 141035..141694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 141955..142728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228097.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 142935..143555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(143687..145126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(145303..146205) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640443.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 tRNA complement(146688..146763) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(146797..146872) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(146923..146998) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(147180..147725) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295188.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene orn CDS 147827..148870 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041948.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene rsgA CDS 149026..149901 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209141.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene asd CDS 149922..153242 product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228123.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene mscM CDS complement(153324..154301) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004789.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene epmA sequence08 source 1..141806 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(8894..10768) product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703497.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene gss CDS 11142..12281 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818441.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 12571..13536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(13608..13892) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081072.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(13889..15175) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461742.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(15318..16259) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091514.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(16282..17058) product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692187.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(17114..18253) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(18341..19666) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437552.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(19788..20921) product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene hadC CDS complement(20921..22162) product phenyllactyl-CoA dehydratase subunit FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048237.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene fldB CDS complement(22159..22986) product phenyllactyl-CoA dehydratase activase FldI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357618.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene fldI CDS complement(23022..24257) product 3-(aryl)acryloyl-CoA:(R)-3-(aryl)lactate CoA-transferase FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048238.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene fldA CDS complement(24322..25959) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048239.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 26340..27056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762387.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 27049..28575 product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463528.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 28583..29971 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 29975..31321 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940915.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 31321..32346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 33067..34377 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 34374..35717 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(35743..36771) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 36958..37599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 37556..38146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(38136..39449) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(39446..40384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 40874..41092 product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097596.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene tatE CDS complement(41206..41619) product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211943.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene tssE CDS complement(41630..42193) product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096443.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene tssJ CDS complement(42215..43252) product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373315.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene tssG CDS complement(43216..44982) product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342476.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 gene tssF CDS complement(45200..46786) product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211937.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 gene tssA CDS complement(46776..50165) product type VI secretion system membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211936.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(50545..51264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(51287..52000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(52037..55102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(55154..55867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(55995..56279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(56297..57463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(57485..58396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(58389..61742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(61884..64595) product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211927.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene tssH CDS complement(64718..65206) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210014.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(65217..66932) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214568.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(67094..67753) product type VI secretion system protein TssL, short form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710992.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene tssL CDS complement(67750..69102) product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211664.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene tssK CDS complement(69130..70665) product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214707.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene tssC CDS complement(70703..71215) product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211662.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene tssB CDS complement(72129..72473) product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558209.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(72621..73484) product SAM-dependent methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212046.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene tehB CDS complement(74000..74323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(74569..75546) product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028521.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(75684..76751) product colicin M resistance lipid reductase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001318137.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene cbrA CDS complement(76822..77613) product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164952.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 gene kdgR CDS complement(77719..78633) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098099.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene rnz CDS complement(78659..79651) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705350.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(79679..80311) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095436.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(80649..81476) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095437.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(81577..82158) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817212.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 82432..83151 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088307.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 83148..83471 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088669.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 83570..85453 product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137313061.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 85553..87442 product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137313061.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(87439..88785) product sodium-coupled multidrug efflux MATE transporter VcrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981941.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene vcrM CDS complement(88817..89425) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121044.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(89627..90937) product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175646.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene gltP CDS 91780..93738 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209031.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene acs CDS 93939..94250 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156735.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 94247..95902 product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175651.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene actP CDS complement(96047..100270) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653944.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene rpoC CDS complement(100405..104433) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503453.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene rpoB CDS complement(104775..105146) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003033114.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene rplL CDS complement(105198..105695) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207203.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene rplJ CDS complement(106011..106715) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096684.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene rplA CDS complement(106719..107147) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210672.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene rplK CDS complement(107306..107851) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210671.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene nusG CDS complement(107853..108236) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210670.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene secE CDS complement(108495..109679) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210669.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene tuf tRNA complement(109799..109874) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(109878..109952) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(110276..110360) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(110386..110461) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 110807..112378 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815714.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS 112450..113346 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212223.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 113343..114155 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212224.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 114149..114955 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212225.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 114939..115547 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815715.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 115752..117527 product two-component system sensor histidine kinase AtoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559125.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene atoS CDS 117524..118900 product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene atoC CDS 119184..119843 product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850540.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene atoD CDS 119846..120511 product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693164.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 120508..121830 product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580275.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 122125..123312 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786529.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene atoB CDS complement(123350..123565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 123743..125404 product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994202.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(125447..125743) product DUF2695 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899242.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS complement(125975..127000) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077175158.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene hypE CDS complement(127012..128118) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817174.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene hypD CDS complement(128102..128398) product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334896.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene hybG CDS complement(128389..129267) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817176.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene hypB CDS 129289..129621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(129802..130143) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544945.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 gene hypA CDS complement(130136..130627) product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004951.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene hybE CDS complement(130630..131115) product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221946.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(131115..132818) product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083046.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene hybC CDS complement(132815..133993) product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017676.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene hybB CDS complement(133983..134966) product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081868.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene hybA CDS complement(134969..136087) product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145410.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene hybO CDS complement(136474..137523) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584083.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 137847..139199 product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090665.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene pcaB CDS 139377..140780 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064529112.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 sequence09 source 1..139514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(167..733) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140169.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene gmhB CDS 936..1967 product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594004.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene metN CDS 1960..2613 product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856130.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 2666..3481 product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene metQ CDS 3621..3959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 3960..4667 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212157.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene tsaA CDS 4817..6538 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163997.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene proS CDS complement(6622..7176) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096965.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(7188..8171) product type 1 fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703282.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(8185..10722) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096967.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(10812..11480) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097474.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(11586..12107) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419182.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 12901..13419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(13422..14102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(14415..15788) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104851.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(16277..18814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(19200..20345) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706383.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(20351..21619) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200863.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(21738..22874) product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209535.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 23392..24699 product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244145.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS 24722..25789 product DUF459 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689032.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 25789..27006 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691388.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS complement(27068..27829) product protein bax inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077703.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 28181..28678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 28672..29514 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272620.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 29511..31040 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272619.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 31262..33934 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816260.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene acnA CDS complement(34117..34812) product LuxR family transcriptional regulator YenR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170826.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene yenR CDS 35326..35760 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170794.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 35928..36914 product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158910.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene hlyD CDS 36924..38681 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168099.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 38674..39816 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168097.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 39820..40947 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168094.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(40996..41985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(42213..43655) product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817210.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene ftsP CDS complement(43723..44469) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098722.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene plsC CDS complement(44679..46949) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817211.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene parC CDS complement(47007..48896) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817213.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene parE CDS complement(49070..49651) product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105725.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene yqiA CDS complement(49651..50478) product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817215.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene cpdA CDS complement(50528..50908) product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703512.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(51184..51540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(51656..52288) product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212184.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene nudF CDS 52339..52515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS 52512..53861 product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001663008.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene tolC CDS 54170..54841 product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357252.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 54854..56014 product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160795.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(56072..56854) product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene ygiD CDS 57149..57913 product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295627.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 gene zupT CDS complement(57980..58633) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076993.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene ribB CDS 59066..59317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(59352..60611) product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817218.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene yjeH CDS complement(60623..62050) product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817219.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene hldE CDS 62247..63185 product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816068.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(63225..68933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(69171..70076) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855391.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(70560..71825) product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495330.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(71838..73508) product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580919.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 73972..75021 product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703914.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 gene allD CDS 75289..76506 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355251.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 76530..77450 product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333961.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(77447..78391) product HTH-type transcriptional activator AllS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460148.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene allS CDS complement(78596..79057) product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016318.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(79117..80199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(80238..81260) product DUF4272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275493.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 81619..82602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(82679..83071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(83068..83283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(83449..86289) product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817220.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene glnE CDS complement(86315..87604) product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817221.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 88011..88634 product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125331.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 88746..89984 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817222.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 90123..90689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS complement(90738..91565) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833310.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene bacA CDS complement(91671..92039) product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369633.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene folB CDS 92149..92787 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160822.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene plsY CDS complement(92794..93816) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369630.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene tsaD CDS 93997..95592 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 95753..95968 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene rpsU CDS 96161..97909 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210358.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene dnaG CDS 98109..99962 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210359.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene rpoD CDS 100044..100619 product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680960.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 tRNA 100701..100776 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(100819..101439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(101488..102072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(102111..102671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(102767..103057) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948599.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(103060..103371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099360.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(103731..103946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(103927..104343) product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022471380.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(104370..104789) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(104789..105043) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614401.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 105677..105865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(106025..106438) product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077627724.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene hicB CDS complement(107168..107698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(107702..108643) product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434121.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(108646..109332) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091922.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(109329..110087) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896415.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(110084..110641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(110791..111333) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211606.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(111449..112225) product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211604.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(112227..112844) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211603.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene dmsB CDS complement(112855..115284) product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211602.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(115680..119165) product autotransporter adhesin YapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817383.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene yapE CDS 119590..119874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 120037..120450 product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766711.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(120510..121949) product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765555.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(121946..124831) product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(124973..125794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(125910..126794) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706023.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(126826..127071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704706.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 127328..128110 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393133.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(128427..129269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(129266..130231) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113699.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(130256..131506) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113698.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(131460..131636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(131749..132372) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389114.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene dhaL CDS complement(132374..133372) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389115.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(133403..134407) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113700.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(134432..135724) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051155748.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 136227..137195 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209407.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 137614..138072 product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209402.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene rpiB CDS 138227..139177 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072436.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene tal sequence10 source 1..121569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(318..1655) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040269.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS complement(1712..3103) product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467018.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene dcuC CDS complement(3399..4589) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975831.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 4914..7823 product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816861.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 gene copA CDS 7922..8725 product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208580.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 8864..9340 product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428207.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 gene ybaK CDS 9488..10708 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208584.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 10926..12623 product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158223.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene ybaL CDS complement(12935..13897) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208599.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene hemH CDS complement(14086..15756) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525720.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(16740..17135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(17334..17978) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220235.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene adk CDS complement(18289..20172) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354670.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene htpG CDS complement(20340..20945) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095898.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 gene recR CDS complement(20945..21274) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(21328..23373) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208605.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene dnaX CDS complement(23467..24015) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208606.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene apt CDS complement(24153..24566) product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704615.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 24790..25326 product primosomal replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208610.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS 25441..26778 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074039.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 26832..28343 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208505.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 28345..29028 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074040.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 29085..29249 product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456217.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene rsmS CDS complement(29264..29788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(29821..30174) product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169669.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene ychN CDS complement(30212..30856) product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167699.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene acrR CDS 31015..32211 product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386618.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 gene acrA CDS 32234..35389 product multidrug efflux RND transporter permease subunit AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704610.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene acrB CDS 35507..36463 product iron exporter MbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090619.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene mbfA CDS complement(36499..36771) product Ni(II)/Co(II)-binding transcriptional repressor RcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019953.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene rcnR CDS 36891..38051 product nickel/cobalt efflux protein RcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703366.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 38341..38661 product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371948.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(38695..39114) product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779802.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 39372..40250 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167662.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene tesB CDS complement(40327..41610) product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167660.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene amtB CDS complement(41650..41988) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208627.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene glnK CDS complement(42336..42626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(42972..44762) product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256174.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(44755..46494) product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235623.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(46622..47089) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367940.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS 47227..48264 product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208631.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(48317..49231) product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086919.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene rhtA CDS complement(49381..50040) product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724436.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene aphA CDS complement(50462..51673) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209717.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene fabB CDS 51845..53875 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815908.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene mnmC CDS complement(53926..54198) product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365545.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS complement(54223..54783) product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089227.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene epmC CDS complement(54822..55625) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815907.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(55629..56465) product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171929.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene mepA CDS complement(56505..57590) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171931.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene aroC CDS complement(57628..58560) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209710.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene prmB CDS 58720..59250 product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227846.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 gene smrB CDS complement(59270..59488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS 59829..60371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS 60371..60817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 60917..61135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS 61249..61581 product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(61639..62112) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158598.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 gene sixA CDS complement(62195..62488) product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227845.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 62904..64202 product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392784.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene fadL CDS complement(64266..65027) product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098159.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene mlaA CDS complement(65068..66270) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815901.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene ccmI CDS complement(66270..66761) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703210.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(66758..67315) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171969.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(67312..69273) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209698.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(69270..69767) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158631.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 gene ccmE CDS complement(69764..69979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(69979..70713) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815898.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(70758..71417) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209694.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene ccmB CDS complement(71417..72043) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209693.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene ccmA tRNA 72307..72381 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(72613..72689) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(72787..72863) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(72937..73013) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(73024..73116) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(73394..73579) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene csrA CDS complement(73865..76492) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047160.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene alaS CDS complement(76633..77106) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167422.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 gene recX CDS complement(77143..78192) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707431.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene recA CDS complement(78295..78789) product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167419.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 gene pncC CDS 79042..79818 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066817.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 79848..80804 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094852.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 81113..83674 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209399.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene mutS CDS complement(83731..84306) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167922.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(84311..85417) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969819.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS 85612..87792 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478019.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(87872..88861) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209397.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene rpoS CDS complement(88920..89834) product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080440.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene nlpD CDS complement(90305..90937) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167299.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(90949..91698) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209394.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene surE CDS complement(91821..92870) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815611.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene truD CDS complement(92867..93340) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219242.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene ispF CDS complement(93362..94072) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209391.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene ispD CDS complement(94073..94360) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167289.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene ftsB CDS complement(94381..95349) product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057563589.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(95481..96203) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705159.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS complement(96196..96957) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705158.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS complement(97029..97805) product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705157.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 98155..98871 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083620.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 98902..99366 product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073203.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 99447..100559 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097629.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(100696..101154) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291990.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene gpt CDS 101474..102934 product beta-Ala-His dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167527.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene pepD CDS complement(102987..104042) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704475.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene dinB CDS complement(104120..105145) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227821.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 105430..106167 product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225658.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene dpaA CDS complement(106174..106941) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208719.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(106981..107565) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457680.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene lpcA CDS complement(107642..108271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 tRNA complement(108398..108474) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(108580..109344) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210700.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene dnaQ CDS 109392..109859 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368126.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene rnhA CDS complement(109874..110593) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173047.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 110592..111395 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210697.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene gloB CDS 111468..112991 product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018127.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene mltD CDS complement(113010..113804) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173073.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(114025..115740) product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175308.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(115804..116703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(116682..116828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(117374..118549) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095683.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 118654..119538 product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648572.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 gene yafC CDS complement(119563..120369) product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154870.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene dkgB tRNA complement(120531..120607) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 rRNA complement(120809..120919) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence11 source 1..120844 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(42..833) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201804.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene murI CDS complement(860..2626) product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815316.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene btuB CDS 3112..4215 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368905.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene trmA CDS complement(4271..7069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(7363..7737) product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501783.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(7769..8422) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470429.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene fabR CDS complement(8503..9420) product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099297.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene oxyR CDS 9581..10312 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209479.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 10459..11907 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815311.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 12049..12954 product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087233.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene eamA CDS 13115..13486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 13889..14731 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681808.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(14786..15367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(15470..16033) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215902.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(16250..17548) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262203.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(17707..19137) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460903.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 gene aspA CDS 19279..20226 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930973.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(20294..30241) product autotransporter adhesin YapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211638.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene yapH CDS complement(30492..30767) product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228052.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(31520..32092) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366420.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 32142..32660 product L-methionine sulfoximine/L-methionine sulfone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027563.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 gene mddA CDS 32657..33103 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705551.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 33181..33999 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230452.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 34062..34370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 34493..34681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 34750..35727 product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230734.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene kdgT CDS 35791..37032 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930574.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 37091..38104 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene pdxA CDS 38203..38958 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224211.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 39054..39512 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228480.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 39544..40047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(40135..41505) product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705380.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene dcuC CDS 41738..42625 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530319.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(42689..44059) product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765672.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(44563..45906) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207682.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene argG CDS complement(46264..46548) product SymE family type I addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094873.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 46680..46844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(46902..48374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 tRNA complement(48525..48619) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(48770..49951) product DNA-binding transcriptional regulator XylR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494484.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene xylR CDS complement(50082..51248) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817423.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene gguB CDS complement(51238..52767) product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817424.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(52869..53867) product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175009.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene xylF CDS 54439..55758 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830210.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene xylA CDS 56232..57686 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050158375.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene xylB CDS 57871..58320 product PsiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095479.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(58402..59010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 59655..60542 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523002.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 60564..61988 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972507.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene leuC CDS 61991..62608 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721055.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene leuD CDS complement(62677..63594) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367267.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS 63956..64552 product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174190.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(64925..66805) product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817432.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene selB CDS complement(66802..68199) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209608.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene selA CDS complement(68401..69018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS complement(69095..69463) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237588.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS complement(69463..69735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069541.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 70335..70529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(70621..70887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(70905..72095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(72292..75027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 75644..76708 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113749.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(76765..77319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 77630..78718 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208546.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 78812..80581 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208545.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 80574..81647 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208544.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(81715..82737) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232704.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(82881..84410) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463030.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(84430..84891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(84943..85926) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582705.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(85923..87005) product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(87029..87955) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703939.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(87957..89615) product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(89617..91248) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210047.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 91310..91471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(91502..92224) product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(92556..93029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS complement(93149..95947) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816318.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 96009..96197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(97227..101084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(102203..102649) product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096210.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene lysM CDS complement(102746..104065) product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817455.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 104250..105212 product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175128.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(105226..105747) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095458.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 105892..107298 product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845433.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene clcA CDS 107325..108104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086844.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(108131..109369) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521075.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 109578..110291 product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030930.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 110288..112999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 113029..114108 product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704976.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS 114185..115633 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704972.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 116069..117706 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704284.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 117716..118270 product enterohemolysin-activating lysine-acyltransferase EhxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520917.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene ehxC sequence12 source 1..111004 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 512..1261 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792300.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 1587..2153 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404446.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS complement(2212..3132) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369744.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 gene speB CDS complement(3214..5115) product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209969.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene speA CDS 5731..6885 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062128.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene metK CDS 7018..7482 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228059.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 7684..8415 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209975.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene rsmE CDS 8427..9377 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173586.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene gshB CDS 9487..10050 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817044.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 10050..10472 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157116.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene ruvX CDS complement(10518..11051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(11091..12086) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703454.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 12106..12807 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173610.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS 12846..13661 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817046.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene proC CDS 13761..14309 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157142.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 14306..14605 product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173614.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene yggU CDS complement(14654..15424) product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050163392.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 15715..16308 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173616.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 16301..17431 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098670.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 gene hemW CDS complement(17481..18206) product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817048.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(18509..18844) product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862421.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS complement(18844..19563) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173629.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 gene trmB CDS 19793..20848 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847823.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene mutY CDS 20863..21135 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105744.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS 21173..22255 product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157159.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 gene mltC CDS 22342..23088 product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687768.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(23132..24310) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786525.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene atoB CDS complement(24321..24968) product acetate CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339065.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene atoA CDS complement(24965..25624) product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693165.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene atoD CDS complement(25741..26040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(26043..27380) product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(27416..28729) product citrate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389229.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS 28960..29835 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818676.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 29955..31382 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527476.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(31438..32007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(32138..32818) product NAAT family transporter MarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885033.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene marC tRNA 33106..33181 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS 33340..34557 product O-antigen ligase RfaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204742.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 gene rfaL CDS complement(34585..34968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(34941..35138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(35196..35972) product 3-deoxy-D-manno-oct-2-ulosonate III transferase WaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790279.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 gene waaZ CDS complement(35969..36676) product lipopolysaccharide core heptose(II) kinase RfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582822.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 gene rfaY CDS complement(36698..37105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33070 note possible pseudo, frameshifted CDS complement(37108..37716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 note possible pseudo, frameshifted CDS complement(37716..38801) product lipopolysaccharide 1,6-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683964.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene waaB CDS complement(38828..39625) product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262247.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene rfaP CDS complement(39618..40742) product lipopolysaccharide glucosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634283.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene rfaG CDS complement(40739..41797) product lipopolysaccharide core heptosyltransferase RfaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360409.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene rfaQ CDS complement(42257..42907) product lipopolysaccharide kinase InaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301054.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene inaA CDS 43333..45036 product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192092.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(45098..45565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(45636..45968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082000.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 46107..46412 product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137910.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 46409..46873 product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095208.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS 47051..53086 product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210294.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 53096..55522 product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070480.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene pbpC CDS complement(55503..56654) product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816744.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(56782..57579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS 58389..62711 product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965697.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS complement(62785..63306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 63636..65441 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940637.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 65428..66780 product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368806.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 gene zraR CDS 66928..67293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(67303..68331) product TerC/Alx family metal homeostasis membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099182.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(68511..69107) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704843.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene ybjG CDS 69297..70229 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083418.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 gene panE CDS complement(70306..71007) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170772.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS complement(71004..71864) product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095306.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS complement(71875..72531) product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056760.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene ulaD CDS complement(72557..73030) product PTS ascorbate transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776536.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 gene ulaC CDS complement(73043..73348) product PTS ascorbate transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218360.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 gene ulaB CDS complement(73352..74773) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368616.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 gene ulaA CDS complement(74869..75018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 75183..76247 product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049161.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 gene ulaG CDS 76381..77136 product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133631.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene ulaR CDS complement(77155..78597) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815810.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene mgtE CDS complement(79125..79439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(79838..81406) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174376.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(81810..83162) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080104.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(83324..83653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 83967..85643 product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816819.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene kdpA CDS 85665..87731 product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816820.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 gene kdpB CDS 87728..88324 product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001334152.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene kdpC CDS 88333..91026 product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167969.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 gene kdpD CDS 91029..91715 product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025470747.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 gene kdpE CDS complement(91732..92526) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209724.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 92630..93550 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209722.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(93555..94046) product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815410.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(94110..94706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(94937..95443) product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209100.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 gene ssb1 CDS complement(95605..96216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 96363..99194 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174389.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene uvrA CDS complement(99241..99729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS 100930..102246 product C4-dicarboxylate transporter DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246626.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 gene dctP CDS complement(102319..103395) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174405.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene alr CDS complement(103564..104907) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165232.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 gene dnaB CDS 105361..106386 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966592.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 106589..107572 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704044.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS 107650..108141 product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681732.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(108498..109067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS 109231..109479 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310454.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 sequence13 source 1..77476 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(44..583) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176268.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 gene hemG CDS complement(614..2065) product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176271.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 gene trkH CDS complement(2104..2715) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378910.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(2715..4046) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211547.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene pepQ CDS 4448..4669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS complement(4737..7007) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176312.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene metE CDS 7109..8005 product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573612.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene metR CDS complement(8002..8931) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215597.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS 9055..11343 product zinc/cadmium/mercury/lead-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815354.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(11402..13213) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050129919.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene edd CDS complement(13474..14811) product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833577.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 gene gntU CDS complement(14823..15167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(15541..16536) product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209514.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene gntR CDS complement(16673..17302) product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833703.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene rhtC CDS complement(17487..19337) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211484.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 gene recQ CDS 19640..20527 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211481.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene rarD CDS complement(20519..21583) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705660.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS complement(21868..22818) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166238.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 gene corA CDS complement(23295..25457) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815343.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 gene uvrD CDS complement(25500..26216) product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211474.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene yigB CDS complement(26216..27142) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815341.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene xerC CDS complement(27139..27846) product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211472.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(27843..28667) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983200.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 gene dapF CDS complement(28771..30021) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384387.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene lysA CDS complement(30135..30347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS 30405..30728 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815340.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 gene cyaY CDS 31000..31971 product reverse transcriptase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046082755.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS complement(31968..34382) product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815339.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS 34878..35819 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166104.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene hemC CDS 35816..36556 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026074.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene hemD CDS 36574..37764 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176188.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene hemX CDS 37767..38948 product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211462.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene hemY tRNA complement(39688..39764) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(39811..39896) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(39923..39998) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(40065..40141) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS 40940..41869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS complement(41959..42687) product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176198.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 gene wecG CDS complement(42697..44067) product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815334.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 gene wzyE CDS complement(44067..45146) product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211979.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(45143..46393) product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176202.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene wzxE CDS complement(46395..47525) product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612044.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 gene rffA CDS complement(47542..48252) product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848112.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene rffC CDS complement(48230..49111) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815331.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene rfbA CDS complement(49169..50242) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848110.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene rffG CDS complement(50239..51501) product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211985.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene wecC CDS complement(51498..52628) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211986.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene wecB CDS complement(52711..53745) product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080212.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene wzzE CDS complement(53766..54848) product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176219.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 gene wecA CDS complement(54935..56194) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883293.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene rho CDS complement(56638..56964) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280776.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 gene trxA CDS 57110..58396 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228177.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene rhlB CDS 58409..59926 product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089447.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene gppA CDS 60051..61223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(61271..63295) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211993.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 gene rep CDS complement(63421..63792) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084974.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(63958..65436) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212007.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene ilvC CDS 65595..66476 product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176081.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 gene ilvY CDS complement(66484..67182) product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS complement(67242..68792) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176085.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene ilvA CDS complement(68792..70642) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127391.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 gene ilvD CDS complement(70718..71647) product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212015.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(71670..71927) product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368897.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 gene ilvM CDS complement(71924..73576) product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815319.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene ilvG CDS 74144..75667 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815318.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS complement(75707..76045) product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840996.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 gene maoP CDS 76162..76992 product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212020.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene hdfR tRNA complement(77054..77129) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA complement(77138..77214) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 sequence14 source 1..75828 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 329..1033 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175190.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 1049..2437 product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099391.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene mdtD CDS complement(2485..4095) product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175182.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 gene kup CDS 4043..4237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS 4582..6105 product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815252.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene ravA CDS 6102..7553 product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212255.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 gene viaA CDS complement(7550..8539) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815250.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene asnA CDS 8694..9155 product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500198.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene asnC CDS 9247..9711 product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212258.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 gene mioC CDS 10176..11966 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817477.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 gene mnmG CDS 11977..12597 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932864.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene rsmG CDS 13203..13583 product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703918.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 gene atpI CDS 13609..14433 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135618.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene atpB CDS 14483..14725 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307205.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene atpE CDS 14788..15258 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004107293.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene atpF CDS 15273..15806 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220760.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene atpH CDS 15819..17360 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176745.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene atpA CDS 17406..18269 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862364.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene atpG CDS 18303..19682 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190499.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 gene atpD CDS 19702..20124 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024912932.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 20207..20938 product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532752.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS complement(20949..21842) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174098.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 22003..23061 product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112567.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS 23058..24134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS 24131..25150 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144142.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 25161..27374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS 27406..28821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS 28824..30077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS 30336..31706 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175168.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 gene glmU CDS 31871..33706 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215552.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene glmS CDS complement(33811..34545) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206820.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS 34692..35750 product bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038544.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS complement(35792..37342) product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480236.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene yfcC CDS complement(37505..40405) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150547447.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS complement(40749..42137) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886939.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS 42646..43686 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215557.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 gene pstS CDS 43746..44702 product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215558.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 gene pstC CDS 44704..45588 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175158.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 gene pstA CDS 45602..46381 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215562.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 gene pstB CDS 46446..47159 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817472.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 gene phoU CDS complement(47226..47768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224304.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(47902..48444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS complement(48550..48723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(48948..49613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 50239..50556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34730 note possible pseudo, frameshifted CDS 50553..50765 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193665.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS 50887..51069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS 51086..51502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 51636..51785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS 52016..53410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(53504..54334) product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156544.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(54381..55427) product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209061.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(55498..57513) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815406.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(57641..57871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(58087..58941) product tagatose bisphosphate family class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423588.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(58996..59775) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083899.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(59879..60925) product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844177.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 gene gatD CDS complement(60973..62355) product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490608.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(62359..62643) product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823282.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 gene gatB CDS complement(62708..63157) product PTS galactitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080443.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 gene gatA CDS complement(63162..64424) product tagatose-bisphosphate aldolase subunit GatZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853833.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 gene gatZ CDS 64759..65604 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215568.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS 65988..66725 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817469.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 66728..67480 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215573.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(67485..68729) product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816067.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene mdtG CDS complement(68854..69522) product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215575.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene yieH CDS 69805..71139 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215577.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(71188..71610) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208063.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 71816..72409 product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098488.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 72421..73857 product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369995.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 73854..74093 product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562964.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(74112..74696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35000 sequence15 source 1..74138 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..7635 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_155030721.1:Ig-like domain-containing protein locus_tag LOCUS_35010 CDS 7717..8679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS 8768..10927 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095715.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS 10929..12185 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095714.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS 12188..13942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS 14140..15600 product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061090571.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS complement(15718..17085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(17333..18700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(19064..21037) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044179.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(21175..22125) product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694473.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(22180..23346) product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(23383..23676) product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812779.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS complement(23876..24379) product anti-virulence regulator CigR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705491.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS 24525..25046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS complement(25006..25950) product DNA-binding transcriptional regulator DsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705340.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 gene dsdC CDS 26219..27823 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS 27851..29224 product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454077.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS 29269..30633 product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658347.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 gene dsdA CDS 30890..31888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS 31842..32663 product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530507.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS complement(32829..35108) product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172316.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 gene maeB CDS 36061..39267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS complement(39332..40009) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097181.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 40149..41054 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811380.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 tRNA 40698..40784 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS 41183..41524 product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929408.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(41624..42214) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170245.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS complement(42232..43629) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167417.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS 43862..44365 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243480.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 gene yfkJ CDS 44425..46110 product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367863.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 gene hscC CDS 46253..46639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS 46709..47041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 47127..47408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(48155..48493) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560819.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS complement(48494..48844) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001779357.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS complement(49088..49756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS complement(50029..50745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 50876..51034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS complement(51775..51921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS complement(51924..52844) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706083.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS 52977..54770 product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706084.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS 54793..56142 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365755.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 56331..56924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(57170..57493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(57505..57927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS complement(57975..58451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS complement(58448..59632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS 59592..59756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS 59762..60094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS complement(60180..60650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS complement(60659..60931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS complement(60972..61202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS complement(61202..63850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS complement(64144..64350) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193665.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(64347..64808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201267.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 65152..65508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(65553..65834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS complement(65851..71283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS complement(71593..72207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS 72330..72596 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433427.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 sequence16 source 1..71254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 8116..8331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS 9022..9636 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703812.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS complement(9633..10631) product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175187.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene rbsR CDS complement(10642..11565) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815255.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 gene rbsK CDS complement(11661..12554) product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175185.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 gene rbsB CDS complement(12598..13569) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815254.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 gene rbsC CDS complement(13573..15090) product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175183.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 gene rbsA CDS complement(15104..15523) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161210.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene rbsD CDS complement(16086..16754) product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693164.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS complement(16751..17410) product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693165.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 gene atoD CDS complement(17431..18609) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666204.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS complement(18609..19439) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS complement(19441..20712) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693428.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS complement(20727..21500) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS 21777..22457 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037144.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS complement(22499..22813) product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156471.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene sugE CDS 23039..23458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS 23497..24750 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037790.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS complement(24779..25132) product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302630.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS complement(25190..25321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS complement(25397..25963) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855940.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene efp CDS 26006..27031 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815416.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 gene epmB CDS 27228..28439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS complement(28488..29735) product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920653.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS complement(29942..30646) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816960.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS 30824..31597 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971598.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS 31657..32703 product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197411.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 gene idnD CDS 32852..34219 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192118.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(34342..35988) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095260.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 gene groL CDS complement(36041..36334) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS complement(36516..37001) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175568.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 gene fxsA CDS 37407..38831 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000335685.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 gene aspA CDS 39080..40381 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095257.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 40534..40878 product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704145.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 gene cutA CDS 40854..42596 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068922.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 gene dsbD CDS 42628..43659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS complement(43705..44580) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972737.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS 44850..45737 product extended-spectrum class A beta-lactamase CTX-M-15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239590.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 gene blaCTX-M tRNA 45875..45950 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 CDS complement(46059..46280) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193665.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS 46621..46872 product type II toxin-antitoxin system antitoxin ChpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223213.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene chpS CDS 46866..47222 product endoribonuclease toxin ChpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239577.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 gene chpB CDS 47309..48385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS complement(48556..49170) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390814.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS 49290..49886 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064380616.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS 50294..50791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS 50885..51565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(51657..52463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(53264..55348) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356916.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(55360..59436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(59482..63561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(63596..64870) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529846.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(64870..65463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(65476..66954) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090505.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(67012..68613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36130 misc_feature complement(69950..>71254) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816318.1:autotransporter outer membrane beta-barrel domain-containing protein locus_tag LOCUS_36140 sequence17 source 1..51180 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1563 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209965.1:transketolase locus_tag LOCUS_36150 CDS 2055..3218 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111274.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 gene pgk CDS 3390..4466 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209962.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 gene fbaA CDS complement(4543..5727) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819149.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS complement(5720..6976) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732668.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS complement(6980..8206) product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356229.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS 8604..9458 product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817032.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 gene mscS CDS 9606..10229 product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173528.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 gene argO CDS 10330..11073 product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173525.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS complement(11083..11976) product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163344.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS 12272..12931 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189743.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 gene rpiA CDS 13228..14460 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151610.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 gene serA CDS 14521..15189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS complement(15184..15774) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173520.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS complement(16089..16418) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205298.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 gene zapA CDS 16753..17328 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173516.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS 17359..18681 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817031.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 gene pepP CDS 18678..19859 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703430.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 gene ubiH CDS 19871..21079 product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192216.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 gene ubiI CDS 21459..22553 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068738.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 gene gcvT CDS 22630..23019 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355634.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 gene gcvH CDS 23130..25922 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817028.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 gene gcvP CDS 26382..27800 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948912.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS 28009..28656 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250274.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS complement(28718..29713) product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209940.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 gene ygfZ CDS 29995..30261 product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354046.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 gene sdhE CDS 30233..30664 product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244779.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS 30718..31398 product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209937.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 gene creB CDS 31395..32825 product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209936.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene creC CDS 32924..34444 product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220113.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 gene creD CDS complement(34515..35033) product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209934.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 gene fldB CDS 35331..36230 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173453.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 gene xerD CDS 36271..37008 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098611.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 gene dsbC CDS 37102..38835 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173449.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 gene recJ CDS complement(38876..45409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS 46227..47078 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817019.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 gene prfB note possible pseudo, frameshifted CDS 47097..48620 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817018.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 gene lysS CDS 48854..49525 product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172134.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS 49550..49918 product DUF4810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215846.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS 49915..50571 product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211607.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 50843..51130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36550 sequence18 source 1..41745 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 650..1342 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(1404..4214) product autotransporter serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036491.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS complement(4892..5968) product DUF3298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042030482.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS complement(6128..8407) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817173.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 gene hypF CDS 8621..9574 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165813.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 gene coaA CDS 9582..10184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(10194..11162) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655746.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 gene birA CDS complement(11159..12196) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016664.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 gene murB CDS complement(12281..12553) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097246.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 gene yccX CDS 12671..13249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246043.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS 13320..14279 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815405.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(14343..14468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS complement(14817..15383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(15386..17131) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047951.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS 17488..18705 product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869174.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 gene dpaL CDS 18740..19924 product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893427.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS 20002..21591 product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812114.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 21679..22974 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807816.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 23824..24027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS 24298..24933 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816728.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS 24933..26951 product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816729.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 gene hyfB CDS 26962..27930 product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168282.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS 27945..29387 product hydrogenase 4 subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168281.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 29399..30049 product hydrogenase 4 membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168280.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 gene hyfE CDS 30056..31618 product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816730.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS 31644..33356 product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816731.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS 33371..33925 product hydrogenase 4 subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816732.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 gene hyfH CDS 33922..34704 product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706330.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS 34709..35122 product formate hydrogenlyase maturation HycH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816734.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS 35119..35589 product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816735.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene hycI CDS 35958..36503 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816736.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS 36571..36990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36870 note possible pseudo, internal stop codon CDS 37039..38715 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816737.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene fdhF note possible pseudo, internal stop codon CDS complement(38773..40410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36890 rRNA complement(41068..41178) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 tRNA complement(41211..41286) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 rRNA complement(41476..41586) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 sequence19 source 1..35661 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2679..3095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS complement(3300..6341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS complement(6904..7545) product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045648.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 gene fdnI CDS complement(7532..8425) product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817434.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 gene fdxH CDS complement(8438..11491) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830448.1 transl_table 11 codon_start 1 transl_except (pos:10904..10906,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_36940 gene fdnG CDS 11849..12679 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209612.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 gene fdhD CDS complement(12736..13647) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209609.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 gene fdhE CDS 13881..14507 product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817437.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 gene sodA CDS 14797..15135 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS 15245..15928 product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817439.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 gene yiiM CDS complement(15968..16522) product DUF1440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214718.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS complement(16780..17298) product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675062.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS complement(17353..18069) product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175086.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(18340..20130) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669894.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(20562..21233) product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175761.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 gene dsbA CDS complement(21257..22237) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175762.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(22280..22549) product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175764.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS complement(22706..23551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS complement(23548..24003) product heme lyase NrfEFG subunit NrfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070642.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 gene nrfF CDS complement(24000..24545) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070641.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS complement(24542..26446) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070640.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS complement(26472..27428) product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706568.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 gene nrfD CDS complement(27425..28096) product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278023.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 gene nrfC CDS complement(28093..28608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS complement(28696..30117) product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101783.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 gene nrfA CDS 30625..31206 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050076897.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 gene mobA CDS 31203..31718 product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175770.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene mobB CDS complement(31730..32440) product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942543.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS complement(32605..33915) product serine dehydratase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463069.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS complement(33949..35280) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401598.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 sequence20 source 1..27893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(126..722) product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885577.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS complement(722..1426) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208845.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS complement(1430..2014) product YmfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005825880.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS complement(2005..3069) product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146835.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS complement(3070..3492) product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763330.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(3489..4037) product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693539.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS complement(4037..5107) product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098807.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS complement(5097..6434) product DNA circularization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869234.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS complement(6434..8215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS complement(8342..8683) product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693534.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(8680..9042) product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015473.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS complement(9053..10519) product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693532.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS complement(10516..10713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS complement(10710..11261) product DUF1834 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005825903.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS complement(11261..11704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS complement(11704..12258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS complement(12329..13210) product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939979.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS complement(13218..14462) product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042037289.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS complement(14631..15098) product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094804.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS complement(15235..16560) product phage head morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046893.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS complement(16544..18127) product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869229.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS complement(18127..19725) product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693520.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS complement(19725..20297) product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072624.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS complement(20290..20586) product winged-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006249663.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS complement(20586..20888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(20881..21102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS complement(21099..21701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS complement(21694..21927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS complement(21912..22187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS complement(22172..22684) product N-acetylmuramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072618.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS complement(22840..23265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS complement(23258..23794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693508.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(23791..24555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(24640..25083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS complement(25080..25541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS 25664..25858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS complement(25841..26170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(26173..26379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS complement(26382..27323) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129790.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 misc_feature complement(27378..>27893) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000289290.1:Mu transposase C-terminal domain-containing protein locus_tag LOCUS_37590 sequence21 source 1..24622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 90..467 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087349.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 464..1435 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368404.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS complement(1508..2506) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110630.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 gene dusA CDS 2736..3191 product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174547.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 gene zur CDS complement(3326..3940) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209090.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 gene lexA CDS 4667..5080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(5120..5494) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002902.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 5671..8073 product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108900543.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 gene plsB CDS complement(8146..9006) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209088.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 gene ubiA CDS complement(9019..9522) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209087.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 gene ubiC CDS complement(9682..10092) product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705335.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene psiE CDS complement(10160..11803) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212085.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 gene pgi CDS complement(11994..12908) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930268.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS 13039..13677 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227736.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS complement(13952..14185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS 14346..15698 product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849837.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 gene lysC CDS 15861..16793 product ketopantoate/pantoate/pantothenate transporter PanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095031.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene panS CDS 16985..18439 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818491.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS complement(18463..18900) product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS complement(18904..19338) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS complement(19335..19667) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298602.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS complement(19750..23433) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817311.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 gene metH CDS complement(23500..24429) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174582.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 gene metA sequence22 source 1..16435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 440..2029 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095020.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 gene purH CDS 2061..3353 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210691.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 gene purD CDS complement(3429..4082) product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355296.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS complement(4140..4415) product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210689.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 gene hupA CDS complement(4609..5196) product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210688.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(5241..5936) product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095016.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene nfi CDS complement(5929..6993) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137619.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene hemE CDS complement(7066..7848) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166081.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 gene nudC CDS 7944..8438 product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175676.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene rsd CDS 8725..10635 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298956.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 gene thiC CDS 10628..11299 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849921.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 gene thiE CDS 11293..12057 product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210680.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS 12038..12238 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815386.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 gene thiS CDS 12240..13040 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815385.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS 13037..14173 product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210678.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 gene thiH CDS complement(14415..14969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS 15354..16049 product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704870.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 gene aqpZ sequence23 source 1..3985 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1305 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816318.1:autotransporter outer membrane beta-barrel domain-containing protein locus_tag LOCUS_38000 CDS complement(1498..1854) product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175559.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 gene frdD CDS complement(1868..2260) product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208749.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 gene frdC CDS complement(2275..3009) product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175554.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 misc_feature complement(3002..>3985) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815417.1:fumarate reductase (quinol) flavoprotein subunit locus_tag LOCUS_38040 sequence24 source 1..2141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence25 source 1..956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence26 source 1..839 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence27 source 1..814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence28 source 1..487 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 225..368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38050 sequence29 source 1..482 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(196..271) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA complement(381..457) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 sequence30 source 1..447 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(104..179) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA complement(298..374) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 sequence31 source 1..419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@